U4'D5671K9

JOURNAL OF BACTERIOLOGY, Aug. 1994, p. 4845-4850 Vol. 176, No. 16

0021-9193/94/$04.00+0
Copyright © 1994, American Society for Microbiology

Identification of Amino Acid Residues in Streptococcus mutans

Glucosyltransferases Influencing the Structure
of the Glucan Product
ATSUNARI SHIMAMURA,1 YOSHIO J. NAKANO,1t HIDEHIKO MUKASA,2 AND HOWARD K. KURAMITSUl*
Department of Oral Biology, State University of New York, Buffalo, New York 142141 and
Department of Chemistry, National Defense Medical College, Saitama 359, Japan2
Received 2 February 1994/Accepted 2 June 1994

The glucosyltransferases (GTFs) of mutans streptococci are important virulence factors in the sucrose-

Downloaded from http://jb.asm.org/ on January 26, 2019 by guest

dependent colonization of tooth surfaces by these organisms. To investigate the structure-function relationship
of the GTFs, an approach was initiated to identify amino acid residues of the GTFs which affect the
incorporation of glucose residues into the glucan polymer. Conserved amino acid residues were identified in the
GTF-S and GTF-I enzymes of the mutans streptococci and were selected for site-directed mutagenesis in the
corresponding enzymes from Streptococcus mutans GS5. Conversion of six amino acid residues of the GTF-I
enzyme to those present at the corresponding positions in GTF-S, either singly or in multiple combinations,
resulted in enzymes synthesizing increased levels of soluble glucans. The enzyme containing six alterations
synthesized 73% water-soluble glucan in the absence of acceptor dextran T1O, while parental enzyme GTF-I
synthesized no such glucan product. Conversely, when residue 589 of the GTF-S enzyme was converted from
Thr to either Asp or Glu, the resulting enzyme synthesized primarily water-insoluble glucan in the absence of
the acceptor. Therefore, this approach has identified several amino acid positions which influence the nature
of the glucan product synthesized by GTFs.

Streptococcus mutans strains have been implicated as the residue within the peptides covalently binds sucrose (17).
primary etiological agents in the development of human dental Site-directed mutagenesis of the corresponding Asp residue in
caries (16). Colonization of teeth by these microorganisms is the GTF-I enzyme of S. mutans GS5 completely inactivated the
enhanced in the presence of dietary sucrose. This results from enzyme (12, 13). Moreover, construction of various hybrid
the formation of water-insoluble glucose polymers (glucans)
from sucrose by these organisms and is catalyzed by extracel-
lular glucosyltransferases (GTFs). Two types of GTFs from S.
mutans and other oral streptococci have been isolated and
characterized: GTF-I, synthesizing primarily water-insoluble
a-1,3-linked glucan (IG), and GTF-S, forming soluble a-1,6-
linked glucose polymers (SG). Both biochemical and genetic
analyses have indicated that S. mutans strains express three
distinct GTFs (2, 8-10, 24, 25): two enzymes involved in
insoluble glucan synthesis, GTF-I and GTF-SI, and one en-
zyme catalyzing the formation of soluble glucans, GTF-S. In
addition, the activity of the latter enzyme is dependent upon
the presence of exogenous glucan acceptors while the former
enzymes are acceptor independent. Recent in vivo experiments
have indicated that all three enzymes are required for maximal
cariogenesis in animal model systems (26).
Comparisons of the amino acid sequences of GTFs isolated
from various oral streptococci have revealed a high degree of
similarity between the enzymes (1, 4-6, 7, 10, 24, 25). For
example, the GTF-I and GTF-S enzymes from S. mutans GS5 B DS7lK K1O04T
(containing 1,475 and 1,431 amino acids, respectively) have
52% sequence identity. In addition, several approaches have :iHLmihM
SeeR! I 5**
I
revealed that these enzymes are composed of two functional HIE-l _~J
am-1 _~ _
aI

_
c

M-
domains: the amino-terminal catalytic domain binding and G_
PA I .ON
hydrolyzing the substrate sucrose and a carboxyl-terminal Sm!I .
HL dM
gII
XD I Him dil
sea. I
domain involved in acceptor glucan binding (3, 17, 20). Mooser ow-s
et al. have isolated an active-site peptide from the GTF-I and 444-,.
GTF-S enzymes of S. sobrinus and demonstrated that an Asp TST9D,T589E
N471D
FIG. 1. Structures of plasmids used for site-directed mutagenesis
*
Corresponding author. (A) and restriction maps of gtfB and gtJD with the replacement
t Present address: Department of Preventive Dentistry, Kyushu positions of the mutated amino acids (B). The arrows under the bars
University School of Dentistry, Fukuoka 812, Japan. in panel B denote the direct repeating units.
4845
4846 SHIMAMURA ET AL. J. BAC-1ERIOL.

