8 Stummer2020

Journal of Applied Microbiology ISSN 1364-5072
ORIGINAL ARTICLE
Quantification of Trichoderma afroharzianum, Trichoderma

harzianum and Trichoderma gamsii inoculants in soil, the
wheat rhizosphere and in planta suppression of the crown
rot pathogen Fusarium pseudograminearum
B.E. Stummer1 , Q. Zhang2, X. Zhang3, R.A. Warren1 and P.R. Harvey1,3
1 CSIRO Agriculture and Food, Glen Osmond, SA, Australia
2 College of Horticulture and Plant Protection, Yangzhou University, Yangzhou, Jiangsu, China
3 Ecology Research Institute, Shandong Academy of Sciences, Jinan, Shandong, China
Keywords Abstract
biocontrol, fungi, markers, plant diseases,
soil. Aims: Develop quantitative assays (qPCR) to determine the detection
threshold limits, colonization and persistence of Trichoderma gamsii,
Correspondence Trichoderma afroharzianum and T. harzianum inoculants in cropping soils, the
Belinda Stummer, Agriculture and Food, wheat rhizosphere and their in planta suppressive efficacy against the crown
Waite Campus CSIRO, Locked Bag 2, Glen
rot pathogen Fusarium pseudograminearum.
Osmond, SA 5064, Australia.
Methods and Results: Trichoderma qPCR primers were designed from the
E-mail: belinda.stummer@csiro.au
internal transcribed spacer region of 5.8S rDNA and from sequences of DNA
2020/0352: received 20 October 2019, fragments diagnostic for each inoculant genotype. The minimum detection
revised 2 April 2020 and accepted 16 April thresholds of qPCR assays varied between 1 9 103 (log 3) and 8 9 104 (log
2020 49) conidia (genome) equivalents per gram of soil for multi- and single-copy
target sequences, respectively and were independent of soil type. There was a
doi:10.1111/jam.14670
strong correlation (r > 0974) between culture-dependent and culture-
independent (qPCR) quantification methods. In wheat bioassays, Trichoderma
inoculants colonized rhizosphere soils and wheat roots at 56–112 days
postemergence to a depth of 20 cm but were more abundant (P < 0001) at 0–
10 cm root depth, means ranging from 2 9 102 (log 23) to 4 9 105 (log 56)
conidia equivalents per gram of rhizosphere soil or root tissue. Inoculants
reduced (P < 0001) F. pseudograminearum biomass in wheat crown and root
tissue by up to 5754-fold and increased (P = 0008) plant biomass, relative to
the pathogen control.
Conclusions: The qPCR assays provided sensitive and accurate assessment of
wheat root and rhizosphere soil colonization of Trichoderma inoculants. Strains
persisted through to grain maturity at levels shown to significantly suppress F.
pseudograminearum in planta.
Significance and Impact of the Study: The qPCR assays developed here were
used to determine the wheat rhizosphere dynamics of T. harzianum, T.
afroharzianum and T. gamsii inoculants and their suppressive efficacy against
F. pseudograminearum in planta. These assays can be applied to monitor
inoculant dynamics in suppressing crown rot and other wheat root diseases in
the field.
Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 1

qPCR of Trichoderma in the wheat rhizosphere B.E. Stummer et al.
semi-selective media (King et al. 1979) have traditionally

Introduction
been used for taxonomic identification and quantification
Fungi belonging to the genus Trichoderma are naturally of colony forming units (CFU) in soil (Williams et al.
occurring soil microbes that are widely used in commer- 2003). However, these methods are time-consuming and
cial horticulture and agriculture as inoculants to suppress are often subjective, as they rely on imprecise morpholog-
diseases caused by plant pathogenic fungi and to promote ical identification of species and strains.
plant growth. Mechanisms involved in plant disease sup- Consequently, molecular methods such as quantitative
pression by Trichoderma spp. have been well documented PCR (qPCR) have become important research tools for
and include rhizosphere competition, induced systemic identifying and estimating inoculants in soil (Cordier
resistance, mycoparasitism and pathogen antibiosis et al. 2007; Savazzini et al. 2008; Gerin et al. 2018). Yet,
involving production of membrane transport proteins, reports on detection of fungal biomass in plant roots
cell wall degrading enzymes and antimicrobial secondary have generally been limited to root endophytes (Lievens
metabolites (Lu et al. 2004; Druzhinina et al. 2011; Zhang et al. 2006; Edel-Hermann et al. 2011) or plant pathogens
et al. 2015). (Tellenbach et al. 2010; Jimenez-Fernandez et al. 2011).
Trichoderma sp. have been shown to suppress root dis- PCR primers developed from sequence characterized
eases caused by plant pathogenic Rhizoctonia sp. and amplified regions (SCARs) and the internal transcribed
Pythium sp. in cereal (Ryder et al. 2005; Harvey et al. spacer (ITS) region of ribosomal DNA (rDNA) are com-
2014) and horticultural crops (Huang et al. 2011). Tri- monly used for the detection of fungi. Multicopy
choderma strains Trichoderma harzianum Tr904, T. gamsii sequences, with high copy number in the genome such as
Tk7a (previously described as T. koningii strain Tk7a) ITS-rDNA, allow the detection of lower quantities of
and Trichoderma afroharzianum LTR-2 have been shown DNA compared with single copy genes. However, the
to suppress cereal root diseases caused by Gaeumanno- number of repeats of multicopy rDNA subunits is known
myces graminis, Rhizoctonia solani AG-8 and Pythium to vary within and between fungal species (Herrera et al.
irregulare in southern Australia (Ryder et al. 2005; Harvey 2009), making species identification difficult when based
et al. 2014), north eastern China (Tang et al. 1996; Ryder solely on ITS sequences (Hagn et al. 2006). The single-
et al. 2005) and the Pacific Northwest of the USA (Duffy copy ribosomal polymerase B gene (rpb2) has recently
et al. 1996). been used in duplex qPCR to quantify T. asperellum and
Within the genus, T. harzianum is the species most T. gamsii in soil and grapevine wood (Gerin et al. 2018).
commonly reported as pathogen antagonistic and plant Similarly, low copy-number SCAR markers developed
disease suppressive. Recently, the T.harzianum complex from RAPDs have been applied to monitor populations
has been revised and 14 new species including T. afro- of T. harzianum in field soils (Rubio et al. 2005) and to
harzianum have been characterized based on secondary differentiate a biological control strain of T. atroviride
metabolite production and host range (Chaverri et al. from other closely related species (Hermosa et al. 2001;
2015). Trichoderma gamsii was only relatively recently Cordier et al. 2007; Savazzini et al. 2008; Feng et al.
described in the literature and is phylogenetically more 2011).
closely related to T. viride and T. atroviride than T. har- qPCR markers derived from amplified fragment
zianum (Jaklitsch et al. 2006; Kubicek et al. 2019). Tricho- length polymorphisms (AFLPs) have also been success-
derma harzianum (Scherm et al. 2009; Steindorff et al. fully used in assays to discriminate closely related strains
2014) and T. gamsii (Varese et al. 2011; Matarese et al. of Aspergillus (Hynes et al. 2006) and Bacillus and
2012; Rinu et al. 2014) strains have been reported to be Paenibacillus species (Providenti et al. 2009) in soils. In
antagonistic to plant pathogenic fungi. Recently, differen- addition, AFLP has proved to be a reliable genotyping
tially expressed genes, previously reported to be associ- method for inter- and intraspecific differentiation of
ated with antibiosis of plant pathogenic Rhizoctonia and Trichoderma strains (Avila Mirandaa et al. 2006; Cordier
Pythium, were identified from inoculant strains T. gamsii et al. 2007).
Tk7a and T. afroharzianum LTR-2 challenged with these In this study, we compare markers developed from the
pathogens (Zhang et al. 2015). ITS-5.8s rDNA region and AFLP-derived sequences for
Registration of inoculants as biopesticide products their abilities to identify, quantify and monitor the colo-
requires risk assessment criteria to be fulfilled, including nization and persistence of T. gamsii, T. afroharzianum
monitoring their population dynamics and environmental and T. harzianum inoculant strains in four field soils and
persistence in the field. Tools are needed to accurately the wheat rhizosphere. To validate the qPCR method for
identify and differentiate inoculant strains from related quantifying these Trichoderma inoculants in soil, we
genotypes in natural microbial communities. Culture-de- determined the minimum detection thresholds (MDT) of
pendent microbiological approaches using Trichoderma the qPCR assays and correlations between DNA-based
2 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

