Probiotics and Antimicrobial Proteins (2019) 11:874–886

https://doi.org/10.1007/s12602-018-9435-6

Kefir Accelerates Burn Wound Healing Through Inducing Fibroblast Cell

Migration In Vitro and Modulating the Expression of IL-1ß, TGF-ß1,
and bFGF Genes In Vivo
Ahmad Oryan 1 & Esmat Alemzadeh 2 & Mohammad Hadi Eskandari 3

Published online: 8 June 2018

# Springer Science+Business Media, LLC, part of Springer Nature 2018

Abstract
Kefir is a natural probiotic compound with a long history of health benefits which can improve wound healing. This study
investigated the regeneration potential of kefir in vitro scratch assay and in vivo burn wound in rat model. Cytotoxicity of different
concentrations of kefir was evaluated by colorimetric methylthiazoltetrazolium assay. A scratch wound experiment was performed
to investigate the ability of kefir in reducing the gap of wounds in a dose-dependent manner, in vitro. The standardized kefir was
incorporated into silver sulfadiazine (SSD) and applied on burn wounds in vivo, and was compared with the SSD and negative
control groups after 7, 14, and 28 days of treatment. The wound sites were then removed for histopathological and morphometric
analyses, assessment of interleukin-1β (IL-1β), transforming growth factor-β1 (TGF-β1), basic fibroblast growth factor (bFGF),
dry weight, and hydroxyproline contents. Kefir enhanced proliferation and migration of human dermal fibroblast (HDF) cells and
12.50, 6.25, and 3.12 μL/mL concentrations showed better effects on the scratch assay. Kefir resulted in reduction of IL-1β and
TGF-β1 expression at day 7 compared to the negative control. Kefir also reduced the expression of IL-1β at days 14 and 28 and
stimulated bFGF at day 28. It significantly improved the dry matter and hydroxyproline contents in the burn wounds. Kefir also
resulted in enhanced angiogenesis and elevated migration and proliferation of fibroblasts and improved fibrous connective tissue
formation in the wound area. The morphometric results indicated significant global contraction values in the kefir-treated wounds
compared to other groups. Taken together, the findings suggest that kefir has considerable ability to accelerate healing of the burn
wounds. Therefore, kefir may be a possible option to improve the outcomes of severe burns.

Keywords Kefir . Scratch assay . Histopathology . Real-time PCR . Burn wound healing

