Aquaculture 507 (2019) 144–154

Contents lists available at ScienceDirect

Aquaculture
journal homepage: www.elsevier.com/locate/aquaculture

Evaluation of defatted black soldier fly (Hermetia illucens L.) larvae meal as T

an alternative protein ingredient for juvenile Japanese seabass (Lateolabrax
japonicus) diets
Guoxia Wanga,1, Kai Penga,1, Junru Hua, Cangjin Yib, Xiaoying Chena, Haomin Wub,
⁎
Yanhua Huanga,b,
a
Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Key Laboratory of Animal Nutrition and Feed Science (South China) of Ministry of Agriculture,
Guangdong Key Laboratory of Animal Breeding and Nutrition, Guangdong Public Laboratory of Animal Breeding and Nutrition, Guangzhou 510640, China
b
Guangzhou Fishtech Biotechnology Co., Ltd., Guangzhou 510640, China

A R T I C LE I N FO A B S T R A C T

Keywords: Defatted black soldier fly larvae meal (DBSFLM) has been shown a promising fish meal (FM) substitute in diets
Defatted black soldier fly for turbot, rainbow trout, Jian carp, Pacific white shrimp and Atlantic salmon, but it has not been examined as an
Fish meal alternative protein source in Japanese seabass (Lateolabrax japonicus) diets. A 56-day feeding trial was conducted
Lateolabrax japonicus to assess the effects of partial replacement of dietary FM with DBSFLM on the growth performance, whole body
Growth performance
composition, blood metabolites, digestive enzyme activities, hepatic and intestinal histomorphology, and lipid
Histology
metabolism related genes expression of juvenile L. japonicus. Five isoproteic (39%) and isolipidic (11%) diets
Lipid metabolism related genes
were formulated by replacing 0% (FM), 16% (DBSFLM16), 32% (DBSFLM32), 48% (DBSFLM48) and 64%
(DBSFLM64) of fish meal. Each diet was randomly assigned to triplicate groups of 30 fish per tank. Fish were fed
two times daily to apparent satiation. Results showed that growth performance, somatic indexes, hepatic and
intestinal histomorphology, and the intestinal antioxidant and immunity indexes of fish were not affected
(P > 0.05) by dietary treatments. Fish consuming DBSFLM48 and DBSFLM64 had higher (P < 0.05) feed in-
take, but lower (P < 0.05) whole body ash content and ash retention along with serum concentrations of total
cholesterol, triacylglycerol, high density lipoprotein cholesterol and malondialdehyde than those fed FM.
DBSFLM inclusion did not alter activities of hepatic trypsin, lipase and amylase, but increased (P < 0.05) ac-
tivity of intestinal lipase for fish fed DBSFLM48 and DBSFLM64 than those fed FM. Relative genes expression
were up-regulated (P < 0.05) in hepatic lipoprotein lipase for fish fed DBSFLM64 and in hormone sensitive
lipase for fish fed DBSFLM32, DBSFLM48 and DBSFLM64, whereas down-regulated (P < 0.05) in fatty acid
synthase for fish fed DBSFLM diets than those fed FM. It was concluded that the replacement of dietary FM with
DBSFLM up to 64% level did not alter growth performance, hepatic and intestinal histomorphology of L. ja-
ponicus. The increased feed intake, reduced blood lipid and inhibited hepatic lipid deposition suggest that
DBSFLM can be a desirable protein alternative source as a replacement of fish meal in L. japonicus diets.

1. Introduction contents, essential amino acid imbalances, presence of anti-nutritional

The development of commercial aquatic feeds has traditionally been
based on fish meal (FM) as the primary protein source (Henry et al.,
2015). However, the decrease in the availability and the increase in the
prices of FM have prompted the search for sustainable alternatives.
Plant feedstuffs usually have deficiencies including lower protein
factors and absent of certain FM components (i.e. taurine and hydro-
xyproline) (Aksnes et al., 2008; Pinto et al., 2013), resulting in the
potential problems of poor growth performance (Yousif et al., 2014),
intestinal inflammation (Merrifield et al., 2011) and decreased palat-
ability of the plant-based diets (Kader et al., 2012). Over the last
decade, the value of insect protein as partial or complete replacements

⁎
Corresponding author at: Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Key Laboratory of Animal Nutrition and Feed Science (South
China) of Ministry of Agriculture, Guangdong Key Laboratory of Animal Breeding and Nutrition, Guangdong Public Laboratory of Animal Breeding and Nutrition,
Guangzhou 510640, China.
E-mail address: huangyh111@126.com (Y. Huang).
1
K. Peng and G. Wang should be considered joint first author.

https://doi.org/10.1016/j.aquaculture.2019.04.023
Received 6 December 2018; Received in revised form 26 February 2019; Accepted 5 April 2019
Available online 08 April 2019
0044-8486/ © 2019 Published by Elsevier B.V.
G. Wang, et al. Aquaculture 507 (2019) 144–154

for FM has been studied (Lock et al., 2018; Gasco et al., 2018a). Insects Table 1
use for food and feed can provide a more sustainable solution to address Ingredients and proximate composition of the experiment diets.
protein deficiency and environmental deterioration in many regions of Items Diets
the world owing to their higher edible share and feed conversion rate,
the lower greenhouse gas and ammonia emissions, along with less FMa DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64
water footprint and land use compared with conventional livestock
Ingredients (g/kg
(Salomone et al., 2017; Meneguz et al., 2018; Martenat et al., 2019). DM)
The European Commission has recently approved the use of processed Fish meal 250 210 170 130 90
insect protein in aquafeeds (Regulation 2017/893/EC, 2017). Defatted black 0 48 96 144 192
Black soldier fly larvae (BSFL), Hermetia illucens L. (Diptera: soldier fly
larvae meal
Stratiomyidae), are efficient converters of biowaste (i.e. animal
Peanut bran 100 100 100 100 100
manure, food waste and other organic wastes) into animal biomass for Soybean meal 200 200 200.5 210 210
feed ingredients of poultry, livestock, pet and aquaculture. Black soldier Rapeseed meal 100 100 100 100 100
fly is a promising insect species to be used in animal feed because the Wheat flour 239.6 227.2 214.2 192.4 180.3
Monocalcium 15 15 15 15 15
BSFL meal shows an essential amino acid pattern similar to that of FM
phosphate
(Henry et al., 2015). As a potential new source of protein and amino Fish oil 30 33 36 39 42
acids, lipids and specific fatty acids, and even functional molecules (Hu Soya oil 20 20 20 20 20
et al., 2017a, 2018; Cummins et al., 2017; Elhag et al., 2017; Park and Soy lecithin 20 20 20 20 20
Yoe, 2017; Dumas et al., 2018; Gasco et al., 2018b), BSFL meal has been Vitamin premixb 1 1 1 1 1
Mineral premixc 5 5 5 5 5
well documented to be suitable to replace FM in aquafeeds without
Vitamin C ester 1.4 1.4 1.4 1.4 1.4
impairing growth performance or digestibility (Lock et al., 2016; Sealey Choline chloride 5 5 5 5 5
et al., 2011; Magalhães et al., 2017; Renna et al., 2017; Zhou et al., Betaine 5 5 5 5 5
2017; Xiao et al., 2018). Lysine 2.0 2.6 3.1 3.4 3.9
Methionine 6.0 6.8 7.8 8.8 9.4
Defatting BSFL can be a means of separating the high insect protein
Proximate
for use in animal feed, and insect oil for use in feed and biofuel (Makkar composition
et al., 2014). The processing of BSFL into defatted protein-rich meal and Dry matter (%) 90.45 90.49 90.53 90.57 90.60
oil fractions has become a frequent practice to minimize the variations Crude protein (% 39.09 39.01 38.93 39.11 39.01
in biochemical composition and attenuate the risk of lipid oxidation DM)
Lipid (% DM) 10.73 10.74 10.76 10.76 10.78
(Dumas et al., 2018). The variations in nutrient composition, i.e. crude
Ash (% DM) 6.63 6.92 6.72 6.75 6.84
protein and crude lipid can vary from 40 to 54% and 15 to 49%, de- Gross energy 19.37 19.25 19.28 19.26 19.06
pending on the substrates fed to larvae and processing methods (Lock (KJ/g DM)
et al., 2016; Makkar et al., 2014).
Despite the great research interest for black soldier fly, data on
a
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by
biology and nutrition studies of defatted black soldier fly larvae meal defatted black soldier fly larvae meal.
b
One kilogram of vitamin premix provided: VA 3230000 IU, VD
(DBSFLM) remain scarce. Currently, only few studies have been con-
1600000 IU, VE 16 g, VK3 4 g, VB1 4 g, VB2 8 g, VB6 4.8 g, VB12 0.016 g, nico-
ducted to evaluate effects of DBSFLM on several aquatic animal species,
tinic acid 28 g, pantothenic acid calcium 16 g, biotin 0.064 g, folic acid 1.285 g,
including Atlantic salmon (Salmo salar) (Belghit et al., 2018), rainbow inositol 40 g.
trout (Renna et al., 2017; Dumas et al., 2018), Jian carp (Cyprinus carpio c
One kilogram of vitamin premix provided: Ca 230 g, K 36 g, Mg 9 g, Fe 10 g,
var. Jian) (Li et al., 2017a, 2017b) and Pacific white shrimp (Litope- Zn 8 g, Mn 1.9 g, Cu 1.5 g, Co 0.25 g, I 0.032 g, Se 0.05 g.
naeus vannamei) (Cummins et al., 2017). However, results observed
among these studies are inconsistent. This is probably mainly due to objective of this study was to evaluate the effects of partial replacement
larvae reared on various substrates (i.e. greenhouse waste streams, of dietary FM with DBSFLM on the growth performance, blood meta-
vegetable by-products, dried distillers grains with solubles or brewer's bolites, digestive enzyme activities, hepatic and intestinal histomor-
grains, kitchen waste), and/or DBSFLM produced from different de- phology, and lipid metabolism related genes expression of juvenile L.
fatting methods (i.e. mechanical press without solvents, Soxhlet japonicus.
method, solvent extraction), which can be challenging for obtaining
consistent quality of insect meal and formulating diets with consistent
nutrient composition. Recently, effects of different substrates on BSFL 2. Materials and methods
composition have been well documented (Tschirner and Simon, 2015;
Liland et al., 2017; Meneguz et al., 2018). Shumo (2018) reported that 2.1. Diet preparation
the nutrient composition from BSFL reared on kitchen waste was rela-
tively higher compared with chicken manure, brewer's spent grain and Five experimental diets were formulated to be isoproteic and iso-
cow dung. Spranghers et al. (2017) showed that BSFL reared on kitchen lipidic with approximately 39% crude protein and 11% crude lipid
waste had higher crude lipid and lower ash contents than those of (Table 1). The diet was formulated using fish meal, soybean meal and
larvae reared on chicken feed, vegetable waste and biogas digestate. rapeseed meal as main protein sources, and fish oil, soya oil and soy
Our pervious study also found that BSFL based on kitchen waste con- lecithin as main lipid sources. The nutritional composition of fish meal
tained higher unsaturated and essential fatty acids than chicken manure was as follows: dry matter (DM) 91.2%, crude protein (CP) 65.9%,
(Hu et al., 2017b). crude lipid (CL) 8.1% and ash 14.6%. The DBSFLM obtained processing
Japanese seabass (Lateolabrax japonicus) is one of the most com- larvae (8-day-old) reared on kitchen waste substrate were provided by
mercially valuable carnivorous species that has been widely cultured in Guangzhou Fishtech Biotechnology Co., Ltd. (Guangzhou, China) and
Asia because of its rapid growth and the ability to adapt to a wide range had the following chemical composition: DM 90.2%, CP 55.4%, CL
of salinity (Xu et al., 2016). Our previous study by Hu et al. (2018) 1.6%, ash 18.6% and chitin 7.69%. The BSFL were first sterilized during
indicated that up to 50% of FM can be replaced by BSFL meal (larvae drying process at 120 °C for 20 min, ground and followed by extraction
reared on kitchen waste) without influencing growth performance of with a 2:1 (v/v) ethyl alcohol (95%) to settle for 10 min, then air-dried
juvenile L. japonicus. However, the feeding value of DBSFLM has not under a fume hood for 24 h and stored at −20 °C until use. The DBSFLM
been examined as an alternative protein source in L. japonicus. The was added to the diets to replace fish meal in the basal diet at the rate of

