Gum Arabic-enriched diet modulates

growth, antioxidant defenses, innate

immune response, intestinal microbiota
and immune related genes expression
in tilapia fish Mohammed A.E. Naiel
Visit to download the full and correct content document:
https://ebookmass.com/product/gum-arabic-enriched-diet-modulates-growth-antioxida
nt-defenses-innate-immune-response-intestinal-microbiota-and-immune-related-gene
s-expression-in-tilapia-fish-mohammed-a-e-naiel/
 Aquaculture 556 (2022) 738249

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Gum Arabic-enriched diet modulates growth, antioxidant defenses, innate

immune response, intestinal microbiota and immune related genes
expression in tilapia fish
Mohammed A.E. Naiel a, *, Samah A.A. Abd El-hameed b, Ahmed H. Arisha d, e, Samar S. Negm c
a
Department of Animal Production, Faculty of Agriculture, Zagazig University, Zagazig 44519, Egypt.
b
Fish Health and Diseases Department, Central Lab for Aquaculture Research, Abbassa, Abu Hammad, Agriculture Research Center, Giza, Egypt
c
Fish Biology and Ecology Department, Central Lab for Aquaculture Research, Abbassa, Abu Hammad, Agriculture Research Center, Giza, Egypt
d
Department of Animal Physiology and Biochemistry, Faculty of Veterinary Medicine, Badr University in Cairo (BUC), Badr City, Cairo, Egypt
e
Department of Physiology, Faculty of Veterinary Medicine, Zagazig University, 44519 Zagazig, Egypt

A R T I C L E I N F O A B S T R A C T

Keywords: This study was designed to assess the influence of dietary supplementation with Gum Arabic at various levels in
Gum Arabic Nile tilapia fish, Oreochromis niloticus. For 56 days feeding period, a total of 200 juvenile fish were allocated into
Hematology 20 aquariums and divided into four equal groups, five replicates each, with Gum Arabic (GA) dietary inclusion as
Antioxidant
follow; the fish group was given a basal diet (CTR 0%); fish group fed a diet supplemented with GA 0.25%; fish
Innate immunity
group fed a diet supplemented with GA 0.5%; and fish group fed a diet supplemented with GA 1%. Dietary
Intestinal microbiota
supplementation with 0.5 or 1% GA significantly improves final fish biomass, weight gain, weight gain percent,
consumed feed, feed conversion ratio, innate immune response and antioxidant status compared to other
treatments. The fish fed elevated levels of GA (1% GA) exhibited higher lipase and amylase activities as well as
total protein, albumin, and globulin levels and lower uric acid, AST, and ALT levels. Furthermore, 1% GA
enriched tilapia diets significantly up-regulated IL-1β and IL10, whereas downregulated TNFɑ mRNA expression
in kidney and spleen tissues. Moreover, highly-AG enriched diets were associated with stronger antibacterial
efficacy against pathogenic bacterial populations, together with increased counts of grown Bacillus in the mid
gut. Overall, these findings suggest that dietary inclusion of 1% GA could be beneficial and should be explored as
a functional feed supplement for Nile tilapia farming.

1. Introduction 2021d). Thus, promoting fish immunological and antioxidant activity is

Worldwide, tilapia is ranked the second-largest farmed cichlid
aquatic species, behind only carp (Negm et al., 2021). Regarding FAO
global production statistics, total cultured Nile tilapia output accounted
for 71.2% of all cultivated fish species (FAO, 2018). Compared with
traditional culture systems, the intensive culture system is known for
higher stocking rates, feed input levels, and management techniques
(Soliman and Yacout, 2016). Meanwhile, the elevated stocking density
of reared farmed fish induced significant stress and suppressed fish
immunological and antioxidant activity leading to increased fish sus­
ceptibility to pathogenic infection (Alam et al., 2021; Raz et al., 2021).
Until now, antibiotics have been supplemented to prevent infection in
cultured fish, although expensive, difficult to apply on a wide scale, and
threaten the aquatic environment and consumer health (Naiel et al.,
a very safe and beneficial approach for eliminating stress and conse­
quently limits the development of any infectious diseases (Abdelghany
et al., 2020; Naiel et al., 2020).
Several recent studies have proven that many herbs might be
incorporated into fish diets, act as immunostimulants and possess anti­
bacterial properties (Shafique et al., 2021). Moreover, many herbs and
their bioactive molecules indicated numerous favorable impacts on fish
performance, production, innate immune responses, antioxidant activity
against pathogens or environmental stressors such as turmeric (Curcuma
longa) (Abd El-Hakim et al., 2020); lemongrass (Cymbopogon citratus)
(Al-Sagheer et al., 2018), Moringa oleifera (Zhang et al., 2020), rosemary
(Rosmarinus officinale) (Naiel et al., 2019), Eruca sativa (Ibrahim et al.,
2019), thyme (Thymus vulgaries) (Abd El-Naby et al., 2020; Alagawany
et al., 2021).

* Corresponding author.
E-mail address: mohammednaiel.1984@gmail.com (M.A.E. Naiel).

https://doi.org/10.1016/j.aquaculture.2022.738249
Received 22 January 2022; Received in revised form 14 March 2022; Accepted 8 April 2022
Available online 13 April 2022
0044-8486/© 2022 Elsevier B.V. All rights reserved.
M.A.E. Naiel et al. Aquaculture 556 (2022) 738249

Haemato-biochemical indices, antioxidant defenses, and intestinal Table 1

microbial population are the leading indicators of general fish health Ingredient and chemical composition of the experimental diet (%).
status in farmed fish (Naiel et al., 2021a). Remarkably, a significant link Ingredient Experimental diet (%)
was suggested between enriching fish diets with several types of herbs or
CTR GA0.25% GA0.5% GA1%
their bioactive molecules and boosting haemato-biochemical indices,
antioxidant activity, and immunological responses against pathogens Fish meal 14.5 14.5 14.5 14.5
Soybean meal 48.58 48.58 48.58 48.58
(Abd El-hameed et al., 2021; Naiel et al., 2021b). Some natural com­ Corn flour 29 28.75 28.5 28
pounds, such as aloe, roots, and propolis, have also been exhibited to be Vegetable oil 4 4 4 4
effective immunostimulants in cultured fish (Libanori et al., 2021). Vitamin & mineral premixa 1 1 1 1
Gum arabic (GA) is the gum secreted by some trees, such as the Limestone 1 1 1 1
L-Tryptophan 0.2 0.2 0.2 0.2
Acacia senegal or Sengalia Senegal (Bakhoum et al., 2018). Also, GA is an
L-Lysine HCl 0.2 0.2 0.2 0.2
important natural molecule that possesses powerful immunostimula­ DL-Methionine 1 1 1 1
tory, antioxidant activities and anti-inflammatory properties in mam­ Antioxidant (BHT)b 0.02 0.02 0.02 0.02
mals (Fouda et al., 2019). To the best of our knowledge, there is no Sodium chloride 0.5 0.5 0.5 0.5
scientific evidence on the possible use of GA dietary supplementation in Gum Arabic (GA) 0.0 0.25 0.5 1
Total 100 100 100 100
farmed tilapia fish. Thus, this feeding trial was conducted to evaluate the
expected beneficial impacts of dietary supplemented GA on Nile tilapia
Proximate composition (%)
production and health as well as the GA effects on blood haemato-
Dry matter 93.1 93.6 92.9 93.3
biochemical indices, antioxidant activity, innate immune responses Crude Protein 32.5 31.9 32.1 32.0
and intestinal microbial modulation in farmed tilapia fish Crude Lipid 8.9 9.4 9.35 9.7
Crude Fiber 6.95 6.81 6.84 6.78
2. Material and methods Ash 11.7 11.8 11.65 11.4
NFEc (%) 46.85 46.49 47.16 46.82
Gross Energyd (kJ g− 1) 508.25 510.01 510.04 511.76
2.1. Experimental design and rearing managements
a
Premix Composition (level per each kg of product): folic acid, 370 mg;
pantothenic acid, 3900 mg; biotin, 40 mg; copper, 740 mg; choline, 75 g; iron,
Two hundred apparent healthy Nile tilapia (Oreochromis niloticus)
7500 mg; inositol 10 g; iodine, 43 mg; manganese, 7600 mg; niacin, 8800 mg;
juveniles (22.4 ± 0.28) g were obtained from a private hatchery in Small
selenium, 38 mg; vitamin A, 780,000 IU; vitamin B1, 1400 mg; vitamin B12,
Abbassa and transported using air-bags to the indoor wet Lab., which is
1900 μg; vitamin B2, 1450 mg; vitamin B6, 1400 μg; vitamin C, 19.5 g; vitamin
part of the Fish Health and Diseases Department, Central Laboratory for D3, 160,000 IU; vitamin E, 14,800 IU; vitamin K3, 480 mg; zinc 1400 mg.
Aquaculture Research (CLAR), and maintained in a fiberglass tank for b
Butylated hydroxytoluene.
two weeks for acclimation to laboratory conditions. Fish were randomly c
Nitrogen free extract (NFE) = 100 – (crude protein + moisture+ crude lip­
assigned into four equal groups in twenty glass aquaria (five replicates ids+ ash + crude fiber).
d
for each group) at the rate of 10 fish per 120 L. All aquaria were sup­ Calculated using the factors 5.64 kcal 100 g-1, 9.45 kcal 100 g-1, and 4.11
plemented with compressed air via air stones and aquarium air pumps. kcal 100 g-1protein, fat and carbohydrate, respectively.
During the acclimation period, fish were fed on a formulated basal diet
with no supplementation at a rate of 3% of the biomass, which was for protein, lipid and carbohydrate as 23.6, 39.5 and 17.2 Kcal/g,
provided equal rations at 09:00 h and 17:00 h to adapt to the prepared respectively, as presented in Table 1. All analyses are performed in five
diet and the trial conditions. replicates.
For 8 weeks, a basic diet was offered to tilapia fish (Table 1); the
formulated basal diet was considered as a control diet and to prepare
2.3. Growth performance and utilization of feeds
experimental diets, the basal formulation was supplemented with vari­
able levels of GA as follow; CTR; the fish group fed on the commercial
During eight weeks, experimental diets were provided twice daily
basal diet without any supplements,
(9.00 and 17.00 h) until apparent satiation. The satiation level was
GA 0.25%; the fish group fed fortified diet with 0.25% Gum Arabic,
confirmed based on apparent visual satiety. Feed was carefully supplied,
GA 0.5%; the fish group fed fortified diet with 0.5% Gum Arabic,
ensuring that no feed remained on the aquarium bottom. Unconsumed
GA 1%; the fish group fed fortified diet with 1% Gum Arabic.
feed was siphoned carefully from each aquarium for 30 min after begin
Throughout the experiment, water was replaced (50%) with clean,
of feeding at each meal every day. Once we measured the dried mass of
and well-aerated water in daily manner and water quality indices were
siphoned food, we deducted it from total feed consumption (FC) to
monitored weekly. Water quality parameters were adjusted to meet the
calculate actual feed intake. In all experimental groups, feed allowance
needs of the fish as described by Boyd and Tucker (2012) (27.2–29.8 ◦ C
of fish was re-adjusted every day according to the feed intake of fish in
water temperature, 7.89 ± 0.46 mg/L for dissolved oxygen (DO),
the control group the previous day. Moreover, the survived fish were
7.98–8.39 for the pH value, and 0.11 ± 0.03 mg/L for un-ionized
weighed every two weeks for estimating consumed diets and calculated
ammonia).
growth. The growth, efficiency of feeds, and survival rate of tilapia ju­
veniles were estimated at the end of the feeding trial using the following
2.2. Processed diets and their chemical analysis
formulas:
Gum Arabic (GA) was obtained from a local market. Before adding a Weight gain (WG) = W2 − W1
suitable quantity of water to the mixture, the raw ingredients were
properly blended with the tested levels of additives. Pelletizing the Weight gain percent, WGP (%) = 100 x (WG/IW)
prepared diets was accomplished using a pellet mill grinder.
While, the chemical analysis of diet samples have been estimated and where W1 and W2 are the initial weight and final biomass, respectively.
calculated moisture, dry matter, crude protein, crude fat, and ash con­
tent using Thiex et al. (2012) standard methods. The nitrogen-free FI
Total Feed intake, TFI (g feed/fish) =
extract (NFE) was determined statically using the following formula; n
NFE (g kg− 1) = 1000 – (crude protein + crude lipids+ ash + crude fiber). where, FI is the consumed diets during the feeding trial and n is the
Moreover, the gross energy (GE) was calculated based on the values total fish number.

