Biochemical and Biophysical Research Communications 509 (2019) 892e897

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

Structure-guided mutational evidence and postulates explaining how

a glycohydrolase from Pyrococcus furiosus functions simultaneously as
an amylase and as a 4-a-glucanotransferase
Pallavi Kaila, Gurkaran Singh Mehta, Neeraj Dhaunta, Purnananda Guptasarma*
Centre for Protein Science, Design and Engineering (CPSDE), Department of Biological Sciences, Indian Institute of Science Education and Research (IISER)
Mohali, Knowledge City, Sector-81, SAS Nagar, Punjab, 140306, India

a r t i c l e i n f o a b s t r a c t

Article history: Pyrococcus furiosus exoamylase-cum-4-a-glucanotransferase (4-a-GTase; PF0272; PfuAmyGT) is reported

Received 26 December 2018 to both (i) act upon starch, and (ii) catalyze ‘disproportionation’ of maltooligosaccharides (with glucose
Accepted 5 January 2019 as the smallest product). PfuAmyGT shares ~65% sequence identity with a homo-dimeric Thermococcus
Available online 11 January 2019
litoralis 4-a-GTase, for which structures are available in complex with a non-hydrolysable analog of
maltotetraose (acarbose) bound to one subunit and maltose (of unknown origin) bound to the other
Keywords:
subunit. We structurally transposed the maltose onto the acarbose-bound subunit and discovered that
Glucanotransferase
the two molecules lie juxtaposed in what could be perfect ‘acceptor’ and ‘donor’ substrate-binding sites,
Amylase
GH57
respectively. We also discovered that there is a loop between the two sites which could use an available
PF0272 aspartate to excise a glucose from the donor, and an available tryptophan to transfer the glucose to the
Loop-based transfer non-reducing end of the acceptor glucan. We derived a structure for PfuAmyGT through homology-based
Glucose modeling, identified the potential donor site, acceptor site, glucan-transferring loop, and catalytically
important residues, and mutated these to alanine to examine effect(s) upon activity. Mutation D362A
abolished creation of shorter, or longer, maltooligosaccharides. Mutation W365A abolished creation of
longer oligosaccharides. Mutation H366A had no effect on activity. We propose that D362 facilitates
glucose excision, and that W365 facilitates its transfer, either (a) directly into solution (allowing PfuA-
myGT to act as an exoamylase), or (b) by glycoside bond formation with an acceptor (allowing PfuAmyGT
to act as a 4-a-glucanotransferase), depending upon whether the acceptor site is vacant or occupied in a
reaction cycle.
© 2019 Elsevier Inc. All rights reserved.

1. Introduction glutamic acid acting as catalytic nucleophile, and an aspartic acid

Glucanotransferases are widespread amongst archaea, bacteria,
and plants. They catalyze the transfer of a mono- or disaccharide
from a donor glucan to an acceptor glucan. In the CAZy database,
glucanotransferases are divided into three families of glycosyl hy-
drolases: GH13, GH57, and GH77. The GH57 family was created in
1996, using one ‘pioneer’ sequence each from the thermophilic
bacterium, Dictyoglomus thermophilum [1], and the hyperthermo-
philic archaeon, Pyrococcus furiosus [2]. GH 57 enzymes lack the
conserved sequence regions specific to GH13 [3]. They also share
features, such as (i) a catalytic domain composed of a TIM-barrel-
like (b/a)7 barrel fold, possessing seven b/a units [4e9]; (ii) a
* Corresponding author.
E-mail addresses: guptasarma@iisermohali.ac.in, guptasarma@yahoo.com
(P. Guptasarma).
acting as a proton donor [6]; and (iii) five conserved stretches of
sequence representing GH57 “fingerprints” [10]. GH57 and GH13
employ the same retaining reaction mechanism [11].
In protein sequence databases, the P. furiosus pioneer sequence
is annotated as PF0272 [NCBI] or P49067 AMYA_PYRFU [UNIPROT].
PF0272 has been reported to be an a-amylase (EC3.2.1.1) [2]. It has
also been reported to be a 4-a-glucanotransferase (2.4.1.25) [12].
The group that reported amylase activity postulated that PF0272 is
an intracellular amylase, and did not report any glucanotransferase
activity [2]. The group that reported glucanotransferase activity in
PF0272 showed that the enzyme is dramatically upregulated dur-
ing growth on starch or maltose, but mentioned that PF0272 does
not catalyze starch degradation [12].
This intrigued us sufficiently to refer to PF0272 as ‘PfuAmyGT’
[to signify that it is derived from P. furiosus and that it might have