TABLE 1. Oligonucleotides used for site-directed mutagenesis

Mutation Gene (upper) and oligonucleotide (lower) sequences" Restriction site
GTF-I I448V AsnPheAspSerIleArgValAsp
AACTTTGATTCCATTCGTGTTGATGC
AACTTTGATTCC0T&CGTGTTGATGC BsiWI
Val

GTF-I D457N ValAspAsnValAspAlaAspLeuLeu

GGTAGATAATGTGGATGCTGACTTGCTC
GGTAGATAATGTZ&ACGCTGACTTGCTC HpaI
Asn

GTF-I D567T SerGluValGlnAspLeuIleAlaAspIle

AGTGAAGTGCAGGATTTGATTGCTGATATC
AGTGAAGTGCAGAC&TTAAZTGCTGATATC AseI
Thr

Downloaded from http://jb.asm.org/ on January 26, 2019 by guest

GTF-I D571K AspLeuIleAlaAspIleIleLysAla
GATTTGATTGCTGATATCATCAAGGCA EcoRV
GATTTGATTGCTMAAATCATCAAGGCA
Lys

GTF-I D567T:D571K SerGluValGlnAspLeuIleAlaAspIleIleLeuAla

AGTGAAGTGCAGGATTTGATTGCTGATATCATCAAGGCA EcoRV
AGTGAAGTGCAGACTTTGATTGCTA AATCATCAAGGCA
Thr Lys

GTF-I K779Q AlaAlaAspIleLysGlyTyrAla

CAGCGGCTGATATTAAAGGCTATGCCA
CAGCGGCTGATATCCAAGGCTATGCCA EcoRV
Gln

GTF-I K1014T SerValLysIleLysGlnThrrpSerALys

TTCTGTTAAGATTAAGCAATGGTCTGCCAAG
TTCTGTTAAGATaACGCA0TGGTCTGCCAAG DraIII
Thr

GTF-S N471D ValAspAsnValAsnAlaAspLeuLeuGln

GTTGATAATGTTAATGCCGACTTGCTGCAG
GTTGATAATGTTOArGCCGACTTGCTGCAG BsaHI
Asp

GTF-S T589D SerGluValGlnThrValIleAlaLysIleIle

AGTGAAGTCCAAACGGTTATTGCTAAAATTATT
AGTGAAGTCCAA9&GTATTGCTAAAATTATT BsaHI
Asp

GTF-S T589E SerGluValGlnThrValIleAlaLys

CAGTGAAGTCCAAACGGTTATTGCTAAA
CAGTGAAGTCCAgOAGGTTATTGCTAAA BstNI
Glu

a Substituted nucleotides are underlined. Parental amino acid sequences are indicated above the corresponding nucleotide sequences. Altered amino acid residues
are shown under the sequences of oligonucleotides. Altered restriction sites are in boldface.

fusion GTFs suggested that the glucan-binding domain plays
an important, but not exclusive, role in determining the nature
of the glucan product synthesized by GTFs (20). However,
identification of GTE subdomains involved in regulating the
incorporation of glucose residues as either a-1,3- or a-1,6-
linked residues into the glucan products has not been accom-
plished.
The present communication describes an initial investiga-
tion into the structure-function relationship of GTFs. We
describe the alteration of specific amino acid residues in the
GTF-S and GTF-I enzymes of S. mutans GS5 following
site-directed mutagenesis of the corresponding gtfB and gtJD
genes which significantly alters the nature of the glucan
products produced.
MATERIALS AND METHODS
Bacteria and plasmids. Escherichia coli HB101 (21), JM109
(27), BW313, and BMH 71-18 mutS (Mutan-K Kit; Takara
Shozu, Kyoto, Japan) were used for site-directed mutagenesis.
Plasmids pTSU5, pCK28 (Fig. 1) (4), pYND7, pMCL20, and
pMCL18 (6) were utilized in previous investigations in this
laboratory. Plasmid pYND72 (Fig. 1) was prepared as follows.
An XbaI fragment from pYND7 was subcloned into XbaI-
cleaved pMCL20. Subsequently, an AvaIl-SacI fragment con-
taining the gtJD gene but lacking its own promoter and
Shine-Dalgarno sequence was introduced into the HincII-SacI
sites of pMCL18, resulting in expression of the gtfD gene from
the promoter and Shine-Dalgarno sequence of the vector.
VOL. 176, 1994 S. MUTANS GTFs 4847