Introduction vitamins, and essential amino acids are the main compounds
of kefir; however it is a rich source of vitamin B1, B12, calci-
Kefir is a natural probiotic containing a complex mixture of um, folic acid, vitamin K, and pantothenic acid too [4]. The
both bacteria (including lactobacilli, lactic streptococci, and health benefits of these compounds have been well document-
acetic acid bacteria) and yeasts (both lactose-fermenting and ed. What we know about kefir is largely based upon empirical
non-lactose-fermenting ones) [1–3]. The composition of kefir studies that have investigated the beneficial effects of kefir on
is variable and depends on the source of milk. Minerals, the gut health; however, there has been a shift toward discov-
ering the therapeutic possibilities of probiotics, including ke-
fir, beyond the gut, to other organs and structures such as skin,
* Ahmad Oryan
in the recent years.
oryan@shirazu.ac.ir; oryan1215@gmail.com Burns are the most extensive form of injuries in which the
treatment depends on the severity of burn. Severe mental and
1 emotional distresses are important complications of post-burn
Department of Pathology, School of Veterinary Medicine, Shiraz
University, Shiraz, Iran injury [5]. Although the burn wounds regenerate, in some
2 aspects such as superficial scab formation, similar to other
Department of Biotechnology, School of Veterinary Medicine, Shiraz
University, Shiraz, Iran wounds, they heal differently in the degree and steps of sys-
3 temic inflammation [6, 7]. Some complications such as vas-
Department of Food Science and Technology, Shiraz University,
Shiraz, Iran cular damage, inadequate nutrition, poor oxygen supply, and
Probiotics & Antimicro. Prot. (2019) 11:874–886
susceptible to bacterial infection delay healing in burn wounds
[7]. Infection is a serious problem in burn patients [8].
Hypermetabolism, chronic inflammation, necrosis, toxemia,
and dehydration may also impair healing in large burns [9,
10]. Although after the emergence of antibiotics, systemic
infections and mortality have considerably subsided, death
due to Gram-positive and Gram-negative bacteria is still one
of the most common problems following burn injuries [11,
12]. Pseudomonas aeruginosa and Staphylococcus aureus
are the main pathogens in burn-related wounds and are able
to form biofilm. Administration of antibiotics has been a good
solution in treatment of infected wounds but the indiscrimi-
nate use of antibiotics has led to multi-drug-resistant strains
[11, 13].
Lactobacillus species are the predominant microorganisms
in kefir and play an effective role in their antibacterial activi-
ties. Lactobacillus species are able to inhibit the growth of P.
aeruginosa by secreting lactic acid and hydrogen peroxide
[14]. It has been shown that the kefir biofilms and their poly-
saccharide compounds are proper antimicrobial agents and
can be used in infections [15]. However, the biological prop-
erties of kefir are not limited to its antimicrobial activity. Some
studies have shown the positive effects of kefir on wound
healing [16, 17]. Nevertheless, there is a lack of information
concerning its mechanism of action on wound healing.
Probiotic therapy seems to promote healing in burn wounds
by regulating the immune response and inhibiting the patho-
genic microorganisms. The purpose of this study was to eval-
uate the efficacy of kefir in accelerating proliferation and mi-
gration of the human dermal fibroblast (HDF) cells into the
monolayer at in vitro condition. It also aimed to estimate the
wound closure percentage and re-epithelialization potential of
kefir and study the effect of this probiotic on cellular and non-
cellular constituents of cutaneous wounds during inflammato-
ry, fibroplasia, and maturation phases of burn wound healing.
Materials and Methods
Preparation of the Kefir Extract and Its
Microbiological Analysis
The kefir grains (10 g) were washed with distilled water and
inoculated in 100 mL pasteurized skimmed milk. The inocu-
lated milk samples were incubated at 25 °C for 96 h. The
grains were then removed by filtration through a plastic sieve.
The kefir pomade was formulated by addition of 10 mL of
extract or 10 g of grain to 10 g of 1% SSD. In another step, the
supernatants were centrifuged and filtered through a 0.45 μm
Millipore filter and were used for in vitro treatment.
The kefir solution was diluted for the microbiological anal-
ysis and plated on the following culture media: De Man,
Rogosa, Sharpe (MRS), and Rogosa Agar (RA), specific for
875
Lactobacillus; Sabouraud-Dextrose Agar [18], for yeasts and
filamentous fungi; Reinforced Clostridial Agar and MRS sup-
plemented with cysteine, for Bifidobacteria and spore forming
bacteria. The incubation temperature was 35.5 °C for the bac-
teria and 25 °C for fungi.
Biological Activities of Kefir
Antibacterial Activity Minimum inhibitory concentration
(MIC) of the kefir against Staphylococcus aureus
ATCC1112 and Pseudomonas aeruginosa ATCC1470 was
conducted in a 96-well plate with concentrations of 12.5, 25,
50, and 100% (v/v) [19]. The minimum bactericidal concen-
tration (MBC) values were obtained by subculturing method.
The content of each sample that did not indicate microorgan-
ism growth in the MIC was cultured on a nutrient agar plate
and incubated at 37 °C for 24 h. The starter’s lowest concen-
tration with no bacterial growth on the solid medium was
identified as MBC.
Antioxidant Capacity Assay: 2,2-Diphenyl-1-Picrylhydrazyl
Radical Scavenging Activity The 2,2-diphenyl-1-
picrylhydrazyl (DPPH) radical scavenging activity of kefir
was measured spectrophotometrically. The DPPH solution
(1.26 mM) was prepared by dissolving 0.05 mg DPPH in
50 mL methanol. Then, 2 mL DPPH solution was added to
1 mL sample solution in various concentrations (6.25, 12.50,
25, 50, and 100% v/v). The samples were incubated at room
temperature, for 30 min, and the absorbance was then deter-
mined at 517 nm. Distilled water was used as the blank. The
scavenging effect was calculated using the following equation:
Scavenging rate % ¼ ð1 –As =A0 Þ  100
where AS is absorbance of the sample and A0 is absorbance of
the blank [20].
In Vitro Biological Experiments
Cell Culture
Human dermal fibroblast cells (NCBI C646, National cell
bank, Pasteur Institute, Iran) were cultured in Dulbecco’s
modified Eagle’s medium (DMEM) supplemented with 10%
fetal bovine serum (FBS), 10 units/mL penicillin, and 10 μg/
mL streptomycin sulfate (GIBCO, Invitrogen Corporation) at
37 °C and 5% CO2 in a humidified incubator.
Methylthiazoltetrazolium-Based Cytotoxicity and Cell
Proliferation Assay
The methylthiazoltetrazolium (MTT) assay was performed,
according to the manufacturer’s instructions (BIO-IDEA), to
876
measure the cell viability and cell proliferation. The HDF cells
were cultured in the 96-well culture plates at a density of 5 ×
103 cells. After 24 h, the medium was removed and replaced
by different concentrations of kefir (3.12, 6.25, 12.50, 25, and
50 μL/mL) and incubated in a humidified atmosphere of 5%
CO2 at 37 °C, for 48 h. Further, 10 μL of the 12 mM MTT
stock solution was then added into each well and incubated at
37 °C for 4 h. Afterwards, 50 μL of DMSO was added to each
well and thoroughly mixed by a pipette. The absorbance was
read at 570 nm, using an ELISA reader, after 10-min
incubation.
Wound Scratch Assay
The HDF cells were seeded in 12-well plates at a density of
3 × 104 cells/well and were allowed to expand and reach 90%
confluence. The cell culture monolayers were scratched, using
a sterile 200 μL tip and rinsed with phosphate-buffered saline
to remove the dead cells and debris. The medium was then
replaced with 1% FBS media containing different concentra-
tions of kefir (3.12, 6.25, 12.50. 25, and 50 μL/mL) and the
plates were incubated at 37 °C and 5% CO2 [21]. The distance
between the two layers of cells was photographed at 0, 12, 18,