https://doi.org/10.1016/j.bbrc.2019.01.021
0006-291X/© 2019 Elsevier Inc. All rights reserved.
 P. Kaila et al. / Biochemical and Biophysical Research Communications 509 (2019) 892e897
both amylase (Amy) and glucanotransferase (GT) functions] and
attempt to explore whether the two activities are derived from the
same site (or set of sites), or from entirely different sites.
Glucanotransferases transfer small sugar units between glucans,
causing donors to become shorter and acceptors to become longer.
If products remain competent to act as substrates (donors/accep-
tors) in further cycles of activity, glucanotransferases can transform
a homogenous population of a single glucan into a pool of glucans
of different lengths. A glucanotransferase must possess a glycoside
bond hydrolyzing function, as well as a glycoside bond synthesizing
function, whereas an amylase may possess only the former.
How are these functions coordinated? Since no crystal structure
is available for PF0272, we turned to a homolog of known structure
from T. litoralis [O32462 MALQ_THELN, UNIPROT], to use it as a
basis for comparative structural-bioinformatics studies, performing
homology-based modeling, and exploring functional mechanisms
through site-directed mutagenesis. We present an evidence-based
hypothesis regarding locations of donor and acceptor sites, nature
of glucose transfer, and a loop performing the transfer, containing a
catalytically-important residue (Asp362) and a glucose-
transferring residue (Trp365).
2. Material and methods
2.1. Materials
Malto-oligosaccharides were purchased from Santa Cruz
Biotechnology, USA. Isopropyl-1-thio-D-galactopyranoside (IPTG)
was purchased from BR Biochem Life Sciences Pvt. Ltd, Delhi, India.
Restriction enzymes, DNA polymerase, and DNA ligase were pur-
chased from New England Biolabs (MA, U.S.A.). TLC silica gel 60
F254 plates were procured from Merck, New Jersey, USA. Kits for
plasmid isolation, agarose gel DNA extraction, and PCR clean-up
were obtained from Qiagen, Germany.
2.2. Comparison and analysis of modeled PfuAmyGT structure to a
known homolog
The structure of PfuAmyGT was modeled using the software, I-
TASSER [13], and visualized using the software, PyMol [14]. This
structure was compared by both sequence-alignment (Clustal
Omega) [15] and structure alignment (PyMol and TM align) [16] to the
known structure of a T. litoralis homolog (PDB IDs: 1K1X, 1K1Y, and
1K1W). Surfaces, topologies, and secondary structures were
compared through superimposition of known and predicted struc-
tures. PDB IDs: 1K1X and 1K1Y show the T. litoralis homolog in
complex with acarbose and maltose of unknown origin. We separated
the coordinates of the two subunits of the T. Litoralis and P. furiosus
enzymes into four separate files, with bound acarbose/maltose where
applicable, and superimposed all subunit structures to derive the
geometry of acarbose and maltose bound to the same subunit.
2.3. Cloning and expression of PfuAmyGT mutants, D362A, W365A,
and H366A
The PfuAmyGT protein has already described (PfuAmy) in a
previous publication [17]. The desired mutants of the enzyme were
created by using (as template) the synthetic, codon-optimized gene
q; observed in mdeg X 100 X MRW
½q ¼
1000 X protein concentration in mg
ml
X cuvette path length in cm
893
encoding the wild-type PfuAmy (or PfuAmyGT), and incorporating
mutations by encoding them in suitable forward and reverse
primers for each mutant (as listed below) and using these in
splicing by overlap extension (SOE) polymerase chain reactions
(PCR) to create the mutated full-length genes according to standard
SOE-PCR protocols [18,19], followed by cloning into vector, pET-23a,
between restriction enzymes sites, NdeI and XhoI, and transforming
into XL1-Blue cells for propagation, or BL21 Star(DE3)pLysS cells for
expression and purification.
PfuAmyGT full-length F: 50 AATAATCATATGATCAATGGTTGG
ACC30
PfuAmyGT full-length R: 50 AATAATCTCGAGACCAGACGCTTC30
Pfu D362A F: 50 GCAACGCCGCGTACTG30
Pfu D362A R: 50 CGTTGCGGCGCATGAC30
Pfu W365A F: 50 GACGCGTACGCGCACGGTCTG30
Pfu W365A R: 50 CTGCGCATGCGCGTGCCAGAC30
Pfu H366A F: 50 GCGTACTGGGCCGGTCTGTTC30
Pfu H366A R: 50 CGCATGACCCGGCCAGACAAG30
2.4. Immobilized metal affinity chromatographic (IMAC)
purification
Primary (10 ml) LB cultures expressing PfuAmyGT mutants were