145
G. Wang, et al. Aquaculture 507 (2019) 144–154

Table 2 Table 2 and Table 3, respectively.

Fatty acid composition (g/100 g of total fatty acids) of experimental diets.
Itemsa FMb DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64 2.2. Fish, experimental design and feeding management

C12:0 0.11 0.10 0.10 0.10 0.22 This experiment was conducted in an indoor circulating water
C14:0 2.63 3.16 2.92 2.78 2.80
aquaculture system at the Institute of Animal Science, Guangdong
C15:0 0.21 0.31 0.21 0.21 0.22
C16:0 19.89 20.10 20.00 20.10 21.29
Academy of Agricultural Science (Guangdong, China). A total of 450
C16:1n-9 2.11 2.24 1.98 1.86 1.94 juvenile L. japonicus (14.14 ± 0.17 g initial body weight) were ran-
C17:0 0.32 0.31 0.31 0.31 0.32 domly assigned to 5 groups (triplicate per group) and distributed into
C18:0 4.63 5.00 4.79 4.95 5.16 15 fiberglass cylinder tanks (350 L, 80 cm diameter × 70 cm high) with
C18:1n-9 26.32 23.16 24.06 23.71 24.62
30 fish per tank. Fish were fed to apparent satiation two times daily
C18:2n-6 27.37 28.16 27.81 28.14 27.74
C18:3n-6 0.11 0.10 0.10 0.10 0.11 (09:00 and 16:00 h) and the feeding trail lasted for 56 days. Uneaten
C18:3n-3 3.16 3.57 3.44 3.51 3.66 feed and feces were siphoned out daily before feeding. The amount of
C20:0 0.32 0.41 0.42 0.31 0.43 supplied diet to each tank was recorded daily and remaining feed in the
C20:1n-9 0.84 1.02 0.94 0.93 0.86
tank was siphoned out 1.0 h after feeding, analyzed for dry matter and
C20:2n-6 0.21 0.31 0.31 0.31 0.32
C20:3n-6 0.11 0.10 0.10 0.10 0.11
subtracted from feed offered (DM basis) to calculate actual feed intake
C20:3n-3 0.11 0.10 0.10 0.10 0.11 (FI). During the 56 days trial, water was continuously aerated and fil-
C20:4n-6 0.42 0.41 0.31 0.31 0.32 tered through sand filter system at a rate of 1.6 L min−1 to remove
C20:5n-3 4.42 4.49 4.90 4.64 4.52 impurities and reduce ammonia, and the water quality was as follows:
C22:0 0.53 0.41 0.42 0.41 0.43
water temperature 27.4 ± 2.6 °C, pH 7.5–8.2, dissolved
C22:6n-3 6.74 6.94 6.15 5.77 5.59
C24:0 0.32 0.31 0.31 0.31 0.32 oxygen > 5 mg L−1, ammonia ≤0.02 mg L−1 and nitrite ≤0.2 mg L−1.
C24:1n-9 0.32 0.20 0.21 0.21 0.22 Dead fish were weighted and the mortalities were recorded.
∑SFA 28.95 30.10 29.48 29.48 31.18
∑MUFA 29.58 26.63 27.19 26.70 27.63 2.3. Sampling
∑PUFA 42.63 44.18 43.23 42.99 42.47
∑n-3 PUFA 14.42 15.10 14.58 14.02 13.87
∑n-6 PUFA 28.21 29.08 28.65 28.97 28.60 At the end of the feeding trial, fish were fasted for 24 h prior to
∑n-3/∑n-6 0.51 0.52 0.51 0.48 0.48 sample collection and then anesthetized with tricaine methanesulfonate
a
(MS-222). All fish in each tank were counted and weighted to measure
MUFA, monounsaturated fatty acids; PUFA, polyunsaturated fatty acids; for final body weight (FBW), and calculate for weight gain (WG), FI,
SFA, saturated fatty acids.
feed conversion ratio (FCR), specific growth rate (SGR) and survival
b
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by
rate (SR).
defatted black soldier fly larvae meal.
Six fish per tank were randomly collected and frozen at −20 °C for
determination of the whole body composition. Another six fish from
Table 3
each tank were randomly selected for collecting data on condition
Amino acid composition (% of feed) of experimental diets.
factor (CF), viscerosomatic index (VSI), hepatosomatic index (HSI),
Items FM DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64 intestinesomatic index (ISI) and intraperitoneal fat ratio (IPF).
Essential amino acid
Blood samples were obtained from the caudal veins of six fish per
Arginine 2.67 2.77 2.69 2.72 2.59 tank using heparinized syringes, and kept at room temperature for
Histidine 1.04 1.07 1.07 1.06 0.99 20 min and then centrifuged at 8000 ×g for 10 min. The resultant
Isoleucine 1.61 1.68 1.58 1.60 1.52 serum was divided into two portions and immediately stored at −80 °C
Leucine 2.91 3.01 2.83 2.83 2.86
for subsequent analysis of the serum metabolites and antioxidant en-
Lysine 2.49 2.59 2.48 2.48 2.39
Methionine 0.87 0.87 0.84 0.86 0.85 zyme activity.
Phenylalanine 1.93 2.00 1.91 1.94 1.97 Three hepatopancreas and intestine of fish from each tank were
Tyrosine 1.10 1.23 1.18 1.26 1.25 sampled, respectively. Samples of hepatopancreas and entire intestine
Threonine 1.51 1.57 1.49 1.50 1.41 were chopped finely and homogenized in 10 volumes (w/v) of ice-cold
Valine 1.99 2.12 2.06 2.14 2.05
Non-essential amino
physiological saline solution and centrifuged at 6000 ×g at 4 °C for
acid 20 min. The supernatant was stored at −20 °C for further analysis of
Alanine 2.25 2.34 2.20 2.22 2.11 trypsin, lipase and amylase activities. The enzyme activity is expressed
Aspartic acid 3.89 4.07 3.81 3.86 3.70 as specific activity, normalized by the tissue protein. The protein con-
Glycine 2.16 2.23 2.08 2.08 1.95
centration of homogenates was determined using the BioRad® Protein
Glutamic acid 7.79 8.11 7.59 7.62 7.23
Serine 1.76 1.85 1.77 1.80 1.73 Assay Kit based on the Bradford dye-binding method (BioRad
Laboratories, Munich, Germany). The creatine kinase (CK) and Na+,
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by K+- adenosine trisphosphatase (Na+, K+-ATPase) activities and protein
defatted black soldier fly larvae meal. carbonyls (PC) concentration in the intestine were also determined in
the supernatant. Another three fish from each tank were randomly
0% (FM), 16% (DBSFLM16), 32% (DBSFLM32), 48% (DBSFLM48) and collected for histological examination of the hepatopancreas and
64% (DBSFLM64), corresponding to dietary inclusion levels of 0%, anterior intestine at the end of the experiment. All tissue samples were
4.8%, 9.6%, 14.4% and 19.2%. Due to the different chemical compo- dissected and fixed immediately in the 4% buffered formalin solution
sition of DBSFLM compared to fish meal, and in order to maintain diets for 24 h. Subsequently, the tissues were dehydrated in ethanol, treated
isoproteic and isolipidic, some other dietary ingredients (soybean meal, with xylene, embedded in paraffin wax, sectioned in 5 μm slices, and
fish oil and wheat flour) were modified with the increase of DBSFLM then stained with haematoxylin-eosin (H&E) using standard histolo-
inclusion in the diets. The experimental diets were extruded using a lab gical techniques (Howard and Smith, 1983). Examination was done by
twin-screw extruder (SLX-80, South China University of Technology light microscopy (Olympus, DP72) with a photomicrograph attached to
Machinery Factory, Guangzhou, China) at 85.5 °C and 1.83 MPa, cut a computer with Motic Images software (Leica Application Suite
into pellets (3 mm), dried at 55 °C and stored at −20 °C until use. The V3.3.0). Images collection, slices measurement (n = 12) and villus of
fatty acid and amino acid profiles of experimental diets were shown in each slice (n = 8) for villus length, villus width, inherent thickness,

