Scribd Logo
Upload

Welcome to Scribd!

  • Design Primer

    Uploaded by

    Shafira Nurianti salim
    45 views35 pages
    This document discusses primer design for PCR. It begins by outlining the steps of PCR including denaturation, annealing and elongation. It then lists the components needed for PCR including DNA polymerase, dNTPs, primers, magnesium ions and buffer. It defines what a primer is and its objectives in PCR and DNA sequencing. The document covers types of primers including oligo dT, random hexamers and gene-specific primers. It discusses considerations for primer design such as uniqueness, length, GC content, melting temperature and lack of secondary structures. It provides examples of primer sets and discusses using programs like Primer3 and Primer-BLAST to design primers in silico and checking factors like specificity. Finally it touches on degenerate,

    Original Description:

    Copyright

    © © All Rights Reserved

    Available Formats

    PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document
    This document discusses primer design for PCR. It begins by outlining the steps of PCR including denaturation, annealing and elongation. It then lists the components needed for PCR including DNA polymerase, dNTPs, primers, magnesium ions and buffer. It defines what a primer is and its objectives in PCR and DNA sequencing. The document covers types of primers including oligo dT, random hexamers and gene-specific primers. It discusses considerations for primer design such as uniqueness, length, GC content, melting temperature and lack of secondary structures. It provides examples of primer sets and discusses using programs like Primer3 and Primer-BLAST to design primers in silico and checking factors like specificity. Finally it touches on degenerate,

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Flag for inappropriate content
    45 views35 pages

    Design Primer

    Uploaded by

    Shafira Nurianti salim
    This document discusses primer design for PCR. It begins by outlining the steps of PCR including denaturation, annealing and elongation. It then lists the components needed for PCR including DNA polymerase, dNTPs, primers, magnesium ions and buffer. It defines what a primer is and its objectives in PCR and DNA sequencing. The document covers types of primers including oligo dT, random hexamers and gene-specific primers. It discusses considerations for primer design such as uniqueness, length, GC content, melting temperature and lack of secondary structures. It provides examples of primer sets and discusses using programs like Primer3 and Primer-BLAST to design primers in silico and checking factors like specificity. Finally it touches on degenerate,

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Flag for inappropriate content
    of 35

    Desain Primer untuk PCR

    Diagnosis Molekuler I, Termin II


    Program Studi D4 Teknologi Laboratorium Medis
    Jurusan Teknologi Laboratorium Medis

    Politeknik Kesehatan Jakarta III


    Tahapan PCR
    Tahap 1: Denaturasi
    ds DNA ss DNA
    60 detik, 90°-95°C

    Tahap 2: Annealing
    Penempelan Primer F dan R
    30-45 detik, 50°-60°C

    P
    Tahap 3: Elongasi
    Perpanjangan untai DNA baru
    P oleh Taq Polymerase
    1-2 menit, 72°C
    Komponen PCR
    • deoksiribonukleotida trifosfat
    (dNTP)
    • enzim termostabil Taq DNA PCR
    polimerase Reagensia
    • Ion Mg2+
    • Buffer
    • Primer Forward
    • Primer Reverse Spesifik
    • Template DNA

    Apa itu Primer?


    Primer
    • A short oligonucleotide which is used in many molecular
    techniques.

    • Primers are designed to have a sequence which is the


    reverse complement a region of template or target DNA
    to which we wish the primer to anneal
    DNA Structure
    Objective of Primer Usage
    • To generate cDNA for PCR assay  RT

    • To use as the origin of new DNA synthesis  PCR

    • To use as the origin of DNA Sequencing


    Types of Primer
    • Oligo dT: Stretch of thymine
    residues that anneal to
    poly(A) tail of mRNA

    • Random Hexamer: Six to


    nine bases long, they anneal
    at multiple points along RNA
    transcript

    • Gene-Spesific Primers:
    Custom made primers that
    target specific mRNA
    sequence
    How can we decide which
    primers to use in PCR?

    Can we design our own


    primer sets?
    Consideration About Primers
    Primer Design

    Sequence PCR reaction Primer


    target parameters Selection Rules

    Primer
    Design
    Primer Design Criteria
    • Primer uniqueness
    • Primer length
    • Base composition
    • Melting Temperature (Tm)
    • GC content range
    • 3’ – clamp properties (terminal
    residue, GC content)
    • Lack of Secondary structures
    • Length of amplified region
    A Simple Rule (I)
    • Primer Uniqueness
    Only one target site in the template DNA where the primer
    binds  the primer sequences should be unique in the
    template DNA
    There shall be no annealing site in possible contaminant
    sources, such as human, rat etc.
    A Simple Rule (I)
    • Primer size: 18-25 bases in length

    • Avoid repetitive bases  to avoid secondary


    structures or mispriming
    • 50-60% GC content in each primer
    • Optimum Tm for each primer: 55-65°C
    Tm and Annealing Temp.

    Annealing Temp. = Tm primer - 5

    Annealing Temp. differences between primers: 3°C


    A Simple Rule (II): 3’ ends
    • 3’ end of each primer contains G or C (2G,
    2C od GC)
    • 3’ end of primers should not be
    complementary
    3’ End of Primer

    Avoid mismatch between primers and template at 3’end


    A Simple Rule (III)
    • Avoid Secondary Structure: Hairpin Loop
    A Simple Rule (III)
    • Avoid Secondary Structure: Self Complementary
    A Simple Rule (III)
    • Avoid Secondary Structure: Primer-Primer Dimer
    How to Design Primer
    1. Manual Design
    • Download all interested sequences from
    GenBank
    • Do Multiple sequence alignment of all interest
    sequence (target sequence)
    • Manually select the position for primer design
     using primer criteria
    • Primer checking: length, %GC, Tm, specificity
    of DNA target (using BLAST), secondary
    structure
    Contoh Design Primer untuk PCR
    Primer Sets

    HA1-F: 5’ CTCGAGAGCAAAAGCAGG 3’
    HA907-R: 5’ GGTTTGTCATTGGGAATGCT 3’
    • PerlPrimer
    results
    How to Design Primer
    2. Program Design
    Program Design
    Primer3
    Primer3

    Put the sequence


    Primer-BLAST
    Degenerate Primers
    Universal Primers
    Semi-Universal Primers

    You might also like