Aquaculture Reports 21 (2021) 100828

Contents lists available at ScienceDirect

Aquaculture Reports
journal homepage: www.elsevier.com/locate/aqrep

Effects of dietary sodium butyrate on growth performance, antioxidant

capacity, intestinal histomorphology and immune response in juvenile
Pengze crucian carp (Carassius auratus Pengze)
Liu Fang a, Qian Wang a, Xiaoze Guo b, *, Xingliang Pan c, Xiaoyong Li d
a
Department of Fisheries, College of Animal Science, Yangtze University, Jingzhou, Hubei, 434024, PR China
b
Institute of Animal Husbandry and Veterinary Medicine, Jiangxi Academy of Agricultural Science, Nanchang, Jiangxi, 330200, PR China
c
Microbiology Laboratory, Beijing General Station of Animal Husbandry, Beijing, 100107, PR China
d
Jiangxi Agriculture Technology Extension Center, Nanchang, Jiangxi, 330046, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: The current study was done to assess the effects of dietary sodium butyrate (SB) on growth performance, anti­
Sodium butyrate oxidative capacities, intestinal microvilli morphology and intestinal immune response in juvenile Pengze crucian
Growth performance carp (Carassius auratus Pengze). Three treated diets and a control containing 0, 1,000, 2,000, 4,000 mg/kg SB
Antioxidative capacities
(CON, SB1, SB2, SB3) were fed for juvenile Pengze crucian carp (5.49 ± 0.41 g) for 8 weeks. The results revealed
Intestinal immune response
Carassius auratus Pengze
that fish in SB2 and SB3 groups showed significantly higher growth performance compared to the control (P <
0.05). The body lipid was significantly decreased in SB-containing groups compared with that of the control (P <
0.05). Trypsin and lipase activities of fish fed SB2 and SB3 diets were both significantly higher than those of fish
fed CON and SB1 diets (P < 0.05). However, no significant difference was found in α-amylase activity among all
groups (P > 0.05). The intestinal total antioxidant capacity, catalase and superoxide dismutase activities were
significantly enhanced in SB groups compared to the control (P < 0.05). The activities of brush border enzymes
such as alkaline phosphatase, γ-glutamyl transpeptidase and Na+/K+-ATPase of fish fed SB2 and SB3 diets were
both significantly higher than those of fish fed CON and SB1 diets (P < 0.05). However, the malondialdehyde
contents of intestines in fish fed SB diets were remarkably reduced (P < 0.05). In addition, the serum total
antioxidant capacity, superoxide dismutase, lysozyme activities and complement C3 content of fish fed SB2 and
SB3 diets were significantly increased than those of fish in the CON (P < 0.05). The analysis of scanning electron
microscopy and transmission electron microscopy demonstrated that density and length of microvilli were
increased in the SB2 and SB3 groups (P < 0.05). The mRNA expression levels of pro-inflammatory gene IL-1β was
significantly down-regulated in the SB2 and SB3 groups (P < 0.05). Moreover, the mRNA expression levels of
anti-inflammatory gene TGFβ and IL-10 were significantly up-regulated in SB groups (P < 0.05). The mRNA
expression levels of TNFα were not significantly different among all the groups (P > 0.05). Conclusively, our
results showed the positive effects of the SB in Pengze crucian carp diets to improve the growth, intestinal
microvilli morphology and intestinal immune response.

1. Introduction animals (Kovalakova et al., 2020). However, the misuse of antibiotics

In recent decades, the expanding development of aquaculture has
met the demand for high-quality protein. However, with the increase in
intensive aquaculture, a series of problems have emerged in aquaculture
species, such as the decline in disease resistance and frequent occurrence
of disease (Mougin et al., 2021). For many years, antibiotics and
chemical drugs were mainly used when diseases occurred in aquatic
and chemical drugs can easily lead to the development of bacterial
resistance, as well as drug residues (Singh et al., 2020). Therefore, it is
important to find some strategies to reduce the use of drugs and improve
the immunity of aquatic animals.
Feed additives, known as non-antibiotic growth promoters, improve
the health and nutrition of aquatic animals (Salah et al., 2017). Dietary
acidifiers, including butyrate, are available from these feed additives,

* Corresponding author.
E-mail address: xiaoze206@126.com (X. Guo).

https://doi.org/10.1016/j.aqrep.2021.100828
Received 20 July 2021; Received in revised form 8 August 2021; Accepted 8 August 2021
Available online 13 August 2021
2352-5134/© 2021 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
L. Fang et al. Aquaculture Reports 21 (2021) 100828

which are widely used in fish farming (Abdel-Latif et al., 2020). Sodium Table 1
butyrate (SB) is used as a substitute for butyric acid in feed industry Ingredients and proximate composition of the experimental diets (g/kg dry
because of its good stability, less odorous and good solid phase prop­ matter).
erties (Guilloteau et al., 2010). SB has attracted special attention Ingredient CON (0 SB1(1,000 SB2(2,000 SB3(4,000
because of its ability to inhibit mucosal apoptosis through antioxidative, mg/kg) mg/kg) mg/kg) mg/kg)
antimicrobial, anti-inflammatory and immunomodulatory properties Formulation
(Mentschel and Claus, 2003; Liu et al., 2014; Zhang et al., 2015). A diet Fish meal 180 180 180 180
supplemented with 1% gelatinized polyhydroxybutyrate (PHB) can Soybean meal 200 200 200 200
Cottonseed meal 140 140 140 140
effectively protect shrimp (Penaeus vannamei) against pathogen infec­
Rapeseed meal 140 140 140 140
tion, and improve its growth rate and immune function (Kiran et al., Wheat flour 190 190 190 190
2020). In mammalian studies, it has been reported that SB has potential Wheat gluten meal 90 90 90 90
immunomodulatory properties by directly inhibiting nuclear factor Soybean oil 20 20 20 20
kappa B (NF-κB), thereby initiating pro-inflammatory responses and the Ca(H2PO4)2 20 20 20 20
Choline chloride 2 2 2 2
expression of a series of chemokine genes (Andoh et al., 2010). SB is also Mineral mixa 5 5 5 5
used in many farmed fish feeds to improve intestinal absorbency and gut Vitamin mixb 5 5 5 5
health, ultimately improving growth performance (Owen et al., 2006; Carboxymethyl 8 6 4 0
Gao et al., 2011; Liu et al., 2014, 2019; Ullah et al., 2020). cellulose
MSB 0 2 4 8
Intestinal tract is one of the largest interfaces between the aquatic
Proximate composition
animal body and the external environment. Intestinal health is one of the Crude protein 34.61 34.61 34.61 34.61
key factors to ensure the normal growth of aquatic animals which is Crude fat 5.58 5.58 5.58 5.58
related to intestinal barrier functions of aquatic animals (Xiao et al., Gross energy(kJ g- 15.29 15.29 15.29 15.29
1 c
2017). In order to protect the intestine tissue from potentially harmful )