grown in 100 mg/ml ampicillin and 35 mg/ml chloramphenicol, at
37  C, with shaking (220 rpm) for 12e16 h, and used for inoculation
of secondary (1000 ml) cultures grown to an O.D600 of 0.6, before
addition of inducer (IPTG) to a final concentration of 1 mM, followed
by growth for a further 6e7 h. Cells were harvested through centri-
fugation at 8000 rpm, re-suspended in non-denaturing pH 8.0 lysis
buffer (Qiagen) containing 10 mM Tris, 50 mM NaH2PO4 and 300 mM
NaCl. Cells were sonicated and the lysate was heated at 90  C for
15e20 min, to denature and heat-aggregate proteins (barring ther-
mostable PfuAmyGT and its mutants) and precipitate and sediment
them through centrifugation at 12,000 rpm for 1 h. The PfuAmyGT/
mutant-enriched supernatant was subjected to affinity chromatog-
raphy on Ni-NTA resin per standard (Qiagen) protocols, using 1 ml
columns. Eluted protein was dialyzed in pH 8.0 Tris buffer (50 mM)
and examined on SDS-PAGE by the protocol of Laemmli [20], on a
Mini-Protean Tetrad apparatus (Bio-Rad, Richmond, CA, USA).
2.5. Determination of oligomeric status
Purified PfuAmyGT and its mutants were subjected to gel
filtration (size exclusion) chromatography on a Superdex-200 In-
crease 10/300 GL column, on an AKTA Purifier 10 chromatographic
system (GE Healthcare), using a flow rate of 0.5 ml/min, with the
column pre-equilibrated with pH 8.0 Tris buffer (50 mM).
2.6. Determination of secondary structural content
Circular dichroism (CD) spectroscopy was performed on a
Chirascan spectropolarimeter (Applied Photophysics) fitted with a
peltier unit. A quartz cuvette of 0.1 cm path-length was used to
collect far-UV CD spectra (197e250 nm). Mean residual ellipticity
(MRE) was calculated using the following equation, where the
mean residue weight (MRW) was determined by dividing the
molecular weight of the protein (in Da) by the number of amino
acids in its polypeptide chain:
894 P. Kaila et al. / Biochemical and Biophysical Research Communications 509 (2019) 892e897
2.7. Confirmation of tertiary structure formation
Formation of a folded tertiary structure was examined by moni-
toring intrinsic tryptophan fluorescence on a Cary Eclipse fluorim-
eter for peak emission wavelength, to verify whether the peak was at
352e353 nm (characteristic of free tryptophan in water) of at a lower
wavelength (suggestive of the burial of tryptophan residues). Spectra
were recorded by exciting samples at 295 nm and collecting emis-
sion spectra in the range of 300e400 nm, using slit widths of 5 nm
for both monochromators and a scan speed of 100 nm/min.
2.8. Examination of thermal stability
Thermal denaturation data for PfuAmyGT and its mutants were
collected by monitoring changes in MRE at 222 nm as a function of
temperature, using CD spectroscopy, 0.15 mg/ml protein, and a
sealable quartz cuvette of 0.1 cm path-length, by raising tempera-
ture from 20  C to 90  C, with 5  C increments, at 5 min intervals.
2.9. Examination of glucanotransferase activity
Maltotriose (20 mM) was used as the sole substrate with PfuA-
myGT or its mutants. This substrate initially acts as both donor and
acceptor, to give rise to maltose and maltotetraose through dispro-
portionation. Thereafter, together with maltotriose, the generated
maltose and maltotetraose product(s) also act as donor, or acceptor,
in fresh cycles of activity, generating glucose and maltopentaose.
Further, progressively higher maltooligosaccharide species are
created, eventually generating a pool of maltooligosaccharides, us-
ing an enzyme concentration of 1 mM (0.078 mg/ml) for PfuAmyGT
and 1, 2, 5, and 10 mM for mutants, with incubation at 90  C for 12 h.
Activity was visualized by thin layer chromatography (TLC) used to
separate maltooligosaccharides of different lengths using highly
polar absorbent silica as stationary phase and a mixture of solvents
(Butanol: Ethanol: Water in 50:30:20 ratio) as the mobile phase.
Separately, a mixture of commercially obtained glucose, maltose,
and higher maltooligosaccharides (maltotriose, maltotetraose,
maltopentaose, and maltohexaose) was run alongside, as standard.
TLC plates were dried, sprayed with methanol:sulphuric acid (95:5
ratio) and heated at 120  C for 2e5 min, and visualize species.
3. Results and discussion