and 24 h and analyzed by image analysis software (Adobe
Photoshop CS-5, Ca, USA). The percentage of wound closure
was calculated, using the following formula:
Wound closure ð%Þ
¼ ½ðwound area day 0–wound area in indicated dayÞ
=wound area day 0  100:
In Vivo Experiments
Animals
Male Sprague-Dawley rats (n = 12, weight 225 ± 25 g, 7–
9 week old) were purchased from a certified laboratory animal
house. The animals were kept in individual cages under con-
trolled conditions of temperature, humidity, and lighting
(12:12 h light–dark cycle) for a week prior to study. All the
animals received human care in accordance with the Guide for
Care and Use of Laboratory Animals published by the
National Institutes of Health (NIH publication No. 85-23).
Additionally, the local Ethics Committee of BRegulations for
using animals in scientific procedures^ in School of Veterinary
Medicine of our university approved this experiment.
Burn Wound Model
The animals were anesthetized with ketamine (10%, 75 mg/kg
BW) and xylazil (2%, 10 mg/kg BW) (both from Alfasan
Probiotics & Antimicro. Prot. (2019) 11:874–886
Co.). The hair of dorsum of the rats was shaved and circular
burn wounds were created, using an aluminum bar with a
surface area of 1 cm in diameter. The aluminum bar was
preheated in 100 °C boiling water for 30 s and then applied
perpendicular to the skin surface, without pressuring, on the
back of animals for a period of 10 s. Three burns were created
on the dorsum of each rat. After 48 h, the necrotic area was
excised, using a punch biopsy with a surface area of 1 cm in
diameter. The wounds were randomized by position on the
animal’s dorsum into one of the following three treatment
groups: (1) untreated group, the burn wounds received no
medication; (2) silver sulfadiazine group, 1% silver sulfadia-
zine was applied on the burn wounds; and (3) kefir group, the
kefir pomade was applied on the burn wounds. The treatments
were applied topically without applying any dressing. Four
animals were euthanized at each of 7, 14, and 28 days’ post-
injury and the samples were collected.
Measurement of the Rate of Wound Closure
At 0, 7, 14, and 28 days after wound creation, the wounds
were photographed and the images were analyzed by
Digimizer 4.2.6.0 software to calculate the percentage of
wound closure, using the following equation:
Wound closure ð%Þ
¼ ½ðwound area day 0–wound area on indicated dayÞ
=wound area day 0  100:
Histological Examination
The skin specimens were fixed in 10% neutral-buffered forma-
lin and dehydrated, cleared, and mounted. Then, sections of
5 μm in thickness were stained with hematoxylin and eosin
(H&E) and examined by a light microscope (Olympus, Tokyo,
Japan) connected to a digital camera (Sony T-700, Tokyo,
Japan). Four random microscopic fields were used from each
tissue section for histopathologic and morphometric analyses
[22–24]. The number of inflammatory cells (neutrophils, lym-
phocytes, macrophages), connective tissue cells (fibroblasts
and fibrocytes), and number of blood vessels in the dermis of
the injured area were counted at 400 magnification.
At 7 days post-wounding, the morphometric analysis was
conducted to indicate the quantity and quality of healing and
estimate wound contraction as described previously [25].
Based on this method, lines L, S, N, T, and D were measured
and the following morphometric indices were calculated
(Table 1):
– Superficial contraction index (SCI of wound = (L-S)/L
– Deep contraction index (DCI) = N-D/N
Probiotics & Antimicro. Prot. (2019) 11:874–886
– Wound severity index (WSI) = (N-T)/N
– Global contraction index (GCI) = SCI + DCI
The parameters were measured with ImageJ Software.
RNA Extraction and Quantitative Real-Time
Polymerase Chain Reaction
Total RNA was extracted, using the Dena Zist commercial kit
and cDNA was synthesized, using the PrimeScript™ RT re-
agent kit (Takara Bio Inc., Otsu, Japan) following the manu-
facturer’s instructions. The mRNA levels for transforming
growth factor-β1 (TGF-β1), interleukin-1β (IL-β) and basic
fibroblast growth factor (bFGF) in each sample were deter-
mined by a quantitative real-time polymerase chain reaction
(qRT-PCR). The RT-PCR was performed using the SYBR
Premix Ex Taq II (Takara) in Exicycler™ 96 Quantitative
Real-Time PCR System (Bioneer). The following specific
primers were used: IL-1ß forward: TCTGAAGCAGCTAT
GGCAAC and IL-1ß reverse: TCAGCCTCAAAGAA
CAGGTCA; TGF-ß1 forward: ACTACGCCAAAGAA
GTCACC and TGF-ß1 reverse: CACTGCTTCCCGAA
TGTCT; bFGF forward: ATTTCCAAAACCTGACCCGAT
and bFGF reverse: TGCCTTTTAACACAACGACCAG; ß-
actin forward: TCCGTAAAGACCTCTATGCC and ß-actin
reverse: GATAGAGCCACCAATCCACA. The relative
mRNA level of each gene was calculated with the 2−ΔΔCT
method. The results were presented as significant increase or
decrease in mRNA detected in the experimental groups com-
pared with their respective controls.
Percentage Dry Weight and Hydroxyproline Contents
Tissue samples from the wounded area were immediately
weighed and then transferred into a freeze drier (Helsicc) until
constant dry weight content was reached. The percentage dry
matter was calculated according to the following equation:
percentage dry matter content = (dry weight / wet weight) ×
100 [26]. To estimate the hydroxyproline content, the dried
samples were used. The hydroxyproline content was mea-
sured according to the manufacturer’s instructions of Kiazist
commercial kit.
Scanning Ultramicroscopy
The skin specimens were harvested on the 28th day post-
wounding for scanning electron microscopic (SEM) stud-
ies. The samples were fixed in cold 2.5% GA, dehydrated
in graded ethanol solutions, and gold-coated. High-
qualified images were created, using a SEM (Cambridge
S360, UK), with different kVs and magnifications.
877
Different structures such as collagen fibrils and fibers
were assessed.
Statistical Analysis
The data was analyzed in Microsoft Excel 2010 and SPSS
software, version 19.0 (SPSS, Inc.). Statistical significance
was calculated using a Kruskal–Wallis H, non-parametric
ANOVA test, and two-tailed Mann–Whitney u test. P values
less than 0.05 were considered significant.
Results
Microbiological Analysis
The results of microbiological analysis showed the following
composition in the kefir: 0.06% (1.4×10 5 CFU) of
Bifidobacteria; 97.47% (2.1×108 CFU) of Lactobacilli;
1.9% (4.1×10 6 CFU) of yeasts and fungi; and 0.55%
(1.2×106 CFU) of spore-forming bacteria. The Lactobacilli
were significantly higher than other microorganisms in the
kefir. The dominant probiotic bacterial and yeast strains in
our kefir are as follows: Lactobacillus kefiranofaciens,
Lactobacillus kefiri, Lactobacillus plantarum, Lactobacillus
parakefiri, Lactococcus lactis, Saccharomyces cerevisiae,
Saccharomyces unisporus.
Biological Activities of Kefir
Antibacterial Activity The antibacterial activity of different
concentrations of kefir was evaluated by MIC and MBC tests.
The minimum inhibitory concentrations were ranged from 50
to 100% for S. aureus ATCC 1112 and 25 to 100% for P.
aeruginosa ATCC1470. The results showed that P.
aeruginosa is more sensitive to kefir than S. aureus. The min-
imum MBC value against these two strains was 50% (μL/mL)
for kefir. The kefir was bactericidal at the MBC concentrations
for both bacterial strains.
Antioxidant Activity The antioxidant activity of kefir was eval-
uated by DPPH method. Figure 1 indicates the DPPH radical-
scavenging activity of kefir at different time intervals and
various concentrations. Higher concentrations of the sample
displayed better antioxidant activity. As can be seen in Fig. 1,
incubation for 24 h demonstrated a significant increase in the
DPPH radical-scavenging activity compared to those in the 1-
h incubation (P < 0.001).
In Vitro Evidences
The proliferation and viability of HDF cells were deter-
mined at different concentrations of kefir (3.12, 6.25,
878 Probiotics & Antimicro. Prot. (2019) 11:874–886