B.E. Stummer et al. qPCR of Trichoderma in the wheat rhizosphere
and culture-dependent quantitative methods. Inoculant 5.8S–ITS2 rRNA gene was PCR-amplified from each iso-
efficacies in supressing the wheat crown rot pathogen late with either of the following primer pairs ITS 1: 5’-
Fusarium pseudograminearum in crown and root tissues TCCGTAGGTGAACCTGCGG-3’ and ITS 4: 5’-
was assessed using the inoculant and pathogen-specific TCCTCCGCTTATTGATATGC-3’ (White et al. 1990)
qPCR assays. and/or SR6R: 5’-AAGWAAAAGTCGTAACAAGG-3’ and
LR1 5’-GGTTGGTTTCTTTTCCT-3’ (Kullnig-Gradinger
et al. 2002). DNA sequencing of amplified regions was
Materials and methods
performed in both directions on a 3730xl DNA Analyzer
(Applied Biosystems Inc., Foster City, CA) at the Aus-
Species and strains
tralian Genome Research Facility (AGRF), Adelaide,
The species and strains used in this study and their ori- South Australia. Forward and reverse sequences were
gins are shown in Table 1. Three previously reported aligned using ClustalX 1.81 (Thompson et al. 1994) and
pathogen antagonistic and root disease suppressive Tri- edited with BioEdit 7.0.5.2 (Hall 1999). Consensus
choderma strains, T. gamsii Tk7a, T. afroharzianum LTR- sequences were generated and compared with TrichOKEY
2 and T. harzianum Tr904 (Duffy et al. 1996; Ryder et al. ver. 2 (http://isth.info/ Druzhinina et al. 2005) and Gen-
2005; Harvey et al. 2014), were chosen for the develop- Bank (http://www.ncbi.nlm.nih.gov/Blast.cgi). ITS-5.8S
ment of qPCR markers. The other Trichoderma strains rDNA sequences of inoculant strains T. gamsii Tk7a (ac-
were isolated from roots or cropping soils and were cession KR051479) and T. afroharzianum LTR-2 (acces-
selected to enable inter- and/or intra specific comparisons sion KR051478) have been deposited in GenBank (Zhang
among the phylogenetically distinct clade Harzianum/ et al. 2015). The ITS-5.8S rDNA sequence of the inocu-
Virens and sections Trichoderma and Longibrachiatum lant strain T. harzianum Tr904 (this study) is identical to
(Kubicek et al. 2019). Inoculant-derived qPCR markers that of LTR-2.
were also tested against strains of nontarget cereal fungal
and oomycete (Pythium) pathogens, yeast and bacterial
Primer design and specificity tests
species (Table 1).
AFLP-derived SCAR markers
Amplified fragment length polymorphism analysis was
DNA extraction
performed as originally described in Petrovic et al. (2013)
All fungal and oomycete strains were grown in potato and modified in Zhang et al. (2015) on 38 Trichoderma
dextrose broth (Acumedia, Lansing, MI) in the dark at isolates (Table 1), including the three target inoculant
25°C. Harvesting of mycelia and conidia and extraction strains (Tk7a, Tr904, LTR-2). Nonselective primers,
of total genomic DNA were as described previously (Har- HaeIII H-0 50 -GATGAGTCCTGAGCC and PstI P-0 50 -
vey et al. 2001). Bacteria were grown in Luria–Bertani GACTGCGTACATGCAG and two selective primer pairs,
(LB) broth, incubated overnight at 37°C with shaking at P-0+AAG/H-0+AG and P-0+AAG/H-0+TA were indepen-
180 rev min1 and DNA was extracted using Powerlyzer dently used to resolve AFLP fragments between 200–
UltraCleanâ Microbial DNA Isolation Kit (MO BIO Lab- 800 bp. Reproducibility of AFLP profiles was assessed by
oratories Inc., Carlsbad, CA) according to manufacturer’s replicating AFLP analyses at least twice with independent
instructions. DNA extractions.
Total DNA was extracted from soil using PowerSoilâ Amplified fragment length polymorphism fragments
DNA isolation kit following the manufacturer’s protocol diagnostic for each of the three target Trichoderma inocu-
(MO BIO Laboratories Inc.). Wheat root and crown tis- lant strains (i.e. Tk7a, Tr904, LTR-2) were purified from
sues were ground in liquid nitrogen and DNA extracted polyacrylamide gels (Vuylsteke et al. 2007)and re-ampli-
from 100 mg of tissue using DNeasy Plant Mini Kit (Qia- fied using the same selective PCR conditions (Zhang et al.
gen, Valencia, CA). All genomic DNA was quantified 2015). Amplicons were electrophoresed on 2% agarose
using Quant-it PicoGreen Assay Kit (Invitrogen, Carls- gels, excised, purified (Wizard SV Gel and PCR Clean-Up
bad, CA) with MXPro qPCR software (Stratagene System; Promega, Madison, WI) and cloned into Escheri-
MX3000P, La Jolla, CA). DNA samples were diluted to chia coli using the TOPO TA Cloning Kit (Life Technolo-
5 ng µl1 for subsequent qPCR. gies, Carlsbad, CA), according to the manufacturers’
instructions. Plasmid DNA was isolated and purified using
the Promega Wizardâ SV Miniprep DNA Purification
Identification of Trichoderma strains
System (Promega).Cloned amplicons were sequenced
To confirm the identity of all Trichoderma strains using M13F (50 -GTAAAACGACGGCCAG) and M13R
(Table 1), a region of nuclear rDNA containing the ITS1- (50 -CAGGAAACAGCTATGAC) primers, as described

Table 1 Identification of microbial strains by ITS-5.8S rDNA (fungi and oomycete) and 16s rDNA (bacteria) sequencing and specificities of qPCR
markers developed in this study
Trichoderma afroharzianum and

T. harzianum T. gamsii
Tr904- LTR-2- T.harz-ITS Tr905- Tr90 Tr905-

Sample ID Origin Species–Clade/section* A159 A80 88 A106 5-A79 ITS122
Tr904 Australia T. harzianium-HV + +

R_10 Australia T. harzianium-HV + +
SR2016_2 Australia T. harzianium-HV + +
LC2016_1 Australia T. harzianium-HV + +
HC China T. harzianium-HV + +
Tr-1 China T. harzianium-HV + +
Tphy12 China T. harzianium-HV + +
T9 China T. harzianium-HV + +
T2-1 China T. harzianium-HV + +
LTR-2 China T. afroharzianum-HV + +
Tr902 Australia T. afroharzianum-HV + +
E3CR171 Australia T. afroharzianum-HV + +
SR4_2_1 M7_1 Australia T. virens-HV
CR26 Australia T. virens-HV
PR14 Australia T. virens-HV
A92-1 China T. pleuroticola-HV
T5 China T. pleuroticola-HV
Tk7a Australia T. gamsii-ST + + +
A5MH Australia T. gamsii-ST + + +
E4PR261 Australia T. gamsii-ST + + +
SR2_4_1M3_2 Australia T. hamatum-ST
SR_RC_2M1_5 Australia T. hamatum-ST
E4CR12 Australia T. koningiopsis-ST
TK7c Australia T. koningiopsis-ST
30592 Australia T. koningiopsis/viride-ST
32084 Australia T. koningiopsis/viride-ST
30594 Australia T. viride-ST
SR1_2_3 M1_3 Australia T. asperellum-ST
LC4_3M1_25 Australia T. asperellum-ST
E4CR41 Australia T. viridescens-ST
E3PR282 Australia T. viridescens-ST
TP21 China T. longibrachiatum-SL
NKN China T. longibrachiatum-SL
Tricho_1 Australia T. longibrachiatum-SL
Q1 China T. longibrachiatum-SL
T61-2 China T. longibrachiatum-SL
Other microbes†
Sac1 Australia Saccromyces cerivisea
p201 Canada Penicillium bilaiae
MUN_1 Australia Pythium irregulare
Rs36 Australia Rhizoctonia solani
TA_R6 Australia Gaeumannomyces graminis
Cs5642 Australia Fusarium pseudograminearum
MAZ_52 Australia Fusarium solani
Ps142 Australia Pseuodomonas fluorescens
W10 China Bacillus amyloliquefaciens
Strain codes shown in bold indicate target inoculant strains used to develop qPCR markers.
+, qPCR amplicon of the expected size detected before detection threshold Ct = 32; , no amplicon of expected size detected after detection
threshold cycle, Ct > 32.
*Species determined by TrichOkey and NCBI blast of ITS-5.8S rDNA sequences (White et al.1990). Clade and section based on nomenclature
(Kubicek et al. 2019). HV, clade Harzianum/Virens, ST, section Trichoderma; SL, section Longibrachiatum.
†
Fungi and oomycetes identified by NCBI blast of ITS-5.8S rDNA sequences. Bacteria identified using 16S rDNA.

