The Commission on Higher Education

in collaboration with the Philippine Normal University

INITIAL RELEASE: 13 JUNE 2016

Teaching Guide for Senior High School

GENERAL
BIOLOGY 2
SPECIALIZED SUBJECT | ACADEMIC-STEM

This Teaching Guide was collaboratively developed and reviewed by

educators from public and private schools, colleges, and universities. We
encourage teachers and other education stakeholders to email their
feedback, comments, and recommendations to the Commission on Higher
Education, K to 12 Transition Program Management Unit - Senior High School
Support Team at k12@ched.gov.ph. We value your feedback and
recommendations.
 Development Team
Team Leader: Ivan Marcelo A. Duka
Writers: Neil Andrew B. Bascos, Ph.D., Ma.
Genaleen Q. Diaz, Ph.D., Ian Kendrich C. This Teaching Guide by the
Fontanilla, Ph.D., Ma. Carmina C. Manuel, Ph.D., Commission on Higher Education is
Sharon Rose licensed under a Creative
Commons Attribution-
M. Tabugo, Ph.D., Eugenio P. Quijano Jr.
NonCommercial-ShareAlike 4.0
Technical Editors: Annalee S. Hadsall, International License. This means
Published by the Commission on Higher Education, 2016 Ph.D. Copy Reader: Caroline H. Pajaron you are free to:
Chairperson: Patricia B. Licuanan, Ph.D. Share — copy and redistribute the
Illustrator: Ma. Daniella Louise F. Borrero
material in any medium or format
Commission on Higher Education
Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz Adapt — remix, transform, and
K to 12 Transition Program Management Unit
build upon the material.
Office Address: 4th Floor, Commission on Higher Education, The licensor, CHED, cannot revoke
C.P. Garcia Ave., Diliman, Quezon City Senior High School Support Team these freedoms as long as you
Telefax: (02) 441-0927 / E-mail Address: k12@ched.gov.ph CHED K to 12 Transition Program Management Unit follow the license terms.
However, under the following
Program Director: Karol Mark R. Yee
terms:
Lead for Senior High School Support: Attribution — You must give
Gerson M. Abesamis appropriate credit, provide a link
to
Consultants the license, and indicate if
Lead for Policy Advocacy and Communications:
THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY. changes were made. You may do
Averill M. Pizarro so in any reasonable manner, but
University President: Ester B. Ogena, Ph.D.
Course Development Officers: not in any way that suggests the
VP for Academics: Ma. Antoinette C. Montealegre, Ph.D.
licensor endorses you or your use.
VP for University Relations & Advancement: Rosemarievic V. Diaz, John Carlo P. Fernando, Danie Son D. Gonzalvo
NonCommercial — You may not use
Ph.D.
Teacher Training Officers: the material for commercial
Ma. Cynthia Rose B. Bautista, Ph.D., CHED Ma. Theresa C. Carlos, Mylene E. Dones purposes.
Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University ShareAlike — If you remix,
Monitoring and Evaluation Officer: transform, or build upon the
Carmela C. Oracion, Ph.D., Ateneo de Manila University
Robert Adrian N. Daulat material, you must distribute your
Minella C. Alarcon, Ph.D., CHED
contributions under the same license
Administrative Officers:
Gareth Price, Sheffield Hallam University as the original.
Ma. Leana Paula B. Bato, Kevin Ross D. Nera,
Stuart Bevins, Ph.D., Sheffield Hallam University
Allison A. Danao, Ayhen Loisse B. Dalena
Printed in the Philippines by EC-TEC Commercial, No. 32 St.
Louis Compound 7, Baesa, Quezon City, ectec_com@yahoo.com
Table of Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ii Chapter 3: Systematics Based on Evolutionary Relationships
.
DepEd General Biology 2 Curriculum Guide . . . . . . . . . . . . vi Lesson 14: Systematics Based on Evolutionary Relationships:
.
Chapter 1: Genetics Tree of Life and Systematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109

Lesson 1: Pedigree Analysis............................................1

Lesson 15: Systematics Based on Evolutionary Relationships:
Lesson 2: Sex Linkage and Recombination...........................
8 Taxonomy.....................................................................117
Lesson 3: Modifications to Mendel’s Classic Ratios.................13
Lesson 16: Systematics Based on Evolutionary Relationships:
Lesson 4: Molecular Structure of DNA, RNA, and Proteins........
19 Cladistics and Phylogeny....................................................129
Lesson 5: DNA Replication and Protein Synthesis..............24 Chapter 4: Compare and Contrast Processes in Plants and Animals

Lesson 6: Genetic Engineering.........................................30

Lesson 17: Reproduction and Development............................136

Lesson 7: Discuss the Applications of Recombinant DNA . . . . 36 Lesson 18: Nutrition.........................................................158

Chapter 2: Evolution and Origin of Biodiversity Lesson 19: Gas Exchange...................................................179

Lesson 8: History of Life on Earth . . . . . . . . . . . . . . . . . . . . . . . 49......................................Lesson 20: Transport and Circulation

190

Lesson 9: Mechanisms that Produce Change in Populations . . 70 Lesson 21: Regulation of Body Fluids.....................................194

Lesson 10: Evolution and Origin of Biodiversity: Patterns of

Lesson 22: Immune Systems . . . . . . . . . . . . . . . . . . . . . . . . . . 204
Descent with Modification...............................................81 ...
214
Lesson 23: Chemical and Nervous Control . . . . . . . . . . . . . . . . .
Lesson 11: Development of Evolutionary Thought . . . . . . . . . 87 Lesson 24: Sensory and Motor Mechanisms..............................226

Lesson 12: Evidences of Evolution . . . . . . . . . . . . . . . . . . . . . . 92 Lesson 25: Feedback Mechanisms.........................................235

Lesson 13: Infer Evolutionary Relationships of Organisms . . . . 102 Colored Images...............................................................249

Biographical Notes..................................................... 257

i
Introduction
As the Commission supports DepEd’s implementation of Senior High School (SHS), it upholds the vision
and mission of the K to 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic
Education Act of 2013, that “every graduate of basic education be an empowered individual, through
a program rooted on...the competence to engage in work and be productive, the ability to coexist in
fruitful harmony with local and global communities, the capability to engage in creative and critical
thinking, and the capacity and willingness to transform others and oneself.”
To accomplish this, the Commission partnered with the Philippine Normal University (PNU), the National
Center for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this
Teaching Guide was studied and reviewed by education and pedagogy experts, and was enhanced with
appropriate methodologies and strategies.
Furthermore, the Commission believes that teachers are the most important partners in attaining this
goal. Incorporated in this Teaching Guide is a framework that will guide them in creating lessons and
assessment tools, support them in facilitating activities and questions, and assist them towards
deeper content areas and competencies. Thus, the introduction of the SHS for SHS Framework.

SHS for SHS The SHS for SHS Framework, which stands for “Saysay-Husay-Sarili for Senior High School,” is at
the core of this book. The lessons, which combine high-quality content with flexible elements to
Framework accommodate diversity of teachers and environments, promote these three fundamental concepts:

SAYSAY: MEANING HUSAY: MASTERY SARILI: OWNERSHIP

Why is this important?
Through this Teaching Guide,
teachers will be able to facilitate
an understanding of the value
of the lessons, for each learner
to fully engage in the content
on both the cognitive and
affective levels.
How will I deeply understand
this?
Given that developing mastery
goes beyond memorization,
teachers should also aim for
deep understanding of the
subject matter where they lead
learners to analyze and
synthesize knowledge.
What can I do with this?
When teachers empower
learners to take ownership of
their learning, they develop
independence and self-
direction, learning about
both the subject matter and
themselves.
 This Teaching Guide is intended for Science, Technology, Engineering, and Mathematics (STEM) Strand
teachers who are teaching learners under the Academic Track. The prerequisite course for this subject is
General Biology 1, that primarily focuses on life processes at the cellular and molecular levels. The
said prerequisite course also covers the transformation of energy in organisms.

As we go broader on a macro-level perspective, General Biology 2 is designed to enhance the

understanding of the principles and concepts in the study of Biology, particularly heredity and
variation, and the diversity of living organisms, their structure, function, and evolution. It is with
passionate desire that the teachers who will tackle the concepts in General Biology 2 lead Grade 12
students to pursue Science-related courses in college. Studies conducted across the globe have
identified innovation and education in the fields of Science, Technology, Education and Mathematics
(STEM) as critical determinants economic prosperity. Indeed, STEM educated and trained individuals
have been shown to be major determinants of innovation and, thus, contributors to significant
economic productivity.

Through this Teaching Guide, teachers are also empowered to be Designers, Facilitators, and
Learners of their own lessons:
1. When teachers are Designers, they should be able to:
- Contextualize available resources, content, and tools to fit their learners and environments
- Collaborate with fellow teachers in preparing materials and lessons
About - Create and utilize assessments (rubrics, exams, projects)
this Teaching - Leverage Pedagogical-Content Knowledge in developing lessons
- Design lessons that encourage creativity and leadership
Guide 2. When teachers are Facilitators, they should be able to:
- Ask questions, facilitate discussions, and encourage student reflection
- Use learner-centered teaching strategies
- Provide useful feedback for learners
- Mentor learners for careers and further education
- Be sensitive to teenage development (gender, identity, character, grit)
3. When teachers are Learners, they should be able to:
- Gather data and student feedback
- Reflect on student feedback and classroom insights to improve teaching
- Use teacher/peer observations
- Critically use research and information
- Connect prior knowledge and debunk common misconceptions in education
iii
 Parts of the This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly
usable for teachers. It contains classroom activities and pedagogical notes, and is integrated
Teaching Guide with innovative pedagogies. All of these elements are presented in the following parts:
1. Introduction
• Highlight key concepts and identify the essential questions
• Show the big picture
• Connect and/or review prerequisite knowledge
• Clearly communicate learning competencies and objectives
• Motivate through applications and connections to real-life
2. Motivation
• Give local examples and applications
• Engage in a game or movement activity
• Provide a hands-on/laboratory activity
• Connect to a real-life problem
3. Instruction/Delivery
• Give a demonstration/lecture/simulation/hands-on activity
• Show step-by-step solutions to sample problems
• Give applications of the theory
• Connect to a real-life problem if applicable
4. Practice
• Discuss worked-out examples
• Provide easy-medium-hard questions
• Give time for hands-on unguided classroom work and discovery
• Use formative assessment to give feedback
5. Enrichment
• Provide additional examples and applications
• Introduce extensions or generalisations of concepts
• Engage in reflection questions
• Encourage analysis through higher order thinking prompts
6. Evaluation
• Supply a diverse question bank for written work and exercises
• Provide alternative formats for student work: written homework, journal, portfolio, group/individual
projects, student-directed research project
 On DepEd Functional Skills and CHED College Readiness Standards

As Higher Education Institutions (HEIs) welcome the graduates of
the Senior High School program, it is of paramount importance
to align Functional Skills set by DepEd with the College
Readiness Standards stated by CHED.
The DepEd articulated a set of 21st century skills that should be
embedded in the SHS curriculum across various subjects and
tracks. These skills are desired outcomes that K to 12 graduates
should possess in order to proceed to either higher education,
employment, entrepreneurship, or middle-level skills development.
On the other hand, the Commission declared the College
Readiness Standards that consist of the combination of
knowledge, skills, and reflective thinking necessary to participate
and succeed - without remediation - in entry-level undergraduate
courses in college.
The alignment of both standards, shown below, is also presented
in this Teaching Guide - prepares Senior High School graduates to
the revised college curriculum which will initially be implemented by
AY 2018-2019.

College Readiness Standards Foundational Skills DepEd Functional Skills

Produce all forms of texts (written, oral, visual, digital) based on:
1. Solid grounding on Philippine experience and culture;
2. An understanding of the self, community, and nation;
Visual and information literacies, media literacy, critical thinking
3. Application of critical and creative thinking and doing processes; and problem solving skills, creativity, initiative and self-direction
4. Competency in formulating ideas/arguments logically, scientifically, and creatively; and
5. Clear appreciation of one’s responsibility as a citizen of a multicultural Philippines and
a diverse world;

Global awareness, scientific and economic literacy, curiosity,

Systematically apply knowledge, understanding, theory, and skills for the development
critical thinking and problem solving skills, risk taking, flexibility
of the self, local, and global communities using prior learning, inquiry, and
and adaptability, initiative and self-direction
experimentation
Global awareness, media literacy, technological literacy,
creativity, flexibility and adaptability, productivity and
Work comfortably with relevant technologies and develop adaptations and innovations for
accountability
significant use in local and global communities
Global awareness, multicultural literacy, collaboration and
interpersonal skills, social and cross-cultural skills, leadership
Communicate with local and global communities with proficiency, orally, in writing,
and responsibility
and through new technologies of communication
Media literacy, multicultural literacy, global awareness,
collaboration and interpersonal skills, social and cross-cultural
Interact meaningfully in a social setting and contribute to the fulfilment of individual
skills, leadership and responsibility, ethical, moral, and spiritual
and shared goals, respecting the fundamental humanity of all persons and the diversity values
of groups and communities

v
 K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Grade: Grade 11/12 Quarters: 3rd to 4th Quarter
Subject Title: Biology 2 I No. of Hours: 40 hours/10 Weeks per Quarter
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly heredity and variation, and
the diversity of living organisms, their structure, function, and evolution.
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
The learners demonstrate The learners:
an understanding of:
1. compare and contrast the following processes in plants
1. Plant and Animal The learners shall be able to: and animals: reproduction, development, nutrition, gas STEM_BIO11/12-
exchange, transport/circulation, regulation of body IVa-h-1
Organ Systems and
develop a presentation (e.g. fluids, chemical and nervous control, immune systems,
their Functions
Organismal role-playing, dramatization and and sensory and motor mechanisms
other forms of multimedia) to
Biology 2. explain how some organisms maintain steady internal STEM_BIO11/12-
show how an organism
conditions that possess various structures and processes IVi-j-2
maintains homeostasis through
the interaction of the various 3. describe examples of homeostasis (e.g., temperature
2. Feedback Mechanisms
organ systems in the body regulation, osmotic balance and glucose levels) and the STEM_BIO11/12-
major features of feedback loops that produce such IVi-j-3
homeostasis
1. predict genotypes and phenotypes of parents and STEM_BIO11/12-
1. make a pedigree analysis in offspring using the laws of inheritance IIIa-b-1
the learner’s family using a
simple genetic trait 2. explain sex linkage and recombination STEM_BIO11/12-
IIIa-b-2
2. make a research paper/case
3. describe modifications to Mendel’s classic ratios (gene STEM_BIO11/12-
study/poster on genetic
1. Mendel’s Laws of interaction) IIIa-b-3
diseases
Inheritance
2. Sex Linkage 4. illustrate the molecular structure of DNA, RNA, and STEM_BIO11/12-
Genetics 3. make a diagram (e.g., proteins
3. Central Dogma of IIIa-b-4
pictogram, poster) showing
Molecular Biology the evolution of a 5. diagram the steps in DNA replication and protein STEM_BIO11/12-
4. Recombinant DNA synthesis
domesticated crop IIIa-b-5

4. differentiate the 3-Domain 6. outline the processes involved in genetic engineering STEM_BIO11/12-
Scheme from the 5-Kingdom IIIa-b-6
Scheme of classification of
STEM_BIO11/12-
living things 7. discuss the applications of recombinant DNA
IIIa-b-7

K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 1 of 3
 K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT

CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE

1. describe general features of the history of life on Earth,

including generally accepted dates and sequence of the STEM_BIO11/12-
geologic time scale and characteristics of major groups IIIc-g-8
of organisms present during these time periods
2. explain the mechanisms that produce change in
populations from generation to generation (e.g., STEM_BIO11/12-
artificial selection, natural selection, genetic drift, IIIc-g-9
mutation, recombination)
Evolution and Relevance, Mechanisms, 3. show patterns of descent with modification from
Origin of Evidence/Bases, and common ancestors to produce the organismal diversity STEM_BIO11/12-
Biodiversity Theories of Evolution observed today IIIc-g-10

4. trace the development of evolutionary thought STEM_BIO11/12-

IIIc-g-11
5. explain evidences of evolution (e.g., biogeography,
fossil record, DNA/protein sequences, homology, and STEM_BIO11/12-
embryology) IIIc-g-12

6. infer evolutionary relationships among organisms using STEM_BIO11/12-

the evidence of evolution IIIc-g-13
1. explain how the structural and developmental
characteristics and relatedness of DNA sequences are STEM_BIO11/12IIIh-
used in classifying living things j-14
Basic Taxonomic Concepts
Systematics
and Principles, Description, 2. identify the unique/distinctive characteristics of a
Based on STEM_BIO11/12IIIh-
Nomenclature, specific taxon relative to other taxa
Evolutionary j-15
Identification, and
Relationships 3. describe species diversity and cladistics, including the
Classification
types of evidence and procedures that can be used to STEM_BIO11/12IIIh-
establish evolutionary relationships j-16

K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 2 of 3
 K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT

Code Book Legend

Sample: STEM_BIO11/12IIIh-j-16

LEGEND SAMPLE

Learning Area and Strand/ Subject or Science, Technology, Engineering and

Specialization Mathematics
First Entry

Grade Level Grade 11 or 12 STEM_BIO11/12

Uppercase Letter/s
Domain/Content/ General Biology
Component/ Topic

Roman Numeral
Quarter Third Quarter III
*Zero if no specific quarter
Lowercase Letter/s
*Put a hyphen (-) in between letters to indicate Week Weeks eight to ten h-j
more than a specific week
-
describe species diversity and cladistics,
including the types of evidence and
Arabic Number Competency 16
procedures that can be used to establish
evolutionary relationships

K to 12 Senior High School STEM Specialized Subject – General Biology 2 December 2013 Page 3 of 3
SUGGESTED ACADEMIC TRACK – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) STRAND SCHEDULING OF SUBJECTS*

Grade 11 Grade 12
STEM
1st Semester 2nd Semester 1st Semester 2nd Semester
21st Century Literature from the
Oral Communication in Context Reading and Writing Skills Physical Education and Health
Philippines and the World
Komunikasyon at Pananaliksik sa Pagbasa at Pagsusuri ng Iba’t-Ibang Contemporary Philippine Arts from
Wika at Kulturang Pilipino Teksto Tungo sa Pananaliksik the Regions
CORE SUBJECTS

General Mathematics Statistics and Probability Media and Information Literacy

Disaster Readiness and Risk Understanding Culture, Society and
Earth Science Reduction Politics
Introduction to the Philosophy of
Personal Development / Pansariling
the Human Person / Pambungad sa Physical Education and Health
Kaunlaran
Pilosopiya ng Tao
Physical Education and Health Physical Education and Health
Empowerment Technologies (E- English for Academic and
CONTEXTUALIZED

Research in Daily Life 1 Research in Daily Life 2

Tech): ICT for Professional Tracks Professional Purposes
SUBJECTS

Entrepreneurship
Pagsulat sa Filipino sa Piling
Larangan (Akademik) Research Project

Pre-Calculus Basic Calculus General Physics 1 General Physics 2

SUBJECTS
SPECIALIZAT

General Chemistry 1 General Biology 1 General Biology 2

ION

General Chemistry 2
Research/Capstone Project
HOURS
PER DAY 5.8 6.6 6.6 5.8

Please note that some subjects have prerequisites. These are indicated in the Curriculum Guides and are listed below for easy referral.