pathogens, the intestine of aquatic animals constitutes its physical bar­ a

rier, epithelial immune system and endogenous microbiome (Guilloteau
et al., 2010; Niklasson et al., 2011). The physical barrier is mainly
composed of intestinal epithelial cells, tight junctions and peritrophic
membrane (Chen and Tang, 2013), while the intestinal immune barrier
can activate intestinal inflammation and inflammatory-induced
apoptosis to prevent the spread of pathogens (Suo et al., 2017). The
intestinal microflora also plays a key role in regulating host immune
homeostasis and metabolic functions (Qiao et al., 2019). Ultimately,
these three kinds of intestinal barriers function coordinate with each
other to maintain intestinal homeostasis.
Global fishmeal supplies are insufficient to meet the increasing
aquatic feed industry, so vegetable protein sources such as soybean
meal, cotton meal, rapeseed meal, wheat protein meal etc. have received
some special attentions (Jiang et al., 2018). However, the high contents
of non-starch polysaccharides and various anti-nutritional factors in
vegetable protein sources may inhibit fish growth, induce intestinal
inflammation, increase intestinal epithelium permeability and intestinal
microflora disorder, and reduce their disease resistance (Green et al.,
2013; Hu et al., 2016; Bai et al., 2019; He et al., 2020). Thus, it is urgent
to find dietary strategies to reduce the adverse effects of vegetable
protein sources in order to improve the utilization efficiency of vege­
table protein sources in aquatic animals. Pengze crucian carp (Carassius
auratus Pengze) is known to be a gynogenetic crucian carp (Zhao et al.,
2004), and very popular with consumers in southern China. As omniv­
orous fish, the content of vegetable protein sources added in commercial
feed of Pengze crucian carp is generally high. So far, it has not been
reported the appropriate supplementation of dietary SB in juvenile
Pengze crucian carp. This research was conducted to investigate
whether the dietary SB could improve gut health and growth perfor­
mance of juvenile Pengze crucian carp when fed a higher vegetable
protein inclusion (48 %) diet. In order to achieve the above objectives,
an 8-week feeding experiment was carried out to study the effects of
dietary SB on growth performance, antioxidative capacities, intestinal
microvilli morphology and gut immune response in juvenile Pengze
crucian carp.
2. Materials and methods
Vitamin premix (per kg of premix): Ascorbic acid (0.5 g), thiamine (2.5 g),
riboflavin (2.5 g), pyridoxine (2.0 g), inositol (100.0 g), biotin (0.3 g), pan­
tothenic acid (100.0 g), folic acid (0.75 g), para-aminobenzoic acid (2.5 g),
choline (200.0 g), nicotinic acid (10.0 g), cyanocobalamine (0.005 g),
α-tocopherol acetate (20.1 g), menadione (2.0 g), retinol palmitate (100,000 IU),
and cholecalciferol (500,000 IU).
b
Mineral premix (g/kg of premix): CaHPO4.2H2O (727.2), MgCO3.7H2O
(127.5), KCl (50.0), NaCl (60.0), FeC6H5O7.3H2O (25.0), ZnCO3 (5.5),
MnCl2.4H2O (2.5), Cu(OAc)2.H2O (0.785), CoCl3.6H2O (0.477), CaIO3.6H2O
(0.295), CrCl3.6H2O (0.128), AlCl3.6H2O (0.54), and Na2SeO3 (0.03).
c
Gross energy (GE) was calculated from NRC (2011) as 5.65, 9.45, and 4.11
kcal/g for protein, lipid, and carbohydrates, respectively.
(35 %, crude protein) and isoenergetic (15.29 kJ/g, gross energy)
practical diets were named CON, SB1, SB2, SB3. Sodium butyrate (50 %,
feed grade) was used at four levels 0, 1,000, 2,000, 4,000 mg/kg. After
grinding the diet ingredients with a 0.3 mm sieve, added distilled water
and mixed until it was sufficiently viscous. Pellets were wet extruded
with a diameter of 2.0 mm at a temperature of 110 ◦ C and a pressure of
2–3 atmosphere pressure. After drying at low temperature, the pellets
were put into a sealed bag and stored at 4 ◦ C until use.
2.2. Feeding procedures
The experimental fish were obtained from Nanchang Academy of
Agricultural Sciences. A control diet was fed at 8:30 and 16:30 until
visibly satiated for 14-day adaptation time to adapt to the feeding
regime. At the beginning of the feeding trial, 320 healthy juvenile cru­
cian carp of similar sizes (5.49 ± 0.41 g) were randomly divided into 16
tanks of 20 fishes each (60 × 60 × 80 cm3). Four replicates were set up
for each experimental diet. Each aquarium were hand-fed twice a day
until fish were visibly full, as in the pre-experiment, for 8 weeks. After
feeding, uneaten feed was sucked out, dried and weighted. The aqua­
culture tanks were changed 30 % of water daily to maintain water
temperature, pH, and dissolved oxygen at 26.50 ± 2.2 ◦ C, 7.25 ± 0.20,
and 7.0 ± 0.25 mg/L, respectively (using a Quanta portable multi-
parameter water quality tester, HACH, USA). A natural photoperiod
was conducted in this experiment.