2
M.A.E. Naiel et al.
TFI
Feed conversion ratio, FCR =
WG
crude protein
Protein intake, PI = TFI ×
fish number
Protein efficiency rate, PER = WG ÷ PI
Survival, SR (%) = (final survived fish number / initial fish number)
x 100.
2.4. Blood and tissue sampling
At the end of the experiment, three fish were randomly sampled from
each aquarium (15 per treatment) and anesthetized with 120 mg/L
amino-benzoic acid (Sigma–Aldrich). Blood samples were collected
from caudal vein using sterile syringe contain small amount of dipo­
tassium salt of EDTA. The collected blood samples were directly
centrifuged at 1500 xg for 15 min to obtain plasma. The plasma was
stored at − 4 ◦ C for further biochemical, antioxidant and immunity pa­
rameters analysis. Also, kidney and spleens were collected and kept at
− 80 ◦ C until the extraction of total RNA for gene expression. Finally, the
midguts of three fish from each group were randomly selected for bac­
terial population detection.
2.5. Blood hematological parameters
Fresh blood samples were used to assess hemoglobin (Hb) concen­
tration u a commercial kit (Diamond Diagnostic, Egypt). A manual
method was applied for counting total erythrocyte (RBCs) and leuko­
cytes (WBCs) immediately with a hemocytometer after dilution using
Natt and Herrick’s solution (Maxham et al., 2016). Hematocrit (Ht %)
was determined by the microhematocrit method described by Golden­
farb et al. (1971) and RBC, Ht, and Hb values were used to calculate the
red cell indices such as mean corpuscular volume (MCV), mean
corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin
concentration (MCHC) according to Sarma (1990) formulas:
( ) / ( ) mg) were directly homogenized with the Eastep® Super Total RNA
MCV μm3 cell− 1 = Ht (v/v ratio) x 1000 RBC 106 cell μl− 1
( ) ( ) / ( ) RNA contamination, 2 μL of extracted RNA (10 mg/ml, Fermentas) was
MCH pg cell− 1 = Hb g dl− 1 x 10 RBC 106 cell μl− 1
( )/
MCHC = Hb g dl− 1 Ht (v/v ratio)
2.6. Blood biochemical analysis
Biochemical parameters such as total protein (TP) and albumin
(ALB) in the blood were measured using a colorimetrical procedure with
a spectrophotometer (Opti Zen POP UV/VIS). At the same time, globulin
(GB) was calculated mathematically by subtracting the albumin value
from the total protein value. Also, Spectrophotometric estimation of
parameters related to kidney function such as creatinine (CR) and uric
acid (UA) was performed using special commercial kits (BioMed, diag­
nostic, Egypt) in accordance with the Folin and Wu (1919) protocol.
Commercial kits (ALT or AST Assay Kit, ABACM241035) have evaluated
liver enzyme activities such as ALT and AST, as designated by Wilkinson
et al. (1972).
2.7. Blood digestive enzymes assays
Amylase and lipase activities were quantified spectrophotometri­
cally at A540 and A714 wave-lengths as described by Wang et al. (2019).
Where, protease activity was estimated using casein as a substrate
following the assay of Sigma’s non-specific protease activity (Cupp-
Enyard, 2008).
3
Aquaculture 556 (2022) 738249
2.8. Immunological assays
Ai (1990) procedure was used to estimate the plasma lysozyme level
using microwell plates. The fish complement 3 (C3) (ELISA) Kits (My-
BioSource Co., USA, No: MBS1601750) had been applied for estimating
COMPC3 levels as illustrated by manual guidelines. The immunoglob­
ulin M (IgM) and immunoglobulin A (IgA) were measured calorimetri­
cally according to Granfors (1979) procedure using Fish
immunoglobulin (ELISA) kits (Cusabio, Bio-tech Co., Ltd., Wuhan,
China, No: MBS282651).
Blood antioxidant defenses The antioxidant activities were detected
using specific colorimetric kits obtained from Bio-diagnostic Co., Cairo,
Egypt, following Nishikimi et al. (1972) for superoxide dismutase (SOD),
Aebi (1984) for catalase (CAT), Beutler (1963) for glutathione peroxi­
dase (GSH) and Draper and Hadley (1990) for the lipid peroxidation
marker; malonaldehyde (MDA) detection.
2.9. Intestinal microbial estimation
Preparation of the media and bacterial isolation were done according
to Esakkiraj et al. (2009) procedure. Sterilization of the media was done
by autoclaving at 121 ◦ C for 15 min. One gram of midgut content was
diluted in 9 mL of 0.85% sterile sodium chloride (w/v) and was then
vortexed. Ten-fold serial dilutions were carried out for bacterial detec­
tion. Afterward, 0.1 mL aliquot was cultured on nutrient agar (Lab M,
Lancashire, UK) according to the plate count method for aerobic colony
counting. The same method and media were used for anaerobic but
under anaerobic conditions (candle jar). Also, 0.1 mL aliquots were
cultured on MRS agar for Bacillus, Muller and Hinton for Pseudomonas,
MacConkey agar for coliform and EMB agar for E. coli counts. All sam­
ples were incubated at 37 ◦ C for 24–48 h and counts were expressed as
log cfu/g as described by Al-Harbi and Uddin (2005) and Espírito Santo
et al. (2007).
2.10. RNA extraction and cDNA synthesis
For total RNA extraction, the spleen and kidney tissue samples (30
Extraction Kit (Promega, Shanghai, China; Cat. No. LS1040). To avoid
blended with 20 μL of DNA before being dissolved in TE buffer
(Tris–EDTA, pH = 8.0) then incubated at 37 ◦ C for 3–4 h. The quality of
extracted RNA was evaluated using gel electrophoresis (contains 1.5%
agarose gel) and the A260/280 absorbance ratio on a Nano-Drop 2000
(Thermo Scientific, USA). Then, Reverse transcription of 1 g of total RNA
using GoScriptTM Reverse Transcription Mix (Promega, Shanghai,
China; Cat. No. LS2054) was performed following the manufacturer’s
protocol.
2.11. Quantitative real-time PCR
The primer sequences for interleukin-1β (IL-1β), tumor necrosis
factor-α (TNF-α), and interleukin-10 (IL-10) are illustrated in Table 2
(Abu Zeid et al., 2021). Briefly, the total reaction volume (20 μL) con­
taining 10 μL of 2 Go Taq® qPCR Master Mix, 2 μL of cDNA, 0.4 μL of
each forward and reverse primer and 7.2 μL of nuclease-free water. The
following qRT-PCR thermocycling limits were applied: 95 ◦ C for 2 min,
then 40 cycles of 95 ◦ C for 15 s., 60 ◦ C for 1 min, followed by melting
phase was from 60 ◦ C to 95 ◦ C. Each real-time PCR reaction (including
cDNA synthesis) was repeated three times to approve the accuracy of the
obtained results. The GAPDH gene was applied as an endogenic refer­
ence to quantify the relative mRNA transcription levels. The product’s
dissociation curve analysis and agarose gel electrophoresis were used to
confirm the q-RT-PCR technique. The relative gene-transcription levels
were estimated using the 2ʌʌCt formula after determining the threshold
cycle (Ct) values for each examined sample (Livak and Schmittgen,
M.A.E. Naiel et al. Aquaculture 556 (2022) 738249

Table 2
The sequence of primers designed to detect target genes using real time PCR technique.
Primer Sequence Size (bp) Accession no.

Forward Reverse

GAPDH CCGATGTGTCAGTGGTGGAT GCCTTCTTGACGGCTTCCTT 82 NM_001279552.1

TNFɑ CCAGAAGCACTAAAGGCGAAGA CCTTGGCTTTGCTGCTGATC 82 NM_001279533.1
IL1β TGGTGACTCTCCTGGTCTGA GCACAACTTTATCGGCTTCCA 86 XM_005457887.3
IL10 CTGCTAGATCAGTCCGTCGAA GCAGAACCGTGTCCAGGTAA 94 XM_013269189.3

2001).
2.12. Statistical procedures
The calculated and collected data were firstly tested for normality
and homogeneity followed by one-way analysis of variance (ANOVA)
followed by tukey post hoc test to identify whether the estimated mea­
surements were significantly influenced by GA levels in fish diets. P <
0.05 was considered significant. The data are illustrated in tables and
figures as mean ± SE.
3. Results
3.1. Performance indices
0.5 or 1% GA-enriched fish diets with presented higher performance
in terms of final biomass (p value: <0.001), weight gain (p value:
<0.001), weight gain percent (p value: <0.001), compared to the fish
group fed GA free diet (Table 3). Compared to the control group, the fish
group fed diets supplemented with GA 0.5 or 1% showed a significant (p
value: <0.001) decrease in consumed feed, feed conversion ratio, pro­
tein intake, and protein efficiency ratio. During the feeding trial period,
no mortality in either of the experimental groups was noticed.
3.2. Hematological measurements
Fish supplemented diets fortified with GA 1% showed a greater
increase in hemoglobin and WBCs levels than the other treatment
groups, followed by the fish fed diets supplemented with GA 0.5%. In
addition, fish supplemented with GA 1% presented a higher MCV, MCH
and MCHC levels (p value: 0.001, 0.014 and 0.039, respectively) than
those fed with the concentration of GA 0.25 or 0.5% (Table 4). On the
other hand, feed supplements had no effect on RBC and hematocrit
levels.
3.3. Biochemical parameters
Supplementation with different levels of Gum Arabic significantly
improved the blood biochemical parameters of tilapia fish (Table 5). The
fish group fed enriched diets with GA 1% exhibited higher total protein,
albumin and globulin values than the control group. Also, dietary in­
clusion of GA 1% within fish feed showed a significant decrease of uric
acid, AST, and ALT concentrations compared with the fish group fed
free-GA diet. Meanwhile, the dietary supplementation of various
amounts of GA did not alter the blood creatinine level.
3.4. Digestive enzymes
The analysis of digestive enzymes indicated that increasing the
amount of GA in fish feed remarkably improved lipase and amylase
activity (p values: 0.023 and 0.001, respectively), but did not affect
protease levels (Table 6). The fish group fed the diet supplemented with
GA 1% reported the highest levels of lipase and amylase followed by GA
0.5 fish group then GA 0.25% fish group.

Table 3
Growth performance, feed efficiency and survival rate of Nile tilapia fish fed on
diets containing several levels of Gum Arabic for 56 days.
Table 4
Parameters Treatments P value Blood hematological parameters of Nile tilapia fish fed on diets containing
CTR GA0.25% GA0.5% GA1% several levels of Gum Arabic for 56 days.
22.39 ± 22.42 ± 22.42 ± 22.43 ± Parameters Treatments P value
IW (g) 0.720
0.24 0.13 0.22 0.12
CTR GA0.25% GA0.5% GA1%
58.63 ± 60.46 ± 63.21 ± 65.09 ±
FW (g) <0.001
0.20b 0.58b 0.48a 0.57a RBCs (106 x 3.01 ± 2.93 ± 2.94 ± 2.97 ±
0.932
36.24 ± 38.04 ± 40.79 ± 42.65 ± μL) 0.07 0.12 0.05 0.10
WG (g) <0.001
0.19b 0.60b 0.46a 0.57a WBCs (104 x 2.98 ± 3.57 ± 4.79 ± 5.42 ±
<0.001
51.19 ± 48.94 ± 45.65 ± 43.49 ± μL) 0.07d 0.04c 0.17b 0.13a
FI (g) <0.001
0.68a 0.55a 0.72b 0.22b 5.86 ± 6.86 ± 7.13 ± 8.03 ±
Hb (g/dL) <0.001
161.9 ± 169.7 ± 181.9 ± 190.1 ± 0.14c 0.29b 0.07b 0.09a
WGP (%) <0.001
0.77b 2.87b 1.96a 2.55a 26.59 ± 28.27 ± 28.81 ± 28.93 ±
HT% 0.223
1.41 ± 1.28 ± 1.12 ± 1.02 ± 0.88 1.02 0.43 0.74
FCR (g/g) <0.001
0.02a 0.03b 0.03c 0.02c 0.88 ± 0.96 ± 0.98 ± 0.97 ±
MCV (fL) 0.001
15.35 ± 14.68 ± 13.69 ± 13.049 ± 0.02b 0.01a 0.01a 0.01a
PI (g) <0.001
0.20a 0.16a 0.21b 0.07b 1.95 ± 2.35 ± 2.42 ± 2.71 ±
MCH (g/dL) 0.014
0.42 ± 0.39 ± 0.34 ± 0.31 ± 0.04b 0.21ab 0.02ab 0.11a
PER (g/g) <0.001
0.001a 0.01b 0.001c 0.001c MCHC (g 22.08 ± 24.41 ± 24.75 ± 27.81 ±
0.039
SR (%) 100 100 100 100 0.365 dl− 1) 0.31b 1.96ab 0.14ab 0.96a

CTR, control group fed basal diet; GA0.25%, fish group fed enriched diets with
0.25% Gum Arabic; GA0. 5%, fish group fed enriched diets with 0.5% Gum
Arabic; GA1%, fish group fed enriched diets with 1% Gum Arabic.
IW, initial weight (g); FW, final weight (g); WG, weight gain (g); FI, feed intake
(g); WGP %, weight gain percentage; FCR, Feed conversion ratio (g/g); PI,
Protein intake; PER, Protein efficiency rate; SR, survival rate.
Different superscript letters at the same raw indicate the significance of exper­
imental groups (p ˂0.05). All data were presented as the mean ± standard error.
CTR, control group fed basal diet; GA0.25%, fish group fed enriched diets with
0.25% Gum Arabic; GA0. 5%, fish group fed enriched diets with 0.5% Gum
Arabic; GA1%, fish group fed enriched diets with 1% Gum Arabic.
RBCs, Red blood cell; WBCs, White blood cell; Hb, Hemoglobin; HT, Hematocrit;
MCV: Mean corpuscular of red blood cells; MCH, Mean corpuscular hemoglobin
values and MCHC, Mean Corpuscular Hemoglobin Concentration.
Different superscript letters at the same raw indicate the significance of exper­
imental groups (p ˂0.05). All data were presented as the mean ± standard error.