SUBJECT
Research in Daily Life 2
Basic Calculus
General Biology 2
General Chemistry 2
General Physics 1
General Physics 2
PREREQUISITE/S
Statistics and Probability
Pre-Calculus
General Biology 1
General Chemistry 1
Pre-Calculus, Calculus
General Physics 1

K to 12 Senior High School Science, Engineering, Technology and Mathematics Strand Scheduling * 80 hours per subject
General Biology 2 60 MINS

Lesson 1: Pedigree Analysis

Content Standard
The learners understand Mendel’s Laws of Inheritance. LESSON OUTLINE
Performance Standard Introduction Communicating Learning Objectives and 5
The learners shall be able to:
Relevant Vocabulary
• make a Pedigree Analysis in the learner’s family using a simple genetic trait.
Motivation Narrative 5
Learning Competency
The learners shall be able to construct pedigrees and predict genotypes based Instruction Recall in Mendelian Ratios, Discussion 40
on pedigree analysis (STEM_BIO11/12-IIIa-b-1) on Co-Dominance and Multiple Alleles

Specific Learning Outcomes: Practice Group Work: Non-Mendelian Traits in 40

At the end of the lesson, the learners will be able to:
• identify the mode of inheritance of a particular trait given the pedigree;
• predict the genotypes of parents; and
• compute the probability of occurrence of an affected offspring in a
given cross.
Humans, Plants, and Animals
Materials
Pen, paper, and ruler
Resources
(1) Klug WS, Cummings MR, Spencer CA, Palladino MA.
2012. Essentials of genetics. 8th ed. Benjamin
Cummings; 2012. 624 p.
(2) Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV,
Jackson RB. 2012. Campbell biology, 9th ed. The
Benjamin Cummings Publishing Co., Inc: 2012. 1464 p.
(3) Bennett RL, Steinhaus KA, Uhrich SB, O’Sullivan CK,
Resta RG, Lochner-Doyle D, Markel DS, Vincent V,
Hamanishi J. Recommendations for standardized human
pedigree nomenclature. Am J Human Genet. 1995;
56:745-752.
INTRODUCTION (5 MINS)
1. Cite the learning objectives, which are as follows:
I. identify the mode of inheritance of a particular trait given the pedigree
II. predict the genotypes of parents
III. predict the probability of having an affected offspring
2. Relevant vocabulary
I. Pedigree. Making use of diagrams showing the ancestral relationships and transmission
of genetic traits over several generations in a family
II. Proband. The individual in the pedigree that led to the construction of the pedigree.
For example, a couple consults a medical geneticist because they have an offspring who
is afflicted with a disease and they want to find out the mode of transmission of this
disease. When the medical geneticist constructs the pedigree, the offspring will be
labeled as the proband. Through the pedigree, the probability of having other affected
children may be determined.
III. Law of Segregation (1st Mendelian Law). For every trait governed by a pair of
alleles, these alleles segregate or separate during gamete formation in meiosis
IV. Law of Independent Assortment (2nd Mendelian Law). A pair of alleles for one trait
will segregate or separate independently of another pair of alleles for another trait
during meiosis
V. Autosomal trait. A trait whose alleles that control it are found in the autosomes
(body chromosomes/ non-sex chromosomes)
Teacher Tip:
VI. Genotype. The gene pair an individual carries for a particular trait symbolized with a Tell the learners that they have to use a letter in
pair of letters. By convention, uppercase letter (eg. A) for a dominant allele and which the uppercase and lowercase versions
lowercase letter (eg. a) for the recessive allele. Any letter in the alphabet may be used are easy to distinguish using cursive to avoid
confusion.
A. For a diploid organism with two alleles in a given gene pair, genotypes may
be written as:
i. Homozygous dominant, i.e. with two dominant alleles (DD)
Ask learners to recall their lessons in
ii. Heterozygous, i.e. with a dominant and recessive allele (Dd). The individual will classical genetics in their previous grade
show the dominant phenotype. levels.

iii. Homozygous recessive, i.e. with two recessive alleles (dd)

2
 VII.Phenotype Teacher Tip:
A. The observable trait of an individual based on its genotype. Examples: red flower, Note that the phenotype is determined by the
genotype. In complete dominance, RR- red
curly hair, blood types ( i.e. the blood type is the phenotype)
flower; rr- white flower; but Rr will express the red
B. For a typical Mendelian trait, phenotypes may either be: flower condition because one dominant allele is
enough for the dominant trait to be expressed in
i. Dominant. A trait that requires at least one dominant allele for the trait to be the organism.
expressed, e.g. Dd
ii. Recessive. A trait that requires two recessive alleles for the trait to be expressed
VIII. Phenocopy. A trait that is expressed due to specific environmental conditions (i.e.
having hair that is dyed of a different color) and is not due to the genotype.
IX. Identical twins. Also known as monozygotic twins, which are derived from a single
fertilization event. After the first cleavage or cell division of the zygote, the cells or
blastomeres separate and become independent blastocysts implanted in the
mother’s uterus.
X. Fraternal twins. Twins that are derived from separate fertilization events (two eggs
fertilized by two sperms) within the fallopian tube, resulting in two separate zygotes; also
known as dizygotic twins

REVIEW (15 MINS) Teacher Tip:

1. Ask the learners to recall Mendelian Laws of Inheritance The learners should be able to predict correctly
the Mendelian ratios without having to use a
I. Law of Segregation (1st Mendelian Law) Punnett square. They should be able to solve for
probabilities of occurrence of a trait by analyzing
II. Law of Independent Assortment (2nd Mendelian Law)
a pedigree.
2. Ask the learners to define genotypes and phenotypes, dominant and recessive
traits, homozygous and heterozygous dominants as well as homozygous recessive
3. Ask the learners to review the classic monohybrid Mendelian F2 genotypic and phenotypic
ratios by filling out a table (see table 1 at the end of this document)
4. In a monohybrid cross and assuming complete dominance, the ratio of the F2 progenies may
be predicted as 3:1, i.e. 3 with the dominant trait and 1 with the recessive trait.
5. In a dihybrid cross and assuming complete dominance, the ratio of the F2 progenies may
be predicted as 9:3:3:1.
INSTRUCTION (15 MINS)
1. Define pedigree analysis.
2. Enumerate uses of pedigree analysis:
I. Describe the mode of inheritance of a trait
II. Calculate the probability of occurrence an affected
offspring in a given cross
3. Establish symbols for creating pedigrees
I. Male (square) vs female (circle)
II. Affected (shaded) vs unaffected (unshaded) individual
III. Marriage/mating line (line connecting mates) vs. sibship line
(line connecting siblings)
IV. Fraternal twins (one birthline branching out into the
individual twin) vs. identical twins (same as fraternal twins but
with a horizontal bar connecting the branches)
V. Generation (Roman numerals) vs. individuals in the
same generation, counting left to right (designated by
Hindu- Arabic numerals)
VI. Proband (arrow)
4. What to expect in a human pedigree
I. For autosomal dominant trait: Two affected individuals can
have a normal offspring
II. For autosomal recessive trait: Two affected individuals can
NEVER have a normal offspring
5. Give an example of a pedigree and solve some questions
PRACTICE (25 MINUTES)
1. Divide learners into groups of four.
2. Provide copies of four sample pedigrees. (See samples in
Figure 2 at the end of this document.)
3. For each pedigree, provide questions for the group to answer
I. Identify the mode of inheritance
II. Write down the genotypes of specific individuals
III. Compute for the probability of having an affected offspring

Sample pedigree with symbol guides

4
A. Look at the family of IV-9 and IV-10. If the trait is dominant, is
it possible for them to have an affected offspring?
(Answer: NO. If the trait is dominant, then unaffected
individuals are homozygous recessive. Two recessive
individuals CANNOT produce a dominant offspring.) A. Is this trait dominant or recessive?
B. If the trait is recessive, is it also possible for IV-9 and IV-10 to (Answer: RECESSIVE. If the trait were dominant, then
have an unaffected offspring?
individuals I-3 and I-4 are both homozygous recessive,
(Answer: YES. This can happen if both parents are
which means they CANNOT have a dominant offspring.)
heterozygous for the trait, which means they can each
give a recessive allele to produce a homozygous B. What are the most probable genotypes of I-3 and I-4?
recessive offspring.) (Answer: Dd and Dd in order for each parent to be able
C. Based on your answers for a) and b), is the trait dominant to contribute a recessive allele to give rise to a recessive
or recessive? offspring.)
(Answer: RECESSIVE) C. What are the most probable genotypes of II-4 and II-5?
D. Give the genotypes of the following: (Answer: Dd and Dd. Same reason as b.)
i. IV-9 (Answer: Dd) D. What is the probability that II-4 and II-5 will have another
ii. IV-10 (Answer: Dd)
normal offspring?
iii. V-1 (Answer: DD or Dd)
(Answer: 75%. A hybrid cross will produce 75% dominant
iv. I-1 (Answer: dd)
v. I-2 (Answer: Dd) offspring and 25% recessive offspring.)
E. If IV-9 and IV-10 were to have another child, what is the
probability that they will have an affected offspring?
(Answer: 1/4 or 25% following the Mendelian ratio from
a hybrid cross)
A. Is the trait dominant or recessive?
(Answer: DOMINANT. If the trait were recessive, then
individuals I-1 and I-2 are homozygous recessive, and
they CANNOT produce a dominant affected offspring.)
B. What are the most probable genotypes of I-2 and I-3?
(Answer: Dd and Dd. Each parent must be heterozygous
in order to give a recessive allele to produce a recessive
unaffected offspring.)
C. What is the probability that II-2 is Dd?
(Answer: 1 or 100%. II-2, together with the
homozygous recessive II-1, was able to produce
homozygous recessive unaffected offspring. This can
only happen if
II-2 also possesses a recessive allele, which means s/he
is a heterozygote.)
D. What is the probability that II-1 and II-2 will have another
normal offspring?
(Answer: 1/2 or 50%. Following the Mendelian cross
of dd x Dd, there is a 50% probability of producing a
homozygous recessive unaffected offspring.)
A. Is the trait dominant or recessive?
(Answer: DOMINANT. If the trait were recessive, then
individuals I-3 and I-4 must be homozygous recessive, and
they CANNOT produce a dominant offspring.)
B. What are the genotypes of I-1 and I-2?
(Answer: dd and dd. Since the trait is dominant, it follows that
unaffected individuals are homozygous recessive.)
C. What is the probability that I-1 and I-2 will have an affected
offspring?
(Answer: 0. Homozygous recessive individuals CANNOT
produce an offspring with a dominant trait.)
D. What are the genotypes of I-3 and I-4?
(Answer: Dd and Dd. Each parent must have a recessive
allele in order to produce a homozygous recessive offspring.)
E. What is the probability that II-6 is Dd?
(Answer: 2/3. II-6’s parents are both heterozygotes.
Following the Mendelian cross of Dd x Dd, the probabilities
of occurrence of phenotypes in this cross are 25% (1/4) DD,
50% (2/4) Dd, and 25% (1/4) dd, giving a ratio of 1:2:1. Since
II-6 is already affected, then his phenotype is dominant.
Therefore, the probability of II-6 being affected is 0. So
 instead of a ratio of 1:2:1, the ratio to be
considered should now be just 1:2 (DD:Dd). The
probability of II-6 being Dd should now be 2/3.)
6
ENRICHMENT
1. As a homework, assign each learner to construct a pedigree of an authentic family using any of the following traits:
I. With (dominant) or without finger hair (recessive)
II. Normal (dominant) or hitchhiker’s thumb (recessive)
III. Widow’s peak (dominant) or straight hairline (recessive)
IV. Free (dominant) or attached earlobe (recessive)
V. Curly (dominant), wavy (heterozygous) or straight (recessive) hair
2. B. Where possible, determine the genotypes of every individual in the family

CROSS EXPECTED GENOTYPE(S) EXPECTED PHENOTYPE(S)

1. DD x DD 100% DD 100% dominant
2. DD x Dd 50% DD: 50% Dd 100% dominant
3. DD x dd 100% Dd 100% dominant
4. Dd x Dd 25% DD: 50% Dd: 25% dd 75% dominant: 25% recessive
5. Dd x dd 50% Dd: 50% dd 50% dominant: 50% recessive
General Biology 2 60 MINS

Lesson 2: Sex Linkage

and Recombination
Content Standard
The learners understand inheritance of Sex Linked characters
LESSON OUTLINE

Performance Standard Introduction Communicating Learning Objectives and 5

The learners shall be able to Relevant Vocabulary
• make a a research paper/case study/poster on transmission of a sex- Motivation Case Study 10
linked genetic disease
Instruction Discussion of Sex-Linked Traits 25
Learning Competency
The learners shall be able to explain sex related inheritance and Practice Group Work 20
recombination; illustrate the transmission of sex-linked characters; and Enrichment Narrative
distinguish sex-linked traits from other sex-related traits (STEM_BIO11/12-IIIa-
b-2) Materials
Specific Learning Outcomes Pen, paper, and ruler
At the end of the lesson, the learners will be able to:
Resources
• illustrate the transmission of an X-linked and a Y-linked character; (1) Klug, W. S., M. R. Cummings, C. A. Spencer and M.A.
• compute the probability of the occurrence of a sex-linked trait; Palladino. 2012. Essentials of Genetics. 8th ed.
and Benjamin Cummings.
• give examples of other sex-related traits. (2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A.,
Minorsky, P.V., and Jackson, R.B. 2012. Campbell
Biology, (9th ed). The Benjamin Cummings Publishing
Co., Inc.
(3) Sheridan, M. 1999. Instructor’s guide for Biology, 5th ed.
By Campbell, Reece, Mitchell. Addison Wesley Longman,
Inc.

8
INTRODUCTION (5 MINS) Teacher tip:
Ask the learners to review the topic on
Communicating Learning Objectives recombination in Meiosis that they took up in BIO 1.
1. Cite the learning objectives, which are as follows: Recombination or shuffling of genes/ alleles in
I. illustrate the transmission of an X-linked and a Y-linked character Meiosis results to variation in the genome of
gametes, the sperm cells and egg cells.
II. compute the probability of the occurrence of a sex-linked trait
III. give examples of other sex-related traits In any cell of the body (somatic), there are
chromosome pairs. In humans, pair numbers 1-22 are
Relevant Vocabulary the autosomes or body chromosomes while the last
2. State the relevant vocabulary: (23rd) pair is the sex chromosome.