Table 1 Parameters of
morphometric analysis in
evaluating wound healing
Line Descriptive
L Length of the re-epithelialization zone
S Distance between the borders of the wound, following the straight line of the epidermis
D Depth of the wound, from the line of the epidermis (line S) to the first layer of connective
tissue at the deepest point of the wound
T Thickness of the connective tissue (residual or new dermis) in the center of wound, from
the deepest point of the wound in the muscle
N Thickness of the natural dermis on both sides of the wound, from the muscle to the epidermis.
The classic way of calculating N is N = D + T

12.50, 25, and 50 μL/mL), using MTT assay, after 48 h
and no cytotoxicity was observed in these concentrations
(Fig. 2a). Kefir was able to promote cell proliferation at
all concentrations after 48 h. For all assayed concentra-
tions, the cell viability was higher than 90%. Migration of
fibroblasts in response to an artificial wound was ob-
served under light microscope and the average distance
between the edges of the scratch was calculated at 0, 12,
18, and 24 h after the scratch. The results showed that the
percentage of wound area covered by the migrated fibro-
blast cells increased in a dose-dependent manner (Fig. 2b,
c). Maximum migration was observed in the concentra-
tions of 12.50, 6.25, and 3.12 μL/mL after 24 h of
wounding.
Percentage of Wound Closure
In order to evaluate the rate of wound closure, the unclosed
wound area was measured. Based on our results, the wound
closure percentage was significantly higher in the wounds
Fig. 1 DPPH scavenging activity at different concentrations of kefir.
Values shown are means ± standard deviation from the triplicate
experiments. DPPH 2,2-diphenyl-1-picrylhydrazyl. Triple asterisks
show a significant difference (P < 0.001). SSD silver sulfadiazine
treated with kefir, in comparison to the other two groups. On
day 1, there was no significant difference among the groups.
However, on days 7 and 14, the kefir-treated group indicated a
greater healing potential compared with the untreated burn
wounds. Kefir enhanced the proliferation and maturation
phases and resulted in 85% wound closure within 7 days
(Fig. 3a, b). In contrast, only 57 and 35% wound closure
was obtained for the SSD and untreated groups at this stage.
Complete wound closure in all groups was achieved at 14 days
post-wounding. The wounds were not easily visible in the
kefir-treated animals on day 14 and showed a significant im-
provement with reduced inflammation and redness, and min-
imal scarring. Likewise, the epidermis was almost mature in
the kefir-treated wounds. In contrast, the SSD and untreated
groups showed superficial signs of inflammation, hyperemia,
and phlogistic signals.
Histopathological Findings
The healing patterns in the wounds were evaluated by histo-
logical examination of the samples at days 7, 14, and 28 post-
wounding (Fig. 4). The SSD and kefir-treated groups showed
more advanced re-epithelialization compared with the untreat-
ed group, on day 7 post-wounding. However, treatment by
kefir resulted in better progress in wound re-epithelialization
on day 7 compared to the SSD-treated group. Re-
epithelialization was completed in all groups, on day 14 post-
injury. The surface of wounds, in the kefir-treated animals, was
very small compared to the SSD and untreated groups.
The number of inflammatory cells including neutro-
phils, lymphocytes, macrophages, and plasma cells signif-
icantly decreased in the kefir-treated group than the un-
treated group at 7 days post-wounding (P < 0.05). At this
time, the wounds treated with kefir showed high number
of inflammatory cells compared to the SSD-treated ones
(P < 0.05). Fewer inflammatory cells (lymphocytes, plas-
ma cells, and macrophages) were also observed in the
kefir-treated group when compared to the untreated group,
at 14 day post-wounding (Table 2; P = 0.006). Higher fi-
broblasts and fibrocytes count were demonstrated in the
kefir-treated group compared to the untreated group at
Probiotics & Antimicro. Prot. (2019) 11:874–886 879