Table 2 Primer sequences for qPCR of Trichoderma and Fusarium pseudograminearum
Species qPCR assay* Primer sequence (5’?3’) TM (°C) Reference
T. afroharzianium T.harz-ITS88 F CGGAGGACCAACCAAAACT 57 This study

/harzianum T.harz-ITS88 R CGAAACGCCTACGAGAGG
T. afroharzianium LTR-2-A80F GAGAGGATACATACGACAA 47 This study
/harzianum LTR-2-A80R GTCCTGAGCCAGATAATC
T. harzianium Tr904-A159F TATTGGTTATTCTGAGGT 55 This study
Tr904-A159R AAGAGATTACGACAACAT
T. gamsii Tk7a-ITS122F AGGGGACTACAGAAAAGA 60 This study
Tk7a-ITS122R CCCAAACCCAATGTGAAC
T. gamsii Tk7a-A106F AGAGACGCTTCACCAGAG 60 This study
Tk7a-A106R AGCCAGCATAAGCATTCC
T. gamsii Tk7a-A79F TAGTGAGTTTGTATCTGTAGG 55 This study
Tk7a-A79R ATGGTCTGGGATTATGTG
Fusarium pseudograminearum Fptri3eF CAAGTTTGATCCAGGGTAATCC 59 Obanor and Chakraborty (2014)
Fptri3eR GCTGTTTCTCTTAGTCTTCCTCA
TM, the annealing temperature used in end point pcr and qPCR.
*ITS after the strain ID, refers to ITS-derived amplicon, sequenced with ITS1 and 4, A after the strain code refers to AFLP amplicon sequenced
with M13 forward primer. Numerals after this acronym refer to the size of the amplicon. F = forward primer, R = reverse primer (reverse compli-
ment).
above (AGRF). DNA sequences were analysed using CA). Each 20 µl reaction consisted of 2–5 µl of DNA
BLAST (http://www.ncbi.nlm.nih.gov/Blast.cgi) and qPCR template (1 fg–10 ng), 10 µl of either 2x SsoFastTM
primers (Table 2) were designed using Beacon Designer EvaGreenâ Supermix or iQTM SyberâGreen Supermix
80 software (Premier Biosoft, Palo Alto, CA) to produce (Bio-Rad) and 25 pMol of each primer. SyberGreen mix
amplicons between 75 and 150 bp. Primers were synthe- was only used with primer pair Tk7a-122 and cycling
sized by GeneWorks Pty Ltd (Thebarton, Australia). conditions included an extension step at 72°C for 2 min.
For all other primers cycling conditions were 95°C for
ITS-5.8S rDNA SCAR markers 3 min, followed by 40 cycles of denaturation at 95°C for
The ITS-5.8S rDNA of Trichoderma isolates Tk7a, LTR-2 10 s and annealing for 30 s. The annealing temperature
and Tr904 were sequenced and primers Tk7a-ITS122 and (TM) for each primer pair (Table 2) was selected after
T.harz-ITS88 (Table 2) were designed as described above. gradient qPCR and experimentally optimized to maxi-
A PCR amplicon was generated for each primer pair mize specificity of the amplicon. Melt curve analysis was
using DNA extracted from the appropriate target inocu- performed to assess the specificity of the amplification
lant. Amplified products were run on 2% agarose gels to products by denaturing amplicons at 95°C for 10 s, with
confirm the size of each amplicon. PCR products were fluorescence continually measured as temperature was
purified from the gel, cloned into E. coli and the recom- increased in increments of 05°C s1 from 65 to 95°C.
binant plasmid DNA isolated using the methods The experimental design of each qPCR run included four
described above. Plasmid DNA was linearized with PstI, replicates per treatment and at least two technical repli-
purified and quantified as described previously and cates for each genomic DNA template and concentration
sequenced (AGRF) with the appropriate primer. of plasmid standard (i.e. a total of eight qPCR reactions
per treatment or standard). The results were analysed
using Bio-Rad CFX Manager 3.1 software. A standard
Quantitative PCR
curve with eight 10-fold dilutions of plasmid DNA (see
Specificity of each primer pair was initially tested using 5 ng below) was run parallel to genomic DNA samples to cal-
of microbial DNA from each of the isolates listed in Table 1 culate concentrations.
by end point PCR (results not shown). Six Trichoderma pri- To test for PCR inhibitors that may have co-extracted
mer pairs that reliably amplified the target DNA (Table 2) with fungal, soil or plant DNA, 1 ng of plasmid standard
were further evaluated by qPCR. Amplification of F. pseudo- (T.harz-ITS88) or Trichoderma genomic DNA was added
graminearum DNA (Table 2) was conducted using Fptri3e to control (i.e. uninoculated) DNA extracts and threshold
F and R primers (Obanor and Chakraborty 2014). cycles (Cq) were compared with the same copy number
Quantitative PCR assays were conducted on CFX96 of plasmid or genomic DNA added to water. Ct values
Real-Time PCR Detection System (Bio-Rad, Hercules, were generally higher in undiluted DNA samples

compared to the standard control, suggesting that there sequence per gram of soil was divided by copies of target
was an inhibition effect in the assay. However, no differ- sequence per conidia (i.e. genome), as expressed in (B)
ences in Ct values were observed between the standard below.
control and diluted soil (05–20 ng µl1) and root copies of target sequence per gram of soil
(50 ng µl1) DNA samples. Subsequently, all DNA sam- B¼
copies of target sequence per genome
ples were quantified and diluted with water (soil 1 : 10,
root to 5 ng µl1) prior to qPCR.
A standard curve, based on threshold cycles (Cq), was
Trichoderma inoculum: Soil microcosm and wheat in
created for each of the seven recombinant plasmids using
planta colonization experiments
the corresponding primer pairs (Table 2). Purified linear
plasmid DNA was quantified by both spectrophotometry Trichoderma strains were grown on PDA at 25°C with
and PicoGreen, as described above. Given that the aver- 12 h photoperiod (1 klx) for 5–10 days. Conidia were
age molecular mass of a double-stranded DNA molecule scraped from the plate surface, suspended in sterile water
is 660 g mol1 base1, Avogadro’s number is containing 01% Triton x-100, inoculum concentration
6023 9 1023 molecules mol1 and the MW of the plas- estimated using a haemocytometer and adjusted to
mid and insert is known, the following formula was used 1 9 109 conidia per ml. For in planta pot experiment 3,
to calculate the plasmid copy number of each standard wheat seed Triticum aestivum L. cv Estoc, were surface
(Whelan et al. 2003): sterilized in a 1% w/v solution of NaOCl for 3 min,
rinsed in three changes of sterile water and air-dried.
Plasmid copy numbers
One gram of surface sterilized wheat seeds was inoculated
6 023 1023 ðcopies per moleÞ DNA amountðgll1 Þ with a Trichoderma conidia suspension of 1 9 107 cells
¼
DNA length ðbpÞ 660 ðgmol1 base1 Þ per ml, mixed for 2 h on an orbital shaker (120
rev min1) and dried aseptically. Control wheat seeds
Plasmid DNA serially diluted (1 : 10) from 3 9 107 to were soaked in sterile water. Inoculum levels were esti-
three copies of plasmid was used to establish the standard mated by placing 10 seeds in sterile distilled water, mix-
curves for each assay. In addition, a 10-fold serial dilu- ing for 1 hr (120 rev min1) and plating serial dilutions
tion of genomic DNA (5 fg µl1 to 5 ng µl1) corre- onto Dichloran-Rose Bengal Agar (DRBC; Neogen, Lans-
sponding to the target Trichoderma inoculant or F. ing, MI).Colony forming units (CFU) were counted after
pseudograminearum strain was included in triplicate in at 3 days incubation at 25°C in the dark.
least three separate qPCR runs to determine the number
of copies of plasmid standard corresponding to known
amounts of genomic DNA. Fusarium pseudograminearum inoculum: In planta
pathogen suppression experiments
Determining amount of DNA and copies of target Fusarium pseudograminearum strain Cs5642 was grown
sequence per conidia (genome equivalent) on Carnation Leaf Agar (Fisher et al. 1982) under a bank
of two 40W cool white and one 36W black light fluores-
Trichoderma conidia were harvested by scraping from the cent lights with a 12-h photoperiod of 25°C light–20°C
surface of 5- to 10-day old PDA plates, weighed and 5– dark. Sporodochia were suspended in sterile water con-
10 mg was serially diluted in sterile water containing 01% taining 01% Triton x-100 and the mean number of
Triton X-100. The mean number of conidia (per mg) of macroconidia (per ml) of three replicate samples calcu-
three replicate samples was calculated using a haemocy- lated using a haemocytometer. Genomic DNA extracted
tometer. DNA extracted from these triplicate samples of from these known macroconidia numbers was 10-fold
known conidia numbers was used to estimate the amount of serially diluted and used to estimate F. pseudogramin-
DNA extracted per conidia for each of our target inoculant earum conidia equivalents by qPCR. Each quantification
strains. Each quantification experiment was repeated twice. experiment was repeated twice.
The copy number of qPCR target sequence per genome Fusarium pseudograminearum inoculum was prepared
(conidia) of each inoculant strain was calculated by (A): as described in Leslie and Summerall (2006). Briefly, 50 g
copies of plasmid standard per ng of genomic DNA of rye grass seed was soaked overnight in sterile water,
A ¼ drained, autoclaved twice and inoculated with 1 ml of
number of conidia per ng of genomic DNA
1 9 106 macroconidia. Inoculated rye grass was incu-
To enable a direct comparison between culture-depen- bated at 25°C for 7 days with periodic shaking until F.
dent microbial (CFU, see below) and qPCR quantifica- pseudograminearum mycelium uniformly covered the
tion of Trichoderma inoculum in soil, the copies of target seed. Pathogen viability was tested by plating colonized

ryegrass seeds on DRBC, DNA extracted and F. pseudo- at 80°C for subsequent DNA extraction and qPCR. At
graminearum inoculum quantified by qPCR as macro- T28, 05 g soil was collected and stored for qPCR and
conidia equivalents per seed. 05 g processed immediately for culture-dependent quan-
tification of CFUs (above).
Culture-dependent (CFU) quantification of Trichoderma