I. Sex linked trait. The gene (pair) that determines a character (e.g. hemophilia) is located Normal human females have two X chromosomes
on the sex chromosomes and normal human males have one X chromosome
and a Y chromosome; that is:
II. X-linked trait. A sex-linked trait is where the gene or allele for the trait is found on the X
XX- female
chromosome XY- male
III. Color blindness. An X-linked recessive trait where a affected individual could
not distinguish red from green color (red green color blindness)
IV. Hemophilia. An X-linked recessive trait where an affected individual suffers from delayed
blood clotting during injuries because of the absence of certain blood clotting factors
V. Y-linked trait. A sex-linked trait where the gene or allele for the trait is found on the Y
chromosome
VI. Hypertrichosis pinnae auris. A Y-linked trait where affected males have hair growing from
their external ears
VII. Other sex-related traits.
A. Sex-influenced trait- Any trait in a diploid organism whose expression is affected
by an individual’s biological sex; a trait that occurs at a higher frequency in one
sex over the other
B. Sex-limited trait- Any trait in a diploid organism whose expression is limited to
just one biological sex
C.
MOTIVATION (10 MINS)
Case Study
Present these three cases using pictures:

A picture of a color blindness test chart
Ask the learners if they could see a figure
in the picture and ask the class to recite
aloud the figure/ number.
A picture of a family with male members
who are bald
Ask the learners if baldness occurs more
in men or women.
A picture or description of a woman
breastfeeding a baby
Ask the learners who among the men and
women are able to lactate or breastfeed their
young.

Use a high resolution figure (photograph or image projected on a

Be careful in conducting this test to discourage teasing of
computer or LCD) to ensure the accuracy of the color blindness
actual colorblind learners. Emphasize that colorblind
test. Those that could see the figure are normal; those that cannot
individuals are normal except that they could not distinguish
are colorblind. In most cases, the colorblind males outnumber the
between red and green colors.
colorblind females, which are rare. If there are no colorblind
individuals in the class, the teacher will just have to mention as a
matter of fact that colorblind females are rare. Misconception: Common misconception is that baldness occurs
only in males. Emphasize that baldness does happen in women,
although the frequency is much lower and is therefore rare.

10
INSTRUCTION (25 MINS)
Sex-linked traits
• Give the definition of an X-linked trait
• Explain why X-linked traits may occur more frequently in
one sex over the other
• In humans, males and females are represented by
different sex chromosomes
• Females have two X chromosomes in the nucleus of
their cells.
• Males have one X chromosome and one Y chromosome in
the nucleus of their cells.
• Depending on whether the trait is dominant or recessive,
the expression pattern of the trait differs in males and
females
• Colorblindness in humans as an example of sex-linked trait
• The alleles responsible for colorblindness is found on the
X chromosome only
• The dominant allele is the normal allele; the recessive allele
causes colorblindness
• Females need two copies of the recessive allele, one
from each of the two X chromosomes, for the trait to be
manifested. If they only have one copy of the recessive
allele, they have normal color vision. However, they are
carriers for the trait in that they may pass it on to their
offspring.
• Males only need one recessive allele in their sole
X chromosome for the trait to be expressed.
• Explain what happens to the expression patterns if the
trait is X-linked and dominant.
• Use Table 2 as guide.
• Give the definition of a Y-linked trait
• Explain why there is difference in expression between
males and females for Y-linked traits. (Since the allele is
found only in the Y chromosome, and since only males have
Y- chromosomes, then only males will express the trait.
Females CANNOT express Y-linked traits.)
• Hypertrichosis pinnae auris as an example of a Y-linked trait
• If a male has the allele responsible for the trait, then his Y
chromosome will possess that allele. Since he will pass on
his Y chromosome to his sons, then all his sons will inherit
the trait, and they, in turn, can pass on the allele to their
sons.
3. Describe other sex-related traits
Sex-influenced trait
• Give the definition
• Explain why traits may be expressed differently
between sexes
• Hormonal or physiological differences between the
sexes cause differences of expression of certain genes
• Baldness in humans as an example of a sex-
influenced trait. See Table 1 how baldness is
hypothesized to be expressed by a single pair of
alleles, with B as the dominant allele for baldness
and b as the recessive normal allele.
Sex-limited traits
• Give the definition
• Explain why traits may be limited to one sex only
• Hormonal or physiological differences between sexes
may limit the expression of some genes to one biological
sex only
• Functional mammary glands as an example of a sex-
limited trait. Only females can express functional
mammary glands that produce milk immediately
after giving birth.
• Note that baldness behaves like a dominant trait in
males in that only one dominant allele is needed for
baldness to be expressed. On the other hand, the trait
behaves like a recessive trait in women in that they
need both dominant alleles to be present for baldness
to be expressed.
PRACTICE (20 MINS)
1. Divide learners into groups of four.
2. Ask each group to answer a set of questions related to sex-related traits in humans.
See sample questions.

ENRICHMENT
As a homework, provide this narrative to the class:

The last Emperor of Russia, Nicolas II, was married to Empress Alexandra, and they had five
Teacher tip:
children, Olga, Tatiana, Maria, Anastasia, and Alexis. Alexis was the only one who was afflicted Hemophilia is an X-linked recessive trait. Empress
with hemophilia or the royal bleeding disease; all other members were normal. Alexandra was most likely a carrier of the trait
• Research on this medical condition and determine the mode of inheritance. (XCX). She was a descendant of Queen Victoria of the
United Kingdom, who herself was a probable carrier.
• If only Prince Alexis was afflicted with the disease, determine his genotype. The Emperor was completely unaffected and
• What could be the genotypes of the Emperor and Empress? therefore had an XY genotype. Based on the
genotypes of the parents, Alexis had an XCY
• Is it possible that each daughter could have been a carrier? genotype, with the defective X chromosome carrying
the allele for hemophilia coming from his mother.
Each daughter, in turn, had a 50% probability of
being a carrier, but they could NEVER have been
affected.

12
General Biology 2 60 MINS

Lesson 3: Modification to Mendel’s Classic

Ratios
LESSON OUTLINE
Content Standard Introduction Communicating Learning Objectives and 5
The learners understand Non-Mendelian Modes of Inheritance Relevant Vocabulary
Performance Standard Motivation Narrative 5
The learners shall be able to
Instruction Recall in Mendelian Ratios, Discussion 40
• make a research paper/case study/poster on a non-Mendelian genetic
trait on Co-Dominance and Multiple Alleles

Learning Competency Practice Group Work: Non-Mendelian Traits in 40

The learners shall be able to describe some modifications to Mendel’s
classic ratios (gene interactions) (STEM_BIO11/12-IIIa-b-3)
Specific Learning Outcomes
At the end of the lesson, the learners will be able to:
• distinguish Mendelian from non-Mendelian modes of inheritance; and
• describe some cases of non-Mendelian genetic traits
Humans, Plants, and Animals
Materials
Pen and Paper
Resources
(1) Klug, W.S., Cummings, M.R., Spencer, C.A. and Palladino, M.A. 2012.
Essentials of Genetics. 8th ed. Benjamin Cummings.
(2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
Jackson, R.B. 2012. Campbell Biology, (9th ed). The Benjamin
Cummings Publishing Co., Inc.
(3) Sheridan, M. 1999. Instructor’s guide for Biology, 5th ed. By
Campbell, Reece, Mitchell. Addison Wesley Longman, Inc.
INTRODUCTION (5 MINS) MOTIVATION (5 MINS)
Communicating Learning Objectives Narrative
1. Cite the major learning objectives, which are as follows: 1. Provide this narrative to the class:
I. distinguish Mendelian from non-Mendelian modes of 2. A local hospital has sent word to a family of a possible mix up
inheritance of some of the children with other families when they were
II. describe some cases of non-Mendelian genetic traits born. To rule out any possible mix up, the hospital obtained
the blood types of every individual in the family, including the
surviving maternal grandfather and paternal grandmother. The
Relevant Vocabulary
results were as follows:
2. Present the following relevant vocabulary:

Father: Type O
I. Co-dominance - When two contrasting alleles are present
Mother: Type A
in the same locus or trait (heterozygote genotype), then
1st child: Type O
the phenotype expressed is a “blend” of the two extreme
2nd child: Type A
phenotypes. The two genes interact and the offspring
3rd child: Type B
shows the effects of both alleles.
Maternal grandfather: Type
AB Paternal grandmother:
II. Incomplete dominance - When two contrasting alleles Type B
are present in the same locus or trait (heterozygote
genotype), then both alleles are expressed in the same 3. Based on the results, is there a possibility that any one of the
phenotype children is not a biological offspring of the couple? To answer
this question, we must first understand how blood types, a
non- Mendelian trait is inherited.
III. Multiple alleles - When there are more than two types of
alleles for a given locus or trait, this will result in more than
two kinds of phenotypes that may be expressed for that
trait.

14
INSTRUCTION (40 MINS) Teacher Tip:
Review the Mendelian ratios and ensure that
Recall in Mendelian Ratios, Discussion on Co-Dominance and Multiple Alleles the learners are familiar with them before they
1. Let the learners recall the Mendelian Ratios in STEM_BIO11/12-IIIa-b-1 could proceed with the lesson.
2. Discuss incomplete dominance. Define the trait. The heterozygote genotype is expressed as
a distinct phenotype (a “blend” of the two extreme phenotypes). In this case, the
phenotypic ratio is the same as the genotypic ratio
I. Use snapdragon plants (Antirrhinum majus) as example (see figure 1).
A. RR – red flowers
B. Rr – pink flowers
C. rr – white flowers
Emphasize that incomplete dominance and co-
3. Discuss co-dominance. Define the trait. The heterozygote genotype is expressed as a
dominance are similar in that their phenotypic
distinct phenotype (both extreme phenotypes are expressed at the same time). Similar to ratios follow their genotypic ratios. However, they
incomplete dominance, the phenotypic ratio is the same as the genotypic ratio. differ in the expression of the heterozygote
condition: in co-dominance, the heterozygote
I. Use human MN blood typing as an example
expresses both extreme phenotypes; in
A. MM – type M incomplete dominance, the heterozygote is
expressed as a “blend” of the two extreme
B. MN – type MN
phenotypes.
C. NN – type N
4. Discuss multiple alleles. Define the trait. There are more than two types of alleles, and the
relationship of each allele with respect to others will determine the number of
phenotypes that may be expressed.
I. Use coat color in rabbits as example (see figure 2)
A. There are four different types of alleles in rabbits: C (Agouti), C ch (Chinchilla), Ch
(Himalayan), and c (Albino), with the following dominance hierarchy: C> Cch>Ch>
c.
B. The following genotypes will have the corresponding phenotypes in coat color:
i. CC – Agouti
ii. CCch – Agouti
iii. CCh – Agouti
iv. Cc – Agouti
v. CchCch – Chinchilla
 vi. CchCh – Chinchilla
Teacher Tip:
vii. Cchc – Chinchilla Note that in the ABO system, the O allele is
h h recessive to both A and B alleles while the A and B
viii. C C – Himalayan
alleles are co-dominants of one another.
ix. Chc – Himalayan
x. Cc – Albino

C. Use ABO blood typing in humans as example

i. There are three different types of alleles A (or IA), B (or IB) and O (or i)
ii. The following genotypes will have the following blood types (phenotypes):
iii. AA (or IAIA) – Type A
iv. AO (or IAi) – Type A
v. BB (or IBIB) – Type B
vi. BO (or IBi) – Type B
vii. AB (IAIB) – Type AB
viii. OO (ii) – Type O

5. Go back to the Motivation narrative

Blood types O and AB can only have OO and
I. The class will now answer the question/narrative provided during the Motivation part.
AB genotypes, respectively.
The teacher will ask first the most probable genotypes of all the members of the family The mother must be AO in order to have an
as follows: offspring that is either A or O.
The paternal grandmother must be BO in order to
i. Father: Type O - OO
have an offspring (father) who is blood type O.
ii. Mother: Type A - AO The 3rd child could have been the result of a mix
up because the B allele is not present in either
iii. 1st child: Type O - OO
parent.
iv. 2nd child: Type A - AO
v. 3rd child: Type B – B? Misconception
Emphasize that blood typing could only be used to
vi. Maternal grandfather: Type AB - AB
exclude/disprove biological parentage, not to
vii. Paternal grandmother: Type B – BO prove it.
viii. Possible mix-up? Yes, 3rd child.

16
PRACTICE (40 MINS)
1. Divide learners into groups of four.
2. Ask each group to answer a set of questions related to
non- Mendelian modes of inheritance. See sample
questions.
C. Two wavy plants will produce what possible kinds of
offspring? Give their ratios? (ANSWER: 25% serrated:
50% wavy: 25% smooth; this is a hybrid cross, which
will give a 1:2:1 ratio)

1. In cattle, coat color is inherited in a co-dominant fashion. 3. In guinea pigs, coat color is governed by four alleles that
Homozygous B1B1 produces black coat, homozygous B2B2 constitute a multiple allelic series, C (black), cS (sepia), cC
produces white coat, and the heterozygous B1B2 produces (cream), and c (albino) with the following dominance
roan coat. Give the phenotypic ratio of the offspring of hierarchy: C>cS>cC>c. Determine the phenotypic ratios of
the following crosses: the progeny from the following crosses:
A. B1B1 x B1B1 (ANSWER: all black) A. Cc x CcS (ANSWER: 75% black: 25% sepia; the
genotypes and their probabilities of occurrence are:
B. B1B1 x B2B2 (ANSWER: all roan)
25% CC, 25% CcS, 25% Cc, and 25% cSc, giving a
C. B1B2 x B1B2 (ANSWER: 25% Black: 50% Roan: 25% phenotypic ratio of 75% black and 25% sepia)
White)
B. CcS x cCc (ANSWER: 50% black: 50% sepia; the
D. B1B1 x B1B2 (ANSWER: 50% Black: 50% Roan) genotypes and their probabilities of occurrence are 25%
1 2
E. B B x B B2 2
(ANSWER: 50% Roan: 50% White) CcC, 25% Cc, 25% cScC, 25% cSc, giving a phenotypic
ratio of 50% black and 50% sepia)

2. In a hypothetical plant, a serrated leaf margined plant, when

crossed with a smooth leaf margined plant, produces
offsprings with wavy leaf margin.
A. Identify the mode of inheritance. (ANSWER:
Incomplete dominance)
B. Two serrated plants, when crossed, will give what type of
offspring? (ANSWER: Serrated plants; the trait is
homozygous, therefore producing offspring with the
same phenotype as the parents)
4. A man who is blood type B is married to a woman who is
blood type A. None of the man’s parents is blood type O.
This couple has 4 children with the following blood types:
B, AB, AB and O. Give the genotypes of the parents.
(ANSWER: Man: BO; Woman: AO; Both parents must have
an O allele in order to produce and offspring with blood
type O with genotype OO)
Incomplete dominance in snapdragons, Antirrhinum majus. The
cross involving homozygote red flowers (RR) and homozygote white
flowers (rr) will yield a heterozygote (Rr) that expresses a different
phenotype, which is pink flowers. The cross between pink-flowered
individuals will produce offsprings where the genotypic ratio also
Coat color in rabbits. The trait is controlled b multiple alleles with
becomes the phenotypic ratio (25% red: 50% pink: 25% white).
the following dominance hierarchy: C (Agouti) > C ch (Chinchilla) >
(Wikipedia)
Ch (Himalayan) > c (Albino).
18
General Biology 2 60 MINS

Lesson 4: Molecular Structure of DNA,

RNA, and Proteins
Content Standard
The learners understand Structures and Functions of DNA, RNA and proteins
LESSON OUTLINE

Performance Standard Introduction Communicating Learning Objectives 5

The learners shall be able to
Motivation Group Work 5
• build models of DNA, RNA and proteins
Instruction Discussion on the Molecular Structures 30
Learning Competency
of DNA, RNA, and Proteins
The learners shall explain how the structures of DNA, RNA and proteins
are related to their functions (STEM_BIO11/12- IIIa-b-4) Practice Building Models of DNA 5

Enrichment Conversion to mRNA Transcripts 5

Specific Learning Outcomes
At the end of the lesson, the learners will be able to: Evaluation Identification of Biomolecule 10
Represented by Given Chain Structures
• describe the building blocks of DNA, RNA and proteins;
Materials
• identify the structural and functional differences between DNA and
Recyclable materials for model construction; freely
RNA and
downloadable molecular modeling software.
• explain the different levels of protein structure
Resources
Biochemistry textbooks; SwissPDB Viewer software (free
download); Protein Data Bank (www.pdb.org)
INTRODUCTION (5 MINS) Teacher Tip:
One dimensional and two dimensional models of
Communicating Learning Objectives
DNA should be presented to the class.
1. The learning outcomes will be presented as follows:
I. describe building blocks of DNA, RNA and Proteins.
II. identify the structural and functional differences between DNA and RNA.
III. discuss the different levels of protein structure (primary, secondary, tertiary and quaternary)
IV. 4.explain how protein structural features may influence their functions

2. Ask learners if they have heard of the term “genes”. Ask them what “genes” have
they inherited from their parents.
Sample answers: genes for dimples, straight hair, etc.