3.1. Prediction of the structure of PfuAmyGT based on the structure
of the T. litoralis 4-a-GTase
The structure of PfuAmyGT was predicted using I-TASSER, with
the structure of a ~65% sequence-identical (Fig. S1) 4-a-GTase (PDB
ID: 1K1W) from T. litoralis as template [21]. Pymol was used to
visualize, superimpose, and compare the structures, with each
other and with structures (PDB IDs: 1K1X, and 1K1Y) available for
the T. litoralis enzyme in complex with acarbose, a non-
hydrolysable maltotetraose analog [21]. In Fig. 1A, a molecule of
acarbose (shown in blue) is seen to lie within a tunnel on the sur-
face of one subunit (chain A, in red) of the homo-dimeric T. litoralis
enzyme. No acarbose binds to the other subunit (chain B, in green).
Additionally, electron density is seen for maltose (in pink) bound to
chain B, but not chain A. The structure-solvers mention that it is not
clear (a) where the maltose molecule comes from, or (b) why the
acarbose and maltose are associated with different subunits, at
different locations [21]. They verified that the acarbose did not
contain maltose as contaminant, and speculated that the bound
maltose is actually bound acarbose, with electron density visible
only for maltose (owing to the acarviosine moiety remaining flex-
ible). While no explanation exists regarding why acarbose binds
Fig. 1. Structure and substrate binding in PfuAmyGT. (A) The T. litoralis 4-a-GTase
homo-dimer (chain A in red; chain B in green), with acarbose (in blue) and maltose (in
pink) bound to chains, A and B, respectively. (B) Superimposition of PfuAmyGT chains A
(in red) and B (in green) with acarbose (in blue) and maltose (in pink). (C) Cut-out of
PfuAmyGT showing the reducing end of maltose juxtaposed to what would be the non-
reducing end of acarbose (if it were maltotetraose). (D) Cut-out of PfuAmyGT showing
a loop (in yellow) bearing a tryptophan (W365; in pink) which could potentially carry,
to maltose, a glucose excised from maltotetraose (bound in place of acarbose). (For
interpretation of the references to colour in this figure legend, the reader is referred to
the Web version of this article.)
only to chain A, inter-dimer protein contacts in the crystal are
proposed to prevent binding of maltose to site in chain A which is
occupied by maltose in chain B.
3.2. Hypotheses regarding mechanisms of exo-amylase and
glucanotransferase action(s)
It is intriguing that the above structure(s) suggest non-
coincident and non-overlapping sites for binding of acarbose, and
maltose, in the otherwise identical twin subunits of T. litoralis 4-a-
GTase. We decided to extrapolate the ‘crystal contact’ explanation
for non-binding of maltose to both subunits into a bioinformatics-
based exploration of what would occur if crystal contacts were not
to prevent binding of maltose to chain A. For this, we physically
separated the sections of the composite PDB file containing co-
ordinates for chain A, chain B, acarbose and maltose in the T. litoralis
4-a-GTase into two separate files of coordinates: one containing
coordinates for chain A (with bound acarbose) and the other con-
taining coordinates for chain B (with bound maltose). Pymol was
used to superimpose the structures specified by the two files. This
achieved structural superimposition of chain A with chain B, with
bound acarbose/maltose. Visualization made it immediately
evident that the acarbose and the maltose lie next to each other,
with nearest atoms separated by about ~15 Å.
We then shifted our focus from the T. litoralis enzyme to the
predicted structure of the P. furiosus enzyme. The structure of chain
A of the T. litoralis enzyme was superimposed with the predicted
structure of chain A of the P. furiosus enzyme. The same operation
was conducted with chain B for the two enzymes. All four chains
were visualized in superimposed form, with acarbose and maltose.
Then the chains A and B of the T. litoralis enzyme were deleted from
the visualization, leaving only the chains A and B of the P. furiosus
enzyme, and acarbose and maltose (apparently bound to these
instead). Fig. 1B shows the result, with chain A of PfuAmyGT (in red)
superimposed upon chain B of PfuAmyGT (in green) in an all-atom
 P. Kaila et al. / Biochemical and Biophysical Research Communications 509 (2019) 892e897 895