Fig. 2 a Effects of different concentrations of kefir on cell viability of difference at the **1 and ***0.1% level, respectively. SSD silver
HDF. b, c Effects of different fractions of kefir on HDF migration in a sulfadiazine, HDF human dermal fibroblast
wound scratch test assay. HDF human dermal fibroblast. Significant

14 days post-wounding (Table 2). Angiogenesis was sig- when compared with the untreated group at 14 day post-
nificantly more pronounced in the kefir-treated group wounding (Table 2; P = 0.004).

Fig. 3 Effects of kefir and SSD on the percentage of wound closure in burn wounds. a Representative images of the burn wounds at day 0, 7, 14, and 28.
b Wound closure analysis. Analysis of variance was used; significant difference (***P < 0.001). SSD silver sulfadiazine
880 Probiotics & Antimicro. Prot. (2019) 11:874–886

Fig. 4 Morphological changes of the wounds on 7, 14, and 28th days after induction of burn wounds (Hematoxylin and Eosin, × 400). Black and white
arrows show blood vessels and inflammatory cells, respectively. SSD silver sulfadiazine

Based on the morphometric results, the values of SCI and differences between the groups for SCI and WSI. The kefir-
DCI increased in the kefir-treated group compared to the SSD treated group indicated a significant increase in the GCI value
and untreated groups. However, there were no significant when compared to the untreated group (P < 0.05) (Fig. 5).

Table 2 Cellular assay from the wound sections on the 7th, 14th, and 28th days after injury

Day 7 after wounding (n = 4) Day 14 after wounding (n = 4) Day 28 after wounding (n = 4)

Control (1) SSD (2) Kefir (3) Control (4) SSD (5) Kefir (6) Control (7) SSD (8) Kefir (9)
mean ± SD mean ± SD mean ± SD mean ± SD mean ± SD mean ± SD mean ± SD mean ± SD mean ± SD

Vessels (n) 11.6 ± 3.16 13.8 ± 4.00 17.1 ± 3.06 3.3 ± 1.67 6.4 ± 0.70 9.3 ± 1.52* 4.8 ± 2.60 4.8 ± 1.26 1.1 ± 0.69
Fibrocyte + 21.5 ± 3.73 26.9 ± 6.10 43.6 ± 2.33* 22.1 ± 5.98 36.3 ± 2.33 45.0 ± 0.50* 29.4 ± 2.90 20.2 ± 1.63 12.6 ± 1.65*
Fibroblast (n)
Inflammatory 28.5 ± 4.70 13.2 ± 0.8 26.6 ± 3.32* 1.6 ± 0.01 0.6 ± 0.21 0.5 ± 0.26* 1.3 ± 0.55 0.4 ± 0.17 0.3 ± 0.14*
cell (n)
P value
1 vs. 2 1 vs. 3 2 vs. 3 4 vs. 5 4 vs. 6 5 vs. 6 7 vs. 8 7 vs. 9 8 vs. 9
Vessels 0.770 0.280 0.620 0.070 0.004 0.090 1.000 0.087 0.087
Fibrocyte + 0.410 0.010 0.036 0.008 0.001 0.063 0.005 0.000 0.012
Fibroblast
Inflammatory 0.024 0.850 0.049 0.008 0.006 0.960 0.050 0.031 0.910
cell

SSD silver sulfadiazine

There was a significant difference between kefir and SSD in number of inflammatory cells (P = 0.049), at 7 day post-surgery. There was a significant
increase in number of fibrocytes + fibroblast in kefir group when compare to the control and SSD groups (P = 0.010 and P = 0.036, respectively), after
7 day of operation. At 14 day after wounding, the number of vessels significantly increased in kefir group compared with control group (P = 0.004). At
this time, the number of fibrocytes + fibroblasts significantly increased in kefir group compared with control group (P = 0.001). The number of
inflammatory cells significantly decreased in kefir compared with control group (P = 006), after 14 day post-surgery. At 28 day after operation, there
were a significant decrease in number of inflammatory cells in kefir group when compare to control group (P = 0.037).At this time, the number of
fibrocytes + fibroblasts significantly reduced in kefir group compared to SSD and control groups (P = 0.012 and 0.000, respectively)
*P < 0.05
Probiotics & Antimicro. Prot. (2019) 11:874–886 881

Fig. 5 Analysis of the morphometric measurements carried out on biopsies of the treated burns, taken on day 7 post-treatment. *P < 0.05

Gene Expression Level compared to the untreated group at 7 days post-wounding.

Because of the importance of cytokines and growth factors in
wound healing, we evaluated the expression patterns of IL-
1β, TGF-ß1, and bFGF in the presence of kefir and SSD,
using quantitative real-time PCR. The overexpression of IL-
1ß cytokine induced by burn wound was significantly down-
regulated after kefir treatment. As shown in Fig. 6a, the level
of IL-1ß mRNA was lower in the kefir-treated group
However, SSD revealed a more effective role in decreasing
IL-1ß level on day 7. Real-time PCR analysis of IL-1ß gene
expression demonstrated that kefir decreased IL-1ß expres-
sion more significantly than the SSD and untreated groups at
14 and 28 days after wounding (P < 0.05).
TGF-β1 is an essential growth factor released by plate-
lets, monocytes/macrophages, endothelial cells and fibro-
blasts, and enhances the regenerative process in soft