MOTIVATION (5 MINS) Teacher Tip:

Expected Answers:
1. Divide the class into groups of learners. Allow each group to enumerate the most
DNA: repository of genetic information
important functions of DNA and proteins that they can recall from their previous grade RNA: transcripts; link between the gene and the
levels. gene product (protein)
Protein: functional products; executors of cellular
2. Consolidate these answers on the board.
functions

INSTRUCTION (30 MINS)

1. The building blocks of any nucleic acid are the nucleotides.
2. A nucleotide is composed of a phosphate group (with negative charges), a sugar portion and
an N-base.
3. The sugar in DNA is deoxyribose while the sugar in RNA is ribose. Explain the difference
through a visual aid.
4. DNA and RNA are polynucleotides. N-bases are either purines or pyrimidines. Purine bases
are Adenine (A) and Guanine (G). Pyrimidines are Cytosine (C), Thymine (T, in DNA only) and
Uracil (U, found only in RNA)
5. Specific base pairings occur in DNA. A pairs with T; G pairs with C
6. DNA is double stranded while RNA is single stranded with Uracil instead of Thymine.

20
7. Main Functions: Teacher Tip:
I. DNA: repository of genetic information; sequence of bases encodes the blueprint for If computers and internet facilities are available,
life processes structures for these biomolecules are available
as molecular structure files (*.pdb) from the
II. RNA: information in the form of base sequence is transformed (transcribed) into mRNA, Protein Data Bank (www.pdb.org).Focus on the
tRNA and rRNA. DNA is the template copied into RNA by base pairing. G with C; A with important parts of the structure that provide the
U. necessary physical properties of DNA, RNA and
III. Protein: functional products of genes; executes cellular functions proteins.

8. The four structural levels of proteins are: 1.Primary- sequence of amino acids in the Discuss the importance of these physical
polypeptide chain; 2. Secondary- when the polypeptide chains form a helix or a pleated features for the functions of DNA, RNA and
sheet structure; 3. Tertiary- coiling of the polypeptide, combining helices and sheet forms; proteins.
4. Quaternary- the association of two or more polypeptides in space

Summary of Important Physical Properties

BIOMOLECULE Physical Property Functional Relevance

DNA Complementary Base Pairs
Phosphodiester bonds
Allows each strand to serve as a
template for replication and
transcription
Essential for polynucleotide chain
elongation
Emphasize that the DNA has negative charges on
the outside due to the phosphate groups. Other
stabilizing factors in the DNA should be
mentioned.

RNA Single stranded but some bases For stability

can be complementary; hence,
some portions may be double
stranded

Uracil Nitrogenous base found only in RNA.

PROTEIN Amino (N)Terminus Start of the polypeptide chain

Note:
Amino (N)Terminus End of the polypeptide chain For each classification of amino acid,give the
names of each amino acid. Give the one letter
Peptide Bond Links amino acids together symbol for each amino acid. The three letter
code for each amino acid may also be provided.
One letter symbol for each Classes:
amino acid a. non-polar- aliphatic or aromatic
b. polar, uncharged
c. polar, charged- acidic and basic
PRACTICE (5 MINS)
Given the following coding sequence for DNA, provide the sequence of the complementary
(template) sequence. Teacher Tip:
Be sure to note the antiparallel orientation of
Coding sequence : 5’ ATGCATAGATTAGGATATCCCAGATAG 3’ the coding and non-coding strands of DNA.
(Answer) Explain the relative positions of the 5’ and 3’
ends.
Complementary sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’

Ask the learners to build models of DNA by using recyclable materials such as popsicle sticks
or pieces of colored papers to represent the complementary bases: G with C; A with T. The
DNA backbone (phosphate, sugar) should be included.

ENRICHMENT (5 MINS)
1. Convert the given coding sequence into an mRNA transcript:
Complementary Non-coding/ Template sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’ Teacher Tip:
The mRNA transcript has almost the same
(Answer) sequence as the coding sequence (DNA), but the
Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’ thymines are replaced to Uracil.

Show the learners how to read the codon Table

2. Translate the given mRNA transcript into a polypeptide sequence:
Teach the learners the single letter codes for
the amino acids (e.g. ryptophan 🢧 Trp 🢧 W).
Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
Ask the learners to spell their names using the
(Answer) amino acid codes (e.g. N-E-I-L 🢧 Asn – Glu – Ile
Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C – Lue).

22
EVALUATION (10 MINS) Teacher Tip:
Ask learners to identify the type of biomolecule represented by a given chain structure: To help learners practice the generation of
complementary sequences, worksheets with
1. DNA- partially completed sequences may be used.
2. RNA-
3. Protein-

Example
Template sequence
3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’

5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’

Learners may be asked to identify the important structural features in these chain structures
(features are listed in the instruction/ delivery table). A similar exercise of generating non-coding
sequences (DNA), transcripts (RNA) and translated polypeptides may be done to test the
learners understanding of the topic.
General Biology 2 60 MINS

Lesson 5: DNA Replication and Protein

Synthesis
LESSON OUTLINE
Content Standard
Introduction Communicating Learning Objectives and 5
The learners understand Central Dogma of Molecular Biology.
Review
Performance Standard
Motivation Inquiry 5
The learners shall be able to
• identify requirements, enzymes and products in DNA Replication, Instruction Discussion on DNA Replication or DNA 20
transcription, and protein synthesis. Synthesis
Learning Competency Practice Matching Type Game 10
The learners should be able to diagram the steps in DNA
replication, transcription, and protein synthesis (STEM_BIO11/12- Evaluation Take-home Activity 5
IIIa-b-5)
Materials
Specific Learning Outcomes Paper, coloured pens
At the end of the lesson, the learners will be able to:
Resources
• describe the requirements, proteins and enzymes in DNA (1) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
replication; Jackson, R.B. 2012. Campbell Biology, (9th ed). The Benjamin
Cummings Publishing Co., Inc.
• transcription and translation; and
• diagram the steps in replication, transcription and translation.

24
INTRODUCTION (5 MINS) Teacher Tip:
1. The learning objectives will be communicated as follows: To help learners practice the generation of
complementary sequences, worksheets with
A. Describe the requirements, proteins and enzymes in DNA replication, transcription partially completed sequences may be used.
and translation
B. Diagram the steps in replication, transcription and translation.
C. Explain what happens to a gene sequence that undergoes transcription and
eventual translation into protein

2. Ask the learners to recall the significance of Mitosis.

Mitosis is an equational cell division that produces daughter cells which are identical or
clones of the original, mother cell. This ensures that every cell of the body has the same
genetic content, i.e. chromosome number. To make this possible, cells have to duplicate their
genetic material which is primarily DNA.

MOTIVATION (5 MINS)
1. Ask learners to imagine how many cells a typical mature human contains. Tell them that they
all came from just one fertilized egg cell. A zygote goes through millions of generations of
cell divisions to become just the one person that a learner is. Even until now, cells in an
individual are still dividing. Ask learners what examples of tissues in their body are
undergoing cell division. (sample answers: skin; blood cells)
2. Also, ask learners to recall that in the previous topics on genetics, the phenotype is the
outside, visible characteristic of an organism. Any phenotype (eg. red flower) is directly
determined by proteins or enzymes functioning in a metabolic pathway. Proteins are made
by “turning on” specific portions of DNA that are called genes. Particular sequences of DNA
are transcribed to become RNAs. These are then used to produce proteins in a process
called translation.
INSTRUCTION (65 MINS) Teacher Tip:
1. DNA replication or DNA synthesis. DNA strands separate and serve as templates for the To help learners practice the generation of
production of new DNA molecules. complementary sequences, worksheets with
partially completed sequences may be used.
A. The following are features of replication:
i. Semiconservative- the resulting DNA consists of one old and one new strand
ii. Base pairing is maintained; Adenine pairs with Thymine, Guanine pairs with Cytosine
iii. New DNA molecules are produced in the 5’ to 3’ direction
iv. Semidiscontinuous. The leading strand is synthesized in a continuous manner (5’ to
3’) while the lagging strand is produced discontinuously in short stretches called
Okazaki fragments.
B. In lagging strand synthesis, there is a need for a primer terminus which is provided by
an RNA molecule. RNA is synthesized by a primase or RNA polymerase. The 3’OH of the
RNA is where new DNA nucleotides are added thus new DNA is built in the 5’ to 3’
direction.
C. Enzymes in replication are as follows: 1. helicase; 2. gyrase; 3. SSB (single strand
binding proteins); 4. primase or RNA polymerase; 4. DNA polymerase and 5. DNA ligase.

26
2. Transcription or RNA synthesis. DNA is unwound and one strand is used as template for Teacher Tip:
the production of an RNA molecule. An RNA polymerase makes RNA in the 5’ to 3’ direction. To help learners practice the generation of
complementary sequences, worksheets with
Specific regions in the DNA called promoters allow the binding of transcription factors which
partially completed sequences may be used.
make possible the binding of RNA polymerase. Three major types of RNA are: messenger
RNA (mRNA); transfer RNA (tRNA) and ribosomal RNA (rRNA).

3. Translation or protein synthesis. This occurs in the ribosome. Basic ingredients are the
various types of RNAs produced in transcription and some proteins or enzymes. The mRNA
contains triplets of bases called codons that specify an amino acid, eg. UUU-phe. Various
tRNAs carry amino acids from the cytoplasm to the actual site of translation in the ribosome.
A tRNA has an anticodon that pair with a codon in the mRNA. Different rRNAs combine with
ribosomal proteins to make up the subunits of a ribosome. A functional ribosome has a small
and a large subunit.

In bacteria, transcription and translation may be simultaneous. In eukaryotic cells, mRNA,

tRNA and rRNA travel from the nucleus to the cytoplasm through the nuclear pores.
RNAs may undergo processing. Some unnecessary parts like introns are removed. In
eukaryotic mRNA, a 5’ cap and a 3’ poly A tail are added. Coding regions of mRNA are
called exons. They specify functional protein products.
 In the elongation
process of translation,
amino acids are linked
by peptide bond
formation due to the
action of peptidyl
transferase known to
be a part of the
ribosome subunit. The
process is summarized
in the diagram above.

To initiate translation, the small and the big subunits of the ribosome have
to be separated. Initiation factors (IF) make this possible. They also prevent
the premature reassociation of these subunits. The small subunit of the
ribosome binds the mRNA and allows the entrance of a tRNA to the P site
bearing the first amino acid. The big subunit then binds and together they
form an assembly ready for the next amino acid in the A site of the
ribosome.

A stop codon signals the

end of translation. No
amino acid corresponds
to a stop codon. Release
factors halt the process
and the polypeptide is
released.

The genetic code is the correspondence of the mRNA codons to

amino acids. An amino acid is specified by a codon with three
code letters. The genetic code is shown as above.

28
The genetic code is the correspondence of the mRNA codons to amino acids. An amino acid is Teacher Tip:
specified by a codon with three code letters. The genetic code is shown as follows: Use flash cards. Organize learners into groups and
ask them to compete.

Point out the effect of the loss of

the following:
PRACTICE (5 MINS)
1. Matching Type Game: For each protein or enzyme or structure mentioned above, ENZYME EFFECT OF LOSS
identify whether such is involved in replication, transcription or translation. DNA Polymerase No replication
2. Explain why both DNA replication and RNA transcription are disrupted by the loss of RNA
Helicases Decreased DNA replication
polymerase. efficiency
Peptidyl No peptide bond formation
EVALUATION (5 MINS) transferase
1. As an assignment, ask the learners to make their own diagram of the steps involved in DNA
RNA Polymerase No replication
replication, transcription and translation or protein synthesis. (Note: The learners may choose a No transcription
variety of medium for presenting the steps of the processes.)
Ribosomes No translation
General Biology 2 60 MINS

Lesson 6: Genetic Engineering

Content Standard
The learners outline the steps in Recombinant DNA. LESSON OUTLINE
Performance Standard
Introduction Communicating Learning Objectives and 5
The learners shall be able to
Review
• explain how genes may be modified and/or inserted in host
cells/ organisms. Motivation Desirable Traits 5

Learning Competency Instruction Genetic Engineering 35

The learners should be able to outline the steps involved in
Practice Recitation 5
genetic engineering (STEM_BIO11/12-III a-b-6)
Enrichment Poster Making 5

Specific Learning Outcomes Evaluation Assignment 5

At the end of the lesson, the learners will be able to:
Materials
• compare classical breeding with modern genetic engineering techniques;
Recyclable materials for paper models of plasmids; scissors; tape; pens
• enumerate the steps in molecular cloning; of various colors
• describe some methods to introduce DNA into cells; and Resources
• explain the selection and screening of transformants / genetically modified Biochemistry textbooks; online videos on genetic engineering
organisms (GMOs) and GMOs

30
INTRODUCTION (5 MINS)
Communicating Learning Objectives and Review Teacher Tip:
1. The learning outcomes will be presented and the overall idea on how organisms may Make a quick review of the previous lesson on
be modified will be discussed. DNA replication and protein synthesis.

2. In order to survive, man has successfully domesticated selected plants and animals. He
has taken an active part in choosing desired traits of plants and animals. Traits that were
considered valuable (i.e. high fruit yield; high milk production, etc.) were sought out and
propagated. The processes involved may include classical breeding practices such as
controlled pollination of plants, and the mating of animals with desired traits. In today’s
modern science, molecular biology techniques are being employed in the insertion and
expression of proteins in different organisms for various purposes.

MOTIVATION (5 MINS)
Desirable Traits Teacher Tip:
1. Ask for volunteers to enumerate plants and animals that have desirable or enhanced Group the learners into 3’s or 4’s and allow each
traits. group to discuss examples of “enhanced” animals/
plants.
2. Ask learners to explain how each of the traits was introduced or developed (i.e.
classical breeding or recombinant DNA technology).

ENHANCED TRAIT MODIFYING TECHNIQUE

Kobe / Wagyu Beef (Beef with good fat Classical breeding

distribution)

Guapple (Large sized guava) Classical breeding

Human Insulin-producing bacteria Recombinant DNA Technology

Flavr-Savr (Delayed-ripening tomatoes) Recombinant DNA Technology

Macapuno trait in coconuts Classical breeding

INSTRUCTION (60 MINS) Teacher Tip:
Pictures of common domesticated plants and
Genetic Engineering
animals may be shown in class.
1. Classical breeding practices focus on the mating of organisms with desirable qualities.
2. Genetic engineering involves the use of molecular techniques to modify the traits of a High cost of medicine and other agricultural
products may be mentioned.
target organism. The modification of traits may involve:
I. introduction of new traits into an organism
II. enhancement of a present trait by increasing the expression of the desired gene
III. enhancement of a present trait by disrupting the inhibition of the desired
genes’ expression.
3. A general outline of recombinant DNA may be given as follows:
I. cutting or cleavage of DNA by restriction enzymes (REs)
II. selection of an appropriate vector or vehicle which would propagate the
recombinant DNA ( eg. circular plasmid in bacteria with a foreign gene of interest)
III. ligation (join together) of the gene of interest (eg. from animal) with the vector ( cut
bacterial plasmid)
IV. transfer of the recombinant plasmid into a host cell (that would carry out replication to
make huge copies of the recombined plasmid)
V. selection process to screen which cells actually contain the gene of interest
VI. sequencing of the gene to find out the primary structure of the protein
4. After outlining the key steps in recombinant DNA, the teacher can proceed to describe
the ways in which these plasmids may be introduced into host organisms.

Biolistics. In this technique, a “gene gun” is used to fire DNA-coated pellets on plant
tissues. Cells that survive the bombardment, and are able to take up the expression
plasmid coated pellets and acquire the ability to express the designed protein.

Plasmid insertion by Heat Shock Treatment. Heat Shock Treatment is a process used to
transfer plasmid DNA into bacteria. The target cells are pre-treated before the procedure
to increase the pore sizes of their plasma membranes. This pretreatment (usually with CaCl2)
is said to make the cells “competent” for accepting the plasmid DNA. After the cells are
made
32
 competent, they are incubated with the desired plasmid at about 4°C for about 30min. The
plasmids concentrate near the cells during this time. Afterwards, a “Heat Shock” is done on
the plasmid-cell solution by incubating it at 42°C for 1 minute then back to 4°C for 2
minutes. The rapid rise and drop of temperature is believed to increase and decrease the
pore sizes in the membrane. The plasmid DNA near the membrane surface are taken into
the cells by this process. The cells that took up the plasmids acquire new traits and are said
to be “transformed”.

Electroporation. This technique follows a similar methodology as Heat Shock Treatment, but,
the expansion of the membrane pores is done through an electric “shock”. This method is
commonly used for insertion of genes into mammalian cells.

5. Some methods to screen recombinant cells are as follows:

Selection of plasmid DNA containing cells
A selection marker within the inserted plasmid DNA sequence allows the selection of
“transformants”. Usually, an antibiotic resistance gene (e.g. AMP ampicillin resistance gene) is
included in the plasmid DNA. This allows only “transformed” cells to survive in the presence
of the antibiotic (e.g. ampicillin). Plating the plasmid-cell solution on antibiotic-containing
media will select for these “transformants” and only allow plasmid-containing cells to grow
and propagate into colonies.

