Automated DNA Encryption Algorithm based on

UNICODE and Colors

Fasila K.A.
Department of Computer Science & Engineering
Muthoot Institute of Technology and Science, Varikoli
Ernakulam, Kerala, India
fasilaka@mgits.ac.in

Abstract—Cellular Automata based computing paradigm is

an efficient platform for modeling complicated computational
problems. This can be used for various applications in the field of
Cryptography. In this paper, it is used for generating a DNA
cryptography based encryption algorithm. The encoded message
in binary format is encrypted to cipher colors with the help of a
simple algorithm based on the principles of DNA cryptography
and cellular automata. The message will be in compressed form
using XOR operator. Since cellular automata and DNA
cryptographic principles are exploited, high level of parallelism,
reversibility, uniformity etc. can be achieved.
Keywords—DNA cryptography; UNICODE encoding; RGB
color model; Cellular Automata; Rule 51.
I. INTRODUCTION
It is a tedious task to design an efficient encryption
algorithm which is suitable for messages in multiple languages.
DNA (Deoxy-ribo Nucleic Acid) cryptography is a developing
field under the applications of DNA computing. Because of its
high degree of parallelism, density etc., DNA is considered as a
good information carrier. A data encrypted DNA structure can
be embedded within a microorganism so that message
exchange can be performed simply by the transfer of this
organism [2]. Before constructing a DNA structure, the
encrypted data must be converted to the form of a DNA
sequence. Cellular automaton, which is a discrete model in
computability theory, is combined here with the principles of
DNA cryptography and the idea of cipher colors in order to
provide multilevel security.
In addition to these features, UNICODE encoding
technique is used so that texts in multiple languages can be
processed using this algorithm. The proposed algorithm gives a
novel idea of cipher colors. There are more than 10million
colors that we are able to see [4]. 16.8million colors can be
displayed on a computer screen. These unique colors can be
easily represented as corresponding hexadecimal values which
can be utilized in our algorithm.
The following part of this paper is organized as follows.
Next section contains a literature survey. Section 3 contains a
background of this work. Section 4 describes encryption and
decryption procedures of the proposed algorithm. Section 5
gives the implementation details and section 6 concludes the
work.
II. MOTIVATION
DNA cryptography placed its main footstep in the field of
cryptography within a very short span of time. The massive
parallelism and inherent storage capacity of a DNA molecule
makes it a very good component for cryptographic purposes.
There exist some encryption algorithms based on this concept.
Some of them are discussed below.
A cellular automaton based DNA cryptography method is
given [1], in which rule 51 is used for the binary sequence.
Rule 51 out of the 256 rules [8] has some particular features
which makes it more suitable for cryptographic purpose. In our
previous work [2], we proposed a hybrid cryptosystem in
which security of both data and key are considered. Data in
plain text are brought into matrix form and some manipulation
steps are carried out. In proposed work, this manipulation steps
are replaced by applying rules of cellular automata. This
reduces the mathematical complexity of processing matrices.
Authors [3] described 2 methods for encryption in another
work. First method used a mapping graph for converting usual
DNA sequence to a cryptographic sequence. Second method
used Exclusive OR technique.
A cryptographic algorithm based on UNICODE and colors
was proposed [4] by Hemant Suryavanshi. UNICODE can be
used for encoding multilingual messages. Mapping and mixing
steps are performed for encryption process.
Use of cellular automata for cryptography was studied by
many researchers. Authors [5] provided a study of DES
algorithm for encryption based on a cellular automaton. In this
work, the authors proved that using cellular automata rules in
cryptography makes the operations simpler.
Another research team [6] proposed encryption of plain text
based on the concept of 2-dimensional CA rules. The algorithm
contained two security levels in which first level contains a
steganography technique and second level describes the
encryption process.
III. BACKGROUND STUDY
A. DNA Cryptography
A Deoxy-ribo Nucleic Acid (DNA) molecule has a double
helix structure with two separate strands. Information carrier