Experiment 2: Persistence of Trichoderma inoculants in soil
in soil
Soil persistence of inoculant strains Tk7a, LTR-2 and
Trichoderma CFU per gram of soil were determined by Tr904 were assessed immediately after inoculation (T0)
suspending 05 g of soil in 50 ml of sterile water in a and at 28 (T28) and 56 (T56) days post-inoculation by
conical centrifuge tube and mixed for 1 h on an orbital CFU and qPCR with primer sets T.harz-ITS88 and Tk7a-
shaker (120 rev min1). A 1 : 10 dilution series of the A106. Each soil was inoculated with conidia concentra-
soil suspension was made using sterile water amended tions of approximately 2 9 105 CFU per g soil, equating
with Triton X-100 and 100 µl aliquots of each dilution to log 53 (Tr904), log 52 (Tk7a) and log 53 (LTR-2).
were spread onto 10 replicate DRBC plates. Trichoderma One gram soil samples were collected at T0, T28 and
CFUs were counted following 3 days of incubation at T56, of which 05 g was processed for qPCR and 05 g
25°C in the dark. for CFUs, as described above.
qPCR detection thresholds and persistence of Experiment 3: Trichoderma colonization of the wheat
Trichoderma in soil rhizosphere
Two contrasting wheat cropping field soils were tested, Nondraining PVC pots (25 cm high 9 7 cm diameter)
an alkaline sand (pH 89, organic carbon 09%) from were lined with plastic sleeves and filled with 900 g of
Warramboo, South Australia and an acidic loam (pH 60, Temora field soil. Wheat (cv Estoc) seed was inoculated
organic carbon 16%) from Temora, New South Wales, with strain Tr905, Tr904 or LTR-2 at 2 9 105 (log 53)
Australia. Soils were air-dried, sieved to <3 mm and conidia per seed and one seed per pot sown at a depth of
stored in sealed plastic containers until use. The water 2 cm. There were eight replicate pots of each Tricho-
content of the soil was determined by drying overnight in derma inoculant treatment and the uninoculated (sterile
an oven at 60°C. Chemical properties of each soil were water) control. At time of sowing, Hoagland’s nutrient
determined by the Analytical Services Unit of CSIRO solution (Hoagland and Arnon 1938) was added to bring
Land and Water, Waite Campus, South Australia. soil to 15% moisture content. Pots were weighed, placed
in a randomized complete block design (four blocks of
four treatments) and wheat was grown under a 12-h pho-
Inoculation of soil microcosms
toperiod (195 klx) at 22°C (light) and 15°C (dark). Pots
Three grams of soil was placed in 10 ml sterile tubes and were watered three times a week to their original weights.
inoculated with conidial suspensions (see below) of either Four replicate plants were harvested at 28 (T28) and 56
T. gamsii Tk7a, T. harzianum Tr904 or T. afroharzianum (T56) days postemergence.
LTR-2 to bring soil to 15% moisture content. Sterile At each harvest, intact plants were removed from pots
water was used as the uninoculated control. Each treat- and soil cores were divided into two sections of 0–10 and
ment consisted of four replicates. Tubes were sealed, 10–20 cm rooting depth from the crown base of the
mixed by vortexing and incubated at 25°C during the plant. Two soil samples were collected from each rooting
day and 20°C during night (12 h photoperiod, 195 klx). depth, that is, bulk soil (loose soil not associated with
roots) and rhizosphere soil (soil tightly adhering to
Experiment 1: Trichoderma minimum detection thresholds roots), the latter removed by gentle agitation in water.
in soil Bulk and rhizosphere soils were air-dried in a laminar
Each soil type was inoculated with increasing concentra- flow cabinet before processing for qPCR and CFU
tions of conidia from inoculant strains Tk7a (22 9 102, (above).
22 9 104, 22 9 106 and 22 9 108 conidia per gram Soil-free root samples were rinsed in water and blotted
soil) and LTR-2 (54 9 102, 54 9 104, 54 9 106 and dry. Twenty root segments (1–2 cm length) were excised
54 9 108 conidia per gram soil). One gram of soil was from each rooting depth of each plant, surface sterilized
collected from each tube immediately after inoculation in a 1% w/v solution of NaOCl for 1 min, rinsed in three
(T0) and at 28 days (T28) after inoculation. Samples at changes of sterile water, blotted dry and plated onto
T0 were immediately frozen in liquid nitrogen and stored DRBC medium. Isolation frequencies of root endophytic

Trichoderma were determined after 3–5 days of incuba- by qPCR was expressed as mean SEM of duplicate
tion at 22°C in the dark. Trichoderma root CFUs were qPCR assays for four individual samples (n = 4 wells).
not determined by grinding and dilution plating as this All data were log transformed. Statistical analysis was per-
process may kill conidia and mycelium, leading to under- formed with Student’s t-test for the comparison of means
estimates of root colonization. Quantification of Tricho- between two groups (qPCR vs CFU), differences were
derma CFU in soil samples did not require grinding and considered statistically significant at P < 005. One-way
is described above. The remaining root, bulk and rhizo- analysis of variance (ANOVA) was used to assess qPCR
sphere soil samples were frozen in liquid nitrogen and detection thresholds of Trichoderma inoculum in each
stored at 80°C for subsequent DNA extraction and soil (Expt. 1) and inoculants’ effects on pathogen sup-
qPCR. pression and plant growth (Expts. 4 and 5), two-way
ANOVA for effects of time and inoculum level (Expt.1), soil
type and time (Expt. 2) and inoculant and soil depth
Experiments 4 and 5: In planta suppression of crown rot
(Expt. 3) and three-way ANOVA for effects of inoculum,
pathogen F. pseudograminearum
soil depth and time. A repeated measure ANOVA was also
Wheat crown rot suppressive pot trials used the durum performed to determine inoculant persistence in soil over
wheat (Triticumturgidum L. ssp. durum) cv Tamaroi, time (Expt. 2). Fisher’s least significant difference (LSD)
reported to be highly susceptible to F. pseudogramin- means comparison (P = 005) was performed to deter-
earum.Durum wheat was grown in a sandy loam (pH mine statistical significance. Linear relationships between
75, 03% organic carbon) from Keith, South Australia Trichoderma CFUs and qPCR were plotted and correlation
(Expt. 4) and an acidic sand (pH 61, 04% organic car- coefficient of determination (R2) or Pearson correlation
bon) from Karoonda, South Australia (Expt. 5), inocu- coefficients (r) were determined for soil microcosm exper-
lated with or without F. pseudograminearum Cs5642 iments 1 (detection threshold) and 2 (soil persistence).
colonized ryegrass seed at 6 9 107 (log 78) macroconidia
equivalents per wheat seed.
Results
Pot trials were established, and wheat grown as
described for experiment 3, with the following modifica-
Identification of Trichoderma strains
tions. A single wheat seed per pot was sown at a depth of
2 cm; the seed covered with 05 cm soil, inoculated with Table 1 shows the identities of the Trichoderma strains
pathogen-colonized ryegrass seed and covered with based on ITS-5.8S rDNA sequences using the TrichOKEY
another 05 cm of soil and Trichoderma inoculants LTR-2 ver. 2 and GenBank databases. Identifications between
and Tr904 (Expt. 4) and Tk7a and A5MH (Expt. 5) indi- the two databases were consistent for all strains except
vidually inoculated as a liquid spore suspension at Tk7a and A5MH. These strains were described as uniden-
2 9 107 (log 73) conidia per wheat seed. There were tified Trichoderma sp. with TrichOKEY ver. 2 but, Tk7a
four replicate pots of each treatment. Uninoculated (nil was reconfirmed and A5MH was identified as T. gamsii
pathogen, nil Trichoderma) and pathogen-only treatments based on strain Tk7a ITS-5.8S rDNA (GenBank accession
served as controls. Harvest and sample preparation meth- KR051479) and tef1 (GenBank accession KR051477)
ods were as described for experiment 3, with the excep- sequences.
tion that only the top 10 cm of root tissue was assessed. Specificity of the six qPCR markers was tested using
Fungal biomass (conidia equivalents) of F. pseudogramin- 5 ng of genomic DNA from each of the isolates listed in
earum and Trichoderma inoculants in the same wheat Table 1. A successful amplification was recorded follow-
root samples was determined by qPCR at 84 (Zadoks ing a correct melt peak and by a Ct value between 15
stage 8, Expt. 5) and 112 (Zadoks stage 9, Expt. 4) days and 22. The detection threshold limit was set at Ct value
postemergence. The effects of Trichoderma-induced sup- in excess of 32. Primer sets Tk7a-A79 and Tk7a-A106,
pression of F. pseudograminearum on plant biomass developed from AFLP amplicon diagnostic for strain
(root + shoot) were determined at harvest (i.e. T84 and Tk7a, only detected Tk7a and four other T. gamsii strains
T112, respectively). (Table 1). ITS primers TK7A-ITS122 also only amplified
DNA from T. gamsii.
Marker Tr904-A159, developed from an AFLP ampli-
Statistical analyses
con diagnostic for T. harzianum strain Tr904, only
GenStat ver. 16 (Lawes Agricultural Trust, Rothamsted detected Tr904 and T. harzianum strain R-10. Both these
Experimental Station, UK) was used for all data analysis. strains had identical AFLP profiles (results not shown)
The relative number of Trichoderma and F. pseudo- and ITS-5.8S rDNA and tefI sequences. The marker LTR-
graminearum conidia (i.e. genome) equivalents detected 2-A80, developed from an AFLP amplicon diagnostic for