2.1. Diet preparation 2.3. Samples and measurements

Basal diet formulation and proximate composition analysis are listed Following the feeding trial, after being fasted for 24 h, fish in each
in Table 1. All the ingredients were provided by Hangzhou King Tech­ tank were anaesthetized with 150 mg/L MS-222 and weighed. For
nology Feed Company Limited (Hangzhou, China). Four isonitrogenous sampling, 9 fish per tank were randomly collected, including 6 fish were

2
L. Fang et al. Aquaculture Reports 21 (2021) 100828

slaughtered for collecting serum, hepatopancreas and intestines and 3 Table 2

fish for analysis of proximate composition. All samples were stored at Primers sequences in the qRT-PCR.
-80 ℃ prior to analysis. Primer Sequence(5’-3’) Accession no. Amplicon
name sizes (bp)
2.4. Growth performance, approximate body composition β-actin GATGATGAAATTGCCGCACTG
forward
AB039726 453
Growth parameters, nutrient efficiency and healthy indices were β-actin
ACCGACCATGACGCCCTGATGT
reverse
calculated using the following formulae (Liu et al., 2018; Sutthi et al.,
IL-1β
2020): GCGCTGCTCAACTTCATCTTG
forward
AJ249137 541
IL-1β
Weight gain (WG, %) = (final weight - initial weight) × 100 / (initial weight) GTGACACATTAAGCGGCTTCAC
reverse
TNFα
Average daily weight gain (ADG, g day-1) = [final weight (g) - initial weight CATTCCTACGGATGGCATTTACTT
forward
EU069818 372
(g)] / days TNFα
CCTCAGGAATGTCAGTCTTGCAT
reverse
Specific growth rate (SGR, % day-1) = (ln final weight - ln initial weight) × 100 IL-10
TCCAGAAGGACCACTTGCAC
/ days of feeding forward
HQ259106 286
IL-10
GGGTGAAGTCCATTTGTGCC
Feed conversion ratio (FCR) = body weight gain / total feed intake reverse
TGFβ
TGGAGAAGAACGCCTCGAAC
Hepatosomatic index (HSI, %) = hepatopancreas mass/ body weight × 100 forward
XM026228406 350
TGFβ
GCACCACCTTGCTGTCAATG
Viscera somatic index (VSI, %) = viscera mass / body weight × 100 reverse

Proximate body composition analyses were performed on whole fish

accordingly (Song et al., 2016). used as the internal control gene.

2.5. Intestinal digestive enzyme activity and antioxidant indicators 2.9. Statistical analysis

Intestines of 3 fish per tank were dissected respectively for digestive Data were analyzed by one-way analysis of variance (ANOVA) with
enzymes and antioxidant indicators analysis. The activity of intestinal Tucky’s post hoc test using GraphPad Prism 5 software. All results were
digestive enzymes (trypsin, lipase, α-amylase), brush-border membrane shown as means ± S.E, and significance was set at P < 0.05.
enzymes (AKP, Na+/K+-ATPase, γ-GT) and antioxidant enzymes (SOD,
LZM, T-AOC, MDA) were measured by using commercially kits (Nanjing 3. Results
Jiancheng Institute, Jiangsu, China). Trypsin, lipase, and α-amylase
enzyme activities were measured accordingly Ross et al. (2000). AKP, 3.1. Growth performance and proximate composition
Na+/K+-ATPase, and γ-GT enzyme activities were evaluated according
to the methods described by Zhao et al. (2012). SOD, LZM, T-AOC Growth parameters and proximate composition after 8 weeks of
enzyme activities and MDA contents were evaluated accordingly Han administration in different groups were shown in Tables 3 and 4 . In the
et al. (2011). All assays were performed in triplicates. present study, FBW, WG, ADG, SGR, and FCR were greater (P < 0.05) in
SB2 and SB3 groups than those in the control. Compared with the con­
2.6. Serum immune and antioxidative parameters trol, VSI was significantly reduced with the supplementation of SB (P <
0.05). Compared with the control, crude lipid was significantly
Blood was collected from the caudal vein from three fish per decreased in all SB groups (P < 0.05). There were no significant dif­
aquarium and their serum samples were prepared by centrifugation ferences in moisture, ash contents and crude protein among experi­
(3000 g for 15 min) and stored at -80 ℃ prior to analysis. The serum mental groups (P > 0.05).
profile of SOD, LZM, T-AOC, MPO and C3 were measured by the com­
mercial kit (Nanjing Jiancheng Institute, Jiangsu, China) according to
the methods of the operation instructions, following the existing method
(Han et al., 2011). All assays were performed in triplicates.
Table 3
2.7. Intestinal microvilli morphology Growth parameters and somatic indices after 8 weeks administration in different
groups.
Hindgut samples were collected from 3 fish in each tank and CON (0 mg/ SB1 (1,000 SB2 (2,000 SB3 (4,000
measured by transmission electron microscopy (TEM) and scanning kg) mg/kg) mg/kg) mg/kg)
electron microscopy (SEM) accordingly (Ran et al., 2015). Images from IBW (g) 5.49 ± 0.41 5.48 ± 0.11 5.56 ± 0.67 5.54 ± 0.13
TEM or SEM were analyzed to obtain microvilli length or density data FBW (g) 12.39 ± 12.41 ± 1.34b 14.31 ± 1.18a 14.69 ± 1.36a
1.25b
according to the previous methods (Ran et al., 2015).
WG (%) 125.51 ± 128.16 ± 157.27 ± 164.79 ±
22.71b 13.32b 11.26a 16.44a
2.8. Real-time quantitative PCR ADG (g 0.12 ± 0.01b 0.13 ± 0.01b 0.16 ± 0.01a 0.17 ± 0.02a
day− 1)
SGR (% 1.45 ± 0.03 b 1.47 ± 0.09b 1.69 ± 0.06a 1.74 ± 0.11a
Total RNA of intestinal tissue was extracted from 6 fish per tank
day-1)
using the SV Total RNA Isolation System (Promega). The first strand FCR 2.16 ± 0.21a 1.98 ± 0.06a 1.76 ± 0.03b 1.71 ± 0.06b
cDAN was synthesized using the PrimeScript TM RT Reagent Kit VSI (%) 18.27 ± 16.39 ± 0.92b 15.45 ± 1.21b 14.68 ± 0.83b
(Takara). The expression levels of TNFα, IL-1β, IL-10 and TGFβ in the 1.79a
intestine were determined as described previously (Guo et al., 2015). HSI (%) 6.39 ± 1.19 6.04 ± 0.63 6.25 ± 0.54 5.94 ± 0.45

The primer sequences were indicated in Table 2. The data were analyzed Note: Values are presented as mean ± S.E (n=3); values with different super­
by the 2− ΔΔCt method (Schmittgen and Livak, 2008), and β-actin was scripts within each row indicate significant differences (P < 0.05).