146
G. Wang, et al. Aquaculture 507 (2019) 144–154

muscular thickness and goblet cells per villus were determined ac- (FAS) were listed in Table 4. The comparative CT method (2-ΔΔCT
cording to the method described by Tan et al. (2018). method) described by Livak and Schmittgen (2001) was used to analyze
The remaining fish from each tank (three tanks per group) were the gene expression levels.
collected and the hepatopancreas were immediately stored at −80 °C
for RNA extraction and real-time quantitative PCR (RT-qPCR) analysis
2.5. Statistical analysis
of lipid metabolism related genes expression.
The parameters were calculated as follows:
Weight gain (WG, g) = final body weight (g) – initial body weight
2.4. Laboratory analyses
(g).
Feed intake (FI, g/fish/day) = total amount of feed consumed (g,
Dry matter (DM) was measured by drying samples to a constant
DM basis)/((final number of fish + initial number of fish)/2)/days.
weight at 105 °C. CP was calculated from the determination of the total
Feed conversion ratio (FCR) = total feed intake (g, DM basis)/(final
nitrogen (N × 6.25) using the Kjeldahl method (2300-Autoanalyzer,
body weight (g) – initial body weight (g)).
FOSS, Denmark). CL was determined by gravimetric analysis following
Survival rate (SR, %) = 100 × (final number of fish)/(initial
ether extraction of the lipids according to the Soxhlet method (36680-
number of fish).
analyzer, BUCHI, Switzerland). Ash was examined by combustion in a
Specific growth rate (SGR, %/d) = 100 × (ln final weight (g) – ln
muffle furnace at 550 °C for 6 h. Chitin was analyzed as D-glucosamine
initial weight (g))/days.
(Wang et al., 2008) using a modification of the method described by
Condition factor (CF, g/cm3) = body weight (g)/body length3 (cm).
Madrid et al. (2013). The proximate composition of diets, feed in-
Viscerosomatic index (VSI, %) = 100 × visceral weight (g)/body
gredients and whole body fish were analyzed using AOAC method
weight (g).
(AOAC, 1999): DM (AOAC #930.15), ash (AOAC #990.03), CP (AOAC
Hepatosomatic index (HSI, %) = 100 × hepatopancreas weight (g)/
# 990.03) and CL (AOAC 920.39).
body weight (g).
Serum biochemical analyses including total cholesterol (TCHO),
Intestinesomatic index (ISI, %) = 100 × intestine weight (g)/body
triacylglycerol (TG), aspartate aminotransferase (AST), alanine amino-
weight (g).
transferase (ALT), globulin (GLOB), glucose (GLU), blood urea nitrogen
Intraperitoneal fat ratio (IPF, %) = 100 × intraperitoneal fat weight
(BUN), high density lipoprotein cholesterol (HDL-C) and low density
(g)/body weight (g).
lipoprotein cholesterol (LDL-C) were tested using an automatic bio-
Data on initial body weight, final body weight, feed intake (DM
chemical analyzer (Hitachi 7180, Tokyo, Japan). Commercial kits
basis), proximate composition of feed and whole body were used to
(Nanjing Jiancheng Bioengineering Institute, Nanjing, China) were
calculate protein retention (PR), lipid retention (LR) and ash retention
used to determine serum enzyme activity of diamine oxidase (DAO),
(AR).
catalase (CAT), glutathione peroxidase (GSH-Px), superoxide dismutase
Protein retention (PR, %) = 100 × fish protein gain (g)/protein
(SOD), alkaline phosphatase (AKP), acid phosphatase (ACP) and lyso-
intake (g).
zyme (LZM), and serum concentrations of malondialdehyde (MDA),
Lipid retention (LR, %) = 100 × fish lipid gain (g)/lipid intake (g).
lipopolysaccharide (LPS) and D-lactate (D-LA), and intestine enzyme
Ash retention (AR, %) = 100 × fish ash gain (g)/ash intake (g).
activity of CK and Na+, K+-ATPase, along with hepatic and intestinal
Tank was used as the statistical unit in the analyses for growth
digestive enzyme activity of trypsin, lipase and amylase, following the
parameters, and biological replicate were used as the statistical unit for
corresponding manufacturer's instructions. The content of PC in the
other analyses. All data were subjected to a one-way analysis of var-
supernatant of intestine was determined according to the method de-
iance using SPSS 17.0 for Windows followed by the Duncan's multiple-
scribed by Armenteros et al. (2009) using 2, 4-dinitrophenylhydrazine
range test. Differences were regarded as significance when P < 0.05
reagent and the value was calculated from the peak absorbance at
and the results are presented as means ± SE.
340 nm using an absorption coefficient of 22,000 mol L−1 cm −1.
Concentration of intestinal inflammatory cytokines, i.e. tumor necrosis
factor (TNF-α), interleukin 6 (IL-6) and interleukin 8 (IL-8), were de- 3. Results
termined by ELISA according to the manufacturer's instructions (R&D
Systems, Minneapolis, Minnesota, USA). The insulin-like growth factor I 3.1. Growth performance and whole body compositions
(IGF-I) was measured with radioimmunoassay (IGF-I 100 T Kit, Catalog
No. 40–2100, Nichols Institute Diagnostics, USA). At the end of feeding trail, all fish had similar FBW, WGR, FCR, SGR,
Total RNA was extracted from hepatopancreas using Trizol Reagent SR, CF, VSI, HSI, ISI, IPF, PR and LR (Table 5). FI was increased across
(Invitrogen, USA) and electrophoresed on a 1.2% denaturing agarose treatment with higher (P < 0.05) value in fish fed DBSFLM48 and
gel to test the integrity. The RNA was then reverse transcribed to cDNA DBSFLM64 than those of fish fed FM. Somatic indexes and nutrient
by Prime Script™ RT reagent kit (Takara, Japan). The RT-qPCR was retention of fish were not affected (P > 0.05) by dietary treatments.
performed in a quantitative thermal cycler (CFX96™ Real Time System, Fish fed DBSFLM48 and DBSFLM64 had lower AR compared to those of
BIO-RAD, USA) according to standard protocols. The amplification was fish fed FM.
performed in a final volume of 25 μl containing 1 μl of each respective The content of CP, CL and moisture in the whole body of fish were
primer, 1 μl cDNA product, 12.5 μl SYBR® Premix ExTaq™ II (Takara, not different (P > 0.05) among dietary treatments (Table 6). However,
Japan) and 9.5 μl RNA-free water. The primer sequences of lipoprotein ash was lower (P < 0.05) in fish fed DBSFLM48 and DBSFLM64 than
lipase (LPL), hormone sensitive lipase (HSL) and fatty acid synthase those of fish fed FM.

Table 4
Primers used in real-time PCR.
Target gene Forward (5′ to 3′) Reverse (3′ to 5′) Amplicon size (bp) PCR cycling conditions

LPL ATCCTCGTCTTTGGTGCACTT CAGACCTCCCTGCAGACATT 164 2 min at 95 °C, followed by 40 cycles of 2 min at 95 °C, 34 s at 60 °C, and 30 s
FAS CGAATCGCTGGCTACTCCTT AGAGGTATTCCACAGGCCAA 188 at 72 °C
HSL CTGAGTCTGGTGAGGAGGGA GTCTGACACAGCTGGTGGTAT 165

LPL, lipoprotein lipase; HSL, hormone sensitive lipase; FAS, fatty acid synthase.

147
G. Wang, et al. Aquaculture 507 (2019) 144–154

Table 5
Effect of substituting FM with DBSFLM on growth performance, somatic indexes and nutrient retention of juvenile Lateolabrax japonicus.
Items2 Treatments1

FM DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64

FBW (g) 57.57 ± 0.99 57.94 ± 2.62 57.40 ± 2.22 61.26 ± 0.64 57.20 ± 0.81
WG (g) 43.27 ± 0.86 43.87 ± 2.59 43.22 ± 2.22 47.11 ± 0.66 43.20 ± 1.96
FI (g/fish/day) 1.05 ± 0.02c 1.11 ± 0.02bc 1.08 ± 0.02c 1.15 ± 0.01b 1.25 ± 0.02a
FCR 1.37 ± 0.03 1.44 ± 0.07 1.41 ± 0.05 1.40 ± 0.02 1.50 ± 0.04
SGR (%) 2.49 ± 0.02 2.52 ± 0.08 2.49 ± 0.07 2.62 ± 0.02 2.51 ± 0.06
SR (%) 98.89 ± 1.11 97.78 ± 1.11 97.78 ± 1.11 95.56 ± 2.22 95.63 ± 2.19
CF (g/cm3) 1.50 ± 0.04 1.46 ± 0.04 1.44 ± 0.02 1.48 ± 0.02 1.48 ± 0.02
VSI (%) 9.92 ± 0.42 9.39 ± 0.29 9.74 ± 0.56 9.43 ± 0.21 10.08 ± 0.38
HSI (%) 0.95 ± 0.06 0.97 ± 0.05 0.98 ± 0.08 1.04 ± 0.05 0.94 ± 0.06
ISI (%) 0.65 ± 0.05 0.65 ± 0.03 0.69 ± 0.07 0.71 ± 0.03 0.63 ± 0.03
IPF (%) 5.56 ± 0.35 5.12 ± 0.31 5.18 ± 0.37 4.95 ± 0.20 5.76 ± 0.34
PR (%) 29.27 ± 1.86 29.75 ± 1.30 30.24 ± 1.30 30.72 ± 0.42 27.65 ± 1.00
LR (%) 58.90 ± 5.98 66.73 ± 3.78 68.80 ± 7.32 69.57 ± 1.20 64.07 ± 3.27
AR (%) 33.12 ± 0.85a 30.49 ± 1.82ab 31.06 ± 1.52ab 28.26 ± 0.85b 23.10 ± 0.39c

a, b, c Means with different letters differ (P < 0.05).

1
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by defatted black soldier fly larvae meal.
2
AR, ash retention; CF, condition factor; FBW, final body weight; FCR, feed conversion ratio; FI, feed intake; HSI, hepatosomatic index; IPF, intraperitoneal fat
ratio; ISI, intestinesomatic index; LR, lipid retention; PR, protein retention; SGR, specific growth rate; SR, survival rate; VSI, viscerosomatic index; WG, weight gain.