4
M.A.E. Naiel et al. Aquaculture 556 (2022) 738249

Table 5 Table 7
Blood biochemical parameters of Nile tilapia fed on diets containing several Antioxidative defenses and non-specific immune activities of Nile tilapia fish fed
levels of Gum Arabic for 56 days. on diets supplemented with graded levels of Gum Arabic for 56 days.
Parameters Treatments P value Parameters Treatments P value

CTR GA0.25% GA0.5% GA1% CTR GA0.25% GA0.5% GA1%

4.14 ± 5.27 ± 6.50 ± 7.72 ± Innate immune responses

TP (g/dL) <0.001
0.04d 0.30c 0.10b 0.24a 1.23 ± 2.02 ± 2.90 ± 3.29 ±
LYZ (μg/mL) <0.001
2.84 ± 3.12 ± 4.27 ± 4.95 ± 0.14c 0.04b 0.10a 0.12a
ALB (g/dL) <0.001
0.05c 0.36c 0.11b 0.51a COMP C3 (U/ 3.38 ± 3.82 ± 4.35 ± 5.15 ±
<0.001
GLOB (g/ 1.30 ± 2.15 ± 2.23 ± 2.77 ± mL) 0.05d 0.08c 0.11b 0.09a
<0.001
dL) 0.09b 0.48b 0.15b 0.26a 3.09 ± 2.67 ± 3.63 ± 4.56 ±
IgM (ug/dL) <0.001
2.26 ± 2.23 ± 1.43 ± 1.16 ± 0.04c 0.11c 0.07b 0.15a
UA (mg/L) 0.005
0.47a 0.09ab 0.34bc 0.02c 2.86 ± 1.65 ± 3.11 ± 3.74 ±
IgA (ug/dL) <0.001
0.26 ± 0.27 ± 0.24 ± 0.23 ± 0.05b 0.08c 0.06b 0.07a
CR (mg/L) 0.587
0.03 0.02 0.03 0.01
14.47 ± 13.46 ± 13.39 ± 12.77 ±
AST (IU/L) <0.001 Antioxidant defense markers and lipid peroxidation
0.17a 0.16b 0.15b 0.12b
MDA (nmol/ 7.99 ± 6.94 ± 4.10 ± 4.87 ±
46.89 ± 42.14 ± 38.11 ± 34.67 ± <0.001
ALT (IU/L) <0.001 mL) 0.15a 0.05b 0.07d 0.13c
0.60a 0.08b 0.08c 0.32d
GSH (nmol/ 12.38 ± 12.28 ± 13.68 ± 14.37 ±
0.001
CTR, control group fed basal diet; GA0.25%, fish group fed enriched diets with mL) 0.21b 0.30b 0.25a 0.17a
0.25% Gum Arabic; GA0. 5%, fish group fed enriched diets with 0.5% Gum 95.04 ± 102.18 ± 182.4 ± 249.09 ±
CAT (U/L) <0.001
Arabic; GA1%, fish group fed enriched diets with 1% Gum Arabic. 4.89c 1.16c 2.16b 0.57a
14.01 ± 14.40 ± 15.75 ± 34.99 ±
TP, total protein; ALB, albumin; GLOB, globulin; UA, uric acid; CR, creatinine; SOD (U/L) <0.001
1.46b 1.19b 0.61b 0.82a
AST, Aspartate aminotransferase ALT, alanine aminotransferase.
Different superscript letters at the same raw indicate the significance of exper­ CTR, control group fed basal diet; GA0.25%, fish group fed enriched diets with
imental groups (p ˂0.05). All data were presented as the mean ± standard error. 0.25% Gum arabic; GA0. 5%, fish group fed enriched diets with 0.5% Gum arabic;
GA1%, fish group fed enriched diets with 1% Gum arabic.
LYZ, lysozyme; COMP C3, complement C3; IgM, immunoglobulin M; IgA,
Table 6 immunoglobulin M; MDA, malonaldehyde; GSH, glutathione; CAT, catalase;
Blood digestive enzymes of Nile tilapia fed on diets containing several levels of SOD, super oxide dismutase.
Gum Arabic for 56 days. Different superscript letters at the same raw indicate the significance of exper­
Parameters Treatments P value
imental groups (p ˂0.05). All data were presented as the mean ± standard error.

CTR GA0.25% GA0.5% GA1%

3.7. Microbiota biodiversity
15.76 ± 16.13 ± 16.06 ± 22.53 ±
Lipase (U/L) 0.023
0.79b 1.02b 0.84b 2.31a
42.53 ± 67.68 ± 84.17 ± 99.56 ±
concerning the total counts of aerobic (TABC) and anaerobic bacte­
Amylase (U/L) <0.001 rial (TAnBC), the fish group supplemented with a diet fortified with a
5.21c 5.33b 6.92ab 0.60a
Protease (ng 20.67 ± 20.24 ± 20.36 ± 20.56 ± high level of GA (GA 1%) had greater antibacterial properties against
0.966
dl− 1) 0.51 0.59 0.68 0.81 both intestinal TABC and TAnBC counts when compared to the other
CTR, control group fed basal diet; GA0.25%, fish group fed enriched diets with treatments (Fig. 3). Furthermore, the fish groups supplemented with GA
0.25% Gum Arabic; GA0. 5%, fish group fed enriched diets with 0.5% Gum 0.5% and GA 1% showed a greater potential to promote Bacillus spp.
Arabic; GA1%, fish group fed enriched diets with 1% Gum Arabic. growth when compared with other treatments (Fig. 3). In contrast, fish
Different superscript letters at the same raw indicate the significance of exper­ treated with Gum Arabic at either 0.5 and 1% lowered the coliform, E.
imental groups (p ˂0.05). All data were presented as the mean ± standard error. coli, Pseudomonas spp., and Aeromonas spp. counts in mid intestine
samples compared to the control group.
3.5. Blood antioxidant defenses, lipid peroxidation and non-specific
immune responses 4. Discussion

A significant increase in GSH, CAT, and SOD levels were reported in
fish groups given 1% GA when compared to the control group. However,
GA feeding in fish diets significantly decreased MDA levels compared to
the control group (Table 7). With respect to immunological parameters,
the highest concentration of GA in fish diets (0.5 or 1%) significantly
improved all innate immunity parameters levels (lysozyme, COMPC3,
IgM and IgA) (Table 7). Furthermore, the maximum lysozyme, COMPC3,
IgM, and IgA concentrations were found mainly in the GA 1% supple­
mented group.
3.6. Immune-related genes transcription
In reference to the fold change values of immune-related genes
transcription in both spleen and kidney tissues, fortified tilapia diets
with graded levels of GA showed up-regulated the mRNA expression of
both IL-1β and IL-10 genes, but not TNF-a, as shown (Figs. 1 and 2). The
fish group fed diets supplemented with GA 1% exhibited elevated IL-1β
and IL-10, but not TNF-a, mRNA expression, compared with the other
treatments.
Growth performance and feed utilization parameters are essential
indicators of fish health and productivity. According to our feeding trial
results, tilapia fish diets supplemented with 0.5 or 1% GA had the best
growth performance indices in terms of feed intake, feed conversion,
final biomass, weight gain, and specific growth rates, when compared to
the control group, which was found to be consistent with previous
research findings using various prebiotics or natural products. For
instance, El-faki (2016) exhibited that tilapia fish fed diet supplemented
with 3% GA had better performance and feed efficiency measurements
but still had a lower survival rate than the un-supplemented fish group.
Also, Faggio et al. (2015) reported that fed Mugil Cephalus supplemented
diets with 12% GA had no adverse effects on growth compared with the
control group. Differences in fish growth response to varied GA con­
centrations may be attributed to supplemented form, fish feeding hab­
itats, fish species, or rearing conditions.
Besides, GA could be categorized as a natural prebiotic source
(Calame et al., 2008). Prebiotics contains fibers and natural simple
structure sugars that boost the performance and encourage the devel­
opment of beneficial bacterium within the intestinal microbiota partic­
ularly probiotic bacteria (Naiel et al., 2021c). Also, GA contains neutral

5
M.A.E. Naiel et al. Aquaculture 556 (2022) 738249

Fig. 1. Influences of supplemented tilapia diets with graded levels of Gum arabic (0.0, 0.25, 0.5 or 1%) for 56 days on mRNA expression folds of kidney (a) TNF-2a
(Tumor necrosis factor-2a), (b) IL-1β (interleukin 1β) and (c) IL-10 (interleukin 10) genes. The different letters were applied to identify the significant differences (p <
0.05) between the experimental treatments.

Fig. 2. Influences of supplemented tilapia diets with graded levels of Gum arabic (0.0, 0.25, 0.5 or 1%) for 56 days on mRNA expression folds of spleen TNF-2a
(Tumor necrosis factor-2a), IL-1β (interleukin 1β) and IL-10 (interleukin 10) genes. The different letters were applied to identify the significant differences (p < 0.05)
between the experimental treatments.

sugars (rhamnose, arabinose, and galactose), glucuronic acid, poly­
saccharides and minerals responsible for performance stimulation
through the development of beneficial bacteria (Al-Baadani et al.,
2021). Previous reports showed that GA acts as a prebiotic when sup­
plemented to diets, boosting growth and stimulating digestive tract
secretion and intestinal health status by interacting with the tract
epithelium, mucus, and tract microbiota (Hu et al., 2014; Celi et al.,
2018; Xia et al., 2020). Therefore, enriched diets with GA might enhance
digestive tract functioning (Calame et al., 2008). Also, GA is a well-
tolerated dietary fiber with bifidogenic characteristics that improve
gut health against enteric infections (Cherbut et al., 2003).
Moreover, the fish group fed a high concentration of GA (1%)
significantly increased blood lipase and amylase, indicating elevated
secretion in the gastrointestinal tract. Rather of being degraded into
their main constituent in the intestines, the entero-pancreatic enzyme
might be re-cycled by being absorbed into the blood, re-accumulated by
the pancreas, and re-utilized (Rothman et al., 2002). Thus, it was shown
that there is a strong correlation between high blood levels of digestive
enzymes and high levels of digestive enzymes in the digestive tract.
These results were similar to Nasif et al. (2011) findings that gum
combined with aspirin caused a remarkedly increase in intestinal
amylase, lipase secretions compared with the control group in rats. Such
an increase in digestive enzyme secretions in addition to the various
beneficial characteristics of GA to the intestinal mucosal layers, leads to
the inhibition of the growth of harmful microorganisms, therefore
improving gastrointestinal digestive properties (Abd El-Mawla and
Osman, 2011).
Blood hematological parameters are essential for evaluating diet
quality, general health status, aquatic environment toxicity, and disease
diagnosis (Ismael et al., 2021). Among the blood parameters measured,
hemoglobin MCV, MCH, and MCHC values were significantly improved
when the level of GA in the diet was increased (up to 1% GA). Similar
results were reported by Francesco et al. (2012) in mullets and
Satheeshkumar et al. (2012) on wild marine teleost fish. While, Faggio
et al. (2015) indicated that when 12% GA-pellets were supplemented to
mullet fish for a short period of time, no significant change in WBC levels
was observed. This study discovered that not only the amount of GA
supplemented in the feeding diet, but also the period of supplementation