Fig. 6 Modulation of growth

factors and cytokines profile by
kefir: mRNA levels of a IL-1β, b
TGF-β1, c bFGF at various time
points after burn injury, as
determined by quantitative real-
time RT-PCR. SSD silver
sulfadiazine, TGF-
β1:transforming growth factor-
β1, IL-β interleukin-1β, bFGF
basic fibroblast growth factor.
The experiments were performed
in triplicate. *P < 0.05; **P <
0.01; ***P < 0.001
882
connective tissues. Figure 6b shows the relative TGF-β1
mRNA expression in response to kefir treatment in com-
parison to the SSD and untreated groups. The TGF-β1
expression statistically decreased in the kefir-treated group
compared to the untreated group on day 7 post-wounding
(P < 0.05). The expression level of TGF-β1 was higher in
the kefir-treated group than untreated group on day 14
post-wounding. However, this difference was not signifi-
cant between SSD and kefir-treated groups (Fig. 6b). At
day 28 post-wounding, a significant decrease in the level of
TGF-β1 was noted in the kefir-treated group as compared
to untreated group (P < 0.01).
Real-time quantitative reverse transcriptase-PCR was used
to measure the bFGF mRNA levels and it was showed that
kefir significantly elevated the bFGF expression when com-
pared to SSD and untreated groups, on day 28 post-wounding
(Fig. 6c; P < 0.05).
Effects of Kefir on Hydroxyproline and Dry Matter
Contents
Kefir significantly increased the percentage dry matter content
compared to the untreated group, at 7 and 14 days post-
wounding (Fig. 7a). The hydroxyproline content was mea-
sured at 7, 14, and 28 days after wounding. The results indi-
cated that the hydroxyproline (HP) levels were higher in the
kefir-treated group than those in the untreated group, at 14 day
post-wounding; however, the differences were not significant
(Fig. 7b).
Scanning Ultramicroscopy
Figure 8 shows the results obtained using SEM. Organized
and aligned collagen fibrils were seen in the wounds treated
with kefir after 28 day of wounding. In addition, kefir in-
creased the density of collagen fibrils compared to those of
the other groups.
Fig. 7 Effects of kefir on the percentage dry weight a and hydroxyproline content b in the healing burn wounds. SSD silver sulfadiazine. *P < 0.05;
***P < 0.001
Probiotics & Antimicro. Prot. (2019) 11:874–886
Discussion
Enhanced fibroplasia resulting in improved granulation tissue
formation, wound contraction, re-epithelialization, and further
preferable tissue maturation are critical to optimal wound
healing and a proper treatment should improve these princi-
ples [27, 28]. This study clearly indicated that SSD is the
desirable option in treatment of burn wounds, while the kefir
was also comparable with this gold standard treatment regime
and in some criteria it was even preferable to this positive
control. We selected rat as our animal model in the present
investigation. Characteristics such as a short gestation, short
life span, docile behavior, and ready availability of this animal
with well-defined health and genetic backgrounds were our
reasons to use rat as the animal model [29]. Although there are
some inherent drawbacks (such as rate of wound contraction,
presence of subcutaneous panniculus carnosus muscle, and
ability of producing vitamin C in rats) in using rat for com-
paring with human skin wound healing, there are several ad-
vantages to use rats as a skin wound healing model [30]. Wide
availability, size, and tractable nature are the main reasons that
many researchers have employed rat as an animal model to
study experimental wound healing. In spite of cost-effective
because of small size, rats are large enough to provide a suit-
able area of skin for wound studies. Another reason to consid-
er rat as a skin wound healing model is availability of a large
and growing knowledge regarding wound healing in rat
gained from years of previous researches [31].
Based on the gross morphological and histopathological
results, kefir enhanced the proliferative and maturation stages
and resulted in enhanced tissue regeneration and wound clo-
sure than the untreated and SSD groups. The percentage of
wound closure was significantly higher in the kefir-treated
group than the untreated group, at 14 day post-wounding (P
< 0.05). This finding is in agreement with the Fallah Huseini’s
(2012) findings which showd a better healing rate in the kefir
96 h gel group compared to those of the control one [17]. They
suggested that the lactic acid and acetic acid concentrations
were higher in the kefir 96 h and this led to superior results in
Probiotics & Antimicro. Prot. (2019) 11:874–886
Fig. 8 Scanning ultrastructural findings after 28 days post-surgery. a Negative control, b SSD, and c Kefir. Treatment with kefir significantly improved
the alignment of collagen fibrils compared to those of the negative control and SSD groups. SSD silver sulfadiazine
terms of inflammation, scar tissue formation, and wound re-
epithelialization. Heydari Nasrabadi (2011) and Partlow et al.
(2016) also demonstrated the positive role of lactic acid bate-
ria and yeasts in reducing the wound area, respectively [32,
33]. Therefore, kefir is able to significantly decrease the
wound size because of the synergistic effects of its
microorganisms.
Antibacterial analysis demonstrated the beneficial effects
of kefir in preventing the growth of P. aeruginosa and S.
aureus and this can be an important reason for faster healing
of the burn wounds, in the kefir-treated group, as infection is a
critical problem in burn wound healing. Due to extensive di-
versity of microorganisms in kefir, it can be concluded that
kefir has several mechanisms against microbial agents and can
be a new therapeutic strategy in accelerating wound healing
because of its antimicrobial effects. Garrote et al. (2000)
showed that the lactic and acetic acids produced during kefir
fermentation could have important bacteriostatic properties
even in the early stages of milk fermentation [34]. In another
study, Rodrigues et al. (2005) suggested that the kefir’s
biofilms and their polysaccharide compounds may be good
antimicrobial to be used in a variety of infections [15]. It has
been shown that both lactic and acetic acids are also important
in inhibiting microbial infections and this synergistic inhibito-
ry effect have been ascribed to the potentiation of acetic acid at
the lower pH produced by lactic acid, shifting the equilibrium
in favor of the undissociated form of the acids [34]. The or-
ganic acids, peptides (bacteriocins), polysaccharide, carbon
dioxide, hydrogen peroxide, ethanol, and diacetyl are pro-
duced by kefir and they are responsible to inhibit the devel-
opment of pathogenic bacteria. Yüksekdag et al. (2004 a,b)
showed that all strain of lactic acid bacteria produced hydro-
gen peroxide while 11 out of 21 strains of kefir lactococci
produced hydrogen peroxide. All the lactococci strains were
able to inhibit the growth of Streptococcus aureus, but were
883
less effective against Escherichia coli NRLL B-704 and
Pseudomonas aeruginosa [35, 36].
Our results showed an increase in the inflammatory cells in
the kefir-treated group in comparison to the SSD-treated
group at 7 post-wounding day. This finding is in consistent
with that of Atalan and co-workers (2003) who reported that
increased activity of polymorphonuclear cells in infection site
is a possible reason for the antibacterial activity of kefir [16].
These findings were also supported by the results of Halper et
al. (2003), showing that Lactobacillus is responsible for stim-
ulating the proliferation of macrophages and lymphocytes
[37]. In another study, Wong and colleagues indicated that
kefir was able to normalize disruptions and bacteria-host in-
teractions and hasten wound regeneration in human microbial
communities [38]. P. aeruginosa limits the therapeutic options
by developing resistance to several classes of antibiotics [39].
Probiotics are able to change P. aeruginosa from a multi-drug-
resistant (MDR) to a multi-drug-sensitive strain [40]. We sug-
gest that combination of bacteria and yeast can be more effec-
tive than separate application of each the microorganisms. In
this regard, Fijan investigated the influence of potentially
pathogenic challenge P. aeruginosa bacteria on multispecies
probiotic food supplements and kefir microbiota. It was found
that multispecies probiotic supplement and kefir microbiota,
which have a much more diverse population than the
oligospecies probiotic supplement and the monospecies sup-
plement, successfully decreased the concentration of chal-
lenge of potentially pathogenic P. aeruginosa bacteria for
three log10 steps. According to these findings, multispecies
microorganisms create a synergistic effect and effective com-
plex interconnecting quorum-sensing regulatory network that
yield antagonistic effects against the potential pathogen P.
aeruginosa [41]. Also, the S-layer proteins present in many
species of lactobacilli inhibit the growth of bacteria [15, 42].
Moreover, the antioxidative activity of kefir can hasten the
884
wound healing processes. The antimicrobial and antioxidant
properties of kefir have been reported in several studies [35,
40, 43, 44].
Since proliferation and migration of fibroblasts have an
important role in the wound healing process, evaluating the
pattern of cellular proliferation and migration can be useful in