3.2. Serum metabolites, antioxidant and non-specific immune enzymes thickness and goblet cells per villus (Table 9).

Fish had similar GLOB, GLU, BUN, AST, ALT, LDL-C, LDL-C/HDL-C,
DAO, LPS and D-LA in serum regardless of the treatments (Table 7).
Fish consuming DBSFLM had lower (P < 0.05) TG compared to those
of fish fed FM. Concentrations of TCHO and HDL-C were lower
(P < 0.05) for fish fed DBSFLM32, DBSFLM48 and DBSFLM64 than
fish fed DBSFLM16 or FM. Similarly, fish fed DBSFLM diets had lower
(P < 0.05) serum MDA concentration than those fed FM. Serum ACP,
AKP and LZM activities were all not affected (P > 0.05) by dietary
treatments.
3.3. Digestive enzymes
Trypsin, lipase and amylase in the hepatopancreas were not affected
(P > 0.05) by dietary treatments (Table 8), whereas intestinal lipase
activity in fish fed DBSFLM48 and DBSFLM64 were higher (P < 0.05)
than those of fish fed FM, DBSFLM16 and DBSFLM32.
3.4. Hepatic and intestinal histomorphology
The histological appearance of hepatocytes and intestine were
presented in Fig. 1. Hepatocytes (Fig. 1, a-e) were loose, polyhedral in
shape with vacuolated cytoplasm, and no obvious inflammatory cell
infiltration was detected. Hepatocytes were shown to have different
degrees of vacuolar degeneration in DBSFLM 32, DBSFLM 48 and
DBSFLM 64 than those in FM or DBSFLM 16. The intestinal microvilli
(Fig. 1, f-j) were most regular in shape. Treatment did not affect
(P > 0.05) villus length, villus width, inherent thickness, muscular
3.5. Intestinal brush border enzymes, antioxidant and inflammatory
cytokines indices
All fish had similar (P > 0.05) CK, Na+, K+-ATPase, MDA, PC,
TNF-α, IGF-I, IL-6 and IL-8 among treatments (Table 10).
3.6. Lipid metabolism related genes expression
Based on the hepatic mRNA content, relative expression of LPL and
HSL were up-regulated with increasing dietary DBSFLM inclusion level
(Fig. 2), and the value was higher (P < 0.05) in DBSFLM64 for LPL,
and greater (P < 0.05) in DBSFLM32, DBSFLM48 and DBSFLM64 for
HSL, as compared with FM or DBSFLM16, respectively. In contrast, the
relative expression of gene FAS was down-regulated (P < 0.05) in fish
fed DBSFLM diets than those of fish fed FM.
4. Discussion
4.1. Feed intake, growth performance and whole body composition
This study showed that partial replacement of dietary FM by
DBSFLM had no significant effect on the growth performance of fish,
suggesting that supplementation of DBSFLM up to 192 g/kg DM diet
(replacing 64% fish meal) for L. japonicus had no negative effect on
growth performance and feed utilization. The increased FI for fish fed
DBSFLM48 and DBSFLM64 indicated that DBSFLM can improve feed
palatability and thereby increase FI of fish. To our knowledge, this is

Table 6
Effect of substituting FM with DBSFLM on whole body composition (% original substance) of juvenile Lateolabrax japonicus (n = 3).
Items2 Treatments1

FM DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64

DM 30.79 ± 0.21 30.53 ± 0.10 30.86 ± 0.80 31.70 ± 0.48 30.69 ± 0.37
CP 17.20 ± 0.13 17.22 ± 0.15 17.13 ± 0.18 16.82 ± 0.13 16.89 ± 0.16
CL 8.66 ± 0.14 8.26 ± 0.18 8.25 ± 0.38 8.88 ± 0.26 8.90 ± 0.22
Ash 4.48 ± 0.06a 4.37 ± 0.02ab 4.38 ± 0.17ab 4.20 ± 0.11b 4.14 ± 0.05b

a, b Means with different letters differ (P < 0.05).

1
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by defatted black soldier fly larvae meal.
2
CP, crude protein; CL, crude lipid; DM, dry matter.

148
G. Wang, et al. Aquaculture 507 (2019) 144–154

Table 7
Effect of substituting FM with DBSFLM on serum biochemical parameters, antioxidant and non-specific immune indices of juvenile Lateolabrax japonicus (n = 3).
Items2 Treatments1

FM DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64

Biochemical parameters
TCHO (mmol/L) 5.36 ± 0.21a 5.14 ± 0.27ab 4.89 ± 0.06b 4.78 ± 0.18b 4.69 ± 0.04b
TG (mmol/L) 5.30 ± 0.10a 4.73 ± 0.18b 4.63 ± 0.16b 4.72 ± 0.26b 4.72 ± 0.04b
GLOB (g/L) 29.47 ± 0.58 28.77 ± 1.54 28.03 ± 0.59 27.87 ± 1.24 27.80 ± 0.78
GLU (mmol/L) 12.40 ± 0.91 10.75 ± 1.24 8.98 ± 0.94 11.37 ± 1.24 10.55 ± 1.12
BUN (mmol/L) 1.57 ± 0.07 1.47 ± 0.09 1.40 ± 0.06 1.47 ± 0.03 1.57 ± 0.09
AST (U/L) 82.00 ± 4.16 84.67 ± 4.33 75.67 ± 4.37 82.67 ± 3.18 87.50 ± 4.09
ALT (U/L) 15.33 ± 1.33 14.67 ± 2.73 12.00 ± 1.00 13.33 ± 1.20 13.33 ± 1.67
LDL-C (mmol/L) 0.26 ± 0.03 0.26 ± 0.02 0.25 ± 0.01 0.22 ± 0.02 0.21 ± 0.01
HDL-C (mmol/L) 2.08 ± 0.07a 2.05 ± 0.11a 1.71 ± 0.07b 1.61 ± 0.06b 1.60 ± 0.08b
LDL-C/HDL-C 0.12 ± 0.01 0.13 ± 0.01 0.15 ± 0.01 0.14 ± 0.01 0.13 ± 0.01
DAO (U/L) 18.43 ± 0.58 18.79 ± 1.39 18.57 ± 1.63 18.24 ± 1.41 18.12 ± 1.03
LPS (pg/ml) 576.67 ± 23.95 529.67 ± 48.52 526.67 ± 25.59 529.75 ± 49.75 531.75 ± 36.26
D-LA (μmol/L) 2.93 ± 0.22 2.81 ± 0.17 2.67 ± 0.10 2.92 ± 0.29 3.29 ± 0.35
Antioxidant indexes
CAT (U/ml) 21.10 ± 2.73 21.69 ± 1.15 19.20 ± 2.38 20.69 ± 1.67 20.52 ± 2.42
GSH-Px (U/ml) 309.57 ± 18.49 278.16 ± 14.87 268.77 ± 20.23 289.79 ± 16.46 292.29 ± 8.19
MDA (nmol/ml) 28.93 ± 3.91a 17.90 ± 2.26b 21.43 ± 1.54b 19.94 ± 1.64b 18.94 ± 1.15b
SOD (U/ml) 22.12 ± 0.76 22.81 ± 0.65 23.00 ± 0.35 22.48 ± 0.55 21.96 ± 0.44
Non-specific immune indexes (U/ml)
AKP 0.27 ± 0.01 0.25 ± 0.01 0.23 ± 0.01 0.24 ± 0.02 0.26 ± 0.02
ACP 0.52 ± 0.01 0.50 ± 0.01 0.52 ± 0.01 0.51 ± 0.01 0.50 ± 0.01
LZM 25.25 ± 2.19 23.41 ± 2.06 29.97 ± 1.43 27.64 ± 2.17 29.31 ± 1.56

a, b Means with different letters differ (P < 0.05).

1
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by defatted black soldier fly larvae meal.
2
ACP, acid phosphatase; AKP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; BUN, blood urea nitrogen; CAT, catalase;
DAO, diamine oxidase; D-LA, D-lactate; GLOB, globulin; GLU, glucose; GSH-Px, glutathione peroxidase; HDL-C, high density lipoprotein cholesterol; LDL-C, low
density lipoprotein cholesterol; LPS, lipopolysaccharide; LZM, lysozyme; MDA, malondialdehyde; SOD, superoxide dismutase; TCHO, total cholesterol; TG, tria-
cylglycerol.

the first study to determine feed intake, growth performance, somatic
indexes and nutrient retention of L. japonicus fed DBSFLM. Previous
studies using fish fed different dietary levels of DBSFLM have reported
growth performance in line with those of fish fed FM. Li et al. (2017a,
2017b) documented that supplementing 106 g/kg diet of DBSFLM (re-
placing 100% fish meal) did not affect feed intake and growth perfor-
mance of Jian carp (Cyprinus carpio var. Jian). A similar result was
reported in rainbow trout (Oncorhynchus mykiss Walbaum) that in-
corporation of DBSFLM up to 400 g/kg DM diet (replacing 50% FM) did
not result in difference of growth performance (Renna et al., 2017). No
significant effects on the growth performance of other species, such as
channel catfish (Ictalurus punctatus Rafinesque) fingerlings (Bondari and
Sheppard, 1987), tilapia (Bondari and Sheppard, 1981, 1987; Devic
et al., 2017; Muin et al., 2017), yellow catfish (Pelteobagrus fulvidraco)
(Hu et al., 2017a), juvenile L. japonicus (Hu et al., 2018), African catfish
(Clarias gariepinus BURCHELL, 1822) fingerlings (Talamuk, 2016),
European seabass (Dicentrarchus labrax) (Sánchez-López, 2015;
Magalhães et al., 2017) and koi cap (Cyprinus carpio) (Liu et al., 2017),
were also observed regarding partial replacement of fish meal by the
BSFL meal in fish diets. In a context of FM scarcity, BSFL meal is con-
sidered a promising alternative to fish meal in aquafeeds (Henry et al.,
2015), also considering that insects are part of the natural diets of both
freshwater and marine fish (Howe et al., 2014; Whitley and Bollens,
2014). The similar growth performance of fish fed DBSFLM compared
to that of FM is likely due to the similar chemical composition between
two protein sources. The crude protein content of DBSFLM determined
in the present study (55.4%) is similar to those reported values by
Renna et al. (2017) (55.34%) and Makkar et al. (2014) (56.9%), which
is also comparable with that of soybean meal though slightly less than
that of fish meal. Furthermore, BSFL meal has a comparable amino acid
profile to that of fish meal (Tran et al., 2015) and could be better
substitutes of fish meal than soybean meal. Feed intake of aquatic an-
imals is usually regulated by both digestibility and palatability of diet
(Sánchez-López, 2015), and both are closely associated with physiolo-
gical and nutritional factors (Sun et al., 2016). In this study, all diets
were formulated to have similar nutrient concentrations, suggesting

Table 8
Effect of substituting FM with DBSFLM on digestive enzymes activity in the hepatopancreas and intestine of juvenile Lateolabrax japonicus (n = 3).
Items Treatments1

FM DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64

Hepatopancreas
Trypsin (U/mg protein) 615.97 ± 11.85 594.74 ± 11.92 585.16 ± 17.85 616.88 ± 16.93 601.98 ± 21.11
Lipase (U/g protein) 2.44 ± 0.41 2.08 ± 0.32 2.00 ± 0.47 1.95 ± 0.51 2.10 ± 0.57
Amylase (U/mg protein) 0.10 ± 0.02 0.12 ± 0.01 0.12 ± 0.01 0.10 ± 0.01 0.10 ± 0.02
Intestine
Trypsin (U/mg protein) 412.89 ± 13.22 398.36 ± 28.89 345.41 ± 17.61 403.52 ± 24.30 353.78 ± 28.91
Lipase (U/g protein) 6.91 ± 0.23b 6.73 ± 0.21b 7.64 ± 0.24b 9.07 ± 0.32a 8.81 ± 0.47a
Amylase (U/mg protein) 0.62 ± 0.08 0.67 ± 0.07 0.65 ± 0.06 0.66 ± 0.02 0.66 ± 0.04

a, b Means with different letters differ (P < 0.05).