I containing ampicillin (50 jig/ml) for gtfB mutants or chloram-

phenicol (25 jig/ml) for gtfD alterations. The cells were har-
vested by centrifugation, suspended in 1 ml of 0.1 M sodium
a. 462 DANFDGIRVDAVDNVDADMLQL 483 acetate buffer (pH 6.5), and sonicated (20). The supernatant of
b. 444 DANFDSIRVDAVDNVDADLLQI 465 the lysate was used as the source of mutant enzymes.
c. 442 DANFDSIRVDAVDNVDADLLQI 463 Enzyme activity assays. Enzyme activity for IG and SG
syntheses was measured as previously described (15), by using
d. 456 EANFDGVRVDAVDNVNADMLQI 477 [U-14C]sucrose as the substrate. The Km values of the enzymes
e. 428 DANFDGVRVDAVDNVNADMLQI 449 for sucrose were determined by measuring enzyme activity in
the presence of 0.58 to 8.7 mM sucrose following incubation
* **** ** * **
for 3 h. Each extract was assayed at least twice.
Linkage analysis. The glucans were synthesized by the
a. 607 FIRAHDNNVQDIIAEIIKKEI 627 GTF-S T589E mutant from 1.5 g of sucrose at 370C for 6 h in
b. 559 FARAHDSEVQDLIRDIIKAEI 580 a 30-ml reaction mixture containing 0.1 M acetate buffer (pH
c. 557 FIRAHDSEVQDLIADIIKKEI 578 6.5) in the absence or presence of 10 mg of dextran T10. IG
was collected by centrifugation, and SG was precipitated with

Downloaded from http://jb.asm.org/ on January 26, 2019 by guest

d. 579 FIRAHDSEVQTVIAKIIKKQI 599
75% ethanol. The glucans were dissolved in 0.5 M NaOH and
e. 542 FIRAHDSEVQTRIAKIIREKL 562 analyzed by 13C nuclear magnetic resonance (NMR) spectro-
photometry (23).
* * * **