Selection of transformed cells with the desired gene

Certain inserted genes within the plasmids provide visible proof of their presence. These Teacher Tip:
Agarose gel electrophoresis (AGE) allows the
include the antibiotic resistance genes that allow for the selection of the transformed cells identification of PCR products and estimation of
within the solution. Some inserted genes also produce colored (e.g. chromogenic proteins) their sizes. This is done by running a molecular
or fluorescent products (e.g. GFP) that label the colonies/cells with the inserted gene. weight (MW) ladder alongside the samples. The
MW ladder is made up of DNA fragments of
known size (e.g. 100bp, 200bp, 300bp, 500bp,
In some cases, the location of the cloning site within the plasmid is in the middle of a gene etc). The size of the PCR product may be
(i.e. β-galactosidase, lacZ) that generates a (blue) colored product in the presence of a approximated by the DNA fragment in the MW
ladder that runs a similar distance.
substrate (i.e. isopropyl β-D-1 thiogalactopyranoside, or IPTG). Cells transformed with these
“empty” plasmids will turn blue in the presence of IPTG. Insertion of a gene in the cloning
site disrupts the sequence of the β-galactosidase gene and prevents the generation of the
colored
product in the presence of the substrate. Cells transformed with the disrupted β-
galactosidase gene will remain “white” in the presence of IPTG. This “blue-white screening”
protocol is thus able to screen for cells that were transformed with the desired gene in the
cloning site.

PCR detection of plasmid DNA

Alternatively, the presence of the desired gene in the inserted plasmids may be confirmed
using PCR amplification. PCR reactions specific for the desired gene may be done using DNA
from cells. Amplification of the expected product would confirm the presence of the gene
within the samples. PCR reactions specific for plasmid sequences will also confirm/identify the
type of plasmid used for the transformation.

Genetically Modified Organisms (GMOs)

With the ability to insert gene sequences, comes the possibility of providing new traits for Teacher Tip:
Note that antisense RNA strands bind to mRNAs.
these target organisms. This has allowed the development of GMOs. Some of these genetic
This prevents their expression into proteins.
modifications promise higher product yield for their targets. These include the Flavr-Savr
Tomato and Bt-Corn.

The Flavr-Savr (“Flavor Savor”) tomato was the first genetically modified organism that was
licensed for human consumption. The trait modified in this tomato is its ripening process. A Note:
Which of the techniques discussed can be used to
gene for an enzyme that causes the degradation of pectin in the cell walls (i.e. detect if GMOs were used in a certain food
polygalacturonase) normally softens the fruit as it ripens. In Flavr Savr tomatoes, an inhibitor product?
(i.e. antisense RNA) disrupts the expression of this gene, thereby delaying the softening of
Answer: Assuming that the DNA is still intact in the
the fruit and extending the time it may be kept in storage and transported to markets.
sample, testing for specific marker genes in
expression plasmids can be used to detect the
Bt-Corn was developed to incorporate the production of a toxin (i.e. Bt-endotoxin) from presence of these engineered plasmids.

Bacillus thuringensis in corn plants. This toxin results in the death of pests that feed on
these plants like the corn borer larvae. The toxin has been shown to be selective for
Lepidoptera larvae and is non-toxic to humans, mammals, fish and birds. The selective toxicity
of the toxin allows its use in foodcrops. The introduction of the toxin is believed to increase
crop production due to decreased losses from pest infestation. The same technology has
been applied in the Philippines for the development of Bt-Eggplant.
34
 Despite the proposed benefits of GMOs, some people have raised their concerns regarding
the consumption of these modified foods. While most of the products are tested for safety,
concerns are raised for the possibility of not being able to detect hazards that are present,
but are currently undetectable by today’s current technology.

Because of these issues, manufacturers are urged to provide labels that notify consumers
of GMO presence in their products. While GMOs are believed to be safe when licensed by
the food regulatory agencies, it is believed that the consumers must be provided with
enough information to make their own choices regarding their use.

PRACTICE (5 MINS)
Recitation Teacher Tip:
Biolistics may be more suitable for plants due
1. Ask the learners to differentiate the various technologies for delivering genes into cells.
to their thick cell walls.
2. Determine which technologies are most appropriate for which cell types.
(Answers: Biolistics for plants; Electroporation for mammalian cells; Heat shock for
bacterial cells)

ENRICHMENT (5 MINS)
Poster Making Teacher Tip:
1. Learners may be asked to make a poster on the steps and other methods involved in This may also be given as an assignment.
recombinant DNA.

EVALUATION (5 MINS)
Assignment
1. Give an assignment and allow learners to research on the pros and cons of
genetic engineering.
2. Ask them for their opinion on the matter, and ask them to support these opinions with
facts learned in class. Be sure that issues of biosafety are included in the discussion.
General Biology 2 60 MINS

Lesson 7: Discuss the Applications

of Recombinant DNA
Content Standard
The learners demonstrate an understanding of recombinant DNA and
LESSON OUTLINE
examples of products from Recombinant DNA Technology.
Performance Standards Introduction Communicating Learning Objectives 5
The learners shall be able to:
Motivation Thought Experiment 5
• describe some techniques for the expression of desired traits in
target organisms; and Instruction Presentation of Recombinant DNA 35
• search online databases for specific traits and source organisms. Practice Steps in PCR and Gene Cloning 5
Learning Competency Enrichment User of PCR and GMOs 5
The learners should be able to discuss the applications of Recombinant DNA
Technology (STEM_BIO11/12-III a-b-7) Evaluation Sample Exercise 5
Specific Learning Outcomes:
Materials
At the end of the lesson, the learners will be able to: Writing materials, recyclable materials for models of plasmids,
• give examples of products from recombinant DNA technology; tape, pens
• illustrate the use of databases to search genes for desired Resources
traits; (1)Genbank, www.ncbi.nlm.nih.gov
• describe steps in PCR to amplify and detect a gene of interest; (2) Protein Data Bank, www.pdb.org
• identify the parts of an expression vector;
• explain how genes may be cloned and expressed

36
INTRODUCTION (5 MINS) Teacher Tip:
Be sure to stress that for a gene to add a trait
Communicating Learning Objectives to an organism, the gene for the trait must be
1. The learning objectives will be presented and the processes in the Central Dogma of inserted within the target organism, and the
Molecular Biology will be reviewed: orga n i s m s h ou l d h a v e t h e n e c e s s
a r y “equipment” (i.e. enzymes, materials ) to
DNA (gene) 🢧 RNA (transcript) 🢧 Protein (trait)
produce the protein that results in the trait or
2. Different organisms have different traits based on their genes (DNA sequences). desired phenotype.
For example, frogs have antimicrobial peptides on their skin. Some jellyfish have proteins
that allow them to glow in the dark. Mutations in hemoglobin genes lead to anemia.
3. Based on the central dogma, if transcription and translation of genes lead to some traits, then
the insertion of certain genes in a given organism may provide it with new traits. This is the
basis for the development of genetically modified organisms (GMOs).

MOTIVATION (5 MINS)
Teacher Tip:
Thought Experiment Discuss the merits of the different proposed
1. The learner may be given a group activity/ thought experiment for constructing a “designer genes” based on the following
genetically modified organism/trait in a fruit. “Designer Genes group work” criteria:

I. Arrange the learners into groups of 3 or 4. 1. Originality of the study (i.e. Has
II. Have them identify a special trait (e.g. large fruit size) anyone done studies of this type
before?)
III. Have them identify a source organism (e.g. jackfruit / langka) 2. Feasibility of the study (How possible is
IV. Have them identify a target organism (e.g. aratilis) the proposed modification? Can the target
organism support the proposed trait? )
V. Have them identify the modified / added trait (e.g. langka-sized aratilis). 3. Potential Applications of the new organism
VI. Have the learners present their work to the rest of the class, and let the class decide on (What benefits would the recombinant
organism provide to society?)
the best proposal.
Some examples: Flood-resistant rice Delayed-
ripening fruits
INSTRUCTION (35 MINS)
Teacher Tip:
Presentation of Recombinant DNA
Ask the learners on the significance of finding
1. After the exercise, the learners should now be aware that there are many different traits that can many versus few entries on a given topic in
be introduced to organisms to change their properties. The following table shows examples of the database.
modified traits using cloned genes and their applications:

GENE RECIPIENT APPLICATION FEW entries MANY

MODIFIED TRAIT in the entries in the
MODIFICATION ORGANISM (FIELD)
database database
Insulin Production Insertion of Human Bacteria (Medicine)
Insulin Gene Production of Human Topic has not Topic is
Insulin in Bacteria been much studied
extensively
studied
Much
Pest Resistance Insertion of Bt-toxin Corn / Maize (Agriculture) PROS information is
gene Production of corn High chance available on
plants with increased to discover the topic
resistance to corn novel traits /
boxer applications

CONS Low number Difficult to

Delayed Ripening Disruption of a gene Tomato plant Agriculture) of research to discover new
for a ripening enzyme Production of plants verify the information
(e.g. with fruits that have observations on the topic
polygalacturonase) delayed ripening
fruits. These fruits will
survive longer
transport time,
allowing their delivery
to further locations
(i.e. export deliveries)

38
Chymosin Production Insertion of a gene Bacteria (Industry)
for chymosin Enhance large scale
production of
chymosin. This
enzyme serves as a
substitute for rennet
in the coagulation of
milk.
Rennet has to be
harvested from calves.
The large scale
production of this
enzyme in bacteria
provides an abundant
supply of this
important component
for the cheese
production industry.

Web based research:

Search for these different traits and how they may be made useful. This involves the collection of gene sequences in accessible locations,
such as databases (e.g. Genbank (www.ncbi.nlm.nih.gov) ; Protein Data Bank (www.pdb.org)). These databases serve like libraries that may
be consulted when trying to find specific traits that belong to different organisms.

For example, one would want to find out if any work has been done on spider silks. The databases (e.g. Genbank:Nucleotide database) may be
searched for entries that contain information on “Spiders, and Silk” (Result: 93615 entries). The results may be screened for more specific
studies (e.g. Malaysia, Spiders, and Silk- Result two entries).
PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or expression
in a given organism.

1. Detection
Teacher Tip:
Some researchers may be interested in determining if a given gene/trait is available in a Mention that unlike DNA replication in
particular organism. If no previous research provides this information, researchers may test the vivo, PCR reactions do not use too many
DNA of different organisms for the presence of these specific genes. A technique that allows the helper enzymes such as helicases and
detection of specific genes in target organisms is called PCR. gyrases to help denature and stabilize
the template DNA strands.
The cyclic heating of the samples is
PCR amplification is an in-vitro method that simulates DNA replication in vivo. It utilizes a meant to provide the physical separation
of the template DNA strands through heat
thermostable (heat-resistant) DNA polymerase that builds single stranded DNA strands unto
denaturation of the inter-strand H-bonds.
unwound DNA templates. PCR uses repeated cycles of incubation at different temperatures to
promote the unwinding of the DNA template (~95°C); the annealing of a primer (a ~20bp
oligonucleotide sequence (recall RNA primers in DNA replication) onto the ssDNA template strand
(~54 - 60°C); and the extension of the generated ssDNA strand through the binding of
complementary bases to the template strand (~72° C). The thermostability of the polymerase
allows it to survive the repeated cycles of denaturation, annealing and extension with little loss of
enzyme function. Each cycle of PCR doubles the amount of the target sequence. A typical PCR
experiment uses about 35 cycles of amplification. This increases the original amount of the target
sequence by 235 (i.e. ~34 billion) times.

Gene detection by PCR involves the design of primers that would only bind to sequences that are
specific to a target. For example, researchers would want to find out if gene X (e.g. the gene for
insulin) is available in a target organism (e.g. a mouse, Mus musculus). Primers may be designed
by looking at the available sequences for gene X in the databases (e.g. all the genes for insulin in
different organisms; humans, pigs, cows, etc.). The different gene X sequences must be aligned/
compared to match areas of sequence similarity (conserved sequences) and areas of sequence
dissimilarity (non-conserved sequences). Primers designed to have the same sequence as the
conserved areas will be specific for binding gene X sequences in all the target organisms. Primers
designed to have the same sequence as the non-conserved areas will only be specific for the
organisms which match its sequence.
40
 Primers may be classified as forward or reverse primers. Forward primers are complementary
and bind to the reverse complementary (non-coding) sequence of the gene. Reverse primers
are complementary and bind to the coding sequence of the gene.
STEPS in PCR Amplification
Step 0: Undenatured Template ; Temp ~ 54 ° C;
Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-bonds
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
Teacher Tip:
Let the learners recall the antiparallel orientation
of the bound primers to the template DNA. If the
template is represented from left to right in the
5’ 🢧 3’ orientation; then the primers should bind
near the 3’ end and the primers would be
represented 3’ 🢧 5’ going left to right.

3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

Step 1: Template denaturation ; Temp ~ 95 ° C;

Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)

3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

Step 2: Primer Annealing ; Temp ~ 54 ° C (dependent on primer melting temperature);

Template: ssDNA strands. H-bonds are formed between complementary sequences on the primers
and the target sequences.

5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)

Direction of elongation CCATAGATC (Reverse Primer)
5’ GCGATGAGG 3’ Direction of elongation (Forward Primer)

3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

 Teacher Tip:
Step 3: New DNA strand elongation ; Temp ~ 72 ° C; nd
Illustrate how by the 2 round of PCR the two
The two new dsDNA strands are formed by the elongation of the generated ssDNA and the H-bonds newly synthesized DNA strands can now be used
between the complementary sequences on these new strands and their templates. Each of the new as templates. For the given example, new strand
synthesis will again generate a 37 base pair long
dsDNA strands is made up of one old strand from the original template, and one new strand that product. Repeated cycles of PCR will make this
was generated as a reverse complement of the template. This is called semiconservative replication product the predominant type of double stranded
of the sequence. DNA in the solution.

New Strand 1:
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’ CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5’ (Reverse Primer) (new)

New Strand 2:
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3’ (Forward Primer) (new)

3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand) (old)

Step 4: Repeat step 1 to 3 for N number of cycles (N is usually 35)

PCR Results
The expected product of PCR amplification will depend on the sequences / position at which the
primer sequences bind. If the forward primer starts binding at nucleotide 3 (coming from the 5’ end)
of a 43bp long gene, and the reverse primer binds at a position complementary to nucleotide 39 of
the coding strand, then a 37bp product is expected per cycle of PCR.

New Strand 1:
Nucleotide # 3 Nucleotide # 39 Note: Other types of organisms (e.g. Yeast,
Mammalian Cells, etc.) may also be
37 bp product “transformed” to exhibit new traits. The type of
DNA constructs used for insertion of genes into
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old) these organisms will vary (e.g. Bacmids, Cosmids,
etc.)
3’- CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC – 5’ (Reverse Primer) (new)
42
New Strand 2:

Nucleotide # 3 Nucleotide # 39

37 bp product
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG -3’ (Forward Primer) (new)
3’ T A C GCTACTCCTATACTGGGCTATCTATCTCCATAGATC TCTA 5’ (Non-coding strand) (old)

PCR Applications Teacher Tip:

PCR may be used to detect the presence of a desired gene in an organism. Depending on the primer The multiple cloning site (MCS) may contain
design, the expected product may represent only a specific region of the gene or the entire gene sequences that may be cut by different
itself. restriction enzymes. Stress how the use of two
restriction enzymes may control the orientation
The first case is useful for detection of the gene, or the detection of organisms with that specific of the inserted gene in the plasmid.
gene within a sample. The second case is useful for the amplification of the entire gene for eventual Note: Forward and Reverse primers should not be
expression in other organisms. The direct amplification/copying of a full gene is part of the process complementary.
for “cloning” that gene.

2. Cloning and Expression

Some genes provide economically, and industrially important products (e.g. insulin-coding genes;
genes for collagen degradation). In some cases, scientists would want to put these genes into
organisms for the expression of their products. One example would be the insertion of an insulin-
coding gene from the human genome into bacteria. This allows the “transformed” bacteria to
now produce human insulin as a product.

Certain types of bacteria are capable of this process since they are able to take genes within their
cell membranes for eventual expression. The genes are normally in the form of small, circular DNA
structures called plasmids.

The genes found in the inserted plasmid DNA sequence will be expressed as proteins that provide
specific traits to the transformed bacteria. The basic components of an expression plasmid are listed
in the following table. The purpose of each of these is also provided.
 COMPONENT PURPOSE

Promoter Allows the controlled expression of the desired gene in the presence
of an inducing agent (e.g. beta- galactosidase; heat treatment (~65°
C)
Multiple Cloning Site DNA sequence or portion for the insertion of the desired gene. This
section may contain sequences that will be cut by specific
restriction endonucleases ( cuts within the molecule) If both the
amplified gene and the plasmid are cut with the same restriction
enzyme, then complementary sequences will be generated for
each, allowing them to bind together or anneal. The desired gene is
inserted into the multiple cloning site through this process.

Restriction enzymes cut at specific sequences.