3
L. Fang et al. Aquaculture Reports 21 (2021) 100828

Table 4 Table 6
Proximate composition of whole body of juvenile Pengze crucian carp after 8- Serum immune and antioxidative parameters of fish fed diets different levels of
week administration in different groups. SB levels for 8 weeks.
CON (0 SB1 (1,000 SB2 (2,000 SB3 (4,000 Item Parameters CON (0 SB1 SB2 SB3
mg/kg) mg/kg) mg/kg) mg/kg) mg/kg) (1,000 (2,000 (4,000
mg/kg) mg/kg) mg/kg)
Moisture (%) 71.42 ± 71.58 ± 0.32 72.21 ± 0.41 72.14 ± 0.30
0.84 LZM (mg 21.35 ± 23.41 ± 28.69 ± 25.17 ±
Crude protein 15.56 ± 15.73 ± 0.28 15.83 ± 0.23 15.92 ± 0.23 ml− 1) 1.39b 0.58b 1.42a 0.97a
Immune
(%) 0.21 C3 (mg 62.85 ± 65.31 ± 83.64 ± 92.49 ±
Crude lipid 6.35 ± 6.01 ± 0.12b 5.65 ± 0.15b 5.27 ± 0.14c mL− 1) 2.36b 1.27b 4.62a 6.57a
(%) 0.07a SOD (U 156.74 ± 170.95 ± 203.84 ± 192.35 ±
Ash (%) 3.15 ± 0.13 3.14 ± 0.05 3.29 ± 0.14 3.23 ±0.11 ml− 1) 10.58b 8.69ab 15.34a 12.57a
T-AOC (U 3.22 ± 3.96 ± 4.62 ± 4.43 ±
Note: Values are presented as mean ± S.E (n=3); values with different super­ Antioxidation
ml− 1) 0.64b 0.24b 0.45a 0.38a
scripts within each row indicate significant differences (P < 0.05). MPO (U 92 ± 101 ± 107 ± 113 ±
ml− 1) 12.34 10.31 21.84 16.37
3.2. Digestive enzyme activity and antioxidant indicators Note: Values are presented as mean ± S.E (n=3); values with different super­
scripts within each row indicate significant differences (P < 0.05).
Intestinal digestive enzyme activity and antioxidant indicators were Abbreviations: LZM, lysozyme;C3:complement C3; SOD, superoxide dismutase;
listed in Table 5. Trypsin and lipase activities in SB2 and SB3 groups T-AOC, total antioxidant capacity; MPO, myeloperoxidase.
were both significantly higher than those in CON and SB1 groups (P <
0.05). However, no significant difference was found in α-amylase ac­ groups were significantly increased than those of CON group (P < 0.05).
tivity among all groups (P > 0.05). Brush border enzymes activities such MPO activity was no significant difference among all trail groups (P >
as AKP, Na+/K+-ATPase and γ-GT of fish in SB2 and SB3 groups were 0.05).
both significantly higher than those in CON and SB1 groups (P < 0.05).
In addition, the intestinal SOD, CAT and T-AOC activities were signifi­ 3.4. Intestinal microvilli morphology
cantly enhanced in SB groups compared to the control (P < 0.05). The
MDA contents of intestines in fish fed SB diets were remarkably reduced The SEM and TEM micrographs were shown in Figs. 1 and 2 ,
(P < 0.05). respectively. Analysis of SEM and TEM demonstrated that microvilli
density and length were both increased significantly in the SB2 and SB3
3.3. Serum immune and antioxidant indicators groups (P < 0.05). Additionally, no significant differences in microvilli
density and length were observed in the SB1 group compared with the
The serum immune and antioxidant indicators were shown in CON group (P > 0.05).
Table 6. The serum LZM activity and C3 content of fish in SB2 and SB3
groups were significantly increased compared to fish in CON and SB1 3.5. Relative expression levels of intestinal cytokines
groups (P < 0.05). The serum SOD and T-AOC activities in SB2 and SB3
The mRNA expression levels of intestinal cytokines genes (TNFα, IL-
Table 5 1β, IL-10 and TGFβ) were shown in Fig. 3. The mRNA expression levels
Intestinal digestive enzyme activity and antioxidant indicators of fish fed with of IL-1β were significantly down-regulated in SB2 and SB3 groups (P <
different levels of SB for 8 weeks. 0.05). The mRNA expression levels of THFα were not significantly
Item Enzymes CON (0 SB1 SB2 SB3 different among all experimental groups (P > 0.05). Moreover, the
mg/kg) (1,000 (2,000 (4,000 mRNA expression levels of TGFβ and IL-10 were significantly up-
mg/kg) mg/kg) mg/kg) regulated in SB groups (P < 0.05).
Trypsin (U mg 0.25 ± 0.24 ± 0.36 ± 0.38 ±
prot-1) 0.02 b 0.05 b 0.06 a 0.07 a 4. Discussion
Lipase (U mg 0.28 ± 0.31 ± 0.35 ± 0.38 ±
Digestive
prot-1) 0.04 b 0.05b 0.03 a 0.08 a
enzymes
0.043 In the present study, growth performance in SB2 and SB3 groups
α-Amylase (U 0.048 ± 0.049 ± 0.045 ±
± coincided with increased FCR as well as trypsin and lipase in these
mg prot-1) 0.004 0.003 0.006
0.002 experimental groups. This is consistent with previous studies showing
Na+/K+- that sodium butyrate has growth-promoting effects on different fishes
0.12 ± 0.18 ± 0.24 ± 0.31 ±
ATPase (U mg
Brush-border prot-1)
0.01b 0.04b 0.03a 0.06a (Liu et al., 2014; Kiran et al., 2020; Ullah et al., 2020). However,
membrane AKP (U mg 0.34 ± 0.41 ± 0.52 ± 0.59 ± researcher got different results in African catfish (Owen et al., 2006).
enzymes prot-1) 0.03 b 0.05 b 0.02a 0.04a These contrary findings on growth performance could be related to
γ-GT (U mg 0.24 ± 0.31 ± 0.42 ± 0.46 ± species, feed composition and additive amount. The sodium butyrate
prot-1) 0.02 b 0.04 b 0.02a 0.03a
lowered the HSI and VSI in visceral mass. The reduction in HSI and VSI
33.45
SOD (U mg
± 2.62
40.83 ± 45.62 ± 45.67 ± could be associated with decreased lipid content in the visceral adipose
prot-1) 1.75 b 2.97a 6.24a
c tissue (Zhou et al., 2019; Xu et al., 2021). Moreover, we also observed
Antioxidant
CAT (U mg 4.56 ± 6.28 ± 7.15 ± 7.63 ± that supplementation SB could affect the body fat content. Studies have
prot-1) 0.66 c 0.46 b 0.57a 1.72a also shown that butyrate acts as signaling molecules that inhibit lipid
enzymes
T-AOC (U mg 0.58 ± 0.65 ± 0.76 ± 0.72 ±
prot-1) 0.14 b 0.07 ab 0.08a 0.09 a
accumulation in mice (Lin et al., 2012). Similarly, Xu et al. (2021) re­
MDA (nmol 9.64 ± 8.02 ± 6.39 ± 7.85 ± ported that an appropriate amount of butyrate could reduce body lipid
mg prot-1) 0.96 a 0.52 b 0.85 c 0.57 b content in large yellow croaker, and moderate dose of dietary tributyrin
Note: Values are presented as mean ± S.E (n=3); values with different super­ decreased the expression levels of lipogenesis-related genes and
scripts within each row indicate significant differences (P <0.05). increased the expression levels of lipid oxidation-related genes. How­
Abbreviations: AKP, alkaline phosphatase; γ-GT,γ-glutamyl transpeptidase; ever, the current study on the correlation between dietary butyrate and
SOD, superoxide dismutase; CAT, catalase; T-AOC, total antioxidant capacity; lipid metabolism of fish is limited; therefore, the underlying mechanism
MDA, malondialdehyde. remains to be elucidated in fish.