6
M.A.E. Naiel et al.
Fig. 3. Effects of enriched tilapia diets with several level of Gum arabic (0.0, 0.25, 0.5 or 1%) for 56 days feeding trial on mid intestinal aerobic (TABC), anaerobic
bacterial (TAnBC), Bacillus spp, coliform, E. coli, Pseudomonas spp and Aeromonas spp counts. All of the data that was represented was mean ± SE.
and fish species affect the fish’s hematopoiesis, however, the exact
mechanisms by which this happens is unknown and requires further
investigation.
Concerning the WBC count, fish fed a diet containing 1% GA had a
considerably higher leucocytic count than fish fed basal diet, provides a
higher capability to sustain homeostasis, as leukocytes are defensive
system cells that initiate the immune response, and lymphocytes are
critical cells for humoral and cell-mediated immunity in fish. This rise in
the WBCs count was also confirmed by Azevedo et al. (2016), who re­
ported higher total leukocytic count in Nile tilapia during the fall season,
assert that a high WBCs count in the blood is indicative of boosted
immunological activity.
Biochemical blood indices reflect the health condition of fish when
they are subjected to numerous feed supplements (Fazio, 2019; Alan­
diyjany et al., 2022). In terms of blood constituents, fish offered a diet
supplemented with GA 1% showed remarkedly higher levels of total
protein, albumin, and globulin as compared to fish fed GA 0.25 or 0.5%,
which demonstrated an improved ability to maintain overall health
status. Besides, in comparison to other treatment groups, dietary in­
clusion with a high level of GA (1%) resulted in decreased AST, ALT, and
uric acid concentrations. Our results in tilapia fish were found to be in
line with findings in other mammals where rabbit supplemented diets
with 2–20 g GA per kg diet significantly increased total protein, albu­
min, and glucose concentrations and remarkedly declined liver and
kidney enzyme activities (Amber et al., 2017). Moreover, Nasir et al.
(2016) reported that mice supplemented 100 g GA per liter in drinking
water reduced uric acid and glucose levels. Moreover, Al-Fadil et al.
(2013) reported that supplemented broiler chicken diets with 20, 40,
and 60 g GA/kg significantly reduced uric acid levels in the blood. The
enrichment of tilapia diets with GA as a prebiotic might be responsible
for the production of short-chain fatty acids and ammonia in the
digestive tract, as well as the creation of a suitable environment for
beneficial microbiota, resulting in higher nitrogen secretion and lower
7
Aquaculture 556 (2022) 738249
serum urea nitrogen concentration (Al-Baadani et al., 2021).
Glutathione, superoxide dismutase, and catalase have been discov­
ered to play a very important role function in the phase II detoxification
of lipid peroxides process and to have an anti-free radical effect in cells
under oxidative stress (Zikić et al., 2001; Rudneva et al., 2010; Sanda­
malika et al., 2021). Moreover, increased malondialdehyde (MDA)
levels are often assumed to be an indication of lipid peroxidation
induced by oxidative stress generated by fish exposure to suboptimal
environmental conditions (Garcia et al., 2020). Concerning our antiox­
idant defense markers results, higher GSH, SOD, and CAT values, as well
as lower MDA concentrations, were observed in association with
increasing the dietary inclusion level of GA within the feeding diet.
Several studies have already shown GA’s antioxidant properties in mice
(Ahmed et al., 2016), broiler (Alzawqari et al., 2016) and Mugil cephalus
(Faggio et al., 2015) . Musa et al. (2013) reported that GA could promote
the antioxidant activity of the hepatocytes via modulating the oxidative
stress-related genes expression. Moreover, GA has been shown to have a
high concentration of phenolic chemicals, which may be responsible for
its strong antioxidant action (Mirghani et al., 2018).
Lysozyme activity is a key indicator of fish adaptive immunity
(Saurabh and Sahoo, 2008). Furthermore, the complement activity is the
main factor of the innate immune response and plays a vital role in
destroying pathogenic bacteria, phagocytosis, anti-inflammatory ef­
fects, complex immune clearance, and production of antibodies
(Holland and Lambris, 2002). Additionally, IgM and IgA support both
the innate and adaptive immune systems in fish, with functional activ­
ities such as complement pathways activation, pathogen phagocytosis
and removal, and cellular cytotoxicity (Mashoof and Criscitiello, 2016).
Furthermore, the spleen and head kidney are well-known lymphoid
organs of teleost fish that are discovered to form at 2 days post-hatching
in Asian seabass and are generally rich in melano-macrophage clusters,
indicating their immune-related activities (Jiang et al., 2014). In this
investigation, the fish fed high amounts of GA (1%) had the greatest
M.A.E. Naiel et al.
levels of Lysozyme, COMPC3, and immunoglobulins, followed by fish
given diets supplemented with 0.5% GA, when compared to other
treatment groups. The obtained results found to be similar to Soleimani
et al. (2012) findings that enriched Caspian roach (Rutilus rutilus) fry
diets with 10, 20 or 30 g fructooligosaccharide (FOS) per kg enhance the
immunoglobulins, complement and lysozyme levels and promote the
innate immune responses. Also, diets supplemented with 2 g GA per kg
found to be significantly increased immunoglobulins levels (IgG, IgM,
and IgA) in rabbits (El-Ratel et al., 2019) and rats (Ali et al., 2013). The
obtained results proposed that GA could indirectly stimulate the fish
immune system via altering the production of the pro-inflammatory
cytokines on intestinal mucosa (Patel and Goyal, 2015) or stimulate
the activation of interleukins, which influence immunological responses
(Blanco et al., 2008). Dendritic cells are a special type of antigen-
presenting cell (APC) that showed a vital function in the innate im­
mune responses. Ahmed (2018) supported that GA dietary supplemen­
tation could promote dendritic cells production. Also, Xuan et al. (2010)
exhibited that GA (5 g per liter) has remarkable immunological in­
fluences via modulating the properties of intestinal dendritic cells
through direct binding with the intestinal lumen cells as APC and thus
providing a potential impact in the immune response regulation process
by improving the cytokine genes (IL-1, IL-10, and TNF-α) production.
The findings indicated that GA might indirectly boost the expression of
immune related genes/cytokines in a variety of tissues (Abdel-Rahman
et al., 2006; Patel and Goyal, 2015).
Feed supplements are one of the numerous factors that affect the
gastric microbial population of fish (Egerton et al., 2018). Prebiotics
modulate the entire gastric environment of the fish through modulating
microbial biodiversity and enhancements the epithelium layer structure,
which regulates the interaction of the gut microbiota and the host
(Vargas-Albores et al., 2021). In addition, prebiotics may benefit fish
health by selectively colonizing the gastrointestinal tract with favorable
microorganisms such as, lactobacillus, bifidobacteria, Saccharomyces sp.
and some non-pathogenic strains of E. coli (Buentello et al., 2010).
Beneficial bacterial strains that predominate the intestinal tract enhance
the enteric environment by releasing bacteriocins, which suppress the
development of some pathogenic bacterial strains and, therefore, un­
doubtedly alter the host’s microbiota diversification (Reza et al., 2009).
In the present research, fish-fed diets supplemented with 1% GA had the
highest bacillus spp. counts when compared to other treatments. In
addition, increasing the amount of GA in tilapia diets remarkedly
reduced total aerobic and anaerobic bacterial counts, as well as Pseu­
domonas spp., Aeromonas spp., and E.coli numbers in the digestive tract.
These results were similar to Alarifi et al. (2018) findings that dietary
supplementation of 10 and 20 g GA per kg had the same prebiotic
Fructooligosaccharide (FOS) effects caused by an increase in Lactoba­
cillus spp. and Bifidobacterium spp. Moreover, Lham et al. (2015) and Hu
et al. (2016) reported that diets supplemented with 2.5 up to 20 g GA per
kg diet exhibited higher antibacterial properties against the develop­
ment of Escherichia coli, Streptococcus Pneumonia, Streptococcus Pyogenes,
Salmonella Typhi, Pseudomonas Aeruginosa, and Staphylococcus Aureus.
The higher antimicrobial efficiency of GA may be attributed to the ex­
istence of elevated levels of tannins and saponins molecules (Ahmed,
2018).
5. Conclusion
Taken together, findings in this feeding trial demonstrate that sup­
plementing tilapia diets with Gum Arabic (1%) boosts performance,
antioxidant status, immunological response and modulates intestinal
microbiota. GA 1% enriched tilapia diet is a potential feed additive in
aquaculture and may improve fish production practices in the future.
Funding
Not applicable.
8
Aquaculture 556 (2022) 738249
Ethics approval
The Local Experimental Animal Care Committee requirements were
followed, and the Institutional Animal care and use Committee (IACUC),
Zagazig University, endorsed the research.
CRediT authorship contribution statement
Mohammed A.E. Naiel: Conceptualization, Methodology, Formal
analysis, Data curation, Writing – original draft, Writing – review &
editing. Samah A.A. Abd El-hameed: Methodology, Investigation,
Validation, Visualization, Writing – review & editing. Ahmed H. Ari­
sha: Methodology, Investigation, Validation, Visualization, Writing –
review & editing. Samar S. Negm: Methodology, Formal analysis, Data
curation, Investigation, Writing – original draft, Writing – review &
editing.
Declaration of Competing Interest
The all-authors state that they have no conflicting interests that may
have influenced the results described in this manuscript.
Acknowledgment
All authors would like to thank Dr. Abdullah Ibrahim El-Kholy,
Pharmaceutical Technology Unit, National Institute of Laser Enhanced
Sciences (NILES), Cairo University, for his valuable and constructive
english and grammatical edits to this manuscript. His generosity in
donating his time and effort has been much appreciated.
References
Abd El-Hakim, Y.M., El-Houseiny, W., Abd Elhakeem, E.M., Ebraheim, L.L., Moustafa, A.
A., Mohamed, A.A.R., 2020. Melamine and curcumin enriched diets modulate the
haemato-immune response, growth performance, oxidative stress, disease resistance,
and cytokine production in Oreochromis niloticus. Aquat. Toxicol. 220, 105406.
Abd El-hameed, S., Negm, S.S., Ismael, N.E., Naiel, M.A., Soliman, M.M., Shukry, M.,
Abdel-Latif, H.M., 2021. Effects of activated charcoal on growth, immunity,
oxidative stress markers, and physiological responses of Nile tilapia exposed to sub-
lethal Imidacloprid toxicity. Animals. 11, 1357.
Abd El-Mawla, A.M., Osman, H.E.H., 2011. Effects of gum acacia aqueous extract on the
histology of the intestine and enzymes of both the intestine and the pancreas of
albino rats treated with meloxicam. Pharm. Res. 3, 114.
Abd El-Naby, A.S., Al-Sagheer, A.A., Negm, S.S., Naiel, M.A., 2020. Dietary combination
of chitosan nanoparticle and thymol affects feed utilization, digestive enzymes,
antioxidant status, and intestinal morphology of Oreochromis niloticus. Aquaculture.
515, 734577.
Abdelghany, M.F., El-Sawy, H.B., Abd El-Hameed, S.A., Khames, M.K., Abdel-Latif, H.M.,
Naiel, M.A., 2020. Effects of dietary Nannochloropsis oculata on growth performance,
serum biochemical parameters, immune responses, and resistance against Aeromonas
veronii challenge in Nile tilapia (Oreochromis niloticus). Fish & Shellfish Immunol.
107, 277–288.
Abdel-Rahman, A.M., El-Sahrigy, S.A., Bakr, S.I., 2006. A comparative study of two
angiogenic factors: vascular endothelial growth factor and angiogenin in induced
sputum from asthmatic children in acute attack. Chest. 129, 266–271.
Abu Zeid, E.H., Khalifa, B.A., Said, E.N., Arisha, A.H., Reda, R.M., 2021. Neurobehavioral
and immune-toxic impairments induced by organic methyl mercury dietary exposure
in Nile tilapia Oreochromis niloticus. Aquat. Toxicol. 230, 105702.
Aebi, H., 1984. (13) Catalase in vitro. Methods Enzymol. 105, 121–126.
Ahmed, A.A., 2018. Health Benefits of Gum Arabic and Medical Use. Academic Press,
pp. 183–210.
Ahmed, A.A., Fedail, J.S., Musa, H.H., Musa, T.H., Sifaldin, A.Z., 2016. Gum Arabic
supplementation improved antioxidant status and alters expression of oxidative
stress gene in ovary of mice fed high fat diet. Middle East Fertility Soc J. 21,
101–108.
Ai, Ellis, 1990. Lysozyme assays. Techniques in Fish Immunol. 1, 101–103.
Alagawany, M., Farag, M.R., Abdelnour, S.A., Elnesr, S.S., 2021. A review on the
beneficial effect of thymol on health and production of fish. Rev. Aquac. 13,
632–641.
Alam, R.T.M., Abu Zeid, E.H., Khalifa, B.A., Arisha, A.H., Reda, R.M., 2021. Dietary
exposure to methyl mercury chloride induces alterations in hematology, biochemical
parameters, and mRNA expression of antioxidant enzymes and metallothionein in
Nile tilapia. Environ. Sci. Pollut. Res. 28, 31391–31402.
Alandiyjany, M.N., Kishawy, A.T.Y., Abdelfattah-Hassan, A., Eldoumani, H., Elazab, S.T.,
El-Mandrawy, S.A.M., Ibrahim, D., 2022. Nano-silica and magnetized-silica
mitigated lead toxicity: their efficacy on bioaccumulation risk, performance, and
M.A.E. Naiel et al.
apoptotic targeted genes in Nile tilapia (Oreochromis niloticus). Aquat. Toxicol. 242,
106054.
Alarifi, S., Bell, A., Walton, G., 2018. In vitro fermentation of gum acacia–impact on the
faecal microbiota. Int. J. Food Sci. Nutr. 69, 696–704.
Al-Baadani, H.H., Al-Mufarrej, S.I., Al-Garadi, M.A., Alhidary, I.A., Al-Sagan, A.A.,
Azzam, M.M., 2021. The use of gum Arabic as a natural prebiotic in animals: a
review. Anim. Feed Sci. Technol. 114894.
Al-Fadil, S., Mukhtar, M.A., Tabidi, M.H., 2013. Response of broiler chicks to diets
containing gum arabic as a natural prebiotic. J. Curr. Res. Sci. 1, 247–253.
Al-Harbi, A.H., Uddin, N., 2005. Bacterial diversity of tilapia (Oreochromis niloticus)
cultured in brackish water in Saudi Arabia. Aquaculture. 250, 566–572.
Ali, B.H., Beegam, S., Al-Lawati, I., Waly, M., Al Za’abi, M., Nemmar, A., 2013.
Comparative efficacy of three brands of gum acacia on adenine-induced chronic
renal failure in rats. Physiol. Res. 62, 47–56.
Al-Sagheer, A., Mahmoud, H., Reda, F., Mahgoub, S., Ayyat, M., 2018. Supplementation
of diets for Oreochromis niloticus with essential oil extracts from lemongrass
(Cymbopogon citratus) and geranium (Pelargonium graveolens) and effects on growth,
intestinal microbiota, antioxidant and immune activities. Aquac. Nutr. 24,
1006–1014.
Alzawqari, M., Al-Baddany, A., Al-Baadani, H., Alhidary, I., Khan, R.U., Aqil, G.,
Abdurab, A., 2016. Effect of feeding dried sweet orange (Citrus sinensis) peel and
lemon grass (Cymbopogon citratus) leaves on growth performance, carcass traits,
serum metabolites and antioxidant status in broiler during the finisher phase.
Environ. Sci. Pollut. Res. 23, 17077–17082.
Amber, K., Abd El-Nabi, F.M., Morsy, W., Morsy, S.H., 2017. Gum Arabic as prebiotic in
growing rabbits diet. Global Vet. 19, 465–471.
Azevedo, T., Albinati, R., Guerra-Santos, B., Pinto, L., Lira, A., Medeiros, S., Ayres, M.,
2016. Reference values of hematological parameters of Oreochromis niloticus
(Linaeus, 1758) cultivated in net cages in Paulo Afonso, state of Bahia, Brazil
Brazilian. J. Aquatic Sci. Technol. 20, 63–74.
Bakhoum, N., Fall, D., Fall, F., Diouf, F., Hirsch, A., Balachandar, D., Diouf, D., 2018.
Senegalia senegal (synonym: Acacia senegal), its importance to sub-Saharan Africa,
and its relationship with a wide range of symbiotic soil microorganisms. South
African J. Botany. 119, 362–368.
Beutler, E., 1963. Improved method for the determination of blood glutathione. J. Lab.
Clin. Med. 61, 882–888.
Blanco, P., Palucka, A.K., Pascual, V., Banchereau, J., 2008. Dendritic cells and cytokines
in human inflammatory and autoimmune diseases. Cytokine Growth Factor Rev. 19,
41–52.
Boyd, C.E., Tucker, C.S., 2012. Pond Aquaculture Water Quality Management. Springer
Science & Business Media.
Buentello, J.A., Neill, W.H., Gatlin, I., Delbert, M., 2010. Effects of dietary prebiotics on
the growth, feed efficiency and non-specific immunity of juvenile red drum Sciaenops
ocellatus fed soybean-based diets. Aquac. Res. 41, 411–418.
Calame, W., Weseler, A.R., Viebke, C., Flynn, C., Siemensma, A.D., 2008. Gum arabic
establishes prebiotic functionality in healthy human volunteers in a dose-dependent
manner. British J. Nutr. 100, 1269–1275.
Celi, P., Verlhac, V., Fru-Nji, F., Kluenter, A., Steinert, R., Cowieson, A., 2018.
Gastrointestinal functionality in animal nutrition and health. AFMA Matrix. 27,
24–31.
Cherbut, C., Michel, C., Raison, V., Kravtchenko, T., Severine, M., 2003. Acacia gum is a
bifidogenic dietary fibre with high digestive tolerance in healthy humans. Microb.
Ecol. Health Dis. 15, 43–50.
Cupp-Enyard, C., 2008. Sigma’s non-specific protease activity assay-casein as a substrate.
J. Vis. Exp. e899.
Draper, H.H., Hadley, M., 1990. (43) Malondialdehyde determination as index of lipid
peroxidation. Methods Enzymol. 186, 421–431.
Egerton, S., Culloty, S., Whooley, J., Stanton, C., Ross, R.P., 2018. The gut microbiota of
marine fish. Front. Microbiol. 9, 873.