1
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by defatted black soldier fly larvae meal.

149
G. Wang, et al. Aquaculture 507 (2019) 144–154

Fig. 1. Histological appearance of hepatopancreas (a-e, ×200) and intestine (f-j, ×100) stained with haematoxylin-eosin stain. Hepatocytes were loose, polyhedral
in shape with vacuolated cytoplasm, and no obvious inflammatory cell infiltration was detected. Hepatocytes in DBSFLM 32, DBSFLM 48 and DBSFLM 64 were
shown to have different degrees of vacuolar degeneration as compared with FM or DBSFLM 16. Villus were characterized by a simple columnar epithelium and
disseminated goblet cells (white spots among the epithelial cells) containing mucins. FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by
defatted black soldier fly larvae meal.

that the increased FI with increasing dietary DBSFLM incorporation was
unlikely caused by their nutrient composition. The positive effect of
dietary DBSFLM on FI in the present study might be through improving
the nutrient digestibility of fish fed DBSFLM diets, but further research
is needed to determine the nutrient digestibility of DBSFLM fed to L.
japonicus.
Results of whole body composition indicated that up to 64% of FM
can be feasibly replaced by DBSFLM without impact on the CP, CL and
moisture contents of fish. This is consistent with our previous ob-
servation by Hu et al. (2018) that observed no effect of dietary BSFL
meal (replacing up to 50% fish meal) on the whole body composition of
L. japonicus. Similar results were also reported in Jian carp (Cyprinus
carpio var. Jian) (Li et al., 2016a, 2016b, 2016c, Li et al., 2017a, 2017b;
Zhou et al., 2017), rainbow trout (Oncorhynchus mykiss Walbaum) (St-
Hilaire et al., 2007), European seabass (Dicentrarchus labrax)
(Magalhães et al., 2017) and yellow catfish (Pelteobagrus fulvidraco) (Hu
et al., 2017a; Xiao et al., 2018). The decreased ash content and AR in
this study indicated that DBSFLM may affect biochemical composition
of L. japonicus. This agree with observation by Renna et al. (2017) who
found DBSFLM (replacing 25% fish meal) decreased ash content of
rainbow trout (Oncorhynchus mykiss Walbaum) fillets. Hu et al. (2017a,
2017b) also reported that BSFL meal supplementation tend to decrease

150
G. Wang, et al. Aquaculture 507 (2019) 144–154

Table 9
Effect of substituting FM with DBSFLM on intestinal morphology of juvenile Lateolabrax japonicus.
Items Treatmentsa

FM DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64

Villus length (μm) 341.52 ± 16.01 313.26 ± 15.40 316.64 ± 19.80 349.78 ± 10.84 318.42 ± 13.38
Villus width (μm) 44.81 ± 1.05 43.27 ± 0.94 42.93 ± 0.72 44.91 ± 0.78 44.40 ± 1.35
Inherent thickness (μm) 126.25 ± 2.62 138.84 ± 5.81 137.60 ± 5.56 129.91 ± 7.82 131.90 ± 7.19
Muscular thickness (μm) 19.12 ± 0.88 21.82 ± 0.99 20.96 ± 0.76 21.24 ± 0.93 19.84 ± 0.80
Goblet cells per villus 32.76 ± 1.88 29.79 ± 1.44 30.26 ± 1.71 34.54 ± 1.21 33.67 ± 1.16

a
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by defatted black soldier fly larvae meal.

ash content of yellow catfish (Pelteobagrus fulvidraco). However, several
studies documented that dietary DBSFLM did not affect ash content of
rainbow trout (Dumas et al., 2018), Jian carp (Cyprinus carpio var. Jian)
(Li et al., 2017a, 2017b) and Pacific white shrimp (Litopenaeus van-
namei) (Cummins et al., 2017). The variation among studies are likely
due to different animal species and type of substrates fed the BSFL. This
study along with Renna et al. (2017) and Hu et al. (2017a, 2017b) fed
the larvae with kitchen waste or vegetable by-products substrate,
whereas others fed with greenhouse waste streams (Kroeckel et al.,
2012), dried distillers grains with solubles or brewer's grains (Cummins
et al., 2017; Dumas et al., 2018). Nevertheless, even the same species,
Dumas et al. (2018) reported that the negative relationship between
whole body CP content of rainbow trout (Oncorhynchus mykiss Wal-
baum) and dietary BSFL meal inclusion level, along with the positive
relationship between CL and BSFL meal inclusion disagreed with those
from a study conducted with rainbow trout (Oncorhynchus mykiss
Walbaum) fed BSFL meal (St-Hilaire et al., 2007). Moreover, another
study reported that both whole body CP and CL contents of juvenile
Pacific white shrimp (Litopenaeus vannamei) were declined with de-
creasing inclusion level of BSFL meal (Cummins et al., 2017). These
discrepancies among studies may have resulted from variations in diet
formulations and/or differences in animal species.
4.2. Serum metabolites, antioxidant and non-specific immune capacity
The lower serum TCHO and TG concentrations for fish fed DBSFLM
than those fed FM in this study indicated that dietary DBSFLM could
reduce blood lipid levels. Similar results were observed that dietary
replacement of FM by DBSFLM or BSFL meal resulted in decreased
blood TCHO concentration of Jian carp (Cyprinus carpio var. Jian) (Li
et al., 2017) and European seabass (Dicentrarchus labrax) (Magalhães
et al., 2017). The TG-decreasing effect of BSFL meal was also reported
by Hu et al. (2018) in juvenile Lateolabrax japonicus. It has been re-
ported that chitosan, existed in the chitin of BSFL meal, possess
cholesterol-lowering properties in fish (Shiau and Yu, 1999; Chen et al.,
2014). Khoushab and Yamabhai (2010) documented that chitin may
interfere with cholesterol absorption by binding with lipid micelles and
inhibiting their absorption. In addition, dietary cholesterol level may
partly be attributed to the level of serum cholesterol (Kaushik et al.,
1995). This may in part account for the lower TCHO concentration in
the present study because the DBSFLM may contain less cholesterol
than fish meal and thereby resulted in the lower TCHO concentration
for fish fed DBSFLM diets. In this study, no significant differences were
observed in serum GLOB, AST and ALT among treatments, suggesting
that dietary DBSFLM might not influence the immune system ability
and hepatopancreas health of fish. The activities of serum AST and ALT
are generally related to hepatopancreas damage or necrosis when their
value increase (Sheikhzadeh et al., 2012; Wang et al., 2014; Li et al.,
2016), and GLOB is also proved to modulate the immune response (El-
Kamary et al., 2009). The reduction of the HDL-C concentration ob-
served in DBSFLM diets and the similar LDL-C/HDL-C ratio among
treatments in this study is in agreement with Hu et al. (2018). It is well
known that LDL-C are the major carriers of cholesterol towards tissues
having atherogenic potential, while HDL-C carry cholesterol from per-
ipheral tissues to the liver (Agellon et al., 1991). Serum LDL-C/HDL-C
ratio could be used as a marker of the balance of cholesterol transport
and is measured as an index of risk for arteriosclerosis lesion (Okumura
et al., 2014). Results of this study showed that the LDL-C/HDL-C ratio
was not affected by dietary treatments, suggesting that the replacement
of dietary FM by DBSFLM did not adversely impact cholesterol trans-
port between peripheral tissues and hepatopancreas.
The lower serum MDA concentration in fish fed DBSFLM than for
those fed FM revealed that given DBSFLM may improve the antioxidant
status of fish. Decreased serum MDA concentration of Jian carp
(Cyprinus carpio var. Jian) fed BSFL meal has also been reported by
Zhou et al. (2017). MDA is a product of polyunsaturated fatty acid
peroxidation and directly reflects the level of lipid peroxidation. Ac-
cumulation of MDA can lead to a lethal effect and tissue damage (Buege

Table 10
Effect of substituting FM with DBSFLM on intestinal brush border enzymes, antioxidant and inflammatory cytokines indexes of juvenile Lateolabrax japonicus (n = 3).
Itemsb Treatmentsa

FM DBSFLM16 DBSFLM32 DBSFLM48 DBSFLM64

Brush border enzymes

CK (U/mg protein) 0.26 ± 0.02 0.24 ± 0.02 0.24 ± 0.01 0.23 ± 0.05 0.28 ± 0.03
Na+, K+-ATPase (U/mg protein) 0.88 ± 0.05 0.88 ± 0.06 0.95 ± 0.02 0.88 ± 0.09 0.98 ± 0.08
Antioxidant indexes
MDA (nmol/mg protein) 2.42 ± 0.32 2.08 ± 0.48 2.25 ± 0.46 2.49 ± 0.21 2.05 ± 0.32
PC (nmol/mg protein) 2.40 ± 0.27 2.50 ± 0.11 1.87 ± 0.20 1.86 ± 0.36 2.00 ± 0.09
Inflammatory cytokines indexes
TNF-α (fmol/ml) 4.26 ± 0.42 3.99 ± 0.68 3.31 ± 0.48 5.23 ± 0.58 4.33 ± 0.94
IGF-I (ng/ml) 17.71 ± 2.15 16.81 ± 0.93 18.22 ± 1.76 14.02 ± 1.06 15.30 ± 2.94
IL-6 (pg/ml) 5.79 ± 1.10 6.88 ± 0.35 4.97 ± 0.21 5.65 ± 1.03 4.81 ± 0.67
IL-8 (pg/ml) 13.20 ± 0.80 12.42 ± 1.35 11.10 ± 0.30 13.55 ± 1.65 10.25 ± 0.50

a
FM, fish meal; DBSFLM16-DBSFLM64, percentage of fish meal replaced by defatted black soldier fly larvae meal.
b
CK, creatine kinase; IGF-I, IGF-I, insulin-like growth factor I; IL-6, interleukin 6; IL-8, interleukin 8; MDA, malondialdehyde; Na+, K+-ATPase, Na+, K+-
adenosine trisphosphatase; PC, protein carbonyls; TNF-α, tumor necrosis factor.