‘surface’ representation.
From Fig. 1B, it becomes immediately evident that acarbose (in
blue) and maltose (in pink) continue to remain placed next to each
other. We also performed docking of acarbose and maltose with the
predicted PfuAmyGT structure to verify that these binding sites and
orientations are preferred (data not shown). The acarbose appears
to be buried in a tunnel. The maltose is bound to a groove. The two
PfuAmyGT subunits are also subtly different in structure. Small
region(s) of non-overlap of structure show up in green in Fig. 1B (as
these are not fully hidden by the overlapping subunit in red).
Otherwise, this visualization manifests a model for maltose and
acarbose bound to chain A of PfuAmyGT. Chain B of PfuAmyGT was
then deleted, leaving only chain A, acarbose and maltose, as shown
in Fig. 1C, in which the structure of the region is also shown as a
‘cut-out’. The non-reducing end of the maltose is next to the
reducing end of acarbose (i.e., from the end of acarbose which
would qualify to be called ‘reducing’, if it were maltotetraose). The
two molecules are so close to each other that is it conceivable that
PfuAmyGT could ‘clip’ off a glucose unit from maltotetraose (acting
as donor), and add it to maltose (acting as acceptor), to perform a
disproportionation reaction. If instead, the excision of glucose from
maltotetraose were to occur without transfer to maltose, the
glucose could be released into solution, qualifying PfuAmyGT
(Pf0272) to function both as an amylase as reported by the group of
Christian B. Anfinsen [2], but notably only as an exo-amylase and
not as an endo-amylase, and also as a glucanotransferase, as re-
ported by the group of Michael W. W. Adams [12].
For glucanotransferase activity, the excised glucose unit would
need to be physically moved from the donor glucan (maltotetraose)
to the acceptor glucan (maltose), over a distance of some ~14e15 Å,
as can be seen in Fig. 1D (which also shows certain other measured
distances). A suitable mechanism for such movement would require
a moveable sub-structure capable of changing conformation, e.g., a
loop akin to those reported in other glycosyltransferases, in which
tryptophan residues bind and carry the excised glucan [22]. We
searched the vicinity of the acarbose and maltose binding sites for
such a loop and found a 15 residues-long loop constituting residues
361e375 of PfuAmyGT. In Fig. 1D, the loop is shown (in yellow) lying
immediately below, and between, the reducing end of the putative
(acarbose-bound) donor site and the non-reducing end of the pu-
tative (maltose-bound) acceptor site, with enough space sur-
rounding it to allow for conformational changes (all-atom
visualization not shown). Loop 362e375 contains a tryptophan
(W365) which could be involved in glucan transfer, and an aspartate
(D362) which could participate in the hydrolysis required to release
the glucose moiety from the donor. We mutated D362, W365, and
H366 (another potentially important residue) to alanine.
3.3. Enrichment-cum-purification of PfuAmyGT mutants
Mutations Asp362Ala, His365Ala, and Trp366Ala were intro-
duced and confirmed by Sanger sequencing. Fig. S2 shows the
alignment of PfuAmyGT and mutant protein sequences. PfuAmyGT
and the three mutants were purified by heating protein-expressing
E. coli cells at 90  C for 20 min, as described in the materials and
methods. The SDS-PAGE analyses of these is shown in Fig. 2A,
establishing purity and identical (correct) chain lengths.
3.4. Structural-biochemical characterization of PfuAmyGT
Quaternary structure. Gel filtration chromatographic analyses are
shown in Fig. 2B. These confirm that PfuAmyGT and its three mutants