El-faki, F.E.-M., 2016. Evaluation of the additions gum Arabic on the growth
performance indices of mix-sex Tilapia O. niloticus fingerlings. Sudan Univ. Sci. &
Technol. 1–74.
El-Ratel, I., Ismail, R.F., Fouda, S.F., 2019. Productive performance, carcass traits, lipid
profile, antioxidants and immunity of growing rabbits treated with gum Arabic
under Egyptian summer condition. Egy. J. Nutr. Feeds. 22, 383–394.
Esakkiraj, P., Immanuel, G., Sowmya, S., Iyapparaj, P., Palavesam, A., 2009. Evaluation
of protease-producing ability of fish gut isolate Bacillus cereus for aqua feed. Food
Bioprocess Technol. 2, 383–390.
Espírito Santo, M.L.P., Vivian, V., Mirapalheta, T., Carbonera, N., Coelho, G., Damian, C.,
2007. Chemical, physical and microbiological changes in tilapia (Oreochromis
niloticus) during marination. Alim. Nutr. 18 (1), 1–5.
Faggio, C., Fazio, F., Marafioti, S., Arfuso, F., Piccione, G., 2015. Oral administration of
gum Arabic: effects on haematological parameters and oxidative stress markers in
Mugil cephalus. Iran. J. Fish. Sci. 14, 60–72.
FAO, 2018. Food and agriculture organization of the united nations. In: Global
Aquaculture Production. Contributing to Food Security and Nutrition for All, Rome,
2018, p. 200.
Fazio, F., 2019. Fish hematology analysis as an important tool of aquaculture: a review.
Aquaculture. 500, 237–242.
Folin, O., Wu, H., 1919. A system of blood analysis. J. Biol. Chem. 38, 81–110.
Fouda, A., El-Aziz, Abd, Mabrouk, N., 2019. Effects of arabic gum on cardiomyopathy in
a rat model of type II diabetes. Al-Azhar Med. J. 48, 29–42.
Francesco, F., Satheeshkumar, P., Senthil Kumar, D., Caterina, F., Giuseppe, P., 2012.
Comparative study of hematological and blood chemistry of Indian and Italian Grey
mullet (Mugil cephalus Linneaus 1758). HOAJ Biol. 1–5.
9
Aquaculture 556 (2022) 738249
Garcia, D., Lima, D., da Silva, D.G.H., de Almeida, E.A., 2020. Decreased
malondialdehyde levels in fish (Astyanax altiparanae) exposed to diesel: evidence of
metabolism by aldehyde dehydrogenase in the liver and excretion in water.
Ecotoxicol. Environ. Saf. 190, 110107.
Goldenfarb, P.B., Bowyer, F.P., Hall, E., Brosious, E., 1971. Reproducibility in the
hematology laboratory: the microhematocrit determination. Am. J. Clinical Pathol.
56, 35–39.
Granfors, K., 1979. Measurement of immunoglobulin M (IgM), IgG, and IgA antibodies
against Yersinia enterocolitica by enzyme-linked immunosorbent assay: persistence of
serum antibodies during disease. J. Clin. Microbiol. 9, 336–341.
Holland, M.C.H., Lambris, J.D., 2002. The complement system in teleosts. Fish &
Shellfish Immunol. 12, 399–420.
Hu, Y., Dun, Y., Li, S., Zhao, S., Peng, N., Liang, Y., 2014. Effects of Bacillus subtilis KN-42
on growth performance, diarrhea and faecal bacterial flora of weaned piglets. Asian-
Australasian J Ani. Sci. 27, 1131.
Hu, Q., Gerhard, H., Upadhyaya, I., Venkitanarayanan, K., Luo, Y., 2016. Antimicrobial
eugenol nanoemulsion prepared by gum arabic and lecithin and evaluation of drying
technologies. Int. J. Biol. Macromol. 87, 130–140.
Ibrahim, R.E., El-Houseiny, W., Behairy, A., Abo-Elmaaty, A., Al-Sagheer, A.A., 2019.
The palliative role of Eruca sativa leaves dietary supplementation against oxidative
stress, immunosuppression, and growth retardation in temperature-stressed
Oreochromis niloticus. J. Thermal Biol. 84, 26–35.
Ismael, N.E., Abd El-hameed, S.A., Salama, A.M., Naiel, M.A., Abdel-Latif, H.M., 2021.
The effects of dietary clinoptilolite and chitosan nanoparticles on growth, body
composition, haemato-biochemical parameters, immune responses, and
antioxidative status of Nile tilapia exposed to imidacloprid. Environ. Sci. Pol. Res,
1–16.
Jiang, J., Miyata, M., Chan, C., Ngoh, S.Y., Liew, W.C., Saju, J.M., Chang, S.F., 2014.
Differential transcriptomic response in the spleen and head kidney following
vaccination and infection of Asian seabass with streptococcus iniae. PLoS One 9,
e99128.
Lham, A.B., NKK, Hindi, Jebur, M.H., Mahdi, M.A., 2015. In VitroAntimicrobial activity
of gum Arabic (Al manna and Tayebat) prebiotics against infectious pathogens.
Human J. 3, 1–9.
Libanori, M., Santos, G., Pereira, S., Lopes, G., Owatari, M., Soligo, T., Mouriño, J., 2021.
Dietary supplementation with benzoic organic acid improves the growth
performance and survival of Nile tilapia (Oreochromis niloticus) after challenge with
Streptococcus agalactiae (Group B). Aquaculture. 545, 737204.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2− ΔΔCT method. Methods. 25, 402–408.
Mashoof, S., Criscitiello, M.F., 2016. Fish immunoglobulins. Biol. 5, 45.
Maxham, L.A., Forzán, M.J., Hogan, N.S., Vanderstichel, R.V., Gilroy, C.V., 2016.
Hematologic reference intervals for Xenopus tropicalis with partial use of automatic
counting methods and reliability of long-term stored samples. Vet. Clin. Pathol. 45,
291–299.
Mirghani, M.E., Elnour, A.A., Kabbashi, N., Alam, M.Z., Musa, K.H., Abdullah, A., 2018.
Determination of antioxidant activity of gum arabic: an exudation from two different
locations. Sci. Asia 44, 179–186.
Musa, K.H., Abdullah, A., Kuswandi, B., Hidayat, M.A., 2013. A novel high throughput
method based on the DPPH dry reagent array for determination of antioxidant
activity. Food Chem. 141, 4102–4106.
Naiel, M.A., Ismael, N.E., Shehata, S.A., 2019. Ameliorative effect of diets supplemented
with rosemary (Rosmarinus officinalis) on aflatoxin B1 toxicity in terms of the
performance, liver histopathology, immunity and antioxidant activity of Nile tilapia
(Oreochromis niloticus). Aquaculture. 511, 734264.
Naiel, M.A., Ismael, N.E., Negm, S.S., Ayyat, M.S., Al-Sagheer, A.A., 2020. Rosemary leaf
powder–supplemented diet enhances performance, antioxidant properties, immune
status, and resistance against bacterial diseases in Nile Tilapia (Oreochromis
niloticus). Aquaculture. 526, 735370.
Naiel, M.A., Negm, S.S., Abd El-hameed, S.A., Abdel-Latif, H.M., 2021a. Dietary organic
selenium improves growth, serum biochemical indices, immune responses,
antioxidative capacity, and modulates transcription of stress-related genes in Nile
tilapia reared under sub-optimal temperature. J Thermal Biol. 99, 102999.
Naiel, M.A., Khames, M.K., Abdel-Razek, N., Gharib, A.A., El-Tarabily, K.A., 2021b. The
dietary administration of miswak leaf powder promotes performance, antioxidant,
immune activity, and resistance against infectious diseases on Nile tilapia
(Oreochromis niloticus). Aquacul. Rep. 20, 100707.
Naiel, M.A., Farag, M.R., Gewida, A.G., Elnakeeb, M.A., Amer, M.S., Alagawany, M.,
2021c. Using lactic acid bacteria as an immunostimulants in cultured shrimp with
special reference to Lactobacillus spp. Aquac. Int. 29, 219–231.
Naiel, M.A., Gewida, A.G., Merwad, A.-R.M., Abdel-Hamid, E.A., Negm, S.S.,
Alagawany, M., Farag, M.R., 2021d. The effects of various organic fertilizers with or
without adsorbents on the productivity, antioxidant status and immune responses of
Nile tilapia raised in cement ponds. Aquaculture 737593.
Nasif, W., Lotfy, M., Mahmoud, M., 2011. Protective effect of gum acacia against the
aspirin induced intestinal and pancreatic alterations. Eur. Rev. Med. Pharmacol. Sci.
15, 285–292.
Nasir, O., Babiker, S., Salim, A.-M.M., 2016. Protective effect of gum Arabic
supplementation for type 2 diabetes mellitus and its complications. Int J Multidiscip
Curr Res. 4, 288–294.
Negm, S.S., Ismael, N.E., Ahmed, A.I., El-Asely, A.M., Naiel, M.A., 2021. The efficiency of
dietary Sargassum aquifolium on the performance, innate immune responses,
antioxidant activity, and intestinal microbiota of Nile Tilapia (Oreochromis niloticus)
raised at high stocking density. J. Appl. Phycol. 33, 4067–4082.
M.A.E. Naiel et al.
Nishikimi, M., Rao, N.A., Yagi, K., 1972. The occurrence of superoxide anion in the
reaction of reduced phenazine methosulfate and molecular oxygen. Biochem.
Biophys. Res. Commun. 46, 849–854.
Patel, S., Goyal, A., 2015. Applications of natural polymer gum arabic: a review. Int. J.
Food Prop. 18, 986–998.
Raz, S.H., Abdelnour, S.A., Alotaibi, M.A., AlGabbani, Q., Naiel, M.A., Shokrollahi, B.,
Alagawany, M., 2021. MicroRNAs mediated environmental stress responses and
toxicity signs in teleost fish species. Aquaculture 737310.
Reza, A., Abdolmajid, H., Abbas, M., Abdolmohammad, A.K., 2009. Effect of dietary
prebiotic inulin on growth performance, intestinal microflora, body composition and
hematological parameters of juvenile beluga, Huso huso (Linnaeus, 1758). J. World
Aquacul. Soci. 40, 771–779.
Rothman, S., Liebow, C., Isenman, L., 2002. Conservation of digestive enzymes. Physiol.
Rev. 82 (1), 1–18.
Rudneva, I.I., Kuzminova, N.S., Skuratovskaya, E.N., 2010. Glutathione-S-transferase
activity in tissues of Black Sea fish species. Asian J. Exp. Biol. Sci. 1, 141–150.
Sandamalika, W.G., Kwon, H., Lim, C., Yang, H., Lee, J., 2021. The possible role of
catalase in innate immunity and diminution of cellular oxidative stress: insights into
its molecular characteristics, antioxidant activity, DNA protection, and
transcriptional regulation in response to immune stimuli in yellowtail clownfish
(Amphiprion clarkii). Fish & Shellfish Immunol. 113, 106–117.
Sarma, P.R., 1990. Red Cell Indices; Clinical Methods: The History, Physical, and
Laboratory Examinations, 3rd ed. Butterworth Publishers.
Satheeshkumar, P., Ananthan, G., Senthilkumar, D., Khan, A.B., Jeevanantham, K., 2012.
Comparative investigation on haematological and biochemical studies on wild
marine teleost fishes from Vellar estuary, southeast coast of India. Comp. Clin.
Pathol. 21, 275–281.
Saurabh, S., Sahoo, P., 2008. Lysozyme: an important defence molecule of fish innate
immune system. Aquac. Res. 39, 223–239.
Shafique, L., Abdel-Latif, H.M., Hassan, F.-u., Alagawany, M., Naiel, M.A., Dawood, M.A.,
Liu, Q., 2021. The feasibility of using yellow mealworms (Tenebrio molitor): towards
a sustainable aquafeed industry. Animals. 11, 811.
10
Aquaculture 556 (2022) 738249
Soleimani, N., Hoseinifar, S.H., Merrifield, D.L., Barati, M., Abadi, Z.H., 2012. Dietary
supplementation of fructooligosaccharide (FOS) improves the innate immune
response, stress resistance, digestive enzyme activities and growth performance of
Caspian roach (Rutilus rutilus) fry. Fish & Shellfish Immunol. 32, 316–321.
Soliman, N.F., Yacout, D.M., 2016. Aquaculture in Egypt: status, constraints and
potentials. Aquac. Int. 24, 1201–1227.
Thiex, N., Novotny, L., Crawford, A., 2012. Determination of ash in animal feed: AOAC
official method 942.05 revisited. J. AOAC Int. 95, 1392–1397.
Vargas-Albores, F., Martínez-Córdova, L.R., Hernández-Mendoza, A., Cicala, F., Lago-
Lestón, A., Martínez-Porchas, M., 2021. Therapeutic modulation of fish gut
microbiota, a feasible strategy for aquaculture? Aquaculture 737050.
Wang, W., Ishikawa, M., Koshio, S., Yokoyama, S., Dawood, M.A., Hossain, M.S.,
Moss, A.S., 2019. Effects of dietary astaxanthin and vitamin E and their interactions
on the growth performance, pigmentation, digestive enzyme activity of kuruma
shrimp (Marsupenaeus japonicus). Aquac. Res. 50, 1186–1197.
Wilkinson, J., Baron, D., Moss, D., Walker, P., 1972. Standardization of clinical enzyme
assays: a reference method for aspartate and alanine transaminases. J. Clin. Pathol.
25, 940.
Xia, Y., Wang, M., Gao, F., Lu, M., Chen, G., 2020. Effects of dietary probiotic
supplementation on the growth, gut health and disease resistance of juvenile Nile
tilapia (Oreochromis niloticus). Ani. Nutr. 6, 69–79.
Xuan, N.T., Shumilina, E., Nasir, O., Bobbala, D., Götz, F., Lang, F., 2010. Stimulation of
mouse dendritic cells by gum Arabic. Cell. Physiol. Biochem. 25, 641–648.
Zhang, X., Sun, Z., Cai, J., Wang, J., Wang, G., Zhu, Z., Cao, F., 2020. Effects of dietary
fish meal replacement by fermented moringa (Moringa oleifera Lam.) leaves on
growth performance, nonspecific immunity and disease resistance against Aeromonas
hydrophila in juvenile gibel carp (Carassius auratus gibelio var. CAS III). Fish &
Shellfish Immunol. 102, 430–439.
Zikić, R., Stajn, A.S., Pavlović, S.Z., Ognjanović, B.I., Saićić, Z., 2001. Activities of
superoxide dismutase and catalase in erythrocytes and plasma transaminases of
goldfish (Carassius auratus gibelio Bloch.) exposed to cadmium. Physiol. Res. 50,
105–111.
Another random document with
no related content on Scribd:
Lukuledigebietes bezeichnen darf. Auch in Sage und Mythus der
hiesigen Völker spielt der Berg die größte Rolle. Um ihn rankten sich
schon vor der Beisetzung Hatias III. die Sagen der Vergangenheit;
jetzt aber, wo der tote Negerfürst dort in dunkler, jedem
Uneingeweihten verbotener Schlucht von den Taten seines Lebens
ausruht, ist der Ungurue im Volksglauben zu einem Heiligtum
geworden, auf dem in mondhellen Nächten der verstorbene
Herrscher seiner Gruft entsteigt, die Geister seiner Untertanen um
sich schart und mit ihnen zur nächtlichen Ngoma antritt.
Hatia IV. war erst unmittelbar vor unserer Ankunft in seine
Residenz zurückgekehrt; er hatte an der Küste für einige Zeit Muße
gehabt, über seine Beteiligung am Aufstand nachzudenken. Jetzt
machte er mir den Eindruck eines völlig gebrochenen Mannes, dem
es körperlich ebenso schlecht erging wie seinen Untertanen; er
wohnte nicht besser als diese und hatte auch sicherlich
ebensowenig zu beißen wie sie. An dem Tage, wo wir für einige Zeit
bei Hatia haltmachten, war er doppelt traurig; wenige Stunden vorher
hatte ein starker Löwe, der wegen seiner Frechheit im ganzen Lande
berühmt ist, aus seiner nächsten Nähe eine Frau geholt; noch sah
man die ungeheuren Pranken im Sande abgedrückt, so daß man
den Weg des Räubers um die Hütte herum genau verfolgen konnte.
Entgegen aller Löwengewohnheit hatte das Tier seine Beute fast am
hellen Tage direkt aus der Hütte herausgeholt. Mann, Frau und Kind
hatten friedlich in dieser gesessen; da war der schwere Körper des
Tieres auf die zunächst sitzende Frau gestürzt. Der Ehemann hatte
zwar versucht, die Gattin zu halten, aber er war krank und schwach,
und so hatte das Tier spielend gesiegt. Längere Zeit noch hatte man
das „nna kufa, nna kufa, ich sterbe, ich sterbe“ der Unglücklichen im
Pori verhallen hören. Zu helfen hatte keiner vermocht. Denn einmal
besaßen die Leute nach dem Aufstand keine Gewehre, und selbst
wenn sie diese gehabt hätten, würde ihnen das Pulver gefehlt
haben, dessen Einfuhr seit einiger Zeit gesperrt ist.
Als Rächer wird der Neffe und Erbe Hatias IV. auftreten. Er ist ein
hübscher, kohlrabenschwarzer Jüngling mit krausem
Schnurrbärtchen auf der Oberlippe und einem beneidenswert
dichten, krausen Haarwuchs auf der Schädeldecke. Mit einem
stolzen Gewehr bewaffnet, ist er mit uns von Lindi heraufgekommen,
um das Gebiet seines Stammes von der Löwenplage zu befreien.
Man kann hier wirklich von einer solchen Plage reden; es heißt, daß
der ganze, lange Weg von Nyangao bis Massassi unter vier
Löwenpaare aufgeteilt sei, die nichts Besseres zu tun haben, als ihre
Wegstrecke nach menschlichen Opfern abzupatroullieren. Selbst die
drei Missionare von Nyangao sind vor dem König der Tiere nicht
sicher; ist es doch kürzlich passiert, daß Pater Clemens auf einem
Spaziergang plötzlich einem großen Löwen gegenüberstand, der ob
des Geschehnisses allerdings ebenso verdutzt war wie der
Gottesmann.
Daß der Löwe von Hatia sein Opfer sogar aus dem Hausinnern
holen konnte, verstehe ich angesichts der Bauart der jetzigen
Wamuerahütten recht wohl. Wenn jemand Lust hat, Studien über die
Entwicklungsgeschichte des menschlichen Wohnhauses zu machen,
hier könnte er die Anfänge sehen. Es sind schon bessere Bauten,
wenn sich zu den Seitenwänden auch noch Giebelteile gesellen;
zumeist sind diese Wohnungen nichts mehr und nichts weniger als
zwei schräg gegeneinander gelehnte, aus Strohbündeln notdürftig
zusammengearbeitete Wände. Es kommt hinzu, daß die Wamuera
diese Urhütten, wenn man so sagen darf, wohl oder übel im
unberührten Pori haben aufstellen müssen; fehlen ihnen doch nach
dem Verlust aller ihrer Habe — ihre Dörfer sind als ihr einziger
wertvoller Besitz von unseren Truppen natürlich dem Erdboden
gleichgemacht worden — selbst die Werkzeuge zur Urbarmachung
der Felder und zum Lichten des Waldes. Freie Plätze scheut der
Löwe, im Pori aber fühlt er sich heimisch; er betrachtet es als sein
natürliches Jagdrevier und schleicht sich in ihm zum tödlichen
Sprunge bis dicht an die Hütten heran.
Eins hätte ich beinahe vergessen, Ihnen zu berichten. Was sind
die berühmten Botokuden mit ihren Lippenscheiben gegen die
Völker des Südens von Deutsch-Ostafrika! Schon in Lindi hatten die
Herren mir den Mund wässerig gemacht mit Erzählungen von dem
abenteuerlichen Äußern der Wamuerafrauen. Aber wie weit sind
jene Schilderungen hinter der Wirklichkeit zurückgeblieben! Bilder
sagen hier mehr als lange Worte, sie sprechen klarer und
verständlicher; schauen Sie, Herr Geheimrat, sich demnach lieber
die Typen an, die ich Ihnen gleichzeitig mitsende. Daß das
Makondeplateau und seine Umgebung mit zu dem großen Bezirk
des P e l ē l e , der Lippenscheibe, gehört, habe ich bereits seit langer
Zeit gewußt, aber eine brauchbare Abbildung hatte ich in der
Literatur bis zu meinen eigenen Aufnahmen noch nirgends
entdecken können. Es scheint in der Tat so, als wenn meine
Vorgänger hier im Lande entweder nicht haben photographieren
können, oder aber, als wenn ihre Apparate bereits vor der
Erreichung des Pelelegebietes dem Klima zum Opfer gefallen seien!