T. afroharzianum strain LTR-2, detected all T. afro- highly reproducible amplification for each of the six
harzianum and T. harzianum strains except Tr904 and assays (Fig. 1).
R10. Consequently, qPCR markers Tr904-A159 and LTR- Genomic DNA extracted from known numbers of
2-A80 may be used to distinguish inoculants LTR-2 and conidia for each of the target inoculant strains LTR-2,
Tr904. Marker T.harz-ITS88, designed from identical Tr904 and Tk7a resulted in an average of 0030 SD
sequences of the ITS region of both LTR-2 and Tr904, 0002, 0046 SD 0008 and 0033 SD 0007 pg of
detected all T. harzianum and T. afroharzianum strains DNA per conidia respectively. This value is consistent
tested. with the published data that a single Trichoderma genome
consists of 0033–0041 pg of DNA (Kubicek et al. 2019).
Evaluation of Trichoderma qPCR primer sets
The optimal annealing temp for each primer pair and
Copies of Trichoderma target sequences per plasmid
target Trichoderma strain determined by gradient qPCR is
standard and conidia (genome equivalent)
shown in Table 2. The amplification specificity was
checked by melting curve analysis and each marker pro- All AFLP-derived markers were assessed to be single-copy
duced a unique, single peak with total genomic DNA and within the respective Trichoderma genomes (Table 3).
plasmid standards of the respective target strains. Agarose qPCR markers derived from the ITS region were calcu-
gel electrophoresis revealed a distinct band of the lated at five copies per genome in T. gamsii Tk7a and
expected size for each primer pair (results not shown). between 45 and 65 copies per genome in T. afro-
For all qPCR assays there was a linear relationship harzianum LTR-2 and T. harzianum Tr904 (Table 3),
between the log of the target (plasmid) DNA copy num- reflecting the multicopy nature of ITS-5.8S rDNA loci.
ber and the calculated threshold cycle (Ct) over the range The in vitro minimum detection limit of qPCR assays
of 3 to 3 9 107 plasmid copies (R2 > 0991, Table 3). LTR-2-A80, Tr904-A159 and Tk7a-A106 was 05 pg of
Amplification efficiencies were >90% for all assays genomic DNA, equating to approximately 11–17 conidia,
(Table 3). When the log of target Trichoderma genomic whereas, the minimum detection limit of Tk7a-A79 was
DNA, ranging from 05 fg to 5 ng, was plotted against 10 times greater (i.e. 5 pg DNA). ITS assay T.harz-ITS88
the threshold cycle (Ct), the resultant regression lines was 10- to 100- fold more sensitive than all other assays,
were linear in the range tested (R2 > 0986), indicating detecting 005pg of genomic DNA compared to 05 pg
Table 3 Amplification efficiencies, correlation coefficients, copy number of target sequences per Trichoderma genome and in vitro detection
thresholds (i.e. sensitivities) of Trichoderma species-specific qPCR assays
Amplification efficiency In vitro

(E%) and squared Copy no. of target detection In vitro detection
Target inoculant correlation sequence threshold of threshold (# conidia
Species qPCR assay* strain(s) coefficient (R2)‡ (per genome)† DNA (pg) equivalents)
Trichoderma afroharzianum T.harz-ITS88 LTR-2 & Tr904 E = 96–101 45 005 1

and T. harzianum R2 = 0998–1000 65
T. afroharzianum LTR-2-A80 LTR-2 & Tr904 E = 96–100 1 050 17
and T. harzianum R2 = 0997–0998
T. harzianum Tr904-A159 Tr904 E = 99–102 1 050 11
R2 = 0998–0999
T. gamsii Tk7a-ITS122 Tk7a E = 90–91 5 050 15
R2 = 0996–0999
T. gamsii Tk7a-A106 Tk7a E = 102–105 1 050 15
R2 = 0993–0996
T. gamsii Tk7a-A79 Tk7a E = 99–101 1 500 148
R2 = 0991–0998
*qPCR assay: T. harz refers to T.harzianum.ITS refers to amplicon derived from ITS-5.8S rDNA. An A after the strain code refers to AFLP amplicon.
Numerals refer to the size of the qPCR amplicon.
†
Calculated by dividing the copy number of the standard (i.e. target sequence) per ng of genomic DNA by the number of genomes (i.e. conidia)
per ng of genomic DNA.
‡
The linear regression equation between Ct and target DNA standard and efficiency E = (10(–1/slope)-1) 9 100% for each qPCR assay was calcu-
lated using the concentration standards of target Trichoderma DNA sequences cloned into plasmid pCR4-TOPO TA. The ranges of E and R2 indi-
cate the lowest and highest values of three replicate runs.

(a) (b)
40 40
35 35
30 30
25 25
Ct
Ct
20 20
15 y = –3·075x + 33·983 15 y = –3·395x + 30·674
R² = 0·998 R² = 0·986
10 10
5 5
0 0
–1 0 1 2 3 4 –2 –1 0 1 2 3
Log DNA concentration (pg) Log DNA concentration (pg)
(c) (d)
40 40
35 35
30 30
25 25
Ct
Ct
20 20
15 y = –2·959x + 34·482 15
10 R² = 0·993 10 y = –3·2189x + 27·032
R² = 0·999
5 5
0 0
–1 0 1 2 3 4 –3 –2 –1 0 1 2 3 4
(e) (f)
40 40
35 35
30 30
25 25
Ct
Ct
20 20
15 15
y = –3·1802x + 34·21 y = –3·376x + 32·556
10 R² = 0·998 10 R² = 0·999
5 5
0 0
–2 –1 0 1 2 3 4 –2 –1 0 1 2 3 4
Figure 1 Standard curve of Trichoderma DNA generated for each primer set using qPCR. Threshold cycle (Ct) was plotted against the logarithm
of genomic DNA (pg). DNA concentrations ranging from 5 ng to 5 fg were used in triplicate in at least two assays. Error bars represent stan-
dard deviation. (a) Trichoderma gamsii primer set Tk7a-A106; (b) T. gamsii primer set Tk7a-ITS122; (c) T. gamsii primer set Tk7a-A79; (d) T. har-
zianum/afroharzianum primer set T.harz-ITS88; (e) T. afroharzianum/harzianum primer set LTR-2-A80; (f) T. harzianum primer set Tr904-A159.
Coefficient of determination is shown on each graph.
for Tk7a-ITS122 and 05 pg–5 pg DNA for the AFLP- to correlate qPCR and culture-dependent (CFU) quantifi-
derived assays (Table 3). cation methods. No Trichoderma sp. were detected in
Based on these assessments of qPCR assay specificities uninoculated soils with any of the qPCR assays or via
(Table 1), efficiencies and sensitivities (Table 3), primer culture-dependent isolation (CFU).
pairs such as T.harz-ITS88, Tk7a-ITS122, LTR-2-A80 and The qPCR MDTs for Trichoderma DNA in both soils
Tk7a-A106 were chosen for Trichoderma quantification in immediately after inoculation (T0) was in the range
cropping soils. 54 9 102 (log 273) to 54 9 104 (log 473) conidia
equivalents per gram soil for T.harz-ITS88 and between
22 9 104 (log 434) and 54 9 106 (log 673) for all
Experiment 1: Trichoderma qPCR minimum detection
other primer sets (Table 4a,b). Significant differences
thresholds in soil
(P < 0001) were apparent in the conidia equivalents
The purposes of this experiment were to determine the detected by all primer pairs in each soil and were directly
Trichoderma MDT of the qPCR assays from two soils dif- proportional to the log of conidia added per gram of soil.
fering in physical properties, organic carbon and pH and All qPCR primer sets detected lower inoculum levels

Table 4 Detection limits of Trichoderma gamsii strain Tk7a and Trichoderma afroharzianum strain LTR-2 conidia equivalents in two field soils
(Temora and Warramboo) at the time of inoculation (T0), estimated by qPCR. DNA was extracted from soil immediately after inoculation
Log conidia equivalents per gram soil*
qPCR Tk7a-ITS122† qPCR Tk7a-A106†
Inoculation rate (log conidia per gram soil)* Temora Warramboo Temora Warramboo
(a) Strain Tk7a

Control 0000c 0000c 0000c 0000c
234 0000c 0000c 0000c 0000c
434 0000c 0000c 0000c 0000c
634 4983b 5113b 5760b 5978b
834 7074a 6475a 7919a 7724a
Coefficient R2‡ 0947 0900 0935 0908
FInoculum Rate <0001 <0001 <0001 <0001
LSD 0143 0268 0200 0329
Log conidia equivalents per gram soil*
qPCR T.harz-ITS88† qPCR LTR-2-A80†
Inoculation rate (log conidia per gram soil)* Temora Warramboo Temora Warramboo
(b) Strain LTR-2