EcoR1 Target Sequence:

5’ GAATTC 3’
3’ CTTAAG 5’

Digestion Reaction
Undigested: Digested dsDNA:

5’ GAATTC 3’ 5’ G AATTC3’
3’ CTTAAG 5’ 3’ CTTAA G5’

If the desired cut sites are not found in the gene that needs to
be inserted; the sequences can be added by including the target
sequences in the primers used for PCR amplification.

44
 COMPONENT PURPOSE
Multiple Cloning Site PCR Primers:
5’ GCGATGAGG 3’ (Forward Primer)
3’ CCATAGATC 5’ (Reverse Primer)

Forward Primer + EcoRI target sequence:

5’ GAATTCGCGATGAGG 3’
Reverse Primer + EcoRI target sequence:
3’ CCATAGATCCTTAAG 5’

Inserted Gene Sequence Successful insertion of a gene allows the expression of its protein
product. This usually provides a specific trait to the “transformed”
bacteria. For example, if the gene for Green Fluorescent Protein is
placed within the expression plasmid, bacteria transformed with this
plasmid will produce protein (GFP) that will allow the bacterial cells /
colonies to glow green in the dark.

Antibiotic Resistance Provides a way to screen a population of bacteria for those that took
Gene up the plasmid. For example, if an ampicillin resistance gene is
encoded in the plasmid, then only bacteria which took up the
plasmid will be able to grow on media with ampicillin.
However, if the ampicillin resistance gene is cut and the gene is
inserted here for cloning, then the cell will no longer be resistant to
ampicillin. This is a way to select which among the colony of cells
actually contain the inserted gene sequence. Bacterial cells whose
ampicillin resistance gene have been cut will die in the presence
(agar plate) of ampicillin.
PRACTICE (5 MINS) Teacher Tip:
Steps in PCR and Gene Cloning At this point, learners’ imagination could be
stretched, but caution the learners that certain
1. Let learners give other hypothetically modified or genetically engineered plants and animals
ethical principles should be followed and adhered
which can be used for health, industry, agriculture and for the protection of the environment. to in the production of genetically modified
2. Ask learner to draw the parts of an expression vector. organisms. Animal welfare should be taken cared
of and human cloning must never be conducted.
3. Using pieces of paper, allow the learners to illustrate the steps in restriction digestion and PCR

ENRICHMENT (5 MINS)
Uses of PCR and GMOs
1. Discuss how PCR may be used for the detection of disease causing pathogens in a population. For
example, it may be used to check if a patient has a dengue virus infection. This is done by using
primers that are specific for complementary DNA (cDNA) sequences that correspond to the
dengue viruses. If PCR amplification occurs using cDNA from a patient’s blood sample then the
patient likely has dengue viruses in his/her blood.
2. Discuss how the cloning and expression of certain genes allows for massive production of the
desired product. For example, the cloning and expression of insulin in bacteria allows for the
mass production of this necessary protein for use by diabetic patients. Prior to insulin production
in bacteria, insulin was harvested from other animals such as pigs.

Teacher Tip:
Try using other classic restriction enzymes:
Ex. Xho1; HindIII

46
EVALUATION (5 MINS)
Sample Exercise
1. Give learners a set of known Restriction Enzyme (RE) cut sites:

EcoRI BamH1

5’ GAATTC 3’ 5’ GGATTC 3’
3’ CTTAGG 5’ 3’ CTTAGG 5’

DNA Sequence (69 bp long) 28 49

5’ ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATCCTATGCCCGAATGTC 3’
3’ TACGTACCATGCATCTCAAGGTACTTAAGCGGGGATATCCCATCGGCTCCTAGGATACGGGCTTACAG 5’

Expected Fragment sizes:

With EcoR1 digestion : 28 bp, 41 bp
With BamH1 digestion : 20 bp, 49 bp
With both EcoR1 and BamH1: 20bp, 28bp, and 21 bp
3. Ask the learners to scan a double stranded DNA sequence to determine the presence of these cut sites. Allow them to provide the
fragment sizes expected for using different combinations of the RE on the given sequence. You may choose to give the sequence as
linear or circular DNA. Discuss how the fragment sizes will vary if the target sequence is in circular or linear DNA.

4. A similar exercise may be done to locate areas where primer sequences can bind. The expected fragment sizes for PCR amplification
using different primers can be tested

Example:
Forward Primer:
5’ CATGGTACGTAG 3’

Reverse Primer:
3’ GCTCTATACGGG 5’

Target Sequence:
4 Product Size: 62 - 4 = 48bp 62

5’ ATGCATGGTACGTAGAGTTCCATGATAGAGCCCCTATAGGGTAGCCGAGCGAGATATGCCCGAATGTC 3’ 3’
TACGTACCATGCATCTCAAGGTACTATCTCGGGGATATCCCATCGGCTCGCTCTATACGGGCTTACAG 5’

48
General Biology 2 60 MINS

Lesson 8.1: History of Life on Earth

Content Standard
The learners demonstrate understanding of the major events in the history LESSON OUTLINE - DAY ONE
of life on Earth.
Introduction Communicating Learning Objectives 5
Performance Standards
The learners shall be able to Motivation Discussion: How Old is the Earth? 15
• create a personal timeline and compare it with the geologic time scale
Instruction Picture Timeline and Short Film 20
• design a poster tracing evolutionary changes in a crop plant (e.g., rice
or corn) that occurred through domestication Enrichment GTS Introductory Worksheet 10

Learning Competency Evaluation My Life History: A Short Narrative 10

The learners describe general features of the history of life on Earth, including
Materials
generally accepted dates and sequence of the geologic time scale and Visual aids on the geologic time scale; 20 printed pictures of
characteristics (STEM_BIO11/12-IIIc-g-8) events/ structures/ organisms; computers and internet connection

Specific Learning Outcomes All Resources listed at the End of this Lesson
At the end of the lesson, the learners will be able to:
• identify the dates and sequence of the periods in the geologic time
scale;
• identify the major events in each major period;
• describe the characteristics of the major groups of organisms
present during a time period;
• identify types of fossils; and
• describe causes of mass extinctions.
INTRODUCTION (5 MINS) Introduction
When we study the Earth’s age, we are also
Communicate Learning Objectives studying the fossil record and ultimately, the
Introduce the following objectives by asking volunteers to read them aloud: theory of evolution. The Earth is approximately
4.6 billion years old – a very big number ordinary
1. I can identify the dates and sequence of the geologic time scale
humans can’t easily relate with, especially, the
2. I can describe the characteristic features of major groups of organisms in each time period. specific time frame when we appeared. Comparing
the Earth’s age to one calendar year, events such
as the extinction of dinosaurs and the re-discovery
of the New World by Columbus would appear
MOTIVATION (10 MINS) relatively much easier. “Understanding the
geologic time scale reminds us of our time and
Discussion: How Old is the Earth? place in the universe.”
1. What is the age of the Earth?
The learners may give various answers from thousands to millions of years. Some will give Big Ideas: (May be written on the board or manila
answers near to 4.6 billion years. Write all the answers on the board and let them think of paper and posted on the board.
what the age of the Earth is.) • The Earth is 4.6 billion years old.
• Life on Earth arose around 3.5 billion
years ago.
2. What was the Earth like million of years ago? • Over Earth’s vast history, both gradual
and catastrophic processes have produced
Ask learners: “Have you seen the movies Ice Age and The Land Before Time? How was the enormous changes.
Earth presented in movies such as these?” Based from what you may have read, describe the
Earth million of years ago. The following answers may be given by learners: (1) covered with
Misconceptions:
thick blanket of ice, (2) lots of volcanoes and high mountains, (3) large organisms roamed
• Humans and dinosaurs existed on the Earth at
the land, (4) the atmosphere did not have high oxygen content, (4) asteroids/ meteors the same time.
frequently hit the surface, (5) the lands moved a lot or the continents were a little closer to • Plants and animals on Earth have
each other, (6) volcanic eruptions, (7) a little bit warmer, (8) plants were bigger, (9) humans always existed.
• The Earth is too big to change.
were not yet around. Accept all answers and ask them what are the possible conditions on
the early Earth. The teacher may show a clip from any of the movies depicting ancient earth
conditions.) Teachers must correct the misconceptions
learners have about the history of life on Earth.

3. When did man first appear on Earth?

Learners may give answers such as millions to thousands years ago. Ask learners to choose
the more probable dates and provide evidence for its accuracy. They may enumerate the
different hominid species but ask them the approximate time when our species (modern
humans) first appeared. Tell them that humans did not co-exist with dinosaurs as what movies
50
 usually depict. Man could have first appeared about 100 – 150 thousand years ago as shown Teacher Tip:
by artefactual evidences in various sites. The human timeline is rather flexible and debatable- It’s hard for learners to understand geologic
every time we know a specific date, a new discovery is announced and everything gets re- events and the time frame where each event took
place. It will be easier if everything is connected
dated to fit the best estimates.) in a 1- year time frame (calendar year). It is more
relevant to see how everything unfolds in a short
time span.
4. Distribute the 15 – 20 pictures to some volunteers. Ask each volunteer to post them along However, tell them that a lot of things can
happen in the span of a year.
the length of the board based on what each thinks occurred first.
5. Let the other learners check what have been posted. They can suggest a possible The teacher will print 15 - 20 events
(preferably with pictures, if necessary) to be
re- arrangement of the pictures. used for this lesson. Refer to the Sample Events
6. When everybody is satisfied with the lineup, tell them that they are going to watch a List.

short video. The pictures should be posted on the front board

that will serve as a 1-year timeline. Tell them that
they will view the Earth’s history in this time frame.
To make it more interesting, attach the 12 months
of the year. Ask interesting questions, such
INSTRUCTION (20 MINS) as,“Who would like to have a birthday party with
1. Watch a short clip dinosaurs?”
I. Geologic Time Scale (https://www.youtube.com/watch?v=nofyRleo3Vc ) Unlocking of Terms:
II. “Four Ways to Understand the Earth’s Age.” (https://www.youtube.com/watch?v=tkxWmh- • EON- largest division of the geologic time
scale; spans hundreds to thousands of
tFGs&spfreload=10 million of years ago (mya)
2. Tell everyone to listen and watch attentively. • ERA- division in an Era that span time periods
of tens to hundreds of millions of years
3. Use the following questions to guide the learners as they watch the video. • PERIOD- a division of geologic history that
spans no more than one hundred million years
I. What are the four ways mentioned in the film? • EPOCH- the smallest division of the geologic
II. Why is it hard to create a timeline of events chronicling Earth’s history? time scale characterized by distinctive
organisms
III. What are the divisions of the geologic time scale?
Tip:
4. Share in class what you have learned from the video. The teacher may also ask the learners to plot
5. Ask the learners to take a closer look at the timeline constructed on the board. their birthdates side-by-side with the geologic
events.
6. Let them re-arrange (if necessary) based on what they learned from the video.
Ask:
In which timeframe were you born? What specific
events happened the day you were born, using the
geologic time scale.

Alternate Video:
Geologic Time Scale: Major Eons, Eras, Periods
and Epochs- https://www.youtube.com/watch?
v=nofyRleo3Vc
ENRICHMENT (10 MINS) Teacher Tip:
1. Answer the following in your journal. Journaling is a good technique to help some
I. The Earth has an incredibly long history. How does understanding of geologic time and passive learners to jot down their thoughts
first then share whatever they have written
the significant geologic events of the past impact your understanding of humans’ with a partner.
unique responsibility and place on earth?
Volunteers may be tapped in advance.
II. How does understanding the past help us understand the present? The best output will be posted in the room.
III. Calculate how many generations of humans it would take for us to exist now (assume an
average life span of 80 years) (What must we humans do to ensure we are able to exist
this long for many generations?
2. Form a dyad and discuss your answers.

EVALUATION (5 MINS) Alternate activity:

1. Answer the Worksheet on Geologic Time Scale. Submit next meeting. Time Machine:
1. Look around your community. Make a narrative
2. My Life History: Create a timeline of events that happened to you since you were born up to on how the place looked like several years ago
the present time. Choose only 20 events that you think are the most important. Be ready to and how it will be several years (maybe after
50 years) from now.
present your timeline next meeting.

ASSIGNMENT: (5 MINS) Going Further:

1. Make a table in your notebook of the geologic time scale (GTS) and include the If time and space permits, the following
following details; activity can be done.
Understanding Geologic Time
I. Major divisions of the GTS
(From: http://www.jsg.utexas.edu/glow/files/
II. Major events and characteristic organisms Understanding-Geologic-Time-6-8.pdf)

52
General Biology 2 60 MINS

Lesson 8.2: History of Life on Earth

Content Standard
The learners demonstrate understanding of the major events in the history LESSON OUTLINE - DAY TWO
of life on Earth.
Introduction Communicating Learning Objectives 5
Performance Standards
The learners shall be able to Motivation Discussion: How Old is the Earth? 5
• create a personal timeline and compare it with the geologic time scale Instruction Lecture of the Geologic Time Scale 20
• design a poster tracing evolutionary changes in a crop plant (e.g., rice
Enrichment The Anthropocene 20
or corn) that occurred through domestication
Evaluation Quiz 10
Learning Competency
The learners describe general features of the history of life on Earth, including Materials
generally accepted dates and sequence of the geologic time scale and Visual aids on the geologic time scale; 20 printed pictures of
characteristics (STEM_BIO11/12-IIIc-g-8) events/ structures/ organisms; computers and internet connection

Specific Learning Outcomes All Resources listed at the End of this Lesson
At the end of the lesson, the learners will be able to:
• identify the dates and sequence of the periods in the geologic time
scale;
• identify the major events in each major period;
• describe the characteristics of the major groups of organisms
present during a time period;
• identify types of fossils; and
• describe causes of mass extinctions
INTRODUCTION (5 MINS) Teacher Tip:
Communicating Learning Objectives This lesson will present formally the lesson on
GTS. The learners will understand better the
The lesson for today will cover the following topics:
highlights of each time frame in the GTS.
1. Major events in the Geologic Time Scale (GTS)
2. Cambrian Explosion

MOTIVATION (5 MINS)
Discussion: How Old is the Earth?
Discussion: How Old is the Earth?
Ask the following questions:
1. How old is the Earth?
2. What is the biggest time frame in the GTS?
3. What is the smallest time frame in the GTS?

INSTRUCTION (20 MINS)

Lecture of the Geologic Time Scale
1. Present a lecture discussion on the Geologic Time Scale
2. The following outline can guide the teacher in the discussion:
I. The Geological Time Scale (GTS)
A. Four eras - Precambrian; Paleozoic; Mesozoic; Cenozoic
B. Periods under the Paleozoic era - Cambrian, Ordovician, Silurian,
Devonian, Carboniferous, Permian
C. Periods under the Mesozoic era - Triassic, Jurassic, Cretaceous
D. Periods under the Cenozoic era - Tertiary and Quaternary
II. Age in millions of years of each time period
III. Major events in the history of life
Teacher Tip:
The Geologic Time Record is a tabular
representation of the major divisions of the
Earth’s history. The time intervals are divided and
described from the longest to the shortest as
EONS, ERAS, PERIODS and EPOCHS.
Each period has an approximated time frame and
characterized by distinctive features (events and
organisms).

54
 The Geologic time is divided into four large segments called Eons:
Hadean, Archean, Proterozoic and Phanerozoic. The Phanerozoic
is divided into Eras: Paleozoic, Mesozoic, and Cenozoic.
Extinction events and appearance of new life forms characterized
the divisions among Eras. Smaller divisions, called Periods,
characterized by a single type of rock system, make up each Era.
Some Periods are further divided into smaller time frame called
Epochs. (From: http://goo.gl/ITmoty)

There is a mnemonics (memory device) to remember the Periods

in exact order (from the earliest to the recent); jumps between
periods and epochs.
Pregnant Plentiful
Camels Early
Often Oiling
Sit Might
Down Prevent
Carefully. Partial
Perhaps Rheumatism!
Their
Joints
Creak?

The teacher can also discuss CAMBRIAN EXPLOSION.

CAMBRIAN EXPLOSION is the belief that there was a sudden,
apparent explosion of diversity in life forms about 545 million years
ago. The explosion created the complexity of multi-celled
organisms in a relatively short time frame of 5 to 10 million years.
This explosion also created most of the major extant animal groups
today.
SOURCE: http://d32ogoqmya1dw8.cloudfront.net/images/NAGTWorkshops/time/
visualizations_teachtips/variable_time_geologic_time.jpg
The start of the Cambrian was characterized by the breaking up of ** The following PowerPoint presentations might help in organizing
supercontinent Gondwana into smaller land masses opening up new your discussion on this lesson.
• http://goo.gl/Xfu2dz
environmental niches where organisms can colonize and specialize. • http://goo.gl/YMUvFL
• http://goo.gl/yRa5c7
• http://goo.gl/45c27A
• http://goo.gl/CoumSB

Teacher Tip:
ENRICHMENT (20 MINS) Ask the learners to research if there are evidences to support that the
The Anthropocene “explosion” is as sudden and spontaneous as it is used to describe the fossil
record.
1. Present to the learners a new proposed Epoch, the Anthropocene.
I. What are the evidences that suggest that we are entering/ This is also a good time to discuss how new findings can affect an existing body of
have entered a new epoch? knowledge.