4
L. Fang et al.
Fig. 1. Comparative SEM micrographs of microvilli density from the posterior intestinal region of Pengze crucian carp fed the control diet (CON), 1,000 mg/kg
sodium butyrate (SB1), 2,000 mg/kg sodium butyrate (SB2), 4,000 mg/kg sodium butyrate (SB3).
In general, digestive enzymes are related to digestive capacity and
directly affect the growth of cultured animals (Ling et al., 2010). In the
present study, intestinal trypsin and lipase activities were significantly
increased in the high-dose SB diet groups. These results are consistent
with the previous studies in fish (Tian et al., 2017; Xie et al., 2020). In
addition, brush-border enzymes are highly responsive to nutrient ab­
sorption in fish (Zhao et al., 2012). Therefore, the activities of the
brush-border enzymes can be used as indicators to evaluate nutrient
absorption. The activities of AKP, Na+/K+-ATPase and γ-GT of SB2 and
SB3 groups from the present study were both significantly higher than
those in CON group. A previous study has also indicated that digestive
enzyme activities correlate positively with intestinal brush-border
enzyme activities (Yuan et al., 2018). These results suggested that di­
etary SB can enhance brush-border enzyme activities and promote the
absorptive capacity in intestine.
In fish, the intestine is the main organ to absorb nutrients (Onura
5
Aquaculture Reports 21 (2021) 100828
et al., 2018). The length and density of the intestinal microvillus is
directly related to the absorption capacity (Liu et al., 2014). In the
current study, dietary SB was found to increase the length and density of
intestinal microvillus. These results indicate that dietary SB can improve
the development of microvillus, thus increasing the absorption effi­
ciency of nutrients and improving growth performance (Abdel-Tawwab
et al., 2021).
Fish intestines are susceptible to toxic substance and oxidative stress
due to the fish intestine and diet including high level polyunsaturated
fatty acid, whose are easy to form lipid free radicals (Wu et al., 2006).
SOD and CAT are two essential enzymes in the cellular antioxidant
enzymatic system, which can remove reactive oxygen species and lipid
peroxidation products in time (Li et al., 2007). In the current study, SOD
and CAT activities were significantly higher in SB groups than those in
the CON group. Similarly, 0.4 % microencapsulated SB increased the
SOD activity of juvenile black sea bream (Ullah et al., 2020). The finding
L. Fang et al.
Fig. 2. Comparative TEM micrographs of microvilli height from the posterior intestinal region of Pengze crucian carp fed the control diet (CON), 1,000 mg/kg
sodium butyrate (SB1), 2,000 mg/kg sodium butyrate (SB2), 4,000 mg/kg sodium butyrate (SB3).
of the current research showed that dietary SB can significantly enhance
the intestinal T-AOC activity. This result was similar to the research in
juvenile grass carp (Wu et al., 2018) and Penaeus vannamei (Kiran et al.,
2020). The results of the present study indicated that dietary SB sup­
plementation can reduce the content of MDA in intestinal tissue, sug­
gesting that dietary SB supplementation may have an effective effect in
preventing gut fat peroxidation.
The innate immune function of intestinal mucosal is closely related
to the inflammatory response, which is mediated by cytokines
(Secombes et al., 2001). A previous study presented evidence that fish
intestinal epithelial cells produce several cytokines (Komatsu et al.,
2009). Some previous studies have observed that butyrate has a pro­
nounced anti-inflammatory effect in fish (Tian et al., 2017; Liu et al.,
2019). In the current study, down-regulated mRNA expression levels of
IL1β and up-regulated mRNA expression levels of IL-10 and TGFβ were
observed in fish fed SB diets. A previous research reported that SB
ameliorates the TNBS-induced inflammatory response through inhibit­
ing the nuclear transcriptional factor κB p65 signaling pathway in mice
6
Aquaculture Reports 21 (2021) 100828
(Zhu et al., 2011). A study in Nibea albiflora also confirmed that the
anti-inflammatory effects of SB attributes to the inhibition of NF-κB
signaling pathway, whose activation initiates pro-inflammatory cyto­
kines (Wu et al., 2020).
Conclusively, our results showed the positive effects of the SB in
Pengze crucian carp diets to improve the growth, intestinal microvilli
morphology and intestinal immune response.
Author statement
Liu Fang: responsible for the fish rearing and the laboratory ana­
lyses. analyzed the data and wrote the manuscript; Qian Wang： ：
responsible for the fish rearing and revised the manuscript; Xingliang
Pan： ：designed the study and interpreted the findings; Xiaoze Guo： ：
designed the study and interpreted the findings;revised the manuscript;
Xiaoyong Li: responsible for the fish rearing and the laboratory
analyses.
L. Fang et al.
Fig. 3. Relative expression levels of intestinal cytokines. Statistical differences in gene expression between samples were evaluated as means ± S.E; n = 6. Different
letters indicate significant differences (one way analysis of variance (ANOVA) with Tucky’s post hoc test; P < 0.05) among groups.
Declaration of Competing Interest