151
G. Wang, et al.
Fig. 2. Expression of hepatic lipoprotein lipase (LPL), hormone sensitive lipase
(HSL) and fatty acid synthase (FAS) genes. FM, fish meal; DBSFLM16-
DBSFLM64, percentage of fish meal replaced by defatted black soldier fly larvae
meal. a, b Means with different letters differ (P < 0.05).
and Aust, 1978). In this study, the supplementary DBSFLM may account
for the lower MDA concentration because black soldier fly larvae con-
tain the polysaccharide chitin in their exoskeleton (Kroeckel et al.,
2012), and the chitin along with its derivatives were reported to have
antioxidant properties (Ngo et al., 2009; Ngo and Kim, 2014).
Although BSFL meal is considered a renewable protein substitution
in aquafeeds, little information is available regarding its immune re-
sponses of fish. The present study showed that dietary inclusion of
DBSFLM did not alter the serum non-specific immune and intestinal
inflammatory cytokines (TNF-α, IGF-I, IL-6 and IL-8) of L. japonicus.
Xiao et al. (2018) found BSFL meal could improve the immune re-
sponses of yellow catfish (Pelteobagrus fulvidraco) and owing the con-
tribution to the presence of chitin. This study combined with Xiao et al.
(2018) suggest that BSFL meal had no negative or even a positive effect
on immune responses of fish.
152
Aquaculture 507 (2019) 144–154
4.3. Hepatic and intestinal histomorphology
In general, the intestinal histology was used to evaluate potential
negative effect of diet on intestine and the dietary protein sources will
particularly affect the construction of intestinal microvilli (Hartviksen
et al., 2014; Ostaszewska et al., 2010). Similarly, it is generally re-
garded that hepatocyte is highly sensitive to the nutritional status of
fish and to the quality of diet (Brusle and Anadon, 1996). Li et al.
(2017) reported that the mild hepatic necrosis along with dietary stress
and intestinal histopathological damage were observed when the re-
placement levels of dietary FM by DBSFLM exceeded 75% in diet of Jian
carp (Cyprinus carpio var. Jian). The histological effects on hepatopan-
creas and intestine observed in fish fed DBSFLM-containing diets maybe
explained by chitin in the DBSFLM. Chitin was reported to induce liver
lipid accumulation (Zarantoniello et al., 2018) and intestinal in-
flammation (Poma et al., 2017). In contrast, it is interesting to note that
replacements up to 64% of FM by DBSFLM in diets for L. japonicus
without negative effects on the hepatic and intestinal histomorphology.
No inflammatory events were also observed both in the liver and in-
testine of Zebrafish from a 50% of full-fat BSFL meal supplemented in
diets (Zarantoniello et al., 2018). Another two recent studies found that
dietary inclusion of a partially DBSFLM up to 26.4% or 40% level had
no impact on the intestinal histology of rainbow trout (Oncorhynchus
mykiss) (Dumas et al., 2018; Renna et al., 2017). The variation among
results of different studies suggest that high substitution of FM by
DBSFLM should be avoided in fish diets in case of any adverse effects or
damage on hepatic and intestinal health. In this study, although hepatic
slices showed different degrees of vacuolar degeneration of hepatocytes
in fish fed DBSFLM diets, the hepatic and intestinal histomorphology
appeared unaltered and characterized by the absence of appreciable
inflammatory influx in all groups of fish. This may also owe to the si-
milar intestinal antioxidant activity (MDA and PC) and undifferentiated
inflammatory cytokines (TNF-α, IGF-I, IL-6 and IL-8) among treatments
because the intestinal antioxidant and immune capacity of fish is di-
rectly related to the structural integrity of epithelial cells (Chen et al.,
2009).
4.4. Expression of hepatic lipid metabolism related genes
It is interesting to note that dietary supplementation of DBSFLM up-
regulated the LPL and HSL mRNA hepatic levels but down-regulated
FAS mRNA level of L. japonicus. LPL is the key regulatory enzyme in the
lipid uptake as it hydrolyzes triglyceride present in plasma lipoproteins
and supplies free fatty acids for storage in adipose tissue, or for oxi-
dation in other tissues and plays a pivotal role in regulating lipid con-
tent in fish (Tan et al., 2009; Zheng et al., 2013). HSL is expressed
predominantly in adipose tissue and it is considered to be the key en-
zyme in lipolysis of stored triacylglycerol (Haemmerle et al., 2002).
Both LPL and HSL are key enzymes in lipolysis. FAS plays a crucial role
in de novo lipogenesis by catalyzing all the reaction steps in the con-
version of acetyl-CoA and malony-CoA to saturated fatty acids, palmitic
acid (16:0) and stearic acid (18:0) (Li et al., 2016). In this study, results
of lipid metabolism related genes expression are likely related to the
presence of chitosan in DBSFLM. It has been reported that chitosan
plays a key role in decreasing fatty acids synthesis and increasing hy-
drolysis of lipoproteins and triglyceride in the liver (Zhang et al., 2008;
Li et al., 2016). The cholesterol- and lipid-decreasing effects of chitosan
have been previously observed both in animals and humans (Liao et al.,
2007; Xia et al., 2011). Dietary chitosan effectively increased the liver
lipid lipase and LPL activities in rats because of the binding capacity of
chitosan with triacylglycerol and cholesterol (Zhang et al., 2008). Re-
sults in the present study is in agreement with those reported by Zhang
et al. (2008) and Li et al. (2016) with the hepatic FAS activity decreased
along with enzyme activity and mRNA content of hepatic LPL increased
in animals. This study suggests that dietary DBSFLM probably play a
significant role on decreasing fatty acids synthesis and increasing
G. Wang, et al.
hydrolysis of lipoproteins and triglyceride, and this explains the in-
hibitory effects of DBSFLM on hepatopancreas fat deposition of fish (Li
et al., 2017).
5. Conclusions
This study demonstrated that replacement of dietary FM by DBSFLM
up to 64% level without impacting growth performance, hepatic and
intestinal histomorphology, and intestinal antioxidant and immunity of
juvenile L. japonicus. It was observed that DBSFLM inclusion increased
FI, and decreased serum TCHO, TG and MDA concentrations along with
ash retention. The up-regulated hepatic LPL and HSL and down-regu-
lated FAS genes are likely due to the presence of chitin in DBSFLM but
further study is needed to elucidate the mechanisms by which DBSFLM
inhibit hepatic fat deposition of fish.
Author contributions
Y. Huang and G. Wang conceived and designed the experiments; G.
Wang, Cangjin Yi, Xiaoying Chen and H. Wu performed the experi-
ments; G. Wang and K. Peng analyzed the data; K. Peng wrote the
paper.
Conflicts of interest statement
We declare no competing conflicts of interest.
Acknowledgments
This study was funded by Guangdong Modern Technology System of
Agricultural Industry, Innovation Team of Feed Industry Technology
System of Guangdong, China (2018LM1082 and 2018LM1083) and
Guangdong Academy of Agricultural Science Discipline Team
Construction Project (Aquaculture Nutrition and Feed Discipline Team)
(201614TD). The authors greatly appreciate for professor Yong Cao
(South China Agriculture University, Guangzhou, China) for technical
assistance with defatting the black soldier fly larvae meal, and ac-
knowledge senior scientist Yuxi Wang (Agriculture and Agri-Food
Canada, Lethbridge Research and Development Centre, Lethbridge,
Canada) for writing guidance. The authors would also like to thank
reviewers for their constructive comments to improve the quality of this
paper.
References
Agellon, L.B., Walsh, A., Hayek, T., Moulin, P., Jiang, X.C., Shelanski, S.A., Breslow, J.L.,
Tall, A.R., 1991. Reduced high density lipoprotein cholesterol in human cholesteryl
ester transfer protein transgenic mice. J. Biol. Chem. 266 (17), 10796–10801.
Aksnes, A., Mundheim, H., Toppe, J., Albrektsen, S., 2008. The effect of dietary hydro-
xyproline supplementation on salmon (Salmo salar L.) fed high plant protein diets.
Aquaculture 275 (1–4), 242–249.
AOAC, 1999. Official Methods of Analysis of the Association of Official Agricultural
Chemists, 16th ed. AOAC International, Gaithersburg, MD, USA 5th rev.
Armenteros, M., Heinonen, M., Ollilainen, V., Toldrá, F., Estévez, M., 2009. Analysis of
protein carbonyls in meat products by using the dnph-method, fluorescence spec-
troscopy and liquid chromatography-electrospray ionisation-mass spectrometry (LC-
ESI-MS). Meat Sci. 83 (1), 104–112.
Belghit, I., Liland, N.S., Waagbo, R., Biancarosa, I., Pelusio, N., Li, Y., Krogdahl, A., Lock,
E.-J., 2018. Potential of insect-based diets for Atlantic salmon (Salmo salar).
Aquaculture 491, 72–81.
Bondari, K., Sheppard, D.C., 1981. Soldier fly larvae as feed in commercial fish produc-
tion. Aquaculture 24, 103–109.
Bondari, K., Sheppard, D.C., 1987. Soldier fly, Hermetia illucens L., as feed for channel
catfish, Ictalurus punctatus (Rafinesque), and blue tilapia, Oreochromis aureus
(Steindachner). Aquac. Res. 18 (3), 209–220.