Control 0000d 0000d 0000c 0000c
273 0000d 0000d 0000c 0000c
473 3142c 2996c 0000c 0000c
673 4913b 5158b 5065b 5559b
873 7649a 7596a 7363a 7779a
Coefficient R2‡ 0990 0996 0955 0947
FInoculum Rate <0001 <0001 <0001 <0001
LSD 0426 0225 0218 0060
*
Log number of conidia (per gram soil) inoculated to soil, control consists of sterile water only.
†
Log mean conidia equivalents (per gram soil) of four replicate samples for each primer set calculated by qPCR. Within columns, letters in super-
script indicate significant differences in conidia equivalents detected by qPCR, for each primer set in each soil type (P < 0001).
‡
Regression curve calculated between inoculation rate and conidia equivalents detected by qPCR.
compared with the actual conidia numbers used to inoc- rate. There was however, a significant interaction between
ulate soil. soil type and inoculation rate (P < 0001, LSD = 0268)
Assays Tk7a-A106 and T.harz-ITS88 had greater sensi- with CFUs of strain Tk7a with recovery from the alkaline
tivity in detecting T. gamsii Tk7a (Table 4a) and T. afro- sand (Fig. 2d) being lower than from acidic loam soil
harzianum LTR-2 (Table 4b), respectively and were (Fig. 2c). No difference in the recovery of Tk7a was
selected to compare qPCR and culture-dependent (CFU) detected from either soil by qPCR (P = 0326).
analyses for quantifying proliferation of these inoculants Overall, there were strong positive correlations between
at T28 (Expt. 1, Fig. 2). CFUs and qPCR at inoculum rates above the qPCR assay
At T28, qPCR and CFU analyses indicated that the MDTs for inoculant strains LTR-2 (T.harz-ITS88,
number of Tk7a and LTR-2 conidia equivalents in both r = 0989) and Tk7a (Tk7a-A106, r = 0974). Based on
soil types had significantly increased (F inoculation two sample t-test analyses, quantification of LTR-2 and
rate 9 time P < 0001) from initial (T0) inoculation Tk7a in both soils was significantly (P < 0001) greater
rates of log 234 (Tk7a) and log 473 (LTR-2) to a maxi- by qPCR than culture-dependent CFUs.
mum of log 750 (Fig. 2). However, both Trichoderma
strains showed no significant increase in population size
Experiment 2: Persistence of Trichoderma inoculants in
in either soil by T28 when initially inoculated at rates of
soil
log 634–873 conidia per gram soil (Fig. 2). There was
no significant difference in the quantification of strain Trichoderma strains LTR-2, Tr904 and Tk7a were quanti-
LTR-2 at day 28 by CFU (P = 0161) and qPCR fied by culture-dependent CFU and qPCR analyses in all
(P = 0118) in either soil regardless of initial inoculation inoculated soils at T0, T28 and T56 (Table 5). There were

(a) (b)
8 8
7 7
Log conidia g–1 soil

6 6
5 5
4 4
3 3
2 2
1 1
0 0
0·00 2·73 4·73 6·73 8·73 0·00 2·73 4·73 6·73 8·73
Inoculation rate LTR-2 log CFU g–1soil Inoculation rate LTR-2 log CFU g–1soil
(c) (d)
9 10
8 9

7 8
6 7
5 6
5
4
4
3 3
2 2
1 1
0 0
0·00 2·34 4·34 6·34 8·34 0·00 2·34 4·34 6·34 8·34
Inoculation rate TK7a log CFU g–1 soil Inoculation rate TK7a log CFU g–1 soil
Figure 2 Quantification of Trichoderma afroharzianum LTR-2 and Trichoderma gamsii Tk7a in Temora (a and c) and Warramboo (b and d) crop-
ping soils by qPCR (□) and culture-dependent microbiology CFU (D) 28 days (T28) after inoculation. (a, b) Trichoderma afroharzianum/harzianum
qPCR assay T.harz-ITS88 used to quantify inoculant strain LTR-2. (c, d) Trichoderma gamsii qPCR assay Tk7a-A106 used to quantify inoculant
strain Tk7a. Values on Y axes represent log conidia per gram of soil measured as colony forming units CFU (D) and conidia (genome) equivalents
qPCR (□) at T28.
significant differences (F soil 9 time, 0001 < P <0046) Overall, pairwise comparisons (t-tests) revealed no sig-
in quantification of all three inoculants over the three nificant differences in quantification of inoculants by
sampling times with CFU and qPCR analyses (Table 5). CFUs and qPCR at T28 (P = 0093) and T56
At T0, inoculant recovery (CFUs) from both soils was up (P = 0089). There were strong correlations between cul-
to eight-fold lower than the initial inoculation rate of ture-dependent (CFU) and qPCR quantification at T28 in
2 9 105 (log 53) the exception being LTR-2 in Temora the Temora (r = 085) and Warramboo (r = 083) soils,
soil (Table 5a). At T28 and T56, CFU counts of Tr904 both greater at T56 (i.e. Temora r = 099 and Warram-
and Tk7a were significantly lower from alkaline sand boo r = 091).
(Warramboo) than from acidic loam (Temora) soil. In
contrast, at T56 strain LTR-2 CFUs were significantly
Experiment 3: Trichoderma colonization of the wheat
higher in Warramboo alkaline sand.
rhizosphere
Quantification of all inoculants by qPCR was signifi-
cantly (P < 005) less (10- to 100-fold) than the initial Trichoderma strains LTR-2, Tr904 and Tk7a were re-iso-
inoculation rates in either soil, except for strain Tk7a in lated from bulk soil, rhizosphere soil and surface steril-
Warramboo soil. At T0, qPCR analyses detected signifi- ized roots of each inoculated wheat plant at T28
cantly greater (F soil 9 time, 0002 < P < 0031) inocu- (tillering) and T56 (anthesis) using culture-dependent
lant levels in Warramboo (alkaline sand) than Temora methods, thereby illustrating their rhizosphere compe-
(acidic loam) soil (Table 5). However, qPCR detected no tence (Tables 6 and 7). Recovered strains were confirmed
significant differences in inoculant populations between as inoculants by extraction of genomic DNA and analyses
soils at T28 or T56. Quantification by both methods at with qPCR and AFLP diagnostics (results not shown). No
T28 showed significant (0002 < P <0031) increases (10- Trichoderma strains were recovered from soil or roots of
to 10 000-fold) in inoculant populations in both soils any uninoculated treatments.
above the initial (T0) inoculation rate, indicating inocu- Inoculant recovery (CFU) was sixfold greater
lant proliferation in the soil-only microcosms. (P < 0001, LSD = 0127) from rhizosphere soil (log

Table 5 Persistence of Trichoderma strains in Temora and rhizosphere soil at both sampling times (T28 and T56)
Warramboo field soils at 0, 28 and 56-days postinoculation, and rooting depths (0–10 and 10–20 cm) by culture-de-
determined by culture-dependent microbiology (CFU) and qPCR
pendent (CFU) and qPCR (Table 6). With qPCR, the
assays. Values represent log Trichoderma CFU and conidia (genome)
equivalents (qPCR) per gram soil. (a and b) Inoculant strains LTR-2
overall effects of time (P = 0018) and depth (P < 0001)
and Tr904 quantified using qPCR assay T.harz-ITS88. (c) Inoculant on inoculant colonization of rhizosphere soil (Table 6)
strain Tk7a quantified using qPCR assay Tk7a-A106 were greater at T28 (2580a) than T56 (2102b) and at
0–10 cm (3149a) compared with 10–20 cm (1533b).
CFU qPCR
Trichoderma gamsii Tk7a was below the qPCR MDT at
LTR-2* Temora Warramboo Temora Warramboo 10–20 cm at T28 and at both depths at T56 (Table 6).
Rhizosphere soil colonization (qPCR) of LTR-2 and
(a)
Tr904 remained stable in 0–10 cm samples at both T28
T0 541b 516a 391a 437b
T28 706d 675c 743d 735d
and T56, with colonization by LTR-2 significantly
T56 742e 769f 691c 680c increasing (P < 0001) by 10–20 cm at T56 (Table 6).
P LSD P LSD Recovery (CFU) of all three inoculants from rhizo-
FSoil 9 Time <0001 0180 0031 0320 sphere soil was also significantly (P < 0001) lower at
FSoil 0064 0104 0322 0185 depth (10–20 cm) at both T28 and T56 (Table 6).
FTime <0001 0127 <0001 0227 Greater (P < 0001) populations of strains Tr904 and
Tk7a were recovered at 0–10 cm rooting depth at T28
CFU qPCR
and T56, compared to those of LTR-2 (Table 6). How-
Tr904* Temora Warramboo Temora Warramboo ever, unlike Tk7a and Tr904 recovery of strain LTR-2
from rhizosphere soil remained stable at 0–10 cm from
(b)
T0 512b 492a 290a 407b
28 to 56 days. There was a slight increase (P < 0001) in
T28 729d 705c 697c 686c Tr904 CFUs recovered from 10–20 cm rooting depth at
T56 752e 704c 683c 681c T56 whereas, numbers of LTR-2 and Tk7a in this depth
P LSD P LSD remained stable over time. In contrast to qPCR analyses
FSoil 9 Time 0046 0170 002 0670 of rhizosphere soils, there was no difference in overall
FSoil <0001 0096 0074 0388 inoculant populations between T28 and T56 (P = 0174).
FTime <0001 0117 <0001 0475
Overall inoculant colonization was however, significantly
less (P < 0001) at 10–20 cm rooting depth by qPCR and
CFU qPCR
CFU (Table 6).
Tk7a* Temora Warramboo Temora Warramboo There was a significant three-way interaction (FTreatment
(c) 9 Time 9 Depth) in root isolation frequencies of inoculants
T0 452a 503b 437a 536b across both sampling times and rooting depths
T28 647d 572c 669cd 644c (P = 0040) but, not with root colonization assessed by
T56 705e 579c 697d 677d qPCR (P = 0909, Table 7). Overall, inoculant root isola-
P LSD P LSD tion frequencies were significantly greater at T56 than at
FSoil 9 Time <0001 0250 0002 0480 T28 (P = 0019) and at 0–10 cm rooting depth compared
FSoil <0001 0142 0179 0274
with 10–20 cm (P < 0001).
FTime <0001 0174 <0001 0336
Two-way ANOVA (FTreatment 9 Depth) of root isolation
For each inoculant strain, letters in superscript indicate significant dif- frequencies revealed no significant differences between
ferences in CFUs and qPCR (conidia equivalents) per gram soil inoculant strains in the 0–10 cm rooting depth at both
detected across both soil types.
T28 and T56 (Table 7). However, in the 10–20 rooting
*Inoculation rates (T0): LTR-2 and Tr904 log 53 (2 9 105), Tk7a log
depth, recovery of strains Tr904 and Tk7a was signifi-
52 (16 9 105) conidia per gram soil.
cantly greater (P < 0001) than that of strain LTR-2 at
both sampling times (Table 7).
161) than bulk soil (log 081). Similarly, qPCR analyses Two-way ANOVA (FTreatment 9 Depth) of qPCR data
also revealed six-fold greater (P < 0001, LSD = 0297) revealed significantly greater inoculant root coloniza-
inoculant levels in rhizosphere (log 234) compared with tion at 0–10 cm rooting depth compared with 10–
bulk soil (log 157). Further quantitative analyses there- 20 cm at both T28 (P < 0001) and T56 (P = 0006).
fore focused on inoculant colonization of rhizosphere soil Root colonization in the 10–20 cm rooting depth was
and root tissue. below the MDT of the respective qPCR assays. At
There were significant differences (FTreatment 9 T28, root colonization by strain LTR-2 in the 0–
Time 9 Depth, P < 0001) in quantification of inoculants in 10 cm profile was significantly (P < 0001) greater