Fig. 2. Characterization of PfuAmyGT and mutants. (A) SDS PAGE of heat- and affinity-purified ~78 kDa PfuAmyGT (lane 1), D362A (lane 2), molecular weight marker (lane 3),
H366A (lane 4), and W365A (lane 5). Some samples have undergone proteolysis to generate a ~52 kDa band and lower species during purification, but the segments remain
associated and folded, yielding a single peak in gel filtration. (B) Gel filtration chromatograms of PfuAmyGT and mutants. (C) CD spectra of PfuAmyGT and mutants. (D) Fluorescence
emission spectra of PfuAmyGT and mutants.
896 P. Kaila et al. / Biochemical and Biophysical Research Communications 509 (2019) 892e897

Fig. 3. Thermal stability of PfuAmyGT and mutants. Temperature-dependence of MRE (222 nm) values in CD spectra of (A) PfuAmyGT, and (B) its mutants (D362A, W365A, and
H366A).

are all homo-dimers eluting at ~11.3 ml from a Superdex-200 In-

crease column, i.e., at the expected elution volume corresponding to
a molecular weight of ~150 kDa. Secondary structure. Circular di-
chroism (CD) analysis is shown in Fig. 2C. It confirms that the sec-
ondary structural contents of PfuAmyGT and its three mutants are
identical, and constituted of mixed alpha helical and beta sheet
structure(s). For comparison, the data is in consonance with the
secondary structural contents of the T. litoralis homolog, which
consists of alpha-helices (28.8%), beta sheets (26.4%) and other
structures (44.8%), based on analysis of PDB ID:1K1W on the web
server http://2struc.cryst.bbk.ac.uk/submit/ [23]. Tertiary structure.
Fluorescence emission spectral analyses are shown in Fig. 2D. These
confirm that PfuAmyGT (containing 18 tryptophan residues) and its
mutants are all well-folded, and show identical wavelengths of
maximal (intrinsic) fluorescence emission indicative of buried
tryptophans, in the range of 339e341 nm which is substantially
(~10e14 nm) below that typical of completely solvent-exposed
tryptophans in unfolded proteins (~352e353 nm). Thermal stabil-
ity. Fig. 3A plots MRE of PfuAmyGT at 222 nm as a function of
increasing temperature. Fig. 3B plots similar data for the mutants.
Typically, thermal unfolding of a protein containing mixed alpha-
beta structures is associated with a reduction of the MRE at
222 nm to zero, with progressive increase in the MRE at 198 nm. No Fig. 4. Activity PfuAmyGT and mutants. TLCs showing glucose, maltose and mal-
such change in the MRE at 222 nm is evident in either Fig. 3A or tooligosaccharide products obtained from reactions involving maltotriose and PfuA-
myGT (lane 1), maltotriose and different concentrations of mutant PfuAmyGT, such as
Fig. 3B. The lack of a change is a reliable indicator of the extraordinary
1 mM (lane 2), 2 mM (lane 3), 5 mM (lane 4) and 10 mM (lane 5), and 6 standard markers
stability of these hyperthermophile proteins to thermal unfolding. (lane 6) including glucose (G1), maltose (G2), maltotriose (G3), maltotetraose (G4),
maltopentaose (G5) and maltohexaose (G6). Data is shown for (A) D362A, (B) W365A,
and (C) H366A.
3.5. Activity assays indicate a hydrolytic role for D362 and a
glucan-carrier role for W365
the W365A mutation abolishes the transfer of glucose, as hypoth-
Thin layer chromatograms (TLCs) probing product-generation in esized, without completely abolishing glucose excision, whereas
PfuAmyGT and its D362, W365, and H366 mutants, respectively, are the D362A mutation completely abolishes glucose excision (with
shown in Fig. 4A, B and 4C. In each of these figures, (i) the first lane no scope remaining for any transfer).
shows the result of a control experiment demonstrating that In summary, using crystallographic data obtained by a different