Copyright.978-1-5090-3239-6/17/$31.00©2017IEEE
within a DNA molecule is called gene. DNA double helical
structure contains mainly 4 nucleotides bases- A, C, T and G
which are Adenine, Cytosine, Thymine and Guanine
respectively. These bases make pairs to form a double helix
structure. Triplets of nucleotide bases are known as DNA
codons.
Compared to other methods, there exist only a few
cryptographic algorithms based on DNA computing. High
tech lab requirements and computational complexity makes
the applications of DNA computing limited in practice. DNA
operations can be performed in 2 ways- biological DNA
computing (in test tubes) and virtual DNA computing which is
done by simulating the operations.
B. Cellular Automata
A cellular automaton is defined as a system of many
discrete cells, in which each cell may be in any one state out
of the finite number of states.
The automaton changes the state based on some rules. It
can be considered as grid of cells [1]. Each cell can be defined
as a triplet i.e. cell A=(S, T, R) where S is the finite set of
states, T is the set of transition rules and R is the neighboring
cell. State transition takes place based on the rule and the
information contained within the neighbor cell, R.
The states can be represented as colors. A two state
automaton can be represented as a black and white system [1].
The defined set of rules determines the state transitions. For
the next instant of time, a particular cell checks the
information in its neighboring cells.
Consider the cell definition in Fig. 1. There are 256 such
rules and all these have their own characteristics and features.
Some rules are shown in Fig. 1 First transition in the figure
shows that if 3 ancestor cells(previous cell, current cell and
next cell) were in state 0, next state of the current cell is state
1. Second rule shows that if the previous cell and current cell
were in state 0 and the 3rd cell was in state 1, then next state of
the current cell is 0. 256 such rules exist. We make use of rule
51 for our algorithm. According to rule 51, next state of the
current cell is the ‘NOT’ of current state of the same.
Pattern of rule 51 is shown in fig. 2. A cellular automaton
already possesses the feature of uniformity since all
Fig. 1. Cell Definition [1]
Fig. 2. Rule 51 pattern
cells follow a common rule. This behavior of cellular
automata makes it suitable for several applications like the
study of gas molecules where all molecules obey one rule. In
addition to this feature, rule 51 has the feature of reversibility.
That means all information within the system is backward
traceable.
C. UNICODE Encoding
UNICODE is an encoding technique similar to ASCII and
it can process multilingual characters. UNICODE consortium
defines encoding for above 1 million characters. UNICODE
Transformation Unit(UTF) is the general encoding form used.
UTF-8, UTF-16 and UTF-2 are different forms of encoding.
UTF-8 makes use of 8 bits to encode characters in English.
Most commonly used characters are encoded by UTF-16
technique. Here, UTF-16 is used for encoding.
D. RGB(Red-Green-Blue) Color model
RGB stands for the primary colors Red, Green and Blue.
As explained in the introduction part, awe can see millions of
colors in this universe. The color appearance is obviously
affected by many other conditions like lighting, brightness,
other colors in the surroundings etc. Each color has an
equivalent hexadecimal value. That means, reverse conversion
is also possible. We can convert any data in our hands to
equivalent color form. This feature is utilized in the proposed
cryptographic algorithm.
IV. PROPOSED ALGORITHM
A flow chart of the proposed encryption algorithm is given
below, see Fig. 3. As explained in above sections, the positives
of various techniques are combined together to get an efficient
encryption algorithm. Plain text is converted to hexadecimal
values (passing through intermediate stages of UNICODE and
colors) in the initial stage and these are directly converted to
binary values. In the second stage, rule 51 is applied to this
binary sequence. Since the rule is reversible, process of
decryption is possible. After applying the transition rule to
every bit in the sequence, result is divided into 2 equal parts, of
which second part is given as input to a finite automaton. This
will result a state containing a number, say N.

Fig. 3. Flow chart of encryption algorithm
Message compression is accomplished by using an XOR
operator. XOR is performed between the two binary parts and
left rotate the resulting sequence N times. Then, in the final
stage, cipher colors are constructed from the DNA code words
obtained based on the binary sequence.
The algorithm is explained below in detail.
Input: Plain text, P from file Dor direct input from the user;
Color mapping table T; An Automata A; Code books C1[1],
C2[1], C3[1], C4[7], C5[7] for conversion.
Output: Cipher colors
Step 1: Encode the characters in plain text, P. Now,
characters under processing P’= UNICODE(P)
Step 2: Convert the UNICODE values to equivalent colors
and then to corresponding hexadecimal values. And, we obtain
binary sequence from these hexadecimal values.
Binary sequence, U= Bin[Hex[Color[P’]]]
Step 3: Apply Rule 51 to this binary sequence and we get
new sequence i.e., U in next state.
State of U at instant t is U(t). According to rule 51, next
state U(t+1)=NOT[current cell of U at time, t]
Step 4: Convert the binary sequence to DNA sequence
form, D.
Step 5: Divide the sequence into 2 equal parts-D1 and D2.
Send the second part D2 to the automata, A and we get an
output state, say N. D2 is treated as the key.
Step 6: Perform XOR between D1 and D2. So, D’=D1 D2
Step 7: The resulting sequence D’ is rotated N times to left.
Step 8: The rotated sequence RS will be a plain DNA
sequence. Form DNA code words from this sequence.
Fig. 4. The finite state automata
Step 9: Convert the codons to cipher text and build colors
from these characters. We get the output.
Initially, plain text is received either from the input file
or from the user. Encode these characters using UNICODE
technique. For example, UNICODE of the alphabet “A” is
u+0041. Convert the UNICODE value to equivalent color
based on a mapping table [2]. Each color is having a
hexadecimal equivalent. Take that value and then convert to
binary form. We can directly find the binary value from the
text. But, security will be less. Since we include UNICODE-
color mapping in between, a third party will not easily
understand the technique.
In the next stage, apply Rule 51 to the binary sequence
and then convert it into DNA form based on codebook [1].
Now, divide the obtained DNA sequence into two equal parts.
Send the second part to an automaton and we get an output
value, N from this machine. Perform XOR operation between
the two sequence parts. This can be done on the corresponding
binary form. The resulting sequence will be used for further
processing. Usage of this compression technique provides the
next layer of protection. Rotate the compressed DNA sequence
N times to the left, where N is the output obtained from the
given automata. The automata used for this step is given below.
See Fig. 4.
In the final stage, get the codons from the obtained DNA
sequence. Then, convert this to cipher text based on codebook
[3]. Cipher text itself will be unrecognized form since each
character is represented as a group of a letter and a number. As
a final step, convert these characters in cipher text to colors.
The red and green components of each color are generated
randomly. Only the third component is formed from the cipher
text character. This will again improve the security because;
same character will be represented by different colors at differ-