Table 6 Colonization of wheat (cv Estoc) rhizosphere soil by Trichoderma afroharzianum LTR-2, T. harzianum Tr904 and T. gamsii Tk7a at 28
(T28) and 56 (T56) days postemergence at two rooting depths (0–10 and 10–20 cm). Inoculant colonization was quantified was by
culture-dependent microbiology (CFU) and qPCR. Inoculant strains LTR-2 and Tr904 were quantified using qPCR assay T.harz-ITS88 and strainTk7a
quantified by qPCR assay Tk7a-A106. Letters in superscript indicate significant differences in colonization of wheat rhizosphere soil by the
Trichoderma inoculants among sampling times and rooting depths
qPCR conidia equivalents (per gram soil) Soil isolation log CFU (per gram soil)
T28 T56 T28 T56

Time
Rooting depth (cm) 0–10 10–20 0–10 10–20 0–10 10–20 0–10 10–20
Treatment*
Control 0000e 0000e 0000e 0000e 0000f 0000f 0000f 0000f
LTR-2 5054a 1779d 5162a 2983c 2510d 0117f 2900d 0092f
Tr904 4578ab 3730bc 4901a 3772bc 5109a 0117f 4604b 0997e
Tk7a 5499a 0000e 0000e 0000e 5346a 0117f 3594c 0185f
Grand mean 2341 1606
P LSD P LSD
FTreatment 9 Time 9 Depth <0001 1104 <0001 0481
FTreatment <0001 0552 <0001 0241
FTime 0018 0390 0174 0170
FDepth <0001 0390 <0001 0170
*Inoculation rate at sowing (T0): LTR-2, Tr904 and Tk7a log 53 (2 9 105) conidia per wheat seed.
Table 7 Colonization of wheat (cv Estoc) roots by Trichoderma afroharzianum LTR-2, T. harzianum Tr904 and T. gamsii Tk7a at 28 (T28) and 56
(T56) days postemergence at two rooting depths (0–10 and 10–20 cm). Inoculant root colonization was quantified by root isolation frequencies
and qPCR, the latter representing conidial (genome) equivalents per gram root tissue. Inoculant strains LTR-2 and Tr904 were quantified using
qPCR assay T.harz-ITS88 and strainTk7a quantified by qPCR assay Tk7a-A106. Letters in superscript indicate significant differences in colonization
of wheat rhizosphere soil by the Trichoderma inoculants among rooting depths at T28 and T56 respectively
qPCR conidia equivalents (per gram root) Root isolation frequency
T28 T56 T28 T56

Time
Rooting depth (cm) 0–10 10–20 0–10 10–20 0–10 10–20 0–10 10–20
Treatment*
Control 0000c 0000c 0000b 0000b 0000e 0000e 0000e 0000e
LTR-2 5621a 0000c 4332a 0000b 0975a 0337d 1000a 0425d
Tr904 5178ab 0000c 4291a 0000b 1000a 0587c 1000a 0875b
Tk7a 3288b 0000c 2673a 0000b 0975a 0762b 0988ab 0750c
Mean 1761 1412 0580 0630
P LSD P LSD P LSD P LSD
FTreatment 9 Depth <0001 1963 0006 1794 <0001 0113 <0001 0123
FTreatment <0001 1388 0006 1269 <0001 0080 <0001 0087
FDepth <0001 0982 <0001 0897 <0001 0057 <0001 0061
Grand mean 1586 0605
P LSD P LSD
FTreatment 9 Time 9 Depth 0909 1814 0040 0118
FTime 0279 0642 0019 0042
*Inoculation rate at sowing (T0): LTR-2, Tr904 and Tk7a log 53 (2 9 105) conidia per wheat seed.
(100-fold) than that of strain Tk7a (Table 7), the lat-

Experiments 4 and 5: In planta suppression of crown rot
ter strain being detected in only 25% of the roots
pathogen F. pseudograminearum
analysed. By T56, levels of wheat root colonization
(qPCR) among inoculant treatments were not signifi- Fusarium pseudograminearum strain Cs5642 actively
cantly different (Table 7). infected and colonized crown and root tissues of durum

Table 8 Colonization of durum wheat (cv Tamaroi) root tissue by Fusarium pseudograminearum isolate Cs5642, root tissue and rhizosphere soil
by Trichoderma afroharzianum LTR2 and T. harziaum Tr904 and effect on plant biomass at 112 days postemergence. Fungal colonization at
0–10 cm rooting depth was determined by qPCR with F. pseudograminearum (Fptri3e) and T. harzianum/T. afroharzianum (Tharz-ITS88) assays
respectively. Wheat was grown in natural field soil (Keith loam, pH 75) inoculated with Cs5642 colonized organic matter at 6 9 107 (log 78)
conidia equivalents per wheat seed, with or without LTR-2 or Tr904 at 2 9 107 (log 73) conidia per wheat seed. Fungal colonization is expressed
as biomass (conidia equivalents) per gram root tissue or rhizosphere soil (Trichoderma only). Letters in superscript indicate significant differences
in fungal colonization and plant biomass among treatments
Log conidia equivalents (per gram)
Trichoderma Tharz-ITS88
Fusarium Fptri3e Plant biomass (g)
Treatment Soil Root Root Root + Shoot
Control Nil 000b 000b 000c 1324a

Control + Cs5642 000b 000b 582a 876c
LTR-2 + Cs5642 551a 468a 522ab 1090bc
Tr904 + Cs5642 546a 475a 428b 1158ab
FTreatment <0001 <0001 <0001 0008
LSD 027 038 138 215
Table 9 Colonization of durum wheat (cv Tamaroi) root tissue by Fusarium pseudograminearum isolate Cs5642, root tissue and rhizosphere soil
by Trichodermagamsii strains A5MH and Tk7a and effect on plant biomass at 84 days postemergence. Fungal colonization at 0–10 cm rooting
depth was determined by qPCR with F. pseudograminearum (Fptri3e) and T. gamsii (Tk7a-A106) assays respectively. Wheat was grown in natural
field soil (Karoonda sand, pH 61) inoculated with Cs5642 colonized organic matter at 6 9 107 (log 78) conidia equivalents per wheat seed with
or without A5MH or Tk7a at 2 9 107 (log 73) conidia per wheat seed. Fungal colonization is expressed as biomass (conidia equivalents) per
gram root tissue or rhizosphere soil (Trichoderma only). Letters in superscript indicate significant differences in fungal colonization and plant
biomass among treatments
Log conidia equivalents (per gram)
Trichodermagamsii Tk7a-A106
Fusarium Fptri3e Plant biomass (g)*
Treatment Soil Root Root Root + Shoot
Control Nil 000b 000c 000c 1032a