Muerafrau.
Das Pelele oder, wie es im Kimuera heißt, Itona, ist auf das
weibliche Geschlecht beschränkt, bei ihm aber ist es allgemein. Es
ist ein Pflock, bei älteren Individuen auch eine wirkliche Scheibe aus
schwarzem Ebenholz oder einem hellen, mittels geschlämmter
Tonerde schneeweiß gefärbten anderen Holz, die sich in die
durchlochte und ausgeweitete Oberlippe zwängt. Selbstverständlich
läßt sich nicht sogleich eine talergroße Itona in diesen Körperteil
einfügen, sondern man fängt mit einem winzig kleinen Fremdkörper
an, um im Laufe langer Jahre das Maximum des Pelele und damit
auch den höchsten Grad landesüblicher Schönheit zu erreichen. Die
erste Durchlochung der Oberlippe erfolgt schon im frühen
Mädchenalter, zwischen dem 7. und 9. Jahre; sie geschieht mit dem
ahlenförmig zugespitzten Ende des Rasiermessers. Man versteht die
Wunde am Zuheilen zu verhindern, indem man dünne Fremdkörper,
einen Strohhalm oder dergleichen, einfügt. Systematisch vergrößert
man die Zahl dieser Halme und damit die ursprünglich so enge
Öffnung. Später fügt man in sie den spiralförmig zusammengerollten
Blattstreifen eines Palmfieders hinein. Der ist elastisch und treibt die
Öffnung von selbst auseinander. Schließlich erfolgt die Einfügung
des ersten massiven Pflockes. Bei den Wamuera schwankt dessen
Durchmesser zwischen der Stärke eines Fingers und dem eines
Zweimarkstückes; bei den Makonde hingegen sollen diese
Oberlippenscheiben bei älteren Frauen bis zu doppeltem
Durchmesser vorkommen. Sie können sich denken, wie gespannt
ich auf dieses Volk bin. Überhaupt freue ich mich unbändig auf das
Makondeplateau; für unsere Wissenschaft ist es tatsächlich noch
eine völlige terra incognita. Was wird dort alles zu finden sein!