a. 836 GVLTFGANDIKGYETFDMSGFV 857 RESULTS AND DISCUSSION

b. 772 GYLYFLNDDLKGVANPQVSGFL 793 Site-directed mutagenesis strategy. Comparison of the
c. 769 GELIFTAADIKGYANPQVSGYL 790 amino acid sequences of GTFs from oral streptococci synthe-
d. 800 GELVFDASDIQGYLNPQVSGYL 821
sizing primarily SG (S. mutans GS5 GTF-S and S. downei
GTF-S [6]) or IG (S. mutans GTF-I, S. salivarius GTF-I [5],
e. 755 GNLSFSQSELQSVANAQVSGMI 776 and S. downei GTF-I [3]) revealed several positions that
appear to be conserved for each group of enzymes (Fig. 2). For
*** * * * **** * * example, the enzymes synthesizing IG contain an Asp residue
a. 1078 IDDSVKLKQWKAEYFNGTNVL 1098
at position 457 (S. mutans gtfB sequence) while those involved
in SG formation contain Asn at the corresponding position.
b. 1011 IDPSVKIKQWSAKYFNGSNIL 1031
Such an analysis revealed six conserved positions in the GTF-I
c. 1007 MDPSVKIKQWSAKYFNGTNIL 1027 enzyme from S. mutans GS5 and two sites in GTF-S which
d. 1039 IDPSEKITAWKAKYFNGTNIL 1059
were selected for site-directed mutagenesis (Fig. 1B). The six
e. 993 IDPSVKITNWSAKYFNGSNIL 1013
amino acids of GTF-I encoded by the gtfB gene were converted
to the corresponding amino acids of GTF-S individually, as
FIG. 2. Comparison of amino acid sequences in the regions chosen well as in multiple combinations, and assayed for SG- and
for site-directed mutagenesis of the S. mutans gtf genes. Lines a to e are IG-synthetic activities. Likewise, two positions in the GTF-S
the sequences deduced from S. salivarius ATCC 25985 gtfy, S. downei enzyme, 471 and 589, were converted to amino acids observed
MFe28 gtfl, S. mutans GS5 gtfB, S. mutans GS5 gtfD, and S. downei at the corresponding positions in the GTF-I enzyme and
MFe28 gtJS, respectively. Mutagenesis was carried out on the double- assayed for GTF activity.
underlined amino acids. The numbers represent positions from the N
termini of the enzymes. Asterisks show residues identical among the
Mutagenesis of GTF-I. In the absence of acceptor dextran
five sequences. The arrow represents the aspartic acid residue of the T10, the D457N, D567T, D571K, and K1014T mutants of
sucrose-binding site. GTF-I synthesized 37, 24, 18, and 14% SG, respectively (Table
2) while GTF-I and both the 1448V and K779Q mutants
synthesized negligible amounts of the water-soluble product.
The enzymes containing two or three of these mutations
Site-directed mutagenesis. Mutation of the gtfB gene was synthesized 28 to 38% SG. Although the mutant containing the
carried out by the method of Kunkel (14). Briefly, plasmid D457N:D567T:D571K:K1014T alterations synthesized only
pCK28 was introduced into E. coli BW313, infected with 10% SG in the absence of acceptor dextran T10, additional
helper phage M13K07, annealed with synthetic oligonucleo- introduction of the K779Q mutation yielded 23% SG and the
tides (Table 1), treated with T4 DNA polymerase and T4 subsequent 1448V mutation resulted in 73% SG synthetic
ligase, and introduced into E. coli BMH 71-18 mutS. The activity. These results indicated that individual substitutions of
resulting plasmids were transformed into E. coli HB101. The three Asp residues at position 457, 567, or 571 with neutral or
gtJD gene from pYND72 was mutated by mutagenesis of basic amino acids resulted in enzymes with enhanced SG-
double-stranded plasmid DNA (11) and expressed in E. coli synthetic activity in the absence of acceptor glucans. The
JM109. The choice of mutagenic oligonucleotide sequences mutated GTF-I containing all three substitutions synthesized
was based on the generation or elimination of restriction sites more SG (73% of total glucan [TG]) only when three addi-
(Table 1) which were used to confirm the construction of the tional sites were converted to amino acids found at corre-
selected mutations. Multiple mutations in each gene were sponding positions in the GTF-S enzyme (GTF-I mutant
produced by sequential mutation by using the appropriate I448V:D457N:D567T:D571K:K779Q:K1l14T).
mutagenic primer. In addition, nucleotide sequencing of some In the presence of dextran T10, the GTF-I enzyme synthe-
of the mutants (GTF-I single mutations and GTF-S T589E) sized a small amount (13%) of SG (Table 2). The 1448V,
was carried out to further confirm the mutations (22). D457N, D571K, and K1014T mutants alone synthesized 25 to
Preparation of mutant GTFs. E. coli containing the mutated 60% SG, which was two to four times higher than the level
gtf8 or gtfD gene was cultured in 50 ml of Luria-Bertani (LB) obtained with GTF-I enzyme. However, the D567T and
4848 SHIMAMURA ET AL. J. BACTERIOL.