The authors declare no conflict of interest.
Acknowledgements
This work was supported by a grant from National Natural Science
Foundation of China (grant no: 31760762, 31660743), the Earmarked
Fund for Jiangxi Agriculture Research System (JXARS-10), the Youth
Science Foundation of Jiangxi Province (20161BAB214185,
20171BAB214015), Hubei Province Modern Agricultural Industrial
Technology System Project (HBHZD-ZB-2020-005). We thank W.H. Fan
and Z.X. Zhou for their assistance in the study.
References
Abdel-Latif, H.M., Abdel-Tawwab, M., Dawood, M.A., Menanteau-Ledouble, S.,
ElMatbouli, M., 2020. Benefits of dietary butyric acid, sodium butyrate, and their
protected forms in aquafeeds: a review. Rev. Fish. Sci. Aquac. 28 (4), 421–448.
https://doi.org/10.1080/23308249.2020.1758899.
Abdel-Tawwab, M., Shukry, M., Farrag, F.A., El-Shafai, N.M., Dawood, M.A., Abdel-
Latif, H.M., 2021. Dietary sodium butyrate nanoparticles enhanced growth, digestive
enzyme activities, intestinal histomorphometry, and transcription of growth-related
genes in Nile tilapia juveniles. Aquaculture 536 (4), 736467. https://doi.org/
10.1016/j.aquaculture.2021.736467.
Andoh, A., Fujiyama, Y., Hata, K., Araki, Y., Takaya, H., Shimada, M., Bamba, T., 2010.
Counter-regulatory effect of sodium butyrate on tumour necrosis factor-alpha (TNF-
α)-induced complement C3 and factor B biosynthesis in human intestinal epithelial
cells. Clin. Exp. Immunol. 118 (1), 23–29. https://doi.org/10.1046/j.1365-
2249.1999.01038.x.
Bai, N., Gu, M., Liu, M., Jia, Q., Pan, S., Zhang, Z., 2019. Corn gluten meal induces
enteritis and decreases intestinal immunity and antioxidant capacity in turbot
Scophthalmus maximus at high supplementation levels. PLoS One 14 (3), e0213867.
https://doi.org/10.1371/journal.pone.0213867.
Chen, Y., Tang, L., 2013. Digestive tract barrier and the immune function of dendritic
cells: research progress. Chin. J. Microecol. 25, 979–981.
Gao, Y., Storebakken, T., Shearer, K.D., Penn, M., Øverland, M., 2011. Supplementation
of fishmeal and plant protein-based diets for rainbow trout with a mixture of sodium
formate and butyrate. Aquaculture 311 (1–4), 233–240. https://doi.org/10.1016/j.
aquaculture.2010.11.048.
7
Aquaculture Reports 21 (2021) 100828
Green, T.J., Smullen, R., Barnes, A.C., 2013. Dietary soybean protein concentrate
induced intestinal disorder in marine farmed Atlantic salmon, Salmo salar is
associated with alterations in gut microbiota. Vet. Microbiol. 166 (1-2), 286–292.
https://doi.org/10.1016/j.vetmic.2013.05.009.
Guilloteau, P., Martin, L., Eeckhaut, V., Ducatelle, R., Zabielski, R., Van Immerseel, F.,
2010. From the gut to the peripheral tissues: the multiple effects of butyrate. Nutr.
Res. Rev. 23 (2), 366–384. https://doi.org/10.1017/S0954422410000247.
Guo, X.Z., Liang, X.F., Fang, L., Yuan, X.C., Zhou, Y., He, S., Shen, D., 2015. Effects of
lipid-lowering pharmaceutical clofibrate on lipid and lipoprotein metabolism of
grass carp (Ctenopharyngodon idellal Val.) fed with the high non-protein energy diets.
Fish Physiol. Biochem. 41 (2), 331–343. https://doi.org/10.1007/s10695-014-9986-
8.
Han, D., Xie, S., Liu, M., Xiao, X., Liu, H., Zhu, X., Yang, Y., 2011. The effects of dietary
selenium on growth performances, oxidative stress and tissue selenium
concentration of gibel carp (Carassius auratus gibelio). Aquacul. Nutr. 17 (3),
741–749. https://doi.org/10.1111/j.1365-2095.2010.00841.x.
He, Y., Ye, G., Chi, S., Tan, B., Dong, X., Yang, Q., Liu, H., Zhang, S., 2020. Integrative
transcriptomic and small RNA sequencing reveals immune-related miRNA-mRNA
regulation network for soybean meal-induced enteritis in hybrid grouper, Epinephelus
fuscoguttatus♀× Epinephelus lanceolatus♂. Front. Immunol. 11, 1502.
Hu, H.B., Kortner, T.M., Gajardo, K., Chikwati, E., Tinsley, J., Krogdahl, Å., 2016.
Intestinal fluid permeability in Atlantic salmon (Salmo salar L.) is affected by dietary
protein source. PLoS One 11 (12), e0167515. https://doi.org/10.1371/journal.
pone.0167515.
Jiang, H.B., Chen, L.Q., Qin, J.G., 2018. Fishmeal replacement by soybean, rapeseed and
cottonseed meals in hybrid sturgeon Acipenser baerii♀× Acipenser schrenckii♂.
Aquacult. Nutr. 24, 1369–1377. https://doi.org/10.1111/anu.12674.
Kiran, G.S., Priyadharshini, S., Sajayan, A., Ravindran, A., Priyadharshini, G.B.,
Ramesh, U., Suarez, L.E.C., Selvin, J., 2020. Dietary administration of gelatinised
polyhydroxybutyrate to Penaeus vannamei improved growth performance and
enhanced immune response against Vibrio parahaemolyticus. Aquaculture 517,
734773. https://doi.org/10.1016/j.aquaculture.2019.734773.
Komatsu, K., Tsutsui, S., Hino, K., Araki, K., Yoshiura, Y., Yamamoto, A., Nakamuraa, O.,
Watanabe, T., 2009. Expression profiles of cytokines released in intestinal epithelial
cells of the rainbow trout, Oncorhynchus mykiss, in response to bacterial infection.
Dev. Com. Immun. 33 (4), 499–506. https://doi.org/10.1016/j.dci.2008.09.012.
Kovalakova, P., Cizmas, L., Mcdonald, T.J., Marsalek, B., Feng, M.B., Sharma, V.K., 2020.
Occurrence and toxicity of antibiotics in the aquatic environment: a review.
Chemosphere 251, 126351. https://doi.org/10.1016/j.chemosphere.2020.126351.