Muerajüngling.
Mit der Itona haben die Frauen indessen in der Ausschmückung
ihres eigenen Ich noch nicht genug getan; sie ist gleichsam nur die
Krönung des ganzen, großen Gebäudes menschlicher Eitelkeit, das
zu allen Zeiten und von allen Gliedern der Spezies Homo sapiens
aufgerichtet worden ist und immer noch weiter ausgebaut wird, um
die eigene Individualität unter allen Umständen aus der Schar der
übrigen Stammesgenossen herauszuheben; zum stillen oder
ausgesprochenen Neid der eigenen Geschlechtsgenossen, zur
Bewunderung für das andere Geschlecht. Zur Itona tritt bei alten
Frauen hier und da zunächst ein Unterlippenpflock, Nigulila genannt.
Lang und schlank, in ein rundes Knöpfchen auslaufend, ragt er aus
der welken Haut hervor; er soll die Aufmerksamkeit von dieser
ablenken und den Beschauer vergessen machen, daß für die
Trägerin dieses Schmuckes die Tage der Schönheit und der Liebe
längst vergangen sind. Ganz allgemein sind dann große Scheiben
oder Pflöcke in den aufgeweiteten Ohrläppchen. Weiterhin aber sieht
der verwunderte weiße Beschauer das Antlitz dieser Schönen mit
auffallenden Gebilden bedeckt. Von ferne gesehen, haben mir diese
Frauen den Aufenthalt in einer deutschen Universitätsstadt
vorgetäuscht, wie sie sich in einer hoffentlich nie erscheinenden
Zukunft darbieten könnte. Als flotter Bursch von Göttingen und
Leipzig habe ich zu meiner Zeit auch ausgesehen wie ein
wandelndes Beefsteak, wie man bei uns zu sagen pflegt, aber gegen
diese prachtvollen, schön breit aufgelaufenen Schmisse der
weiblichen Wamueraburschen hätte ich nicht anzukämpfen
vermocht; im Zeitalter der Asepsis findet man dergleichen bei uns
überhaupt nicht mehr. Kommt man dann dem Trupp der Frauen
näher, so lösen sich die Terzen und Quarten zu tausend Einzelheiten
auf; lang ziehen sich die Reihen der Narbenkeloide über Stirn und
Wange dahin, verlaufen wagrecht oder senkrecht, oder bilden die
verschiedensten Figuren. Im einzelnen besteht jedes dieser Muster
aus vielen, vielen Hautschnitten, die, einander parallel, meist
senkrecht verlaufen. Man hat sie seinerzeit am Verheilen verhindert,
indem man sie während der Schorfbildung immer wieder von neuem
aufgeschnitten hat. So sind sie im Laufe von Wochen und Monaten
zu merkbaren Wulsten geworden, die in ihrer Gesamtheit die ganze
Physiognomie in entscheidender Weise beeinflussen.
 Muerafrau mit Unterlippenpflock
(s. S. 77).
Und selbst hiermit ist dem Schönheitsbestreben der
Wamuerafrauen noch nicht genug getan. Wenn das Brust und
Rücken umhüllende Tuch einmal zur Seite gleitet, sei es durch eine
unbeabsichtigte Bewegung der Frau selbst oder durch das
Vorrücken des von ihr unzertrennlichen Babys von dem
gewöhnlichen Ruhesitz auf dem Rücken der Mutter nach der Hüfte
oder gar nach der Vorderseite, so sieht das erstaunte Auge auch
diese Körperflächen mit denselben oder ähnlichen Mustern übersät
wie das Gesicht. Selbst Gesäß und Oberschenkel sollen von
solchen Ziernarben nicht frei sein. O menschliche Eitelkeit, was
treibst du doch für Blüten! ruft da der Ethnograph. Wollte er aber
hinzufügen: Da sind wir Wasungu doch bessere Menschen, so
möchte er sich wohl am besten unterbrechen. Denn zunächst tragen
auch unsere Töchter, Frauen und Schwestern noch immer recht
hübsche Überlebsel genau der gleichen Sitte in Gestalt ihrer
Ohrringe; sodann aber dürfte unser Korsett, soweit es von seiner
Trägerin zu dem Zweck angelegt wird, die Vorzüge der Figur zu
heben, ebensosehr der Diskussion unterliegen wie die geschilderten
Schönheitsmittel der Afrikanerinnen. Ich hebe das Korsett
ausdrücklich als problematischen S c h m u c k hervor, und auch nur so
weit, als es unsere Mädchen und Frauen verleitet, durch
unvernünftiges Schnüren die inneren Organe zu schädigen und
dadurch vielleicht verhängnisvoll auf die Nachkommenschaft
einzuwirken. Als Bestandteil unserer europäischen Kleidung halte
ich es dagegen nicht nur für berechtigt, sondern sogar für nötig,
denn es scheint mir den Zug der mannigfaltigen Gewänder immer
noch besser zu verteilen als ein Paar den Hosenträgern der Männer
entsprechende Schulterbänder. Ein ganz klein wenig muß ich
schließlich sogar meinem Kollegen Max Buchner in München
zustimmen, der auch aus ästhetischen Gründen das Korsett
verteidigt. Buchner hat seine berühmte Reise zum Muata Jamvo tief
unten im Kongobecken gemacht; er hat auch andere Teile Afrikas
studiert, die Südsee in den verschiedensten Richtungen durchkreuzt,
kurz, einen großen Teil von der Welt unserer heutigen Naturvölker
mit eigenen Augen gesehen; ihm steht also wohl ein maßgebendes
Urteil zu. Der Münchner Ethnograph meint nun, daß es auch den
Negerinnen und den übrigen mehr oder minder unbekleideten
Vertreterinnen des weiblichen Geschlechts auf der Erde ganz
dienlich sein würde, ihrerseits zu einem unserem Korsett
entsprechenden Gerät überzugehen. Er wünscht es für diese Frauen
nicht als Kleidungs- und nicht als Schmuckstück, sondern lediglich
als Büstenhalter. Und da hat er ganz recht; so anmutig, vielleicht gar
schön der schlanke Körper der jugendlichen Negerin mit seinen
zarten Formen uns berührt, so widerwärtig wirkt bei den späteren
Jahrgängen die durch mehrfache Geburten und das überlang
ausgedehnte Stillen der Kinder bewirkte Mißbildung der Brüste. Sie
sind wahrlich ein nichts weniger als schöner Anblick, und wenn auch
Buchner selbst nicht im mindesten daran denkt, allen Negerinnen,
Indianerinnen und Ozeanerinnen als höchstes und mit allen Kräften
anzustrebendes Ziel unseren europäischen Frauenpanzer zu
wünschen, so ist allen Verfechterinnen unseres viel angefeindeten
Korsetts in dem Münchner Gelehrten doch unstreitig ein
ausgezeichneter Sekundant erstanden.
In das Leben der Binnenlandstämme habe ich in der kurzen Zeit
noch nicht viele, aber doch recht interessante Einblicke zu tun
vermocht. Völkerpsychologisch bemerkenswert war mir während des
Marsches nach Massassi die Beobachtung, daß überall da, wo die
Eingeborenen sich aktiv am Aufstand beteiligt hatten, die Wege in
tadelloser Ordnung waren, während im Gebiet unserer
Bundesgenossen hohes Gras, ja selbst ganze Büsche die
Barrabarra nur schwer passierbar machten. Die Braven und Artigen
pochen nun auf ihre Verdienste und sagen sich: „Wir können es uns
jetzt einmal eine Zeitlang leisten; uns wird der Mdachi, der Deutsche,
so leicht nichts tun, nachdem wir so wacker zu ihm gestanden
haben.“ Herr Ewerbeck hat aber trotz alledem den Akiden und den
Jumben, den Bezirkschefs und Ortsvorstehern, recht energisch den
Standpunkt klargemacht. Diese Organe sind nämlich für die
Ordnung innerhalb ihres Bezirks verantwortlich.
 Lichte Baumgrassteppe mit Barrabarra in der Gegend von Chingulungulu.
Einen großartigen Anblick gewährt Afrika bei Nacht. Saß man
während des Hermarsches im Lager vor seinem Zelt, oder trete ich
jetzt abends vor die Tür der Barasa, des Rasthauses, in dem ich
meinen Wohnsitz aufgeschlagen habe: wohin auch das Auge
schaut, ringsum am Horizont wälzen sich rote Gluten durch die weite
Ebene. Das ist das afrikanische Brennen, ein Verfahren, das die
Neger schon seit Jahrtausenden geübt haben und welches Ihnen,
Herr Geheimrat, als dem ausgezeichneten Kenner der Geographie
der Alten, schon seit Ihrer Jugendzeit, wenn auch vielleicht
unbewußt, geläufig ist. Sie wissen ja, als der alte Karthager Hanno
an der Westküste Afrikas gen Süden fuhr, erschreckte ihn und seine
Mannschaften nichts so sehr und nachhaltig als glühende
Feuerströme, die nachts von den Küstenbergen zur Ebene
niederflossen. Nach meiner unmaßgeblichen Meinung haben diese
Feuerströme absolut nichts mit dem Vulkanismus gemein, wie man
sooft behauptet hat, sondern es sind dieselben Brennprozesse
gewesen, die von den Bewohnern des schwarzen Erdteils zur
Trockenzeit noch jetzt allnächtlich veranstaltet werden.
 Über den Nutzen oder Schaden dieses Brennens ist in unserer
Kolonialliteratur schon viel geschrieben worden; die einen verurteilen
es, weil es den Baumwuchs schädige, die anderen stellen sich auf
die Seite der Eingeborenen und sagen: nur dadurch, daß man das
dichte, hohe Gras und das Unterholz des afrikanischen Urwaldes in
regelmäßigen Zwischenräumen durch Feuer vernichte, könne man
des Ungeziefers, das sich sonst zu Myriaden vermehren würde,
einigermaßen Herr werden; zudem sei die Asche einstweilen noch
das einzige Düngemittel großen Stils. Ich halte mich nicht für
berechtigt, den Streit der Meinungen zu entscheiden; mich fesseln
viel mehr allabendlich die prachtvollen Leuchteffekte der nahen und
fernen Flammenherde, die sich in der dunstigen Atmosphäre in
verschiedenster Helle und Farbe widerspiegeln. Für den Reisenden
gefährlich ist übrigens keiner dieser Brände; wo die Flamme eine
Partie vollkommen trocknen Grases erfaßt, da rauscht sie wohl mit
dem Knattern eines lebhaften Kleingewehrfeuers darüber hin; aber
sonst und im allgemeinen müssen die Menschen sogar noch durch
zielbewußtes Weitertragen des Feuerbrandes nachhelfen. In jedem
Fall haben sie Richtung und Ausdehnung des Feuers völlig in der
Hand.
Dieses Brennen ist, soweit ich ein Urteil zu fällen berechtigt bin,
nur bei der ganz merkwürdigen Vegetationsform möglich, die den
größten Teil Afrikas charakterisiert und die auch die große, weite
Ebene hier im Westen und Nordwesten des Makondeplateaus in
ihrer ganzen Ausdehnung bedeckt. Das ist die „lichte
Baumgrassteppe“, wie der Geologe Bornhardt sie treffend genannt
hat. In der Tat ist diese Vegetationsform weder ganz Wald, noch
ganz Steppe, sie vereinigt vielmehr beides. Denken Sie sich einen
besonders stark verwilderten bäuerlichen Obstgarten bei uns daheim
im deutschen Vaterlande, wo man leider noch viel zu wenig Gewicht
auf diesen Teil des Feldbaues legt, und setzen Sie unter die
struppigen, vereinzelt stehenden Apfel-, Birnen- und
Zwetschenbäume statt des bescheidenen deutschen Grases dieses
zwei, auch drei Meter hohe, fast rohrähnliche afrikanische;
untermischen Sie es dann mit einem dornigen, aber ebenfalls nicht
sehr dichten Unterholz, und verbinden Sie schließlich die Kronen der
nicht übergroßen, d. h. sicherlich nicht über 10 bis 12 Meter hohen
Bäume, die trotz aller Varietäten doch ziemlich allgemein den
Eindruck unseres Ahorns erwecken, durch ein System luftiger
Lianen. Haben Sie das alles getan, so haben Sie, ohne weitere
Betätigung Ihrer Phantasie, diese Vegetationsform, die man hier mit
dem allgemeinen Namen P o r i bezeichnet, während im Norden der
Name Myombowald vorwaltet. Während der Regenzeit und
unmittelbar nach ihr muß dieses Pori seine unleugbaren Reize
haben, ja Ewerbeck und sein Begleiter Knudsen singen für diesen
Zeitraum sein Lob in den höchsten Tönen. Jetzt, im Juli hingegen, ist
es alles andere als schön; weder imponiert es durch die Zahl und
Stattlichkeit seiner Bäume, noch erquickt es durch irgendwelchen
Schatten, noch bringt die Eintönigkeit des Geländes Abwechselung
in dieses ewige Einerlei, welches den Reisenden gleich hinter
Nyangao und nach dem Übergang auf das rechte Lukulediufer
begrüßt und welches ihn erst nach mehrwöchigem Marsch hoch
oben am oberen Rovuma freigibt. „Das also ist die Üppigkeit der
Tropen, und so sieht ein immergrüner Urwald aus“, dachte ich,
nachdem ich einen Tag lang diesen Genuß gekostet hatte. Genau
wie in bezug auf die angebliche Appetitlosigkeit des Weißen in den
Tropen, müssen wir also auch bezüglich der allgemeinen
Vorstellungen von der vermeintlichen Üppigkeit Äquatorialafrikas für
eine bessere Belehrung unserer Volkskreise sorgen. Sie machen
sich sonst von der Zukunft Deutsch-Ostafrikas übertrieben
glänzende Vorstellungen.
Geradezu unangenehm wird dieses Pori überall dort, wo die
Herren des Landes unmittelbar vorher gebrannt haben. Links und
rechts vom Wege nichts als eine dicke, schwarze oder graue
Aschenschicht; darüber hingelagert der Leichnam eines vom Sturm
gefällten Baumes, der munter weiterglimmt und glüht; über der Erde
aber ein nunmehr durch kein Gras mehr behinderter, tiefer Einblick
in die vordem so undurchsichtige und undurchdringliche Baumweite.
Für den Jäger bedeutet dieser Zustand eine Lust, denn nun kann er
das Wild auf weite Entfernungen erspähen; für den Wanderer, zumal
den mit einer großen Karawane behafteten, ist er eine Qual.
Weniger in der Frühe des Tages; denn dann bindet der starke Taufall
die feinen Staubteilchen noch fest zusammen. Steigt die Sonne aber
höher, so entwickeln sich starke Luftdifferenzen auf engem Raum;
harm- und arglos wandelt man in der glühenden Mittagshitze fürbaß,
da wirbelt’s unversehens vor den Füßen auf; eine schwarze
Schlange steigt in rasenden Spiralen senkrecht empor, tänzelt in
koketten Kurven um den in reinstes Khaki Gekleideten herum und
verschwindet dann rasch, mit leisem Kichern, als wollte sie sich über
den Fremdling lustig machen, seitwärts hinter den Bäumen. Den
schwarzen Begleitern hat die Schlange nichts getan, denn sie sind ja
von ihrer Farbe. Doch wie sieht der Expeditionsführer aus! Zwar ist
er nicht zum waschechten Neger geworden, doch sieht er einem
Mohren immerhin ähnlich; unter diesen Umständen werden die
beiden Getreuen, Moritz und Kibwana, im Lager nachher nichts
Eiligeres zu tun haben, als dem Herrn das Bad zu bereiten und ihn
vom Scheitel bis zur Sohle gründlich abzuseifen. Und „das hat mit
ihrem Wehen die Poriwindhose getan!“
Tröstlich ist in diesen kleinen Nöten des Marschlebens der
unverwüstliche Frohsinn der Eingeborenen. Im ehemaligen
Aufstandsgebiet der Wamuera herrschte wenig Stimmung zu Tanz
und Lustbarkeit, dazu erging es den Leuten doch zu schlecht; überall
sonst entwickelte sich, sobald unser Lager nur halbwegs eingerichtet
war, unter den stets scharenweise herbeigeströmten Landeskindern
ein in seinem allgemeinen Verlauf stets gleiches, in seinen
Einzelheiten jedoch stets wechselndes Bild. Der Neger m u ß wohl
tanzen. Wie der Deutsche, sobald ihn nur irgend etwas über das
Stimmungsniveau des Werkeltags hinaushebt, den unbezwinglichen
Drang zum Singen in sich fühlt, so schart sich der Neger bei jeder
Gelegenheit zu seiner Ngoma zusammen. Ngoma heißt zunächst
nichts anderes als Trommel; in übertragener Bedeutung bezeichnet
das Wort jede Festlichkeit, die zum Klang dieser Trommel gefeiert
wird. Diese Festlichkeiten haben vor den unseren den
unbestreitbaren Vorzug voraus, daß bei ihnen Musik, Tanz und
Gesang gleichzeitig ertönen. Die Kapelle trommelt, improvisiert aber
auch zuweilen eine Art Schnadahüpfl; der Kreis ringsum bildet den
Chor; zum Rhythmus des Gesanges bewegt er sich gleichzeitig um
die Kapelle herum. Das ist das gewöhnliche Bild. Es ist bei aller
Fremdartigkeit so reizvoll, daß in den Küstenstädten selbst die
„ältesten Afrikaner“ es nicht für unter ihrer Würde halten, von Zeit zu
Zeit diesem Ausdruck autochthonen Volkstums die Ehre einer wenn
auch nur kurzen Anwesenheit angedeihen zu lassen. Andere,
weniger angekränkelte Weiße sind bei diesen Volksfesten hingegen
förmliche Habitués, die keinen Sonnabend abend — Sonnabend ist
der gesetzlich freigegebene Ngomentag — vorübergehen lassen,
ohne sich stundenlang in den Dunstkreis der schwitzenden,
keuchenden Menge zu stellen.
Außerordentlich ansprechend ist eins dieser Reigenspiele, das
von den Frauen aller Gegenden, die ich bisher berührt habe, bei
jeder nur denkbaren Gelegenheit ausgeführt wird. Es hat den
Namen Liquata, das Händeklatschen. Die Frauen und Mädchen
treten zusammen und stellen sich, die Gesichter nach innen, im
Kreise auf. Plötzlich fliegen die Arme in die Höhe, der Mund öffnet
sich, die Füße zucken zum ersten Takt. Im gleichen Takt und im
gleichen Rhythmus setzt nun alles ein, Händeklatschen, Gesang und
Tanz. Mit der eigentümlichen Grazie, die alle Bewegungen der
Negerin kennzeichnet, bewegt sich der ganze Kreis nach rechts;
zuerst erfolgt ein relativ großer Schritt, dem drei merklich kleinere
folgen; diesem Rhythmus ist das Händeklatschen nach Intensität
und Takt genau angepaßt, desgleichen auch der Gesang, den ich
sogleich wiedergeben werde. Plötzlich, bei einem bestimmten Takt,
lösen sich aus der Reihe der Tänzerinnen zwei Figuren los; sie
tänzeln in die Mitte des Kreises hinein, bewegen sich dort in
bestimmten, dem Auge leider nur zu schnell entschwindenden
Figuren umeinander herum und treten dann wieder an bestimmte
Stellen des Kreises zurück, um im gleichen Augenblick zwei anderen
Solotänzerinnen Platz zu machen. So geht das Spiel reihum;
unermüdlich, ohne auszusetzen und ohne Abschwächung setzt es
sich Stunde um Stunde fort; unbekümmert auch um die Babys, die in
dem unvermeidlichen Rucksack auf dem Rücken der Mama alles
mitmachen müssen. In dem engen, heißen und oft genug auch
schmutzigen Behälter schlafen, wachen und träumen sie, während
die Mutter die derbe Mörserkeule schwingt oder den schweren
Läufer zur Mehlbereitung über den Reibstein führt; während sie die
Felder hackt, das Unkraut jätet und die Ernte einholt; während sie
den schweren Tonkrug vom weitentlegenen Quell auf dem Kopf nach
Hause trägt, und während sie sich im Tanze wiegt. Es ist kein
Wunder, wenn unter solchen Umständen der Negersprößling über
Takt und Rhythmus seines Volkes schon vollkommen im Bilde ist,
kaum daß er das Tragtuch und die mütterliche Brust verlassen hat.
Fast möchte es allein die Reise nach Ostafrika lohnen, diese
winzigen Knirpse von drei und vier Jahren mit absoluter Sicherheit
im Reigen der Alten dahinschweben zu sehen.
Und hier der überaus geistvolle Text zum sinnvollen Spiel! Steht
man dabei und sieht die Frauenwelt im wiegenden Tanz sich regen,
bedient man vielleicht gar den Kinematographen, so achtet man
allen vorgefaßten Absichten zum Trotz doch viel zu wenig auf den
Wortlaut des Tanzgesangs. Baut man dann nach vollendetem Tanz
die Teilnehmerinnen vor dem Phonographentrichter auf, so möchte
man schier glauben, man hätte sich verhört, so inhaltlos ist dieser
Sang. Ich habe die Liquata an den verschiedensten Stellen
aufgenommen, aber niemals ist mehr herausgekommen, als ich hier
bieten kann. Hier Text und Tonfall:

ad infinitum wiederholt.
*) Kein reines , sondern ein zwischen diesem und
, doch näher an liegender Ton.
Lied anhören
MusicXML-Datei herunterladen

Sie werden zugeben, Herr Geheimrat, übermäßig viel Geist wird

in diesem Liede keineswegs vergeudet; allein, das ist ein Zug, der
allen Negerliedern hier im Süden eigen ist; selbst die Meister des
Gesanges in Afrika, meine Wanyamwesi, liefern in dieser Beziehung
nicht übermäßig viel mehr. Hier können wir wirklich und mit Fug und
Recht sagen: „Wir Wasungu sind doch bessere Sänger!“
 Massassiberge. Nach Zeichnung des Salim Matola (s. S. 455).

Sechstes Kapitel.
Umschau.
Massassi, 25. Juli 1906.

Seit reichlich einer Woche bin ich in Massassi. Mein Heim ist
eine im reinsten Yaostil gebaute Hütte, die von den Eingeborenen
auf Befehl des kaiserlichen Bezirksamts eigens für durchreisende
weiße Herren gebaut worden ist. Die Hütte oder, wie man wohl
sagen muß, das Haus, denn es ist ein stattlicher Bau von zirka 12
Meter Länge bei 6 Meter Tiefe, liegt außerhalb der Boma, welche
den hiesigen Polizeiposten beherbergt. Es ist ein Ovalbau, dessen
Dachform aufs täuschendste einem umgekehrten Boote gleicht. Das
Material der Wände ist wie überall im Lande Bambus und Holz, das
innen und außen sauber mit grauschwarzem Lehm verputzt ist. Im
Gegensatz zu den Eingeborenenhäusern hat mein Palais den
Vorzug von Fenstern. Das heißt: Fensterscheiben fehlen; kriecht
man abends unter sein Moskitonetz in das Tippelskirchsche Feldbett
hinein, so schließt man vorher die Luken mit Türen aus derben
Bambusstäben. Der Fußboden ist, wie auch in allen
Eingeborenenhütten, gestampfter Estrich. Er läßt sich im
allgemeinen ziemlich sauber halten, ist aber nicht für die scharfen
Kanten europäischer Stiefelabsätze eingerichtet; sie richten in ihm
sehr bald erhebliche Verwüstungen an. Das ganze Innere stellt ein
ungeteiltes Ganzes dar, das lediglich unterbrochen wird durch die
zwei gleichsam in den Brennpunkten der Ellipse stehenden Pfeiler,
auf denen das schwere Strohdach ruht. Dieses ragt nach außen und
unten hin weit über die Hauswand hinaus, wird an seinem
Außenrande von einer weiteren Ellipse von kürzeren Pfeilern
getragen und bildet damit jenen schattigen, breiten Umgang um das
ganze Haus, der unter dem Namen Barasa ein unumgänglicher
Bestandteil jedes ostafrikanischen Wohngebäudes ist. —
Mit dem Namen Massassi bezeichnen die Eingeborenen einen
ganzen Bezirk. Er ist geologisch, geographisch, botanisch und
ethnographisch gleich interessant. Sehr bald hinter Nyangao, von
der Küste aus gerechnet, beginnt die berühmte lichte
Baumgrassteppe; gleichzeitig treten die Ränder des
Makondeplateaus im Süden und der verschiedenen kleinen
Hochländer im Norden des Lukuledi immer weiter zurück. So
wandert man Tag um Tag in vollkommen horizontaler Ebene und in
gleich einförmiger Vegetation dahin. Das ist nichts weniger als
anregend und interessant. Aber was ist das? Eine glänzend graue,
riesige Felswand grüßt bei einer Biegung des Weges unverhofft über
das endlose Meer dürrer Baumkronen herüber. Man atmet auf und
vergißt angesichts des neuen landschaftlichen Reizes alle Müdigkeit.
Auch der Schritt der schwerbelasteten Träger wird schneller.
Plötzlich hört der Wald, der mit der Annäherung an jenen Fels
dichter, grüner und frischer geworden ist, auf; statt der einen steilen
Felswand erblickt das Auge nunmehr aber eine ganze lange Reihe
solcher Berggipfel, die sich dem Scheine nach quer über unseren
Weg hinüberzieht und ihn versperrt. Doch dem ist nicht so, denn hart
am Fuß der ersten dieser Kuppen schwenkt auch der Weg nach
Südsüdosten ab, um nunmehr die ganze Bergreihe in nächster Nähe
zu begleiten. Wo sie endlich zu Ende geht, da ist auch er zu Ende,
denn dort liegt, eingebettet in einen förmlichen Kreis von
Bergkindern, wie der Neger in seiner Sprache sagen würde, d. h.
zwischen niedrigen, nur 100 oder wenige 100 Meter hohen Hügeln,
die Militärstation Massassi.
 Inselberg von Massassi.

Die Gneiskuppen von Massassi sind in der geologischen Literatur

über Afrika hochberühmt; sie sind aber auch etwas Einzigartiges,
nicht ihren petrographischen Bestandteilen nach, sondern wegen
ihrer enggeschlossenen Reihenform. Orographisch wird dieser
ganze Osten Afrikas, in dem ich mich befinde, charakterisiert durch
„Inselberge“, wie sie der Geologe Bornhardt nennt. Der Name ist gar
treffend; würde sich der Erdteil um etliche hundert Meter senken,
oder der Indische Ozean um ebensoviel steigen, so würde das
ganze Lukuledital, auch das des Umbekuru und des Rovuma, sicher
auch das mancher Flüsse von Portugiesisch-Ostafrika, fernerhin
dann die ganze riesige Ebene westlich vom Wamuera- und vom
Makondeplateau, einen gewaltigen See bilden. Über dessen
Oberfläche würden hier im Westen lediglich diese klobigen, plumpen
Gneiskuppen als winzige Inseln hervorragen, während nach der
Küste zu die genannten Plateaulandschaften sozusagen die
Kontinente auf diesem Stück Erdoberfläche darstellen würden.
 Im allgemeinen sind diese Inselberge völlig regellos über das
ganze, weite Land zerstreut. Klettere ich auf eine der kleinen
Kuppen unmittelbar hinter meinem Wohnhaus, so vermag ich nach
Norden, Westen und Süden eine fast unabsehbare Schar dieser
merkwürdigen Gebilde zu überblicken. Meist liegen sie einzeln oder
in Gruppen angeordnet da; nur eine Anzahl von Tagereisen weiter im
Westen häufen sie sich in der Madjedjelandschaft in dichter
Scharung zusammen. In unmittelbarster Nähe bildet dann die
Massassikette die andere Ausnahme. Der Regellosigkeit der
Anordnung entspricht auch eine große Verschiedenheit der Höhe;
viele dieser Kuppen sind nur winzige Hügel; andere wieder ragen
steil und unvermittelt noch 500 Meter und mehr über die hier bei
Massassi schon reichlich 400 Meter hochgelegene Ebene empor.
Damit erreichen also die höchsten dieser Berge die Höhen unserer
deutschen Mittelgebirge.
Über die Entstehung dieser seltsamen Bergformen habe ich als
Nichtgeologe natürlich kein Urteil. Nach Bornhardt, der in seinem
großartigen Werke „Zur Oberflächengestaltung und Geologie
Deutsch-Ostafrikas“ (Berlin 1900) die erdgeschichtlichen Züge
dieses Landschaftsbildes in bewunderungswürdiger Plastik
geschildert hat, sind alle diese Inselberge Zeugen eines uralten und
niemals unterbrochenen Kampfes zwischen der aufbauenden
Tätigkeit des Meeres und der abflachenden, nagenden, grabenden,
erniedrigenden Wirkung des fließenden Wassers und der
Atmosphärilien. Er sieht diese Gegend zur Primordialzeit als eine
ungeheure Ebene lückenlosen Urgneises. In sie gruben die Bäche
und Flüsse im Laufe der Zeit ihre Täler, alle in mehr oder weniger
gleicher Richtung. Es blieben also nach Ablauf dieses
langdauernden Prozesses langgestreckte Bergrücken zwischen
jenen einzelnen Tälern stehen. Dann kam aber eine andere Zeit: an
die Stelle der Zerstörung trat die der Auflagerung; wo vordem
Regen, Quellen, Bäche und Ströme das zerkleinerte und zersetzte
Gestein abwärts und meerwärts getragen hatten, flutete jetzt das
Meer selbst; es füllte die Täler wieder aus und deckte auch wohl den
ganzen, alten Schauplatz mit seinen Sedimenten zu. Diese
Sedimente wurden im Laufe weiterer Zeiträume selbst wieder zu
hartem Gestein. Und abermals wechselte die Szenerie; wieder lag
der Boden trocken, und wieder konnten Wind, Regen und
strömendes Wasser ihr Zerstörungswerk beginnen. Aber sie
arbeiteten diesmal in anderer Richtung; hatten sie den Detritus
vordem nach Norden oder Süden geführt, so schleppten sie ihn
diesmal rechtwinkelig dazu nach Osten. Und sie feilten und feilten,
trugen die ganze Oberdecke ab und zernagten auch die langen
Rücken, die als Reste der ersten Zerstörungsperiode noch
übriggeblieben waren. Und als sie schließlich auch dieses Urgestein
bis zur Sohle der ersten Täler hinweggenagt hatten, siehe, da zeigte
sich, daß als kümmerlicher Rest der alten, stolzen Gneisdecke
lediglich diese in den Kreuzungspunkten der beiden Abrasions- und
Erosionsrichtungen gelegenen festen Kerne übriggeblieben waren.
Das sind eben diese Inselberge. Die Bornhardtsche Theorie ist kühn;
auch setzt sie ganz unmeßbare Zeiträume voraus, aber sie ist als
der plausibelste von allen Erklärungsversuchen allgemein
angenommen worden. In jedem Fall ist sie ein glänzender Beweis
der Kombinationsgabe deutscher Gelehrter.
Mit ihrem ungemein steilen Anstieg und der Unmittelbarkeit, mit
der diese wuchtigen Steinmassen der Ebene entsteigen, wirken alle
diese Berge, wo sie auch immer erscheinen, beherrschend auf die
Umgebung ein; wo sie aber so wundervoll geschlossen auftreten wie
hier im Mkwera, im Massassi, Mtandi, Chironji, Kitututu, im
Mkomahindo, und wie sie alle heißen die großen und die kleinen
Erhebungen hier in meinem Gesichtskreis, da sind sie etwas
Unvergleichliches und dem Forscher Unvergeßliches. Wird erst
einmal die geplante Südbahn das Stromgebiet des Umbekuru
durchschneiden, so wird es keinen lohnenderen Ausflugspunkt für
unsere Weltreisebureaus geben als die Bergreihe von Massassi!
Auch floristisch kommt der Besucher auf seine Kosten. Weilt man
erst im Schatten dieser Berge, so ist die Öde und Eintönigkeit des
Pori mit einem Schlage vergessen; Pflanzung reiht sich an
Pflanzung, Beet an Beet; Hirsefelder der verschiedensten Varietäten
neigen ihre fruchtschweren Kolben und Rispen in dem frischen
Morgenwinde, der nach der stickigen, heißen Luft des tagelangen
Porimarsches eine wahre Erquickung ist. Bohnen aller Art, Kürbisse
und Melonen erfreuen das Auge durch ihr frisches Grün; rechts und
links vom Wege breitet der Mhogo, der Maniok, seine sperrigen
Zweige. Wo aber alle jene Fruchtpflanzen noch eine Lücke gelassen
haben, da klappert die Basi-Erbse in ihrer Schote. Möglich ist diese
für den Süden Deutsch-Ostafrikas erstaunliche Fruchtbarkeit nur
durch die geologische Beschaffenheit des Bodens. Wohin der Fuß
auf der großen Barrabarra getreten ist, und wohin das Auge nördlich
und südlich geschaut hat, überall ist lehmiger Sand und sandiger
Lehm an der Zusammensetzung der obersten Erdschicht in erster
Linie beteiligt; nur an Stellen größerer Wasserwirkung sind hie und
da nackte, glatte Gneisfelsen zutage getreten, oder aber die
Fußsohle ist knirschend über harte Quarzite dahingewandert.
Lediglich wo diese mächtigen Gneiszeugen das Einerlei
unterbrechen, da findet das den wirtschaftlichen Wert des Landes
prüfende Auge sich in vollem Maß befriedigt. Gneis verwittert leicht
und gibt einen guten Boden. Das haben auch die Schwarzen seit
langem entdeckt, und wenn sie auch die weniger fruchtbaren Teile
ihrer Heimat durchaus nicht verschmähen, so sind diese Zonen um
die Gneisinseln doch stets das bevorzugte Ziel autochthoner
Besiedelung gewesen. Massassi mit seiner gewaltigen, sich
stundenlang hinziehenden Ausdehnung ist ein typisches Beispiel
eines solchen wirtschaftlichen Verständnisses.
Bei diesem Zusammenströmen aus aller Welt ist es kein Wunder,
wenn die Frage nach der Stammeszugehörigkeit der Massassileute
ein wahres Völkerchaos zur Antwort gibt: Makua, Yao, Wangindo,
einzelne Makonde, und zu alledem ein großer Prozentsatz von
Küstenleuten; das sind die freiwillig hergewanderten Elemente
dieses kleinen Kulturzentrums. Zu ihnen allen kommt ein
Konglomerat von Stammeselementen des innersten Afrika, das hier
unter dem Namen Wanyassa zusammengefaßt wird. Diese
Wanyassa sind der lebende Beweis eines menschenfreundlich im
höchsten Sinne gedachten Experimentes, das leider nicht in dem
Umfange gelungen ist, wie es von jenen Philanthropen erwartet und
erhofft wurde. Gerade der Süden des heutigen Deutsch-Ostafrika ist
vor Jahrzehnten der Schauplatz des lebhaftesten Sklavenhandels
gewesen; durch diese leicht gangbaren, damals noch
dichtbevölkerten Gefilde hat sich der von den Arabern Sansibars und
der Küste genährte und gepflegte Sklavenhandel mit Vorliebe