TABLE 2. Soluble and insoluble glucan-synthetic activities of original and mutant GTFs of S. mutans GS5
Glucan-synthetic activity' (cpm) Stimulation'
Glucosyltransferase Without dextran T10 With dextran T10 by dextran
SG IG TG SG IG TG (fold)
GTF-I pTSU5 0(0) 8,950 (100) 8,950 1,380 (13) 9,120 (87) 10,500 1.2
GTF-I 1448V 0 (0) 9,170 (100) 9,170 2,690 (25) 8,160 (75) 10,850 1.2
GTF-I D457N 2,490 (37) 4,250 (63) 6,740 2,780 (26) 7,870 (74) 10,650 1.6
GTF-I D567T 2,080 (24) 6,760 (76) 8,840 1,880 (18) 8,500 (82) 10,380 1.2
GTF-I D571K 1,500 (18) 6,990 (82) 8,490 2,590 (25) 7,900 (75) 10,490 1.2
GTF-I K779Q 160 (3) 5,320 (97) 5,480 1,510 (18) 6,930 (82) 8,440 1.5
GTF-I K1014T 730 (14) 4,350 (86) 5,080 6,400 (60) 4,350 (40) 10,750 2.1
GTF-I 1448V:D457N 2,560 (33) 5,280 (67) 7,840 2,930 (24) 9,030 (76) 11,960 1.5
GTF-I D457N:D567T 1,900 (30) 4,340 (70) 6,240 3,070 (29) 7,450 (71) 10,520 1.7
GTF-I D457N:D571K 2,890 (28) 7,430 (72) 10,320 4,170 (34) 8,170 (66) 12,340 1.2
GTF-I D567T:D571K 3,250 (41) 4,700 (59) 7,950 4,810 (48) 5,240 (52) 10,050 1.3

Downloaded from http://jb.asm.org/ on January 26, 2019 by guest

GTF-I D567T:D571K:K1l14T 2,290 (38) 3,780 (62) 6,070 3,870 (42) 5,450 (58) 9,320 1.5
GTF-I D457N:D567T:D571K:K1014T 220 (10) 1,890 (90) 2,110 1,670 (25) 4,940 (75) 6,610 3.1
GTF-I 1448V:D457N:D567T:D571K: 100 (4) 2,410 (96) 2,510 1,180 (21) 4,530 (79) 5,710 2.3
K1014T
GTF-I D457N:D567T:D571K:K779Q: 570 (23) 1,910 (77) 2,480 1,960 (30) 4,510 (70) 6,470 2.6
K1014T
GTF-I I448V:D457N:D567T:D571K: 4,540 (73) 1,650 (27) 6,190 7,720 (51) 7,330 (49) 15,050 2.4
K779Q:K114T
GTF-S pYND72 840(86) 140(14) 980 7,480 (99) 90 (1) 10,500 7.7
GTF-S N471D 3,190 (62) 1,990 (38) 5,180 11,080 (99) 60 (1) 11,140 2.2
GTF-S T589D 180 (15) 1,000 (85) 1,180 9,400 (99) 100 (1) 9,500 8.1
GTF-S T589E 30 (2) 1,510 (98) 1,540 12,080 (99) 70 (1) 12,150 7.9
GTF-S N471D:T589D 5,440 (69) 2,440 (31) 7,880 12,260 (99) 160 (1) 12,420 1.6
GTF-S N471D:T589E 3,330 (53) 2,970 (47) 6,300 13,340 (99) 70 (1) 13,410 2.1
a The activities are shown for SG, IG, and TG synthesized from [U-14C]sucrose. The values in parentheses represent the percentages of SG or IG in the reactions.
b Stimulation is expressed as the ratio of TG in the presence and absence of dextran T10.