comparative estimation of the wound healing processes [45].
Based on the cell viability findings, kefir did not result to any
cytotoxic effects on HDF cells in dose ranges from 50 to
3.12 μL/mL. This experiment was conducted to make sure
that the effects of kefir therapy on HDF proliferation and mi-
gration is not interfered by any toxicity. Scratch assay is an
easy-to-do, low-cost screening method to study wound
healing [46] and is related to the fibroplasia or proliferative
phase of wound healing [47]. In this study, kefir was used as
treatment in different dose ranges during scratch assay and it
was found that kefir is able to increase cell migration, promote
fibroblast proliferation, enhance wound contraction, and result
in reduction in the wound size, in a dose-dependent manner.
Although wound contraction is an essential process in tis-
sue repair, however, it can lead to severe mental and emotional
distresses too. Better wound contraction resulted after treat-
ment with kefir can relief such mental and emotional compli-
cations. Our morphometric results showed that the value of
GCI in the kefir-treated group was higher at days 7 post-injury
than the SSD and untreated groups. Based on the findings of
Osuagwa et al. (2004), granulation tissue is the main source of
contraction force in a wound [48]. In addition, higher concen-
tration of hydroxyproline in the kefir-treated wounds could be
a reason for elevated collagen deposition resulting in en-
hanced wound contraction. Increased HP content in the
kefir-treated group indicated faster rate of wound healing by
enhanced proliferation, migration, and differentiation of fibro-
blasts which resulted in improved collagen synthesis. Higher
content of HP in the kefir-treated group in comparison to the
untreated group at day 28 after wounding indicated higher
collagen production after wound closure, in accordance with
the development of fibrogenesis. These findings were support-
ed by the histological and morphometric results.
IL-1β is a potent proinflammatory cytokine which is cor-
related with regulation of wound healing [49]. Based on our
findings, kefir was able to decrease the expression of IL-1β
during wound healing. These results were supported by those
of Hadisaputro showing that kefir is able to potentially reduce
proinflamatory cytokines interleukin 1 (IL-1) and TNFα [50].
Hyaluronidase is an enzyme that promotes inflammation and
the kefir’s polysacharide extract is able to inhibit this enzyme.
Prado et al. (2016) indicated that lower dosages of the kefir’s
polysaccharides have higher anti-inflammatory activity than
the ethanolic extract of propolis [51]. During the healing pro-
cesses, the macrophages change their phenotype and function
from M1 to M2 and produce more anti-inflammatory/angio-
genic cytokines instead of pro-inflammatory cytokines [52,
Probiotics & Antimicro. Prot. (2019) 11:874–886
53]. In the present study, kefir reduced IL-1β expression and
enhanced the TGF-β1 levels and resulted in proper switching
of the M1 to M2 macrophages.
TGF-β1 has various functions in the wound healing pro-
cess and can be both inhibitory and stimulatory in nature [54].
The present study showed that kefir can increase
TGF-β1expression at early proliferation phase and encourage
proliferation of fibroblasts, deposition of collagen, elastin, and
glycosaminoglycans as the ECM proteins and enhance gran-
ulation tissue formation. The expression of TGF-β1 decreased
in the kefir-treated lesions on days 14 after wounding. These
findings further support this hypothesis that the TGF-β1
might have balanced the deposition and degradation of
ECM. Therefore, kefir might have an influential role in reduc-
tion of scar formation.
Among the fibroblast growth factors (FGFs), bFGF has an
important role in wound healing. bFGF can contribute to re-
epithelialization, mesenchymal cell proliferation, collagen and
other ECM deposition, and inflammation downregulation
[55]. Based on the findings of the present study, there was a
reduction in the bFGF expression on day 7 and then elevation
in its content on days 14 and 28 post-wounding, in the kefir-
treated group. It has been indicated that application of bFGF
reduces scarring and promotes wound healing by TGF-β1/
SMAD-dependent pathway [56]. Therefore, it has been sug-
gested that kefir may positively influence bFGF expression
and then diminish scar formation. These findings show that
kefir not only modulates inflammatory responses but also sus-
tains the regenerative functions and consequently promotes
the wound healing processes.
Many studies reported the anti-inflammatory, antioxidant,
and antimicrobial effects of polysaccharides on burn injuries
[57–59]. Kefir is a potential source of exopolysaccharides
(EPSs) [1]. EPSs are composed of proteins, polysaccharides
(such as glucose, galactose, and rhamnose), and a complex
symbiotic microbial mixture [60]. ESPs have the ability to
form a biofilm shape [61]. Lactic acid bacteria are the predom-
inant microorganisms in kefir that can synthesize
homopolysaccharides or heteropolysaccharides.
Homopolysaccharides contain only one type of monosaccha-
ride (glucose or fructose) [62], whereas the
heteropolysaccharides are composed of different types of
monosaccharides (mainly glucose, galactose, and rhamnose)
[63]. Nikolic et al. (2010) showed that heteropolysaccharides
can produce the anti-inflammatory cytokines [64]. On the ba-
sis of these findings, the exopolysaccharides present in kefir
extract may also accelerate the wound healing process. In
support of this hypothesis, the lactic acid concentration, a
potential source of exopolysaccharides, was the highest in
our study. However, an important question for future stud-
ies is to determinate the polysaccharide concentration pres-
ent in kefir along with its effect on healing of burn wounds
in animal studies.
Probiotics & Antimicro. Prot. (2019) 11:874–886
Conclusion
Kefir seems a proper therapeutic choice in wound healing
without causing cytotoxicity and unusual inflammatory re-
sponse. It modulated inflammation, increased rate of healing
and improved the remodeling stage by reducing IL-1β and
bFGF content and increasing the TGF-β1 and hydroxyproline
contents. Kefir also enhanced re-epithelialization and de-
creased scar tissue formation. It resulted in a dose-dependent
migration manner of fibroblasts, at in vitro condition, without
showing any cytotoxicity effects. From these data, we can
conclude that kefir can significantly improve the healing pro-
cess of the cutaneous burn wounds. Kefir may also be sug-
gested as a proper antibacterial biological therapeutic modal-
ity to be used in burn wound infection. However, further ex-
perimental investigations are still needed to understand the
mechanism of action of kefir on burn wound healing before
suggesting it to be applied in clinical settings.
Acknowledgements The authors would like to thank the authorities of
the Veterinary School, Shiraz University for their kind cooperation. We
would also thank the INSF (grant number 96006039) for its kind financial
support.
Compliance with Ethical Standards
Conflict of Interest The authors declare that they have no conflict of
interest.
References
1. Prado MR, Blandón LM, Vandenberghe LP, Rodrigues C, Castro
GR, Thomaz-Soccol V, Soccol CR (2015) Milk kefir: composition,
microbial cultures, biological activities, and related products. Front
Microbiol 6:1177
2. Plessas S, Nouska C, Mantzourani I, Kourkoutas Y, Alexopoulos
A, Bezirtzoglou E (2016) Microbiological exploration of different
types of kefir grains. Fermentation 3:1
3. Lopitz O, Rementeria F, Elguezabal N, Garaizar J (2006) Kefir: a
symbiotic yeasts-bacteria community with alleged healthy capabil-
ities. Rev Iberoam Micol 23:67–74
4. Otles S, Oe C (2003) Kefir: a probiotic dairy-composition, nutri-
tional and therapeutic aspects. Pakistan J Nutr 2:54–59
5. Oryan A, Alemzadeh E, Moshiri A (2017) Burn wound healing:
present concepts, treatment strategies and future directions. J
Wound Care 26:5–19
6. Tiwari V (2012) Burn wound: how it differs from other wounds?
Indian J Plast Surg 45:364–373
7. Winter GD (1975) Histological aspects of burn wound healing.
Burns 1:191–196
8. Dries DJ, Marini JJ (2017) Management of Critical Burn Injuries:
recent developments. Korean J Crit Care Med 32:9–21
9. Farina JA, Rosique MJ, Rosique RG (2013) Curbing inflammation
in burn patients. Int J Inflam 2013 (2013). http://doi.org/10.1155/
2013/715645
10. Porter C, Hurren NM, Herndon DN, Børsheim E (2013) Whole
body and skeletal muscle protein turnover in recovery from burns.
Int J Burns Trauma 3:9–17
885
11. Argenta A, Satish L, Gallo P, Liu F, Kathju S (2016) Local appli-
cation of probiotic bacteria prophylaxes against sepsis and death
resulting from burn wound infection. PLoS One 11:e0165294
12. Laurie C, Hogan BK, Murray CK, Loo FL, Hospenthal DR,
Cancio LC, Kim SH, Renz EM, Barillo D, Holcomb JB (2010)
Contribution of bacterial and viral infections to attributable
mortality in patients with severe burns: an autopsy series.
Burns 36:773–779
13. Branski LK, Al-Mousawi A, Rivero H, Jeschke MG, Sanford AP,
Herndon DN (2009) Emerging infections in burns. Surg Infect 10:
389–397
14. Jamalifar H, Rahimi H, Samadi N, Shahverdi A, Sharifian Z,
Hosseini F, Eslahi H, Fazeli M (2011) Antimicrobial activity of
different Lactobacillus species against multi-drug resistant clinical