Fig. 5. Cipher Colors
ent times. Thus, finally we get the cipher colored image as
output.
V. EXPERIMENTAL RESULTS
JAVA is used to implement the proposed algorithm.
Consider the plain text BEAD. The UNICODE equivalent of
B is +U0042, E is +U0045, A is +U0041and that of D is
+U0044. These are converted to colors based on the
UNICODE-color mapping. Each color has a hexadecimal
format and from this, binary sequence is obtained. Then, rule
51 is applied to this binary sequence and the result is another
sequence in binary format. The reason for choosing rule 51 is
that it is reversible and stable. Convert this sequence to DNA
sequence form by applying simple substitution steps. Let the
sequence obtained now is GCTCTTTAAGTGCAGTCATGC
and so on. Pass the second half of the sequence to the given
automata and we get a number as output. Perform XOR
operation among the two halves and rotate this result to left that
much times. From this DNA sequence obtained, DNA codons
are formed and this sequence is converted to cipher text. Cipher
text obtained is C4A1L4A2A4V2 and so on. Finally, cipher
colors are formed from this letters. The output is shown is Fig.
5.
VI. CONCLUSION
In this paper, a new DNA encryption technique based on
rule 51 and finite automaton is proposed. The system is further
secured by the use of UNICODE encoding as well as RGB
color conversion. Finally, DNA sequence form is converted to
cipher colors. Thus, it provides multiple security layers which
do not give any clue about plain text.
REFERENCES
[1] G.Shanmuga Sundaram, S Pavithra, A Arthi, B Madubala, S
Mahalakshmi. “Cellular automata based DNA cryptography algorithm”.
IEEE conference on ISCO; 978-1-4799-6480-2/15, DOI:
10.1109/ISCO.2015.7282333 January 2015.
[2] Fasila K A, Deepthy Antony. “A multiphase cryptosystem with secure
key encapsulation scheme based on principles of DNA computing”.
IEEE ICACC 2014; DOI 10.1109/ICACC.2014.7, August 2014.
[3] Guangzhao Cui, Cuiling Li, Haobin Li, Xiaoguang Li. “DNA
Computing and Its Application to Information Security Field”. IEEE
ICNC DOI: 10.1109/ICNC.2009.27, August 2009.
[4] Hemant Suryavanshi, Dr. Pratosh Bansal , “An Improved Cryptographic
Algorithm using UNICODE and Universal Colors” WOCN-2012:
DOI:10.1109/WOCN.2012.6335543, Vol. 3, p.1 – 3, September 2012.
[5] Rama R, Bala Suyambu J, Andrew Arokiaraj, Shanmugam Saravanan.
“A Study of DES Algorithm with cellular automata” IJIM P 2011:ISSN
2185-5439 Volume 3,Number 1,p. 10-16, June 2013.
[6] Pratibha Sharma, NiranjanLal, ManojDiwakar . “Text Security using 2D
Cellular Automata Rules”. CACCS 2013, p. 363-368, .
[7] Panchami V, Fasila K A, Sudhin Vamattam, “A multilevel security
scheme based on UNICODE and RGB color model using DNA
cryptography” IJCA Proceedings on Emerging Technology Trends on
Advanced Engineering Research - 2012 ICETT(3):29-34, January 2012 .
[8] Standard encyclopedia of Philosophy, “Cellular Automata”,March
2012, Available : http://plato.stanford.edu/entries/cellular-automata/#toc.