K779Q mutants did not synthesize significantly more SG than
GTF-I. The latter two mutations resulted in higher dextran
T10-dependent SG-synthetic activity only in combination with
other mutations. For example, the D567T:D571K mutant
synthesized 48% SG in the presence of dextran T10. Likewise,
the I448V:D457N:D567T:D571K:K779Q:K1O14T mutant syn-
thesized 51% SG although the I448V:D457N:D567T:D571K:
K1014T mutant synthesized 21% of the water-soluble product
in the presence of the acceptor. Therefore, substitutions at
several conserved positions in the GTF-I enzyme (residues
457, 567, 571, and 1014) increased the capacity of the resultant
enzyme to synthesized SG. Furthermore, conversion of six
amino acids in GTF-I to the corresponding residues present in
GTF-S yielded an enzyme synthesizing primarily SG in the
absence of acceptor dextran T10 and equal amounts of IG and
SG in the presence of the acceptor. This altered GTF-I still
synthesized IG but at reduced levels relative to those produced
by unaltered GTF-I.
Mutagenesis of GTF-S. Since conversion of the Asp residues
at positions 457 and 567 of GTF-I to amino acids present at
corresponding positions in GTF-S resulted in mutated en-
zymes synthesizing increased levels of SG relative to GTF-I
(Table 2), these residues in GTF-S encoded by gif) were
selected for mutation. The change of Asn-471 to Asp resulted
in a mutant enzyme synthesizing a higher percentage of IG
than GTF-S (37 versus 14%). More dramatically, the conver-
sion of Thr to Asp at position 589 of GTF-S yielded an enzyme
synthesizing 85% IG in the absence of acceptor dextran T10.
Likewise, conversion of Thr to Glu at this position resulted in
a GTF-S mutant synthesizing 98% IG in the absence of
acceptor dextran T10. However, introduction of mutations into
GTF-S at both positions 471 and 589 yielded a mutant which
synthesized lower levels of IG than single mutants T589D and
T589E did. In the presence of dextran T10, however, all of the
mutants synthesized primarily SG, as did GTF-S. These obser-
vations are similar to previous results indicating that addition
of dextran T10 to GTF-I leads to increased soluble-glucan
synthesis (2). The activities of the T589D and T589E mutants
were stimulated 8-fold by dextran T10, which was almost the
same as that of GTF-S, while the stimulation of the double
mutants was reduced to 1.6- to 2.1-fold. The T589D and T589E
mutants of GTF-S synthesized predominantly IG in the ab-
sence of dextran T10, while they failed to synthesized IG in the
presence of dextran T10. This suggests that the presence of an
acidic amino acid at this position greatly influences the nature
of the glucan product but is not sufficient in itself to convert the
enzyme completely to one exhibiting GTF-I activity in the
presence or absence of dextran T10.
Effect of mutagenesis on Km values. To determine if some of
the mutations which significantly altered the nature of the
glucan products affect the substrate binding of the GTFs, the
Km values of the original and mutant GTF-I and GTF-S
enzymes for sucrose were determined in the absence and
presence of acceptor dextran T10. The Km values of GTF-I and
its mutant I448V:D457N:D567T:D571K:K779Q:K1O14T for
sucrose were similar (0.7 and 1.6 mM, respectively, for TG
synthesis) in the absence or presence of the acceptor. Likewise,
the Km values of GTF-S and its mutant T589E were similar in
the absence or presence of dextran T10 (1.6 and 5.0 mM,
respectively). These results suggested that the binding abilities
of GTF-I and GTF-S for substrate sucrose were not drastically
altered by the mutations.
Linkage analysis. To determine if the IG synthesized by the
T589E GTF-S mutant resembles the insoluble product synthe-
sized by GTF-I, the glucose linkages of the glucan products
synthesized by the GTE-S T589E mutant were analyzed by 13C
VOL. 176, 1994
TABLE 3. Linkage analyses of a-D-glucans synthesized by the
GTF-S T589E mutant in the absence or presence of dextran T10
Concn (mol%) glucose residue
Enzyme Dextrana Glucan with the following a linkage:
1,3 1,6 1,3,6
GTF-S T589E - Soluble 4.3 65.8 13.7
Insoluble 38.1 33.6 10.9
+ Soluble 8.2 44.1 23.1
Insoluble 31.0 37.8 10.0
GTF-Sb - Soluble 0 70.3 15.1
GTF-IC _ Insoluble 76.0 24.0 NDd
a The enzymes were reacted in the absence (-) or presence (+) of 10 mg of