isolates of Pseudomonas aeruginosa. Iran J Microbiol 3:21
15. Rodrigues KL, Caputo LRG, Carvalho JCT, Evangelista J,
Schneedorf JM (2005) Antimicrobial and healing activity of kefir
and kefiran extract. Int J Antimicrob Agents 25:404–408
16. Atalan G, Demirkan I, Yaman H, Cina M (2003) Effect of topical
kefir application on open wound healing on in vivo study. Kafkas
Univ Vet Fak Dderg 9:43–47
17. Huseini HF, Rahimzadeh G, Fazeli MR, Mehrazma M, Salehi M
(2012) Evaluation of wound healing activities of kefir products.
Burns 38:719–723
18. Shridharani SM, Magarakis M, Manson PN, Singh NK, Basdag B,
Rosson GD (2010) The emerging role of antineoplastic agents in
the treatment of keloids and hypertrophic scars: a review. Ann Plast
Surg 64:355–361
19. Kang C-G, Hah D-S, Kim C-H, Kim Y-H, Kim E, Kim J-S (2011)
Evaluation of antimicrobial activity of the methanol extracts from 8
traditional medicinal plants. Toxicol Res 27:31–36
20. Fiorda FA, de Melo Pereira GV, Thomaz-Soccol V, Medeiros AP,
Rakshit SK, Soccol CR (2016) Development of kefir-based probi-
otic beverages with DNA protection and antioxidant activities using
soybean hydrolyzed extract, colostrum and honey. LWT-Food sci
technol 68:690–697
21. Muhammad AA, Pauzi NAS, Arulselvan P, Abas F, Fakurazi S
(2013) In vitro wound healing potential and identification of bioac-
tive compounds from Moringa oleifera Lam. Biomed Res Int 2013
(2013). https://doi.org/10.1155/2013/974580
22. Oryan A, Goodship AE, Silver IA (2008) Response of a
collagenase-induced tendon injury to treatment with a
polysulphated glycosaminoglycan (Adequan). Connect Tissue
Res 49:351–360
23. Oryan A, Moshiri A, Meimandiparizi A-H (2011) Effects of
sodium-hyaluronate and glucosamine-chondroitin sulfate on re-
modeling stage of tenotomized superficial digital flexor tendon in
rabbits: a clinical, histopathological, ultrastructural, and biome-
chanical study. Connect Tissue Res 52:329–339
24. Oryan A, Khalafi-Nezhad A, Toloo N, Rad S (2007) Effects of 4-
chloro-2, 6-bis-(2-hydroxyl-benzyl)-phenol on healing of skin
wounds and growth of bacteria. J Vet Med A 54:585–591
25. Schencke C, Vasconcellos A, Sandoval C, Torres P, Acevedo F, del
Sol M (2016) Morphometric evaluation of wound healing in burns
treated with Ulmo (Eucryphia cordifolia) honey alone and supple-
mented with ascorbic acid in guinea pig (Cavia porcellus). Burns &
Trauma 4:25
26. Oryan A, Silver IA, Goodship AE (2009) Effects of a serotonin S2-
receptor blocker on healing of acute and chronic tendon injuries. J
Investig Surg 22:246–255
27. Guo S, LA DP (2010) Factors affecting wound healing. J Dent Res
89:219–229
28. Mickelson MA, Mans C, Colopy SA (2016) Principles of wound
management and wound healing in exotic pets. Vet Clin North Am
Exot Anim Pract 19:33–53
886
29. Kohn DF, Clifford C (2002) Biology and diseases of rats.
Laboratory animal medicine 2:121–167
30. Gottrup F, Ågren MS, Karlsmark T (2000) Models for use in wound
healing research: a survey focusing on in vitro and in vivo adult soft
tissue. Wound Repair Regen 8:83–96
31. Dorsett-Martin WA (2004) Rat models of skin wound healing: a
review. Wound Repair Regen 12:591–599
32. Nasrabadi H, Ebrahimi T, Banadaki D, Kajousangi T (2011) Study
of cutaneous wound healing in rats treated with Lactobacillus
plantarum on days 1, 3, 7, 14 and 21. Afr J Pharm Pharmacol 5:
2395–2401
33. Partlow J, Blikslager A, Matthews C, Law M, Daniels J, Baker R,
Labens R (2016) Effect of topically applied Saccharomyces
boulardii on the healing of acute porcine wounds: a preliminary
study. BMC Res Notes 9:210
34. Garrote GL, Abraham AG, De Antoni GL (2000) Inhibitory power
of kefir: the role of organic acids. J Food Prot 63:364–369
35. Yüksekdağ Z, Beyatli Y, Aslim B (2004) Determination of some
characteristics coccoid forms of lactic acid bacteria isolated from
Turkish kefirs with natural probiotic. LWT-Food sci technol 37:
663–667
36. Yüksekdaǧ ZN, Beyath Y, Aslım B (2004) Metabolic activities of
Lactobacillus spp. strains isolated from kefir. Mol Nutr Food Res
48:218–220
37. Halper J, Leshin L, Lewis S, Li W (2003) Wound healing and
angiogenic properties of supernatants from Lactobacillus cultures.
Exp Biol Med 228:1329–1337
38. Wong VW, Martindale RG, Longaker MT, Gurtner GC (2013)
From germ theory to germ therapy: skin microbiota, chronic
wounds, and probiotics. Plast Reconstr Surg 132:854e–861e
39. Lister PD, Wolter DJ, Hanson ND (2009) Antibacterial-resistant
Pseudomonas aeruginosa: clinical impact and complex regulation
of chromosomally encoded resistance mechanisms. Clin Microbiol
Rev 22:582–610
40. Thomson C, Hassan I, Dunn K (2012) Yakult: a role in combating
multi-drug resistant Pseudomonas aeruginosa? J Wound Care 21:
566–569
41. Fijan S (2016) Influence of the growth of Pseudomonas aeruginosa
in milk fermented by multispecies probiotics and kefir microbiota. J
Probiotics Health 3:136
42. Mobili P, de los Ángeles Serradell M, Trejo SA, FXA P, Abraham
AG, De Antoni GL (2009) Heterogeneity of S-layer proteins from
aggregating and non-aggregating Lactobacillus kefir strains.
Antonie Van Leeuwenhoek 95:363–372
43. Yilmaz-Ersan L, Ozcan T, Akpinar-Bayizit A, Sahin S (2016) The
antioxidative capacity of kefir produced from goat milk. Int J Chem
Eng Appl 7:22
44. Suetsuna K, Ukeda H, Ochi H (2000) Isolation and characterization
of free radical scavenging activities peptides derived from casein. J
Nutr Biochem 11:128–131
45. Syarina PNA, Karthivashan G, Abas F, Arulselvan P, Fakurazi S
(2015) Wound healing potential of Spirulina platensis extracts on
human dermal fibroblast cells. EXCLI J 14:385
46. Liang C-C, Park AY, Guan J-L (2007) In vitro scratch assay: a
convenient and inexpensive method for analysis of cell migration
in vitro. Nat Protoc 2:329–333
47. Schäfer M, Werner S (2007) Transcriptional control of wound re-
pair. Annu Rev Cell Dev Biol 23:69–92
48. Osuagwu F, Oladejo O, Imosemi I, Aiku A, Ekpo O, Salami A,
Oyedele O, Akang E (2004) Enhanced wound contraction in fresh
Probiotics & Antimicro. Prot. (2019) 11:874–886
wounds dressed with honey in Wistar rats (Rattus Novergicus).
West Afr J Med 23:114–118
49. Oncul O, Yildiz S, Gurer US, Yeniiz E, Qyrdedi T, Top C, Gocer P,
Akarsu B, Cevikbas A, Cavuslu S (2007) Effect of the function of
polymorphonuclear leukocytes and interleukin-1 beta on wound
healing in patients with diabetic foot infections. J Inf Secur 54:
250–256
50. Hadisaputro S, Djokomoeljanto R, Soesatyo M (2012) The effects
of oral plain kefir supplementation on proinflammatory cytokine
properties of the hyperglycemia Wistar rats induced by
streptozotocin. Acta Med Indones 44:e4
51. Prado MRM, Boller C, Zibetti RGM, de Souza D, Pedroso LL,
Soccol CR (2016) Anti-inflammatory and angiogenic activity of
polysaccharide extract obtained from Tibetan kefir. Microvasc
Res 108:29–33
52. Darby IA, Hewitson TD (2007) Fibroblast differentiation in wound
healing and fibrosis. Int Rev Cytol 257:143–179
53. Lucas T, Waisman A, Ranjan R, Roes J, Krieg T, Müller W, Roers
A, Eming SA (2010) Differential roles of macrophages in diverse
phases of skin repair. J Immunol 184:3964–3977
54. Gopalakrishnan A, Ram M, Kumawat S, Tandan S, Kumar D
(2016) Quercetin accelerated cutaneous wound healing in rats by
increasing levels of VEGF and TGF-β1. Indian J Exp Biol 54:187–
195
55. Wagner W, Wehrmann M (2007) Differential cytokine activity and
morphology during wound healing in the neonatal and adult rat
skin. J Cell Mol Med 11:1342–1351
56. Shi H-X, Lin C, Lin B-B, Wang Z-G, Zhang H-Y, Wu F-Z, Cheng
Y, Xiang L-J, Guo D-J, Luo X (2013) The anti-scar effects of basic
fibroblast growth factor on the wound repair in vitro and in vivo.
PLoS One 8:e59966
57. Huang N, Lin J, Li S, Deng Y, Kong S, Hong P, Yang P, Liao M, Hu
Z (2018) Preparation and evaluation of squid ink polysaccharide-
chitosan as a wound-healing sponge. Mat Sci Eng C 82:354–362
58. Pereira LP, Mota MR, Brizeno LA, Nogueira FC, Ferreira EG,
Pereira MG, Assreuy AM (2016) Modulator effect of a
polysaccharide-rich extract from Caesalpinia ferrea stem barks in
rat cutaneous wound healing: role of TNF-α, IL-1β, NO, TGF-β. J
Ethnopharmacol 187:213–223
59. Ding L, Shan X, Zhao X, Zha H, Chen X, Wang J, Cai C, Wang X,
Li G, Hao J (2017) Spongy bilayer dressing composed of chitosan–
Ag nanoparticles and chitosan–Bletilla striata polysaccharide for
wound healing applications. Carbohydr Polym 157:1538–1547
60. Witthuhn R, Schoeman T, Britz T (2005) Characterisation of the
microbial population at different stages of kefir production and kefir
grain mass cultivation. Int Dairy J 15:383–389
61. Wang Y, Li C, Liu P, Ahmed Z, Xiao P, Bai X (2010) Physical
characterization of exopolysaccharide produced by Lactobacillus
plantarum KF5 isolated from Tibet kefir. Carbohydr Polym 82:
895–903
62. Badel S, Bernardi T, Michaud P (2011) New perspectives for
lactobacilli exopolysaccharides. Biotechnol Adv 29:54–66
63. Ruas-Madiedo P, Hugenholtz J, Zoon P (2002) An overview of the
functionality of exopolysaccharides produced by lactic acid bacte-
ria. Int Dairy J 12:163–171
64. Nikolic M, López P, Strahinic I, Suárez A, Kojic M,
Fernández-García M, Topisirovic L, Golic N, Ruas-Madiedo
P (2012) Characterisation of the exopolysaccharide (EPS)-pro-
ducing lactobacillus paraplantarum BGCG11 and its non-EPS
producing derivative strains as potential probiotics. Int J Food
Microbiol 158:155–162