PfuAmyGT transforms maltotriose into a pool of sugars (glucose, group, we arrived at hypotheses concerning locations and roles of
maltose, maltotriose, maltotetraose, maltopentaose, maltohexaose, sites for binding of donor and acceptor glucans, supporting an
and higher maltooligosaccharides) through disproportionation, explanation for how a GH57 enzyme can function as an exo-
whereas (ii) the last lane shows how an artificially-constituted amylase and a glucanotransferase. We then performed mutations
mixture of six sugar markers (glucose, maltose, maltotriose, mal- and obtained confirmatory evidence supporting the hypotheses.
totetraose, maltopentaose, and maltohexaose) gets chromato-
graphed. It is seen that (a) the Asp362Ala (D362A) mutation
(Fig. 4A) completely abolishes activity; (b) the Trp365Ala (W365A) Acknowledgments
mutation (Fig. 4B) significantly abolishes activity, with only trace
amounts of maltose and glucose being visible, but no formation of We acknowledge IISER Mohali and the Centre of Excellence (COE)
maltooligosaccharides larger than maltotriose through glucano- in Protein Science, Design and Engineering supported by the Ministry
transferase action; (c) the His366Ala (H366A) mutation (Fig. 4C) of Human Resource Development, Govt. of India (Project MHRD-14-
has no discernible qualitative effect. Therefore, we postulate that 0064), and discussions with Shashi B. Pandit and Arpana K. Jha.
 P. Kaila et al. / Biochemical and Biophysical Research Communications 509 (2019) 892e897
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.bbrc.2019.01.021.
References
[1] S. Fukusumi, A. Kamizono, S. Horinouchi, T. Beppu, Cloning and nucleotide
sequence of a heat-stable amylase gene from an anaerobic thermophile,
Dictyoglomus thermophilum, Eur. J. Biochem. 174 (1988) 15e21.
[2] K.A. Laderman, B.R. Davis, H.C. Krutzsch, M.S. Lewis, Y.V. Griko, P.L. Privalov,
C.B. Anfinsen, The purification and characterization of an extremely thermo-
stable a-amylase from the hyperthermophilic archaebacterium Pyrococcus
furiosus, J. Biol. Chem. 268 (32) (1993) 24394e24401.
[3] S. Janecek, a-Amylase family: molecular biology and evolution, Prog. Biophys.
Mol. Biol. 67 (1997) 67e97.
[4] H. Imamura, S. Fushinobu, M. Yamamoto, T. Kumasaka, B.S. Jeon, T. Wakagi,
H. Matsuzawa, Crystal structures of 4-a-glucanotransferase from Thermo-
coccus litoralis and its complex with an inhibitor, J. Biol. Chem. 278 (2003)
19378e19386.
[5] A. Dickmanns, M. Ballschmiter, W. Liebl, R. Ficner, Structure of the novel a-
amylase AmyC from Thermotoga maritima, Acta Crystallogr. D Biol. Crystallogr.
62 (2006) 262e270.
[6] M. Palomo, T. Pijning, T. Booiman, J.M. Dobruchowska, J. van der Vlist, S. Kralj,
A. Planas, K. Loos, J.P. Kamerling, B.W. Dijkstra, M.J. van der Maarel,
L. Dijkhuizen, H. Leemhuis, Thermus thermophilus glycoside hydrolase family
57 branching enzyme: crystal structure, mechanism of action, and products
formed, J. Biol. Chem. 286 (2011) 3520e3530.
[7] C.R. Santos, C.C. Tonoli, D.M. Trindade, C. Betzel, H. Takata, T. Kuriki, T. Kanai,
T. Imanaka, R.K. Arni, M.T. Murakami, Structural basis for branching-enzyme
activity of glycoside hydrolase family 57: structure and stability studies of a
novel branching enzyme from the hyperthermophilic archaeon Thermococcus
kodakaraensis KOD1, Proteins 79 (2011) 547e557.
[8] S. Na, M. Park, I. Jo, J. Cha, N.C. Ha, Structural basis for the transglycosylase
activity of a GH57-type glycogen branching enzyme from Pyrococcus hori-
koshii, Biochem. Biophys. Res. Commun. 484 (2017) 850e856.
[9] M. Martinovi
cova cek, In silico analysis of the a-amylase family GH57:
, S. Jane