dextran T10.
b The data shown from reference 18 for the enzyme from S. mutans Ingbritt.
cThe data shown are from reference 19 for the enzyme from S. mutans
Ingbritt.
d ND, not detected.
NMR spectrophotometry (Table 3). The SG synthesized in the
absence and presence of acceptor dextran T10 were primarily
(1--6)-a-D-glucans with 4 to 8% 1,3-linked and 13 to 23%
1,3,6-branched glucose. The mutant synthesized IG which
contained 38 and 31% 1,3-linked glucose in the absence and
presence of dextran T10, respectively, as well as 11 and 10%
1,3,6-branched glucose, respectively. By comparison, the SG
synthesized by purified GTF-S from S. mutans Ingbritt was
mainly (1--*6)-0c-D-glucan with 15% 1,3,6-branched glucose
and no 1,3-linked glucose (18). The IG of GTF-I from the
same organism was 76% (1->3)-a-D-glucan with 24% 1,6-
linked glucose and no 1,3,6-branched glucose (19). Therefore,
the GTF-S T589E mutant synthesized a novel IG with lower
levels of a-1,3 glucose linkages than those of the insoluble
product synthesized by GTF-I.
Summary. This study demonstrated the effects of site-
directed mutagenesis of selected amino acid residues on the
structure of the glucans synthesized by S. mutans GTFs. The
presence of an acidic amino acid residue at position 567 of
GTF-I (equivalent to reside 589 of the GTF-S enzyme) re-
sulted in an enzyme synthesizing low levels of SG in the
absence of dextran T10. Conversely, the presence of a neutral
amino acid at this position in either GTF-I or GTF-S results in
an enzyme synthesizing primarily SG. Thus, conversion of Thr
to Asp or Glu at this position in GTF-S is sufficient to yield an
enzyme synthesizing primarily IG in the absence of the accep-
tor. Several other amino acid changes in both enzymes also
altered the nature of the glucan product but not to the same
extent as the changes at the position equivalent to residue 589
of GTF-S.
Conversion of multiple amino acid residues of GTF-I to the
corresponding amino acids found in GTF-S resulted in en-
zymes with increased GTF-S-like properties; i.e., the enzyme
containing six such changes synthesized primarily SG. How-
ever, this enzyme still synthesized significant levels of IG. Thus,
additional residues are involved in the differential properties of
GTF-S relative to GTF-I. Nevertheless, it is interesting that
such changes can be demonstrated by altering only a few amino
acid residues in proteins containing approximately 1,450 amino
acids. Therefore, this approach has identified several amino
acid positions which are important in determining the structure
of the glucan product synthesized. However, no three-dimen-
sional structural information is available regarding these large
enzymes and it is not possible to specifically identify the role of
each change in catalysis. Since the alterations affecting the
glucan product occur in the catalytic domain of the enzyme, it
S. MUTANS GTFs 4849
is likely that these changes affect the incorporation of the
glucose residues from sucrose into the growing glucan polymer
chain. Additional investigations are required to define the
nature of such influences. In addition, like the GTF-S T589E
1
enzyme, some of the mutated enzymes may synthesize unique
glucan structures with properties distinct from naturally pro-
16.2 duced glucans. Such characteristics will be investigated for
17.4 selected mutated GTFs.
24.6
21.2 ACKNOWLEDGMENT
14.6
ND This study was supported in part by NIH grant DE-03258 (H.K.K.).
REFERENCES
1. Abo, H., T. Matsumura, T. Kodama, H. Ohta, K. Fukui, K. Kato,
and H. Kagawa. 1991. Peptide sequences for sucrose splitting and
Downloaded from http://jb.asm.org/ on January 26, 2019 by guest
glucan binding within Streptococcus sobrinus glucosyltransferase
(water-insoluble glucan synthetase). J. Bacteriol. 173:989-996.
2. Aoki, H., T. Shiroza, M. Hayakawa, S. Sato, and H. K. Kuramitsu.
1986. Cloning of a Streptococcus mutans glucosyltransferase gene
coding for insoluble glucan synthesis. Infect. Immun. 53:587-594.
3. Ferretti, J. J., M. L. Gilpin, and R. R. B. Russell. 1987. Nucleotide
sequence of a glucosyltransferase gene from Streptococcus sobrinus
MFe28. J. Bacteriol. 169:4271-4278.
4. Giffard, P. M., D. M. Allen, C. P. Milward, C. L. Simpson, and
N. A. Jacques. 1993. Sequence of the g#K gene of Streptococcus