II. How do scientists decide if a new finding should be validated?
2. This can be discussed in a small group of 5 learners.
Let the learners read the following articles about a proposed new epoch,
the Anthropocene.
• Human impact has pushed Earth into the Anthropocene -
http://goo.gl/ fxggQf (04/13/16)
• What Is Anthropocene and Are We in It? - http://goo.gl/mq7I9V (04/13/16)
• Welcome to the Anthropocene - http://www.anthropocene.info (04/13/16)

EVALUATION (10 MINS)

1. Geologically speaking with reference to the entire history of
the earth, the dinosaurs went extinct… 3. The Earth is years old.
A. Shortly after the formation of Earth A. 6,000
B. In the first billion years of Earth’s history B. 46,000,000
C. In the most recent 2% of the history of Earth C. 4,600,000,000
D. Before the first fish formed A. There is no way to know
2. Relative to the percent of time dominating the surface of Earth
4. 100,000 years in the geologic history of Earth would
which organisms have the longest reign?
be considered
A. Dinosaurs
B. Plants A. Immensely long
C. Prokaryotes B. A drop in the bucket
D. Eukaryotes C. Half of Earth's history
E. Humans D. An extremely significant amount of time
56
5. Understanding geologic time is significant because it helps us 6. Which organism first dominated Earth?
A. Understand humans’ impact on our environment A. Dinosaurs
B. Understand the evolution of organisms over time B. Insects
C. Understand the possibility for life on other planets C. Plants
D. Understand the process of evolution D. Fish
E. All of the above E. Bacteria

ASSIGNMENT Answer Key:

1. What are fossils? How are they formed? Answer with discussion must be given by the teacher.
1. C
2. List down the types of fossils and given examples.
2. C
3. How do we measure the age of fossils? 3. C
4. B
4. What are mass extinctions? How many mass extinctions
5. B
events happened in the GTS? 6. E

Teacher Tip:
See to it that everyone has a clear understanding of the geologic time
scale. There is no need to remember all the events in each period.
General Biology 2 60 MINS

Lesson 8.3: History of Life on Earth

Content Standard
The learners demonstrate understanding of the major events in the history
LESSON OUTLINE - DAY THREE
of life on Earth.
Performance Standards Introduction Communicating Learning Objectives 5
The learners shall be able to Motivation Questions on Dinosaurs 5
• create a personal timeline and compare it with the geologic time scale;
and Instruction Types of Fossils 50
• design a poster tracing evolutionary changes in a crop plant (e.g., rice Materials
Visual aids on the geologic time scale; 20 printed pictures of
or corn) that occurred through domestication
events/ structures/ organisms; computers and internet connection
Learning Competency Resources
The learners describe general features of the history of life on Earth, including (1) Freeman, S. Biological Science. 3rd ed. 2008. California:
generally accepted dates and sequence of the geologic time scale and Pearson Benjamin Cummings. pp. 503-525.
characteristics (STEM_BIO11/12-IIIc-g-8) (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB
Jackson. Campbell Biology. 9th ed. 2014. Illinois: Pearson Education
Specific Learning Outcomes Inc. pp.
At the end of the lesson, the learners will be able to: 480-499.

• identify the dates and sequence of the periods in the geologic time scale; (3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
• identify the major events in each major period; 419-439.
• describe the characteristics of the major groups of organisms
Additional Resources listed at the End of this Lesson
present during a time period;
• identify types of fossils; and
• describe causes of mass extinctions.

58
INTRODUCTION (5 MINS) Teacher Tip:
The lesson for today will cover the following topic: An alternative could be to show a clip from
the movie Jurassic Park or Jurassic World.
1. The types of fossils
2. Ways fossils are formed and how fossils’ ages are determined
The following sites provide information about
3. Mass extinctions- causes and frequency in the GTS Fossils:
• http://teacher.scholastic.com/scholasticnews/
magazines/scienceworld/assets/SW-
MOTIVATION (5 MINS) POWERPOINT-FOSSILS.ppt - (Downloaded
1. Where did scientists discover the first dinosaurs? 04/15/16)
2. Who coined the term dinosaurs? • http://www.enchantedlearning.com/subjects/
dinosaurs/dinofossils/Fossiltypes.html -
3. How did the discovery of dinosaurs make scientists become more interested in the (Downloaded 04/15/16)
geologic record? • http://www.livescience.com/37781-how-do-
4. How can fossils be used as evidence for the evolution of living forms? fossils-form-rocks.html - (Downloaded
04/15/16)
• http://www.bbc.co.uk/nature/fossils -
INSTRUCTION (50 MINS) (Downloaded 04/15/16)
1. The teacher will post on the board examples of fossils and let the learners identify the type. • http://www.whatisafossil.net - (Downloaded
04/15/16)
FOSSILS are evidences of organisms that lived in the past. They can be actual remains
like bones, teeth, shells, leaves, seeds, spores or traces of past activities such as animal
burrows, nests and dinosaur footprints or even the ripples created on a prehistoric
shore.

In exceptional preservation, fine details such as original color and individual muscle
fibers are retained, features often visible in electron microscopes. This is referred to as
the “Medusa effect.” (From: http://www.bbc.co.uk/nature/fossils/Lagerstätte)
TYPES OF FOSSILS DESCRIPTION EXAMPLES

Molds Impression made in a substrate = negative image of an Shells

organism

Casts When a mold is filled in Bones and teeth

Petrified Organic material is converted into stone Petrified trees;

Coal balls (fossilized plants and their tissues, in
round ball shape)

Original Remains Preserved wholly (frozen in ice, trapped in tar pits, dried/ Woolly mammoth;
dessicated inside caves in arid regions or encased in Amber from the Baltic Sea region
amber/ fossilized resin)

Carbon Film Carbon impression in sedimentary rocks Leaf impression on the rock

Trace / Ichnofossils Record the movements and behaviors of the organism Trackways, toothmarks, gizzard rocks, coprolites
(fossilized dungs), burrows and nests

THE SIX WAYS OF FOSSILIZATION

Teacher Tips:
1. Unaltered preservation - Small organism or part trapped in amber, hardened plant sap The teacher may also mention that more than 90
percent of all organisms that have ever lived on
2. Permineralization/ Petrification - The organic contents of bone and wood are replaced with
Earth are extinct (http://goo.gl/K83SA). This is due
silica, calcite or pyrite, forming a rock-like fossil to mass extinctions events that wiped out
3. Replacement - hard parts are dissolved and replaced by other minerals, like calcite, silica, organisms in the past. The following sites offer
pyrite, or iron explanations on these mass extinction events.

4. Carbonization or Coalification - The other elements are removed and only the • Big 5 Mass Extinction Events - http://
carbon remained www.bbc.co.uk/nature/extinction_events -
(Downloaded 04/16/16)
5. Recrystalization - Hard parts are converted to more stable minerals or small crystals turn into • The Great Dying - http://science.nasa.gov/
larger crystals science-news/science-at-nasa/
6. Authigenic preservation - Molds and casts are formed after most of the organism have 2002/28jan_extinction/ - (Downloaded
04/16/16)
been destroyed or dissolved
• Mass Extinctions - http://
science.nationalgeographic.com/science/
prehistoric-world/mass-extinction -
(Downloaded 04/16/16)
60
DATING FOSSILS
Knowing the age of a fossil can help a scientist establish its position in the geologic time scale
and find its relationship with the other fossils. There are two ways to measure the age of a fossil:
relative dating and absolute dating.

1. RELATIVE DATING
I. Based upon the study of layer of rocks
II. Does not tell the exact age: only compare fossils as older or younger, depends on
their position in rock layer
III. Fossils in the uppermost rock layer/ strata are younger while those in the
lowermost deposition are oldest

How Relative Age is Determined

I. Law of Superposition: if a layer of rock is undisturbed, the fossils found on upper layers
are younger than those found in lower layers of rocks
II. However, because the Earth is active, rocks move and may disturb the layer making
this process not highly accurate

Rules of Relative Dating

(From: http://staff.harrisonburg.k12.va.us/~esutliff/forms/Relative_Dating_1334236393.ppt )

A. LAW OF SUPERPOSITION: Sedimentary layers are deposited in a specific time- youngest

rocks on top, oldest rocks at the bottom

B. LAW OF ORIGINAL HORIZONTALITY: Deposition of rocks happen horizontally- tilting,

folding or breaking happened recently
C. LAW OF CROSS-CUTTING RELATIONSHIPS: If an igneous intrusion or a fault cuts
through existing rocks, the intrusion/fault is YOUNGER than the rock it cuts through

Try this exercise on radioactive dating:

Carbon-14 Dating: http://www.starhop.com/library/pdf/studyguide/high/
brsp-15carbondating.pdf

INDEX FOSSILS (guide fossils/ indicator fossils/ zone fossils): fossils from short-
lived organisms that lived in many places; used to define and identify geologic
periods

2. ABSOLUTE DATING
• Determines the actual age of the fossil
• Through radiometric dating, using radioactive isotopes carbon-14 and potassium-40
• Considers the half-life or the time it takes for half of the atoms of the radioactive element
to decay
• The decay products of radioactive isotopes are stable atoms.

Take a look at the table below. A living organism has carbon-14. For the amount of Carbon in
the organism’s body to become half, it will take about 5,700 years; which is the half-life of
carbon-14. Fill up the remaining data in the table. What is the limit in using carbon-14 as a
measure to determine a fossil’s age?

62
General Biology 2 60 MINS

Lesson 8.4: History of Life on Earth

Content Standard
The learners demonstrate understanding of the major events in the history LESSON OUTLINE - DAY FOUR
of life on Earth.
Practice Creation of Fossils 50
Performance Standard
The learners shall be able to Wrap Up Clean Up 10
• create a personal timeline and compare it with the geologic time scale Materials
Visual aids on the geologic time scale; 20 printed pictures of
• design a poster tracing evolutionary changes in a crop plant (e.g., rice
events/ structures/ organisms; computers and internet connection
or corn) that occurred through domestication
Resources
Learning Competency (1) Freeman, S. Biological Science. 3rd ed. 2008. California:
The learners describe general features of the history of life on Earth, including Pearson Benjamin Cummings. pp. 503-525.
generally accepted dates and sequence of the geologic time scale and (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB
characteristics (STEM_BIO11/12-IIIc-g-8) Jackson. Campbell Biology. 9th ed. 2014. Illinois: Pearson Education
Inc. pp.
Specific Learning Outcomes 480-499.
At the end of the lesson, the learners will be able to: (3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
• identify the dates and sequence of the periods in the geologic time scale 419-439.
• identify the major events in each major period
Additional Resources listed at the End of this Lesson
• describe the characteristics of the major groups of organisms
present during a time period
• identify types of fossils and
• describe causes of mass extinctions
PRACTICE (50 MINS) Teacher Tip:
1. The learners are going to make fossils from a natural and man-made object. Making fossil is a fun way to get involved in
science. There are a lot of online sites to guide
2. There are two methods used to create fossils. you on how to create cheap replicas of fossils.
A. Imprint
The activity can be a little messy, so instruct the
I. Choose the object you want to make a fossil of. Any natural object (shells, leaves, learners to use newspapers or this can be done in
animal bone) will do as long as it fits in the container. If you choose leaves, be sure an open area.
it is not dry.
The following materials are needed for this activity.
II. Coat the object with petroleum jelly. This will keep the object from sticking to the 1. A small natural object (shell, bone, leaf)
plaster when you try to remove it. Coat it thoroughly. 2. Any small toy
III. Mix plaster and water in a bowl. Follow the directions on the plaster of Paris 3. Clay
4. Petroleum jelly
packaging. Mix them together thoroughly and let the concoction sit for a few 5. Plaster of Paris
minutes without stirring. You should need about 2x more water than plaster, but you 6. Disposable dish
can adjust the ratio as you see fit.
IV. Press the object into the plaster of Paris. Be careful not to push too hard! Now Teacher Tip:
your part is done; all it has to do is dry. Set it aside and check it the next day; drying Given that this can be messy, tell learners to
will take at least one day. work on top of old newspapers. Tell them not to
throw plastic of Paris in the sink or drainage in
V. Remove the object. After you've waited 24 hours, pop your natural item out of the order for them not to get clogged with the dried
plaster of Paris. It's just like a shell that was enveloped in soil for thousands of up materials. Provide a container for them to put
years. It was disintegrated and this image was left behind. all waste materials.

B. 3-D Object (Cast) It will take 1 - 2 days to completely dry and

I. Choose the object you want to make a fossil of. Any natural object (shells, leaves, harden the fossil model.
animal bone) will do as long as it fits in the container. If you choose leaves, be sure
Give incentives/ small tokens to those who
it is not dry. made the best fossils.
II. Combine the plaster of Paris with water. Use 1 part plaster of Paris to 2 parts water and
mix well in a paper cup with a plastic spoon. Let it sit while you work with the clay.
III. Choose an object as the template of your fossil. Generally, leaves, shells, branches, or
bones work best. Just make sure you have enough clay and plaster to cover it.
IV. Knead the modeling clay until it is soft and pliable. This will be what your object
rests and forms an impression in. It needs to be kneaded until it can cover the area
of your object.
V. Coat the object with petroleum jelly. Firmly yet slowly press it into the modeling clay to
64
 make an impression. The petroleum jelly prevents it from sticking to the clay, so be
generous. Remove the object carefully to create a mold in the shape of the item
you used.
VI. Fill the impression left by your object with plaster of Paris. Smooth the plaster to the
level of the clay to form a flat surface. Place your clay and plaster mold on a
newspaper, paper towel, or other disposable surface and allow it to harden. You'll
need to wait at least overnight, but 2 or 3 days is preferable and safer.
VII. Peel the clay off the hardened plaster to free the fossil. The shape of your
object should be recreated in the plaster, details intact.

WRAP UP (10 MINS)

1. Tell the learners to clean up and put all the output in one corner of the room for them to dry
up.
2. Tell them to label their works with masking tape.
General Biology 2 60 MINS

Lesson 8.5: History of Life on Earth

Content Standard
The learners demonstrate understanding of the major events in the history
of life on Earth. LESSON OUTLINE - DAY FIVE
Performance Standards Evaluation Summative Assessment 60
The learners shall be able to Materials
• create a personal timeline and compare it with the geologic time scale; Visual aids on the geologic time scale; 20 printed pictures of
and events/ structures/ organisms; computers and internet connection

• design a poster tracing evolutionary changes in a crop plant (e.g., rice
or corn) that occurred through domestication
Learning Competency
The learners describe general features of the history of life on Earth, including
generally accepted dates and sequence of the geologic time scale and
characteristics (STEM_BIO11/12-IIIc-g-8)
Specific Learning Outcomes
At the end of the lesson, the learners will be able to:
Resources
(1) Freeman, S. Biological Science. 3rd ed. 2008. California:
Pearson Benjamin Cummings. pp. 503-525.
(2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB
Jackson. Campbell Biology. 9th ed. 2014. Illinois: Pearson Education
Inc. pp.
480-499.
(3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
419-439.

• identify the dates and sequence of the periods in the geologic time scale; Additional Resources listed at the End of this Lesson
• identify the major events in each major period;
• describe the characteristics of the major groups of
organisms present during a time period;
• identify types of fossils; and
• describe causes of mass extinctions.