Li, X.M., Ma, Y.L., Liu, X.J., 2007. Effect of the Lycium barbarum polysaccharides on age-
related oxidative stress in aged mice. J. Ethnopharmacol. 111 (3), 504–511. https://
doi.org/10.1016/j.jep.2006.12.024.
Lin, H.V., Frassetto, A., Kowalik Jr, E.J., Nawrocki, A.R., Lu, M.M., Kosinski, J.R.,
Marsh, D.J., 2012. Butyrate and propionate protect against diet-induced obesity and
regulate gut hormones via free fatty acid receptor 3-independent mechanisms. PLoS
One 7 (4), e35240. https://doi.org/10.1371/journal.pone.0035240.
L. Fang et al.
Ling, J., Feng, L., Liu, Y., Jiang, J., Jiang, W.D., Hu, K., Li, S.H., Zhou, X.Q., 2010. Effect
of dietary iron levels on growth, body composition and intestinal enzyme activities
of juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Nutr. 16 (6), 616–624.
https://doi.org/10.1111/j.1365-2095.2009.00699.x.
Liu, W., Yang, Y., Zhang, J., Gatlin, D.M., Ringø, E., Zhou, Z., 2014. Effects of dietary
microencapsulated sodium butyrate on growth, intestinal mucosal morphology,
immune response and adhesive bacteria in juvenile common carp (Cyprinus carpio)
pre-fed with or without oxidised oil. Brit. J. Nutr. 112 (1), 15–29. https://doi.org/
10.1017/s0007114514000610.
Liu, L.W., Liang, X.F., Li, J., Yuan, X.C., Fang, J.G., 2018. Effects of supplemental phytic
acid on the apparent digestibility and utilization of dietary amino acids and minerals
in juvenile grass carp (Ctenopharyngodon idellus). Aquacul. Nutr. 24, 850–857.
https://doi.org/10.1111/anu.12614.
Liu, Y., Chen, Z., Dai, J., Yang, P., Xu, W., Ai, Q., Zhang, W., Zhang, Y., Zhang, Y.,
Mai, K., 2019. Sodium butyrate supplementation in high-soybean meal diets for
turbot (Scophthalmus maximus L.): effects on inflammatory status, mucosal barriers
and microbiota in the intestine. Fish Shellfish Immun. 88, 65–75. https://doi.org/
10.1016/j.fsi.2019.02.064.
Mentschel, J., Claus, R., 2003. Increased butyrate formation in the pig colon by feeding
raw potato starch leads to a reduction of colonocyte apoptosis and a shift to the stem
cell compartment. Metabolism 52 (11), 1400–1405. https://doi.org/10.1016/
S0026-0495(03)00318-4.
Mougin, J., Roquigny, R., Flahaut, C., Bonnin-Jusserand, M., Grard, T., Bris, C.L., 2021.
Abundance and spatial patterns over time of vibrionaceae and vibrio harveyi in water
and biofilm from a seabass aquaculture facility. Aquaculture 542 (3), 736862.
https://doi.org/10.1016/j.aquaculture.2021.736862.
Niklasson, L., Sundh, H., Fridell, F., Taranger, G.L., Sundell, K., 2011. Disturbance of the
intestinal mucosal immune system of farmed Atlantic salmon (Salmo salar), in
response to long-term hypoxic conditions. Fish Shellfish Immun. 31 (6), 1072–1080.
https://doi.org/10.1016/j.fsi.2011.09.011.
NRC, 2011. Committee on the Nutrient Requirements of Fish Shrimp. Nutrient
Requirements of Fish and Shrimp. National academies press National Research
Council.
Onura, C.N., den Broeck, W.V., Nevejan, N., Muendo, P., Stappen, G.V., 2018. Growth
performance and intestinal morphology of African catfish (Clarias gariepinus,
Burchell, 1822) larvae fed on live and dry feeds. Aquaculture 489, 70–79. https://
doi.org/10.1016/j.aquaculture.2018.01.046.
Owen, M.A.G., Waines, P., Bradley, G., Davies, S., 2006. The effect of dietary
supplementation of sodium butyrate on the growth and microflora of Clarias
gariepinus (Burchell 1822). The XII International Symposium Fish Nutrition and
Feeding 147.
Qiao, R., Sheng, C., Lu, Y., Zhang, Y., Ren, H., Lemos, B., 2019. Microplastics induce
intestinal inflammation, oxidative stress, and disorders of metabolome and
microbiome in zebrafish. Sci. Total Environ. 662, 246–253. https://doi.org/
10.1016/j.scitotenv.2019.01.245.
Ran, C., Huang, L., Liu, Z., Xu, L., Yang, Y., Tacon, P., Auclair, E., Zhou, Z., 2015.
A comparison of the beneficial effects of live and heat-inactivated baker’s yeast on
Nile tilapia: suggestions on the role and function of the secretory metabolites
released from the yeast. PLoS One 10 (12), e0145448. https://doi.org/10.1371/
journal.pone.0151207.
Ross, N.W., Firth, K.J., Wang, A., Burka, J.F., Johnson, S.C., 2000. Changes in hydrolytic
enzyme activities of naive Atlantic salmon Salmo salar skin mucus due to infection
with the salmon louse Lepeophtheirus salmonis and cortisol implantation. Dis. Aquat.
Org. 41, 43–51. https://doi.org/10.3354/dao041043.
Salah, A.S., El Nahas, A.F., Mahmoud, S., 2017. Modulatory effect of different doses of
β-1,3/1,6-glucan on the expression of antioxidant, inflammatory, stress and
immunerelated genes of Oreochromis niloticus challenged with Streptococcus iniae.
Fish Shellfish Immunol. 70, 204–213. https://doi.org/10.1016/j.fsi.2017.09.008.
Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT
method. Nat. Protoc. 3 (6), 1101. https://doi.org/10.1038/nprot.2008.73.
Secombes, C.J., Wang, T., Hong, S., Peddie, S., Crampe, M., Laing, K.J., Zou, J., 2001.
Cytokines and innate immunity of fish. Dev. Comp. Immunol. 25 (8–9), 713–723.
https://doi.org/10.1016/j.fsi.2004.09.006.
Singh, A., Gautam, P.K., Verma, A., Singh, V., Shivapriya, P.M., Shivalkar, S., Samanta, S.
K., 2020. Green synthesis of metallic nanoparticles as effective alternatives to treat