eventual subfamilies reflecting enzyme specificities, Biotech 8 (2018) 307.
[10] R. Zona, C. Hin, M.J. Donhue, S. Janecek, Bioinformatics of the glycoside
897
hydrolase family 57 and identification of catalytic residues in amylopullula-
nase from Thermococcus hydrothermalis, Eur. J. Biochem. 271 (2004)
2863e2872.
[11] C.S. Rye, S.G. Withers, Glycosidase mechanisms, Curr. Opin. Chem. Biol. 4
(2000) 573e580.
[12] H.S. Lee, K.R. Shockley, G.J. Schut, S.B. Conners, C.I. Montero, M.R. Johnson,
C.J. Chou, S.L. Bridger, N. Wigner, S.D. Brehm, F.E. Jenney, D.A. Comfort,
R.M. Kelly, M.W. Adams, Transcriptional and biochemical analysis of starch
metabolism in the hyperthermophilic archaeon Pyrococcus furiosus,
J. Bacteriol. 188 (6) (2006) 2115e2125.
[13] Y. Zhang, I-TASSER server for protein 3D structure prediction, BMC Bioinf. 9
(2008).
[14] The PyMOL Molecular Graphics System, Version 2.0 Schro €dinger, LLC.
[15] F, Wilm, A, Dineen, DG, Gibson, TJ, Karplus, K, Li, W, Lopez, R, McWilliam, H,
Remmert, M, So €ding, J, Thompson, JD, Higgins, Fast, scalable generation of
high-quality protein multiple sequence alignments using clustal omega.
Sievers Mol. Syst. Biol.. doi:10.1038/msb.2011.75.
[16] Y. Zhang, J. Skolnick, TM-align: a protein structure alignment algorithm based
on TM-score, Nucleic Acids Res. 33 (2005) 2302e2309.
[17] J.M. Khan, P. Sharma, K. Arora, N. Kishor, P. Kaila, P. Guptasarma, The achilles'
heel of “ultrastable” hyperthermophile proteins: submillimolar concentra-
tions of SDS stimulate rapid conformational change, aggregation, and amyloid
formation in proteins carrying overall positive charge, Biochemistry 55 (2016)
3920e3936.
[18] Steffan N. Hoa, Henry D. Hunt, Robert M. Horton, Jeffrey K. Pullen, Larry
R. Peasea, Site-directed mutagenesis by overlap extension using the poly-
merase chain reaction, Gene 77 (1989) 51e59.
[19] Karin L. Heckman, Larry R. Pease, Gene splicing and mutagenesis by PCR-
driven overlap extension, Nat. Protoc. 2 (4) (2007).
[20] U.K. LaemmLi, Cleavage of the structure proteins during the assembly of the
head of bacteriophage T4, Nature 227 (1970) 680e685.
[21] H. Imamura, S. Fushinobu, M. Yamamoto, T. Kumasaka, B.S. Jeon, T. Wakagi,
H. Matsuzawa, Crystal structures of 4-a-glucanotransferase from Thermo-
coccus litoralis and its complex with an inhibitor, J. Biol. Chem. 278 (21) (2003)
19378e19386.
[22] P.K. Qasba, B. Ramakrishnan, E. Boeggeman, Substrate-induced conforma-
tional changes in glycosyltransferases, Trends Biochem. Sci. 30 (1) (2005)
53e62.
[23] D.P. Klose, B.A. Wallace, W.J. Robert, 2Struc: the secondary structure server,
Bioinformatics 26 (20) (2010) 2624e2625.