salivarius ATCC 25975 and evolution of the gtf genes of oral
streptococci. J. Gen. Microbiol. 139:1511-1522.
5. Gifard, P. M., C. L Simpson, C. P. Milward, and N. A. Jacques.
1991. Molecular characterization of a cluster of at least two
glucosyltransferase genes in Streptococcus salivarius ATCC 25975.
J. Gen. Microbiol. 137:2577-2593.
6. Gilmore, K. S., R. R. B. Russell, and J. J. Ferretti. 1990. Analysis
of the Streptococcus downei gtJS gene, which specifies a glucosyl-
transferase that synthesizes soluble glucans. Infect. Immun. 58:
2452-2458.
7. Hanada, N., Y. Isobe, Y. Aizawa, T. Katayama, S. Sato, and M.
Inoue. 1993. Nucleotide sequence analysis of the gtJT gene from
Streptococcus sobrinus OMZ176. Infect. Immun. 61:2096-2103.
8. Hanada, N., and H. K. Kuramitsu. 1988. Isolation and character-
ization of the Streptococcus mutans gtfC gene, coding for synthesis
of both soluble and insoluble glucans. Infect. Immun. 56:1999-
2005.
9. Hanada, N., and H. K. Kuramitsu. 1989. Isolation and character-
ization of the Streptococcus mutans gtfD gene, coding for primer-
dependent soluble glucan synthesis. Infect. Immun. 57:2079-2085.
10. Honda, O., C. Kato, and H. K. Kuramitsu. 1990. Nucleotide
sequence of the Streptococcus mutans gtJD gene encoding the
glucosyltransferase S-enzyme. J. Gen. Microbiol. 136:2099-2105.
11. Jung, R., M. P. Scott, L. 0. Oliveira, and N. C. Nielsen. 1992. A
simple and efficient method for the oligodeoxyribonucleotide-
directed mutagenesis of double-stranded plasmid DNA. Gene
121:17-24.
12. Kato, C., and H. K. Kuramitsu. 1990. Carboxyl-terminal deletion
analysis of the Streptococcus mutans glucosyltransferase-I enzyme.
FEMS Microbiol. Lett. 72:299-302.
13. Kato, C., Y. Nakano, M. Lis, and H. K. Kuramitsu. 1992.
Molecular genetic analysis of the catalytic site of Streptococcus
mutans glucosyltransferases. Biochem. Biophys. Res. Commun.
189:1184-1188.
14. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis
without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-
492.
15. Kuramitsu, H. K. 1975. Characterization of extracellular glucosyl-
transferase activity of Streptococcus mutans. Infect. Immun. 12:
738-749.
16. Loesche, W. J. 1986. Role of Streptococcus mutans in human dental
decay. Microbiol. Rev. 50:353-380.
17. Mooser, G., A. Hefta, R. J. Paxton, J. E. Shively, and T. D. Lee.
1991. Isolation and sequence of an active-site peptide containing a
catalytic aspartic acid from two Streptococcus sobnnus a-glucosyl-
transferases. J. Biol. Chem. 266:8916-8922.
4850 SHIMAMURA ET AL.
18. Mukasa, H., A. Shimamura, and H. Tsumori. 1982. Purification
and characterization of basic glucosyltransferase from Streptococ-
cus mutans serotype c. Biochim. Biophys. Acta 719:81-89.
19. Mukasa, H., A. Shimamura, and H. Tsumori. 1989. Purification
and characterization of cell-associated glucosyltransferase synthe-
sizing insoluble glucan from Streptococcus mutans serotype c. J.
Gen. Microbiol. 135:2055-2063.
20. Nakano, Y. J., and H. K. Kuramitsu. 1992. Mechanism of Strep-
tococcus mutans glucosyltransferases: hybrid-enzyme analysis. J.
Bacteriol. 174:5639-5646.
21. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular
cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labo-
ratory Press, Cold Spring Harbor, N.Y.
22. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA
74:5463-5467.
23. Shimamura, A. 1989. Use of 13C-N.M.R. spectroscopy for the
J. BACTERIOL.
quantitative estimation of 3-0- and 3,6-di-O-substituted D-gluco-
pyranosyl residues in a-D-glucans formed by the D-glucosyltrans-
ferases of Streptococcus sobrinus. Carbohydr. Res. 185:239-248.
24. Shiroza, T., S. Ueda, and H. K. Kuramitsu. 1987. Sequence
analysis of the gtfB gene from Streptococcus mutans. J. Bacteriol.
169:4263-4270.
25. Ueda, S., T. Shiroza, and H. K. Kuramitsu. 1988. Sequence
analysis of the gtfC gene from Streptococcus mutans GS-5. Gene
69:101-109.
26. Yamashita, Y., W. H. Bowen, R. A. Burne, and H. K. Kuramitsu.
1993. Role of the Streptococcus mutans gtf genes in caries induc-
tion in the specific-pathogen-free rat model. Infect. Immun.
61:3811-3817.
27. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved
M13 phage cloning vectors and host strains: nucleotide sequences
of the M13mpl8 and pUC19 vectors. Gene 33:103-119.
Downloaded from http://jb.asm.org/ on January 26, 2019 by guest