Brusle, J., Anadon, G.G., 1996. The structure and function of fish liver. In: Fish
Morphology, pp. 77–93.
Buege, J.A., Aust, S.D., 1978. Microsomal lipid peroxidation. Methods Enzymol. 52 (349),
302–310.
Chen, J.C., Zhou, X.Q., Lin, F., Yang, L., Jiang, J., 2009. Effects of glutamine on hydrogen
peroxide-induced oxidative damage in intestinal epithelial cells of Jian carp (Cyprinus
carpio var. Jian). Aquaculture 288 (3–4), 285–289.
153
Aquaculture 507 (2019) 144–154
Chen, Y., Zhu, X., Yang, Y., Han, D., Jin, J., Xie, S., 2014. Effect of dietary chitosan on
growth performance, haematology, immune response, intestine morphology, intes-
tine microbiota and disease resistance in gibel carp (Carassius auratus gibelio). Aquac.
Nutr. 20 (5), 532–546.
Cummins, V.C., Rawles, S.D., Thompson, K.R., Velasquez, A., Kobayashi, Y., Hager, J.,
Webster, C.D., 2017. Evaluation of black soldier fly (Hermetia illucens) larvae meal as
partial or total replacement of marine fish meal in practical diets for Pacific white
shrimp (Litopenaeus vannamei). Aquaculture 473, 337–344.
Devic, E., Leschen, W., Murray, F., Little, D.C., 2017. Growth performance, feed utiliza-
tion and body composition of advanced nursing nile tilapia (Oreochromis niloticus) fed
diets containing black soldier fly (Hermetia illucens) larvae meal. Aquac. Nutr. 24 (1),
416–423.
Dumas, A., Raggi, T., Barkhouse, J., Lewis, E., Weltzien, E., 2018. The oil fraction and
partially defatted meal of black soldier fly larvae (Hermetia illucens) affect differently
growth performance, feed efficiency, nutrient deposition, blood glucose and lipid
digestibility of rainbow trout (Oncorhynchus mykiss). Aquaculture 492, 24–34.
Elhag, O., Zhou, D., Song, Q., Soomro, A.A., Cai, M., Zheng, L., Yu, Z., Zhang, J., 2017.
Screening, expression, purification and functional characterization of novel anti-
microbial peptide genes from Hermetia illucens (L.). PLoS ONE 12 (1), e0169582.
El-Kamary, S.S., Shardell, M.D., Abdel-Hamid, M., Ismail, S., El-Ateek, M., Metwally, M.,
Mikhail, N., Hashem, M., Mousa, A., Aboul-Fotouh, A., El-Kassas, M., Esmat, G.,
Strickland, T., 2009. A randomized controlled trial to assess the safety and efficacy of
silymarin on symptoms, signs and biomarkers of acute hepatitis. Phytomedicine 16
(5), 391–400.
Gasco, L., Gai, F., Maricchiolo, G., Genovese, L., Ragonese, S., Bottari, T., Caruso, G.,
2018a. Fishmeal alternative protein sources for aquaculture feeds. In: Gasco, L. (Ed.),
Chemistry of foods: feeds for the aquaculture sector – current situation and alter-
native sources, pp. 1–28.
Gasco, L., Finke, M., van Huis, A., 2018b. Can diets containing insects promote animal
health? J. Insects Food Feed 4 (1), 1–4.
Haemmerle, G., Zimmermann, R., Hayn, M., Theussl, C., Waeg, G., Wagner, E., Sattler,
W., Magin, T.M., Wagner, E.F., Zechner, R., 2002. Hormone-sensitive lipase defi-
ciency in mice causes diglyceride accumulation in adipose tissue, muscle, and testis.
J. Biol. Chem. 277 (7), 4806–4815.
Hartviksen, M., Vecino, J.L.G., Ringo, E., Bakke, A.M., Wadsworth, S., Krogdahl, A.,
Ruohonen, K., Kettunen, A., 2014. Alternative dietary protein sources for Atlantic
salmon (Salmo salar L.) effect on intestinal microbiota, intestinal and liver histology
and growth. Aquac. Nutr. 20 (4), 381–398.
Henry, M., Gasco, L., Piccolo, G., Fountoulaki, E., 2015. Review on the use of insects in
the diet of farmed fish: past and future. Anim. Feed Sci. Technol. 203, 1–22.
Howard, D.W., Smith, C.S., 1983. Histological Techniques for Marine Bivalve Molluscs.
Woods Hole, MA: NOAA Technical Memorandum NMFS-F/NEC-25, pp. 97.
Howe, E.R., Simenstad, C.A., Toft, J.D., Cordell, J.R., Bollens, S.M., 2014.
Macroinvertebrate prey availability and fish diet selectivity in relation to environ-
mental variables in natural and restoring North San Francisco Bay tidal marsh
channels. San Francisco Estuary Watershed Sci 12 (1), 1–46.
Hu, J.R., Wang, G.X., Huang, Y.H., Sun, Y.P., He, F., Zhao, H.X., Li, N.N., 2017a. Effects of
substitution of fish meal with black soldier fly (Hermetia illucens) larvae meal, in
yellow catfish (Pelteobagrus fulvidraco) diets. Isr. J. Aquac. 69, 1–9.
Hu, J.R., He, F., Mo, W.Y., Chen, X.Y., Huang, Y.H., Wang, G.X., Sun, Y.P., 2017b. The
feeding value of black soldier fly (Hermetia illucens) larvae for feeding different or-
ganic wastes. China Feed 15, 24–27.
Hu, J.R., Wang, G.X., Mo, W.Y., Huang, Y.H., Li, G.L., Li, Y., Sun, Y.P., Zhao, H.X., 2018.
Effects of fish meal replacement by black soldier fly (Hermetia illucens L.) larvae meal
on growth performance, body composition, plasma biochemical indexes and tissue
structure of juvenile Lateolabrax japonicus. Chinese J. Anim. Nutr. 30 (2), 613–623.
Kader, M.A., Bulbul, M., Koshio, S., Ishikawa, M., Yokoyama, S., Nguyen, B.T., Komilus,
C.F., 2012. Effect of complete replacement of fishmeal by dehulled soybean meal
with crude attractants supplementation in diets for red sea bream, Pagrus major.
Aquaculture 350-353, 109–116.
Kaushik, S.J., Cravedi, J.P., Lalles, J.P., Sumpter, J., Fauconneau, B., Laroche, M., 1995.
Partial or total replacement of fish meal by soybean protein on growth, protein uti-
lization, potential estrogenic or antigenic effects, cholesterolemia and flesh quality in
rainbow trout, Oncorhynchus mykiss. Aquaculture 133 (3), 257–274.
Khoushab, F., Yamabhai, M., 2010. Chitin research revisited. Mar. Drugs 8 (7),
1988–2012.
Kroeckel, S., Age, H., Roth, I., Katz, H., Wuertz, S., Susenbeth, A., Schulz, C., 2012. When
a turbot catches a fly: evaluation of a pre-pupae meal of the black soldier fly
(Hermetia illucens) as fish meal substitute—growth performance and chitin degrada-
tion in juvenile turbot (Psetta maxima). Aquaculture 364-365 (3), 345–352.
Li, Q.P., Gooneratne, S.R., Wang, R.L., Zhang, R., An, L.L., Chen, J.J., Pan, W., 2016a.
Effect of different molecular weight of chitosans on performance and lipid metabo-
lism in chicken. Anim. Feed Sci. Technol. 211, 174–180.
Li, S., Ji, H., Zhang, B., Tian, J., Zhou, J., Yu, H., 2016b. Influence of black soldier fly
(Hermetia illucens) larvae oil on growth performance, body composition, tissue fatty
acid composition and lipid deposition in juvenile jian carp (Cyprinus carpio var. Jian).
Aquaculture 465, 43–52.
Li, S., Mai, K., Xu, W., Yuan, Y., Zhang, Y., Zhou, H., Ai, Q.H., 2016c. Effects of dietary
lipid level on growth, fatty acid composition, digestive enzymes and expression of
some lipid metabolism related genes of orange-spotted grouper larvae (Epinephelus
coioides H.). Aquac. Res. 47 (8), 2481–2495.
Li, S., Ji, H., Zhang, B., Zhou, J., Yu, H., 2017a. Defatted black soldier fly (Hermetia
illucens) larvae meal in diets for juvenile Jian carp (Cyprinus carpio var. Jian): growth
performance, antioxidant enzyme activities, digestive enzyme activities, intestine and
hepatopancreas histological structure. Aquaculture 477, 62–70.
Li, Q., Zhu, H.Y., Wei, J.J., Zhang, F., Li, E.C., Du, Z.Y., Qin, J.G., Chen, L.Q., 2017b.
G. Wang, et al.
Effects of dietary lipid sources on growth performance, lipid metabolism and anti-
oxidant status of juvenile Russian sturgeon Acipenser gueldenstaedtii. Aquac. Nutr. 23
(3), 500–510.
Liao, F.H., Shieh, M.J., Chang, N.C., Chien, Y.W., 2007. Chitosan supplementation lowers
serum lipids and maintains normal calcium, magnesium, and iron status in hyperli-
pidemic patients. Nutr. Res. 27 (3), 146–151.
Liland, N.S., Biancarosa, I., Araujo, P., Biemans, D., Bruckner, C.G., Waagbo, R.,
Torstensen, B.E., Lock, E.-J., 2017. Modulation of nutrient composition of black
soldier fly (Hermetia illucens) larvae by feeding seaweed-enriched media. PLoS ONE
12 (8), e0183188.
Liu, X., Sun, X.L., Li, L.X., Zhang, Y., Chen, J.C., 2017. Effects of dietary fish meal replaced
by Hermetia illucens meal on growth and health of koi cap (Cyprinus carpio). J. Dalian
Ocean Univ. 32 (4), 422–427.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2-ΔΔCT method. Methods 25 (4), 402–408.
Lock, E.R., Arsiwalla, T., Waagbo, R., 2016. Insect larvae meal as an alternative source of
nutrients in the diet of Atlantic salmon (Salmo salar) postsmolt. Aquac. Nutr. 22 (6),
1202–1213.
Lock, E.-J., Biancarosa, I., Gasco, L., 2018. Springer international publishing AG 2018. In:
Halloran, A. (Ed.), Insects as raw materials in compound feed for aquaculture. Edible
Insects in Sustainable Food Systems, pp. 263–276.
Madrid, J., Martínez, S., López, C., Orengo, J., López, M.J., Hernández, F., 2013. Effects of
low protein diets on growth performance, carcass traits and ammonia emission of
barrows and gilts. Anim. Prod. Sci. 53 (2), 146–153.
Magalhães, R., Sánchez-López, A., Leal, R.S., Martínez-Llorens, S., Oliva-Teles, A., Peres,
H., 2017. Black soldier fly (Hermetia illucens) pre-pupae meal as a fish meal re-
placement in diets for European seabass (Dicentrarchus labrax). Aquaculture 476,
79–85.
Makkar, H.P.S., Tran, G., Heuzé, V., Ankers, P., 2014. State-of-the-art on use of insects as
animal feed. Anim. Feed Sci. Technol. 197, 1–33.
Martenat, A., Diener, S., Zurbrugg, C., 2019. Black soldier fly biowaste treatment – as-