antibiotics resistant bacterial infections: a review. Biotechnol. Rep. 25, e00427
https://doi.org/10.1016/j.btre.2020.e00427.
Song, F., Xu, D., Mai, K., Zhou, H., Xu, W., He, G., 2016. Comparative study on the
cellular and systemic nutrient sensing and intermediary metabolism after partial
Aquaculture Reports 21 (2021) 100828
replacement of fishmeal by meat and bone meal in the diet of turbot (Scophthalmus
maximus L.). PLoS One 11, e0165708. https://doi.org/10.1371/journal.
pone.0165708.
Suo, Y., Li, E., Li, T., Jia, Y., Qin, J.G., Gu, Z., Chen, L., 2017. Response of gut health and
microbiota to sulfide exposure in Pacific white shrimp Litopenaeus vannamei. Fish
Shellfish Immunol. 63, 87–96. https://doi.org/10.1016/j.fsi.2017.02.008.
Sutthi, N., Panase, A., Chitmanat, C., Sookying, S., Ratworawong, K., Panase, P., 2020.
Effects of dietary leaf ethanolic extract of Apium graveolens L. On growth
performance, serum biochemical indices, bacterial resistance and lysozyme activity
in Labeo chrysophekadion (Bleeker, 1849). Aquac. Rep. 18, 100551 https://doi.org/
10.1016/j.aqrep.2020.100551.
Tian, L., Zhou, X.Q., Jiang, W.D., Liu, Y., Wu, P., Jiang, J., Feng, L., 2017. Sodium
butyrate improved intestinal immune function associated with NF-κB and p38MAPK
signalling pathways in young grass carp (Ctenopharyngodon idella). Fish Shellfish
Immun. 66, 548–563. https://doi.org/10.1016/j.fsi.2017.05.049.
Ullah, S., Zhang, G., Zhang, J., Shengli, T., Wang, L., Kalhoro, H., Shao, Q., 2020. Effects
of microencapsulated sodium butyrate supplementation on growth performance,
intestinal development and antioxidative capacity of juvenile black sea bream
(Acanthopagrus schlegelii). Aquac. Res. 51 (12), 4893–4904. https://doi.org/
10.1111/are.14824.
Wu, J.H., Xu, C., Shan, C.Y., Tan, R.X., 2006. Antioxidant properties and PC12 cell
protective effects of APS-1, a polysaccharide from Aloe vera var. chinensis. Life Sci. 78
(6), 622–630. https://doi.org/10.1016/j.lfs.2005.05.097.
Wu, P., Tian, L., Zhou, X.Q., Jiang, W.D., Liu, Y., Jiang, J., Feng, L., 2018. Sodium
butyrate enhanced physical barrier function referring to Nrf2, JNK and MLCK
signaling pathways in the intestine of young grass carp (Ctenopharyngodon idella).
Fish Shellfish Immun. 73, 121–132. https://doi.org/10.1016/j.fsi.2017.12.009.
Wu, X., Wang, L., Xie, Q., Tan, P., 2020. Effects of dietary sodium butyrate on growth,
diet conversion, body chemical compositions and distal intestinal health in yellow
drum (Nibea albiflora, Richardson). Aquac. Res. 51 (1), 69–79. https://doi.org/
10.1111/are.14348.
Xiao, W., Jiang, W., Feng, L., Liu, Y., Wu, P., Jiang, J., Zhou, X., 2017. Supplementation
of enzyme-treated soy protein saves dietary protein and promotes digestive and
absorptive ability referring to TOR signaling in juvenile fish. Fish Physiol. Biochem.
43 (6), 1657–1675. https://doi.org/10.1007/s10695-017-0400-1.
Xie, D., Dai, Q., Xu, C., Li, Y., 2020. Dietary tributyrin modifies intestinal function by
altering morphology, gene expression and microbiota profile in common carp
(Cyprinus carpio) fed all-plant diets. Aquac. Nutr. 27 (2), 439–453. https://doi.org/
10.1111/anu.13197.
Xu, N., Ding, T., Liu, Y., Zheng, W., Liu, Q., Yin, Z., Xiang, X., Xu, D., Mai, K., Ai, Q.,
2021. Effects of dietary tributyrin on growth performance, body composition, serum
biochemical indexes and lipid metabolism-related genes expression of juvenile large
yellow croaker (Larimichthys crocea) fed with high level soybean oil diets. Aquacult.
Nutr. 27, 395–406. https://doi.org/10.1111/anu.13192.
Yuan, X.Y., Jiang, G.Z., Wang, C.C., Absubong, P.K., Zhou, Q., Zhou, Y.Y., Liu, W.B.,
2018. Effects of partial replacement of fish meal by yeast hydrolysate on antioxidant
capability, intestinal morphology, and inflammation-related gene expression of
juvenile Jian carp (Cyprinus carpio var. Jian). Fish Physiol. Biochem. 42, 689–700.
https://doi.org/10.1007/s10695-018-0552-7.
Zhang, T., Xia, M., Zhan, Q., Zhou, Q.Y., Lu, G.M., An, F.M., 2015. Sodium butyrate
reduces organ injuries in mice with severe acute pancreatitis through inhibiting
HMGB1 expression. Digest. Dis. Sci. 60 (7), 1991–1999. https://doi.org/10.1007/
s10620-015-3586-z.
Zhao, J., Liu, L.G., Chen, X.L., Qing, N., Dong, C.W., 2004. Karyotypic analysis of the
multiple tetraploid allogynogenetic Pengze crucian carp and its parents. Aquaculture
237 (1–4), 117–129. https://doi.org/10.1016/j.aquaculture.2004.05.001.
Zhao, B., Feng, L., Liu, Y., Kuang, S.Y., Tang, L., Jiang, J., Zhou, X.Q., 2012. Effects of
dietary histidine levels on growth performance, body composition and intestinal
enzymes activities of juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Nutr. 18
(2), 220–232. https://doi.org/10.1111/j.1365-2095.2011.00898.x.
Zhou, J.S., Guo, P., Yu, H.B., Ji, H., Lai, Z.W., Chen, Y.A., 2019. Growth performance,
lipid metabolism, and health status of grass carp (Ctenopharyngodon idella) fed three
different forms of sodium butyrate. Fish Physiol. Biochem. 45 (1), 287–298. https://
doi.org/10.1007/s10695-018-0561-6.
Zhu, Y., Luo, T.M., Jobin, C., Young, H.A., 2011. Gut microbiota and probiotics in colon
tumorigenesis. Cancer Lett. 309 (2), 119–127. https://doi.org/10.1016/j.
canlet.2011.06.004.