66
SUMMATIVE ASSESSMENT 3. The layers in sedimentary rocks are also called
1. Geologic Time Scale Practice A. eras
Go to this site and try the quiz. (There is no need to B. epochs
memorize the smaller divisions of the geologic time scale.) C. strata
http:// D. gaps
www.geosci.ipfw.edu/gildner/TimeScalePractice.html
(Downloaded 04/16/16) 4. The movie “Jurassic Park” got its title from which era?
A. Paleozoic
2. Geologic Time Scale Events B. Mesozoic
Go to this site and try the quiz. http://www.glencoe.com/qe/ C. Cenozoic
scienceOLC.php?qi=6024 (Downloaded 04/16/16) D. Holozoic

5. During which era were the first land plants formed?

3. Practice Quiz for the Nature of Fossils
A. Cambrian
Go to this site and try the quiz. http://anthro.palomar.edu/time/
B. Pre-Cambrian
quizzes/timquiz1.htm (Downloaded 04/16/16)
C. Paleozoic
D. Mesozoic
MULTIPLE CHOICE. Choose the letter of the correct answer.
1. The largest division of the geologic time scale is the 6. The era of middle life, a time of many changes on Earth
A. Eon A. Paleozoic
B. Mesozoic
B. Era
C. Cenozoic
C. Period
D. Holozoic
D. Epoch
7. What is the longest part of Earth’s history where trace fossils
2. The Mesozoic Era was the Age of Reptiles while the appeared.
current Cenozoic Era is the Age of A. Pre-Cambrian
A. Mammals B. Paloezoic
B. Birds C. Mesozoic
C. Humans D. Cenozoic
D. Technology
8. The geologic time scale is subdivided into 4 groups. List them TRUE OR FALSE. Write True if the statement is correct and False
from the largest to the smallest. if it is not.
A. Eons, periods, epochs, eras 1. Fossils give clues about the past.
B. Eras, eons, periods, epochs 2. Animals that are extinct are still alive today.
C. Epochs, periods, eras, eons 3. Scientists do not know for sure what happened to the dinosaurs.
D. Eons, eras, periods, epochs 4. A mold is a cast filled in with sediments.
5. Soft body parts cannot be fossilized.
9. The end of this era was believed to be caused by a comet or 6. Paleontology is the study of fossils.
asteroid colliding with Earth, causing a huge cloud of dust
7. A wooly mammoth’s footprint is a trace fossil.
and smoke to rise into the atmosphere, blocking out the sun.
8. Distinctive fossils used to determine the ages of rocks are
A. Paleozoic
called scale fossils.
B. Holozoic
9. Saber - toothed tiger is more likely preserved in amber.
C. Mesozoic
10. Fossils are most likely found in sedimentary rocks.
D. Cenozoic

10. Which geologic event occurred during the Mesozoic era?

A. Pangaea formed
B. Asteroids killed the dinosaurs
C. The Rocky Mountains formed
D. The Pleistocene Ice Age began

68
RESOURCES:
NOTES:
1. The Geologic Time Scale: http://www.uky.edu/KGS/education/geologictimescale.pdf (Retrieved 07/08/15)
2. What Is a Fossil: http://www.discoveringfossils.co.uk/whatisafossil.htm (Retrieved 04/16/16)
3. BBC- Fossils: http://www.bbc.co.uk/nature/fossils (Retrieved 04/16/16)
4. How Fossils Form: http://www.enchantedlearning.com/subjects/dinosaurs/dinofossils/Fossilhow.html
(Retrieved 04/16/16)

VIDEOS:
1. Evolution (1971 animation)- https://www.youtube.com/watch?v=T1_vnsdgxII (viewed 07/08/15)
2. Geologic Time Scale
3. The Geologic Time Scale: https://www.youtube.com/watch?v=r10oh1NHKv4&spfreload=10 (viewed 07/08/15)
4. The Geologic Time Scale: https://www.youtube.com/watch?v=nofyRleo3Vc (viewed 07/24/15)
5. Four Ways to Understand the Earth’s Age: https://www.youtube.com/watch?v=tkxWmh-tFGs&spfreload=10 (viewed 07/08/15)
6. The History of Earth: https://www.youtube.com/watch?v=RQm6N60bneo (viewed 07/08/15)

FURTHER: Advance learners can explore these sites beyond class.

1. Deep Time: A History of the Earth – Interactive Infographic: http://deeptime.info (viewed 07/09/15)
2. National Museum of Natural History – Geologic Time: http://www.nmnh.si.edu/paleo/geotime/index.htm (viewed 07/09/15)
3. Abiogenesis: https://www.youtube.com/watch?v=W3ceg--uQKM (viewed 07/08/15)
4. http://mitep.mtu.edu/include/documents/2013/presentations/What_is_the_Geologic_Time_Scale_DWagner.pdf
5. http://ed.ted.com/lessons/the-earth-s-age-in-measurements-you-can-understand-joshua-m-sneideman#review
6. http://www.stratigraphy.org/index.php/ics-chart-timescale
7. http://deeptime.info
8. http://www.nmnh.si.edu/paleo/geotime/index.htm
9. http://www.enchantedlearning.com/subjects/dinosaurs/dinofossils/Fossiltypes.html

Other possible sources of quiz items on fossils: (Downloaded 04/16/16)

1. https://mrssmiths4thportfolio.wikispaces.com/file/view/fossil+quiz.pdf
2. http://www.marcom.com.au/SGuides/ZZVECS/6VCSQS06.pdf
3. https://www.nps.gov/blca/learn/education/upload/fossils-2.pdf
4. http://www.biorules.org/Biology/articles/hist_life/Chap12PracTest.pdf
5. http://scioly.org/wiki/images/4/44/2015CT_FOSS1_TESTKEY.pdf
General Biology 2

SUPPLEMENTARY HANDOUTS
HANDOUT A

BODY SYSTEM DEBATE

In this project you and your group mates will research on a human
Your campaign must include the following:
body system. Organize a campaign for your body system, present
1. The name of your body system written clearly.
your campaign to the rest of the class, and debate whether or not
your body system is most essential to the survival of the human 2. A colored, life-size representation of your body system.
species. In doing this, you will become an “expert” on your body 3. A brief description of the overall function(s) of your
system as well as learn about the other body systems from our body system.
classroom “experts”. Once all campaigning and debating is 4. All organs/parts of your body system drawn on your
complete, each student will vote for the system that they feel is representation where they are found in nature and clearly
most essential to humans. labeled.
5. A complete description of the function of each organ/part.
The body system you will be campaigning for is the (check one): 6. A complete description of the importance of your body
• Digestive system to an individual and to the survival of humans
• Respiratory referencing information given in points 1-5.
• Reproductive
• Circulatory
Your Debate must include the following:
• Excretory
• Lymphatic 1. A review of the importance of your system to the individual
• Integumentary and the species.
• Nervous 2. Rebuttals to points made by each of the other systems.
• Skeletal 3. Closing arguments.
• Endocrine
• Muscular

246
 CAMPAIGN and DEBATE
RUBRIC

CAMPAIGN CAMPAIGN DEBATE

NAME OF BODY SYSTEM POINTS DESCRIPTION OF ORGAN OR REVIEW POINTS
PART FUNCTION
Written clearly, spelled correctly, Clearly stated, easy to understand 2
3
easy to see Accurate, clearly stated, easy to
6 Missing one criterion 1
understand
Missing one criterion 2
Missing one criterion 4 Absent 0
Missing two criteria 1
Missing two criteria 2 REBUTTAL
Absent 0
Not all organs and parts accounted for 1 Effectively refutes points made in all 15
LIFE SIZE REPRESENTATION other campaigns
Absent 0
Correct size, colored, neatly drawn 12 All other campaigns are refuted, but 10
CONCLUSION not all points
Missing one criterion 8
Clearly stated, easy to understand, All other campaigns are not refuted 5
Missing two criteria 4 9
evidence to back it up
Absent 0
Absent 0 Missing one criterion 6
CLOSING ARGUMENT
DESCRIPTION OF BODY SYSTEM FUNCTION Missing two criteria 3
Clearly stated, easy to understand, 3
Accurate, clearly stated, easy to Absent 0 evidence to back it up
6
understand
Missing one criterion 2
Missing one criterion 4
Missing two criteria 1
Missing two criteria 2
Absent 0
Absent 0

PLACEMENT AND LABELLING OF

ORGANS AND PARTS

All organs and parts are accurately

4
placed and labeled

Either not labeled or placed correctly 3

Not all organs and parts accounted for 2

Absent 0
 BALLOT ESSAY RUBRIC

QUESTION: WHY IS THERE NOT ONE SYSTEM

WHICH BODY SYSTEM IS MOST ESSENTIAL
THAT IS MOST ESSENTIAL TO SURVIVAL OF
TO THE SURVIVAL OF THE HUMAN SPECIES?
THE HUMAN SPECIES?

Nervous System Substandard

Student shows only a surface level understanding of why there is
Integumentary System no one system that is most essential to the survival of the species,
Skeletal System and cannot cite examples of this in practice or effectively refute
arguments to the contrary.
Muscular System
Adequate
Circulatory System Student shows clear but not deep understanding of why there is no
Respiratory System one system that is most essential to the survival of the species,
cites examples of this in practice, but cannot effectively refute
Digestive System arguments to the contrary.

Excretory System Proficient

Student shows clear and deep understanding of why there is no one
Endocrine System
system that is most essential to the survival of the species, cites
Reproductive System examples of this in practice, but cannot effectively refute arguments
to the contrary.
Lymphatic System
Exemplary
Student shows clear and deep understanding of why there is no one
system that is most essential to the survival of the species, cites
examples of this in practice, and effectively refutes arguments to the
contrary.

248
General Biology 2 - Colored Images

Lesson 2: Sex Linkage Lesson 3: Modification

Lesson 5: DNA Replication and Protein Synthesis
and Recombination to Mendel’s Classic
Ratios Page 26, 27, and 28
Page 10
Page 18
Lesson 5: DNA Replication and
Protein Synthesis, Page 28

250
Lesson 17.1: Compare and Contrast Process in Plants and Animals: Reproduction and
Development Pages 141, 142, and 143
 Lesson 17.1: Reproduction and
Lesson 17.2: Reproduction and Development / Pages 150, 151, 152, and 153
Development / Pages 143 and 145
252
Lesson 17.2: Reproduction and Development
Pages 153, 154, and 155
 Lesson 19: Gas Exchange / Page 184 Lesson 23: Chemical and Nervous Control / Page 217

Lesson 23: Chemical and Nervous Control /

Page 218

254
Lesson 23: Chemical and Nervous Control / Page 216
Lesson 17: Introduction to Reproduction / Page 138

Lesson 25: Feedback Mechanisms / Pages 240 and 241

256
Biographical Notes
IVAN MARCELO A. DUKA
Team Leader
Prof. Ivan Marcelo A. Duka is an Associate Professor 5 and the
College Secretary of the College of Arts and Sciences at the
University of the Philippines Los Banos. He has been teaching at
the university various courses, such as Biology 1 and 2,
Molecular Biology, Evolutionary Biology, Cell Biology and
Genetics for 40 years.
He finished his Master of Science in Genetics from the University
of the Philippines Los Banos, and his Bachelor’s Degree in
Biology, major in Zoology, in the same university. He also
earned a Cell Biology Apprentice Degree from the University of
Wales College of Cardiff, United Kingdom. He received
numerous grants and fellowships, such as the AIDAB Fellowship
Award in Sydney, Australia; and the British Council Fellowship to
the University of Wales. He also wrote various papers, articles,
books, laboratory manuals, and other teaching materials
focusing on Biotechnology, Molecular Biology, Immunology,
Recombinant DNA Techniques, Physiology, and Genetic
Engineering.
Prof. Duka is also a Board Member of the Philippine Society for
Biochemistry and Molecular Biology, a Subject Matter Specialist
of the Learning Resource Centre for Biology Tutorials and
Biology Summer Bridge Course, and a member of the UPLB
University Council. He is also primarily responsible for assisting
incoming university instructors by providing them necessary
mentorship in classroom management and curriculum
development.
NEIL ANDREW B. BASCOS, PH.D.
Writer
Dr. Bascos is an Associate Professor 7 at the National Institute of
Molecular Biology and Biotechnology at the University of the
Philippines Diliman. He earned his doctorate degree in Molecular
and Cellular Biology from Tulane University, New Orleans; and
his bachelor’s degree in Molecular Biology and Biotechnology
from the University of the Philippines Diliman. He is also a
Principal Investigator at the Protein Structure and Immunology
Laboratory at the National Institute of Molecular Biology and
Biotechnology, UP Diliman. He is a member of the Technical
Panel on Biology and Molecular Biology at the Commission on
Higher Education, and also became the Deputy Director for
Facilities and Services at the National Institute of Molecular
Biology and Biotechnology, University of the Philippines Diliman.
MA. GENALEEN Q. DIAZ, PH.D.
Writer
Dr. Genaleen Diaz is Professor IV at the University of the
Philippines Los Banos where she has been teaching
undergraduate and graduate subjects for 27 years. She is
currently the Head of Genetics and Molecular Biology Division of
the Institute of Biological Sciences. Dr. Diaz earned her
doctorate degree in Genetics at the UPLB. She also completed
her master’s degree in Genetics and her bachelor’s degree in
Biology at the same university. Dr. Diaz is a member of the
National Research Council of the Philippines and the
Outstanding Young Scientists, Inc. Her scholarly works were
included in publications such as the Philippine Journal of
Philippine Science and Technology, Journal of Genetics, and
UPLB’s Genetics Laboratory Manual.
MA. CARMINA C MANUEL, PH.D.
Writer
Dr. Carmina Manuel is Assistant Professor V at the University of
the Philippines Los Banos where she teaches subjects spanning
molecular genetics, human genetics, and evolutionary biology.
Dr Manuel is recipient of the IBS Outstanding Teacher Award for
3 consecutive years since 2013. She has also presented her
authored research papers in Science conferences around the
country. Dr. Manuel finished her doctorate degree in Genetics at
the UPLB. She earned her master’s degree in Genetics and her
bachelor’s degree (cum laude) also in UPLB.
SHARON ROSE M. TABUGO, PH.D.
Writer
Dr. Sharon Rose is Assistant Professor IV at the Mindanao State
University - Iligan Institute of Technology where she has been
teaching for 6 years. Her academic papers and researches were
published in a number of ISI-indexed and international journals
such as the International Research Journal of Biological
Sciences, the European Journal of Zoological Research, the
Australian Journal of Biological Sciences, and the Global Journal
of Medicinal Plant Research. Dr. Tabugo earned her doctorate
degree in Biology at the MSU-IIT. She received her master’s
degree in Biology as a DOST scholar also in MSU-IIT and she
graduated cum laude with a bachelor’s degree in Biology at the
same university.
258
IAN KENDRICH C. FONTANILLA, PH.D.
Writer
Dr. Ian Fontanilla has been teaching at the University of the
Philippines Diliman for 20 years, where he is currently Assistant
Professor. His researches are found in scholarly publications,
including the Philippine Journal of Science, Asia Life Sciences,
and the Zoological Journal of the Linnean Society. Dr. Fontanilla
has presented academic papers in international conferences in
the Philippines, Portugal, Brazil, Belgium, London, and
Australia. He is a member of professional societies such as
Unitas Malacologia and the Philippine Environmental Mutagen
Society among others. Dr. Fontanilla completed his doctorate in
Genetics at the University of Nottingham, while he earned his
master’s and bachelor’s degrees in Biology at UP Diliman.
EUGENIO P. QUIJANO, JR.
Writer
Mr. Eugenio Quijano, Jr. has been teaching science for 25 years
now. He is currently a Biology and General Science teacher at
the Xavier School and also a student Trainer in science
competitions. Prior to teaching, he has worked as a Researcher
for the DOST and DepEd. Mr Quijano is a member of the Biology
Teachers Association of the Philippines and the Greenpeace
Organization. He is currently finishing his master’s degree in
Biological Sciences at the University of Santo Tomas. He finished
his Certification Program in Education at the University of the
Philippines Diliman, and earned his bachelor’s degree in Biology
at the UST.
ANNALEE S. HADSALL
Technical Editor
Prof. Annalee S. Hadsall is an Assistant Professor 7 at the
Institute of Biological Sciences, College of Arts and Sciences,
University of the Philippines Los Banos. She earned her
bachelor’s degree in Biology, Cum Laude, from the Philippine
Normal College. She finished her Master of Science degree in
Botany, Major in Plant Systematics, and a Minor degree in
Horticulture at the University of the Philippines Los Banos,
under the UP-NSDB Graduate Manpower Scholarship Program.
She is also the curator for orchids and epiphytes at the UPLB
Museum of Natural History. Her research interests include
morpho-anatomical diversity of indigenous Philippine orchids,
biodiversity studies of Mt. Isarog, and phytogeographical
patterns of epiphytes. With her work in botany studies, she was
able to describe three new plant species, and has written
laboratory exercises in biodiversity and general botany. She also
a writer in Distance Education Modules for the Diploma in
Science Teaching of UP Open University.
Besides being prolific in her academic publications, she was also
tapped by the Department of Education to evaluate teaching
materials and general references in elementary Science. She
became a trainer for Grades 8, 9, and 10 Science. She is actively
involved in training teachers, especially in biodiversity and plant
systematics.
CAROLINE PAJARON
Writer
Caroline Hernandez Pajaron is a communication specialist and
journalist. She has 13 years of experience in content
development, production, and management with different
agencies such as Globe Telecommunications, and Asian
Development Bank . She is currently Information and Advocacy
Officer of the Civil Society Coalition on the Convention on the
Rights of the Child. Ms. Pajaron received her master’s degree in
Journalism from the Ateneo de Manila University through a
Konrad Adenauer Center for Journalism grant. She graduated
from the Ateneo as a Father Nicholas Kulny scholar with degrees
in English Literature and Communication. She is finishing her
doctorate degree in Public Administration at the University of
the Philippines.
MA. DANIELA LOUISE F. BORRERO
Illustrator
Ms. Daniela Borrero is a visual artist, photographer, writer, and
teacher. She is the Founder and Chief Operating Officer of the
D11B Graphic Design Studio. She has also worked as Human
Resource Officer in a Law Office. Ms. Borrero’s works were part
in exhibits such as The Heist Conference and Analog Signals
in Nova Gallery, and Maximum Purity in Prose Gallery. She
graduated her bachelor’s degree in Home Economics and
Elementary Education at the University of the Philippines Diliman.