sessment of global warming potential. Waste Manag. 84, 173–181.
Meneguz, M., Schiavone, A., Gai, F., Dama, A., Lussiana, C., Gasco, L., 2018. Effect of
rearing substrate on growth performance, waste reduction efficiency and chemical
composition of black soldier fly (Hermetia illucens) larvae. J. Sci. Food Agric. 98 (15),
5776–5784.
Merrifield, D.L., Olsen, R.E., Myklebust, R., Ringo, E., El-Shemy, H., 2011. Dietary effect
of soybean (Glycine max) products on gut histology and microbiota of fish. In: El-
Shemy, H. (Ed.), Soybean and Nutrition. InTech, pp. 231–250.
Muin, H., Taufek, N.M., Kamarudin, M.S., Razak, S.A., 2017. Growth performance, feed
utilization and body composition of Nile tilapia, Oreochromis niloticus (Linnaeus,
1758) fed with different levels of black soldier fly, Hermetia illucens (Linnaeus, 1758)
maggot meal diet. Iran. J. Fish. Sci. 16 (2), 567–577.
Ngo, D.H., Kim, S.K., 2014. Antioxidant effects of chitin, chitosan and their derivatives.
Adv. Food Nutr. Res. 73, 15–31.
Ngo, D.N., Lee, S.H., Kim, M.M., Kim, S.K., 2009. Production of chitin oligosaccharides
with different molecular weights and their antioxidant effect in raw 264.7 cells. J.
Funct. Foods 1 (2), 188–198.
Okumura, S., Sakakibara, M., Hayashida, R., Jinno, Y., Tanaka, A., Okada, K., Hayashi,
M., Ishii, H., Murohara, T., 2014. Accelerated decline in renal function after acute
myocardial infarction in patients with high low-density lipoprotein-cholesterol to
high-density lipoprotein-cholesterol ratio. Heart Vessel. 29 (1), 7–14.
Ostaszewska, T., Dabrowski, K., Kamaszewski, M., Grochowski, P., Verri, T., Rzepkowska,
M., Wolnicki, J., 2010. The effect of plant protein-based diet supplemented with
dipeptide or free amino acids on digestive tract morphology and pept1 and pept2
expressions in common carp (Cyprinus carpio L.). Comparative Biochem. Physiol. Part
A 157 (2), 158–169.
Park, S., Yoe, S.M., 2017. A novel cecropin-like peptide from black soldier fly, Hermetia
illucens: isolation, structural and functional characterization. Entomol. Res. 47 (2),
115–124.
Pinto, W., Ronnestad, I., Dinis, M.T., Aragao, C., 2013. Taurine and fish development:
insights for the aquaculture industry. In: El-Idrissi, A., L'Amoreaux, W.J. (Eds.),
Advances in Experimental Medicine and Biology. vol. 776. Springer, New York, pp.
329–334.
Poma, G., Cuykx, M., Amato, E., Calaprice, C., Focant, J.F., Covaci, A., 2017. Evaluation
of hazardous chemicals in edible insects and insect-based food intended for human
consumption. Food Chem. Toxicol. 100, 70–79.
Renna, M., Schiavone, A., Gai, F., Dabbou, S., Lussiana, C., Malfatto, V., Prearo, M.,
Capucchio, M.T., Biasato, I., Biasibetti, E., De Marco, M., Brugiapaglia, A., Zoccarato,
I., Gasco, L., 2017. Evaluation of the suitability of a partially defatted black soldier fly
(Hermetia illucens L.) larvae meal as ingredient for rainbow trout (Oncorhynchus my-
kiss Walbaum) diets. J. Anim. Sci. Biotechnol. 8 (4), 957–969.
Salomone, R., Saija, G., Mondello, G., Giannetto, A., Fasulo, S., Savastano, D., 2017.
Environmental impact of food waste bioconversion by insects: application of life
cycle assessment to process using Hermetia illucens. J. Clean. Prod. 140, 890–905.
Sánchez-López, A., 2015. Potential of Pre-Pupae Meal of the Black Soldier Fly Hermetia
illucens as Fish Meal Substitute: Effect on Growth Performance and Digestibility in
154
Aquaculture 507 (2019) 144–154
European Sea Bass Dicentrarchus labrax. Master Thesis. Universitat Politècnica de
València, Valencia, Spain.
Sealey, W.M., Gaylord, T.G., Barrows, F.T., Tomberlin, J.K., McGuire, M.A., Ross, C., St-
Hilaire, S., 2011. Sensory analysis of rainbow trout, Oncorhynchus mykiss, fed en-
riched black soldier fly prepupae, Hermetia illucens. J. World Aquacult. Soc. 42 (1),
34–45.
Sheikhzadeh, N., Tayefinasrabadi, H., Oushani, A.K., Enferadi, M.H., 2012. Effects of
haematococcus pluvialis supplementation on antioxidant system and metabolism in
rainbow trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 38 (2), 413–419.
Shiau, S.Y., Yu, Y.P., 1999. Dietary supplementation of chitin and chitosan depresses
growth in tilapia, Oreochromis niloticus × O. aureus. Aquaculture 179 (1–4), 439–446.
Shumo, M., 2018. An analysis of the nutritive value of the black soldier fly larvae reared
on different substrates. Proceedings of the 2nd International Conference “Insects to
Feed the World”, May 15–18, Wuhan, China. J. Insects Food Feed, vol. 4 (supplement
1), S27.
Spranghers, T., Ottoboni, M., Klootwijk, C., Ovyn, A., Smet, S.D., 2017. Nutritional
composition of black soldier fly (Hermetia illucens) prepupae reared on different or-
ganic waste substrates. J. Sci. Food Agric. 97 (5), 2594–2600.
St-Hilaire, S., Sheppard, C., Tomberlin, J.K., Irving, S., Newton, L., Mcguire, M.A., Mosley,
E.E., Hardy, R.W., Sealey, W., 2007. Fly prepupae as a feedstuff for rainbow trout,
Oncorhynchus mykiss. J. World Aquacult. Soc. 38 (1), 59–67.
Sun, M., Hassan, S.G., Li, D.L., 2016. Models for estimating feed intake in aquaculture: a
review. Comput. Electron. Agric. 127, 425–438.
Talamuk, R., 2016. Comparisons of Growth Performance of African Catfish (Clarias gar-
iepinus BURCHELL, 1822) Fingerlings Fed Different Inclusion Levels of Black Soldier
Fly (Hermetia illucens) Larvae Meal Diets. Master Thesis. Stellenbosch University,
Stellenbosch, South Africa.
Tan, X.Y., Zhi, L., Ping, X., Liu, X.J., 2009. Effect of dietary linolenic acid/linoleic acid
ratio on growth performance, hepatic fatty acid profiles and intermediary metabolism
of juvenile yellow catfish Pelteobagrus fulvidraco. Aquaculture 296 (1), 96–101.
Tan, X.H., Sun, Z.Z., Zhou, C.P., Huang, Z., Tan, L.J., Xun, P.W., Huang, Q.Q., Lin, H.Z.,
Ye, C.X., Wang, A.L., 2018. Effects of dietary dandelion extract on intestinal mor-
phology, antioxidant status, immune function and physical barrier function of juve-
nile golden pompano trachinotus ovatus. Fish Shellfish Immunol 73, 197–206.
Tran, G., Heuzé, V., Makkar, H.P.S., 2015. Insects in fish diets. Anim. Front. 5 (2), 37–44.
Tschirner, M., Simon, A., 2015. Influence of different growing substrates and processing
on the nutrient composition of black soldier fly larvae destined for animal feed. J.
Insects Food Feed 1 (4), 249–259.
Wang, X., Chen, X., Chen, L., Wang, B., Peng, C., He, C., Tang, M., Zhang, F., Hu, J., Li, R.,
Zhao, X., Wei, Y., 2008. Optimizing high-performance liquid chromatography
method for quantification of glucosamine using 6-aminoquinolyl-N-hydro-
xysuccinimidyl carbamate derivatization in rat plasma: application to a pharmaco-
kinetic study. Biomed. Chromatogr. 22 (11), 1265–1271.
Wang, L.N., Liu, W.B., Lu, K.L., Xu, W.N., Cai, D.S., Zhang, C.N., Qian, Y., 2014. Effects of
dietary carbohydrate/lipid ratios on non-specific immune responses, oxidative status
and liver histology of juvenile yellow catfish Pelteobagrus fulvidraco. Aquaculture 426-
427 (1), 41–48.
Whitley, S.N., Bollens, S.M., 2014. Fish assemblages across a vegetation gradient in a
restoring tidal freshwater wetland: diets and potential for resource competition.
Environ. Biol. Fish 97 (6), 659–674.
Xia, W., Liu, P., Zhang, J., Chen, J., 2011. Biological activities of chitosan and chit-
ooligosaccharides. Food Hydrocoll. 25 (2), 170–179.
Xiao, X., Jin, P., Zheng, L., Cai, M., Yu, Z., Yu, J., Zhang, J., 2018. Effects of black soldier
fly (Hermetia illucens) larvae meal protein as a fishmeal replacement on the growth
and immune index of yellow catfish (Pelteobagrus fulvidraco). Aquac. Res. 49 (4),
1569–1577.
Xu, H., Dong, X., Zuo, R., Mai, K., Ai, Q., 2016. Response of juvenile Japanese seabass
(Lateolabrax japonicus) to different dietary fatty acid profiles: growth performance,
tissue lipid accumulation, liver histology and flesh texture. Aquaculture 461, 40–47.
Yousif, M.O., Krishnankutty, M.K., Abdul-fatah, A., Abdul-rahman, A., 2014. Growth
performance, feed efficiency and carcass composition of African catfish, Clarias gar-
iepinus (Picess: Clariidae) fingerlings fed diets composed of agricultural by-products.
Int. J. Biosci. 4 (10), 276–284.
Zarantoniello, M., Bruni, L., Randazzo, B., Vargas, A., Gioacchini, G., Truzzi, C.,
Annibaldi, A., Riolo, P., Parisi, G., Cardinaletti, G., Tulli, F., Olivotto, I., 2018. Partial
dietary inclusion of Hermetia illucens (black soldier Fly) full-fat prepupae in zebrafish
feed: biometric, histological, biochemical, and molecular implications. Zebrafish 15
(5), 519–532.
Zhang, J., Liu, J., Li, L., Xia, W., 2008. Dietary chitosan improves hypercholesterolemia in
rats fed high-fat diets. Nutr. Res. 28 (6), 383–390.
Zheng, J.L., Luo, Z., Zhu, Q.L., Tan, X.Y., Chen, Q.L., Sun, L.D., Hu, W., 2013. Molecular
cloning and expression pattern of 11 genes involved in lipid metabolism in yellow
catfish Pelteobagrus fulvidraco. Gene 531 (1), 53–63.
Zhou, J.S., Liu, S.S., Ji, H., Yu, H.B., 2017. Effect of replacing dietary fish meal with black
soldier fly larvae meal on growth and fatty acid composition of Jian carp (Cyprinus
carpio var. Jian). Aquac. Nutr. 24 (1), 1–10.