Control + Cs5642 000b 000c 470a 886b
A5MH + Cs5642 545a 331a 094bc 1031a
Tk7a + Cs5642 090b 233b 228b 988a
FTreatment <0001 <0001 <0001 0076
LSD 136 095 166 102
*Plant biomass: FTreatment = 0076. Significance determined at P = 010.
wheat (cv Tamaroi) grown in sandy loam (Table 8) and levels being significantly (P < 0001) greater than the
acidic sand (Table 9) soils at 112 (Zadoks stage 9) and uninoculated controls (Table 8). There were no signifi-
84 (Zadoks stage 8) days postemergence, respectively. No cant differences in root or rhizosphere soil colonization
F. pseudograminearum DNA was detected in wheat tissues between these Trichoderma treatments. Inoculation with
from the nil-pathogen control. strain Tr904 significantly (P < 0001) decreased F. pseu-
Trichoderma strains LTR-2, Tr904 (Expt.4) and Tk7a dograminearum biomass in root and crown tissues by 35-
and A5MH (Expt. 5) were re-isolated from surface steril- fold and increased (P = 0008) wheat biomass by 32%,
ized roots of each inoculated wheat plant, indicating their relative to the pathogen-only control (Table 8). There
endophytic habit and rhizosphere competence in the was however, no significant decrease in pathogen biomass
presence of the pathogen. Recovered inoculant strains or increase in wheat biomass following inoculation with
were identified via qPCR and AFLP diagnostics (results strain LTR-2.
not shown). No Trichoderma strains were recovered from Trichoderma gamsii inoculants Tk7a and A5MH also
roots of any uninoculated treatments. actively colonized wheat crown and root tissues relative
Trichoderma strains LTR-2 and Tr904 actively colo- to the uninoculated controls (P < 0001), in planta bio-
nized (qPCR) wheat roots and rhizosphere soil at T112, mass of strain A5MH 10-fold greater (P < 0001) than

strain Tk7a (Table 9) by T84. Rhizosphere soil coloniza- markers reported here were confirmed to exist as multi-
tion by A5MH was also significantly (P < 0001) greater ple copies (5–65) in the target inoculant genomes. In our
than Tk7a, the latter not significantly different from the study, ITS-derived qPCR markers exhibited 10- to 100-
uninoculated control (Table 9). Strains Tk7a and A5MH fold greater sensitivity (005 pg or approximately 1 coni-
significantly (P < 0001) decreased F. pseudograminearum dia) compared with the markers derived from single-copy
biomass in root and crown tissues by 260- and 5750-fold AFLP amplicons (0.5 pg DNA or approximately 10 coni-
respectively (Table 9). In planta suppression of pathogen dia). Despite the lower sensitivity, our screening results
biomass by strain A5MH was not significantly different suggested that the AFLP-derived assay Tr904-A159 may
from the non-diseased, nil-pathogen control (Table 9). be specific for T. harzianum strain Tr904 and the likely
Inoculant treatments had no significant effect on wheat clonal strain R10, as no other T. harzianum strains were
biomass when analysed at P = 005. However, at detected with this marker. As reported previously, qPCR
P = 010 strains Tk7a and A5MH significantly assays derived from strain-diagnostic SCAR markers can
(P = 0076) increased wheat biomass in the presence of be used to differentiate and quantify closely related Tri-
the pathogen by 12 and 16% respectively (Table 9). choderma species and strains (Rubio et al. 2005; Cordier
et al. 2007; Savazzini et al. 2008; Feng et al. 2011).
In soil microcosm experiments, quantification of Tri-
Discussion
choderma inoculants by qPCR immediately after inocula-
An aim of this study was to compare culture-dependent tion (T0) was significantly lower (10- to 100-fold) than
(microbiological) and culture-independent (qPCR) meth- the actual T0 inoculation rates determined by conidia
ods for quantifying pathogen-antagonistic (Zhang et al. counts and CFUs. Possible reasons include inefficient
2015) and root disease suppressive (Ryder et al. 2005; extraction and or recovery of DNA from Trichoderma
Harvey et al. 2014) inoculant genotypes of T. afro- conidia in soil (Schroeder et al. 2006; Savazzini
harzianum (strain LTR-2), T. harzianum (strain Tr904) et al.2008), reported to be influenced by clay and organic
and T. gamsii (strain Tk7a) in cropping soils and the matter content (Feinstein et al. 2009). Limitations in
wheat rhizosphere. We developed qPCR assays using pri- DNA extraction efficiency and inhibition of amplification
mers designed from the ITS-5.8S rDNA region and from in qPCR may lead to an underestimation of microbial
inoculant-diagnostic AFLP amplicons to quantify these populations (Cordier et al. 2007). The presence of PCR
inoculant strains. The MDTs of the qPCR assays were inhibitory substances in soil is known to influence qPCR
approximately 103–105 (log 3–5) conidia per gram of soil accuracy and diluting DNA samples has been shown to
or wheat root tissue. Quantification by qPCR assays were eliminate inhibitory effects (Haugland et al. 2004). The
comparable (R2 > 0900) with culture-dependent meth- detection threshold of T. reesei conidia using a single-
ods (CFUs) providing inoculum levels in environmental copy marker based on competitive PCR was 106 in soil
samples (soil or roots) were above the MDTs of the compared to 104 in water, the 100-fold lower detection
respective assays (104 conidia per gram). All inoculant threshold in soil due to substances inhibiting the PCR
strains persisted in soil and actively colonized wheat rhi- (Providenti et al. 2004). In our study, we routinely tested
zosphere soil and roots for at least 56–112 days postinoc- for PCR inhibition and diluted soil DNA extracts as
ulation. required. Consequently, the 10- to 100- fold lower qPCR
The qPCR assays detected T. afroharzianum, T. harzia- detection of inoculant strains LTR-2, Tr904 and Tk7a at
num and T.gamsii inoculants in soil and root tissue and T0 in both cropping soils was likely due to inefficient
did not amplify the non-target Trichoderma sp., soil- extraction and recovery of DNA from conidia and not
borne fungal and oomycete (Pythium) plant pathogens the result of soil inhibitory substances.
and yeast or bacterial species tested in this study. It is Black et al. (2013) also reported inefficient DNA
notable that each qPCR assay only detected Trichoderma extraction and detection of rDNA sequences from spores
species of the target inoculants. Phylogenetically related of filamentous fungi in soil at levels 100- to 200-fold less
species within clade Harzianum/Virens and section Tri- than expected. However, as time after inoculation
choderma (Kubicek et al. 2019) were not detected by the increased and actively growing mycelia had been estab-
respective inoculant assays (Table 1). lished, DNA recovery from soil was more efficient. Our
The in vitro MDTs for genomic DNA extracted from results also showed that at inoculation rates above the
pure cultures of inoculant strains was as little as 005 pg MDTs of the qPCR assays, quantification of strains LTR-
of target DNA, these results are in agreement with similar 2 and Tk7a immediately after inoculation (T0) were 10-
studies using the multicopy ITS-5.8s rDNA for qPCR to 100-fold lower than expected. However, by 28 (T28)
(Schroeder et al. 2006; Black et al. 2013). Similar to the days, postinoculation qPCR and CFUs detected that both
study by Herrera et al. (2009), the ITS-derived qPCR Trichoderma inoculants had proliferated 10- to 1000-fold

in each soil (Fig. 2). No differences in conidia equivalents MDT threshold of the assay by this time. Colonization
(qPCR) of inoculant strains LTR-2, Tr904 or Tk7a were (qPCR) by T. atroviride strain SCI was also greater in the
evident between the two soil types at T28 or T56 days upper soil layer and at levels comparable to the inocu-
postinoculation (Table 5), implying that DNA extraction lants used in our study (Savazzini et al. 2008). Field
efficiency was similar from both soils and increased with experiments with strain SCI (Longa et al. 2009) also
time as the inoculants proliferated. reported greater colonization (1 9 106 CFU per gram
The inoculum carrying capacity of the volume of soil) in the upper soil profile of the grapevine rhizosphere
Temora and Warramboo soil used in the detection for up to 18 weeks after inoculation. Similarly, T. atro-
threshold experiment was between log 7 and 8 (CFU and viride and T. harzianum inoculants in open-field lettuce
qPCR), as both strains LTR-2 and Tk7a did not prolifer- production persisted for up to 2 years at levels of
ate beyond this initial (T0) inoculum level by T28 ≥104 CFU per gram of soil (Oskiera et al. 2017). These
(Fig. 2). Inoculant strains LTR-2, Tr904 and Tk7a all studies however, only provide information on Tricho-
proliferated in both cropping soils beyond their initial derma soil colonization and not the interactions with
inoculation rate (log 5) by 28 and 56 d postinoculation, plant roots.
according to both CFU and qPCR assays. Australian In our in planta inoculant-only study (Expt. 3), all
strains Tk7aand Tr904 were isolated from acidic (Simon three Trichoderma strains actively colonized wheat roots
and Sivasithamparam 1988) and alkaline (Harvey et al. in 0–10 cm depth at levels (qPCR) ranging from log 26
2014) sandy soils respectively, whereas Chinese strain (Tk7a) to log 43 (LTR-2) conidia equivalents per gram
LTR-2 was isolated from an acidic loam (Ryder et al. of tissue and persisted at these levels for up to 56 days
2005). Our results highlight the abilities of these inocu- after plant emergence. Tissue colonization detected by
lants to actively colonize and persist in soil types other qPCR was significantly greater at 0–10 cm rooting depth
than those from which they were originally isolated. It is than at 10–20 cm, the latter being below the MDTs of
notable however, that Tk7a quantification by CFUs was the qPCR assays. All three inoculant strains were how-
lower (P < 0001) in alkaline rather than acidic soil ever, isolated from surface sterilized roots at both rooting
(Fig. 2, Table 5c) but there was no difference by qPCR. depths and sampling times, strain recovery being signifi-
This suggests that conidiation, but not hyphal growth of cantly lower at 10–20 cm. These results highlight the
this strain may be suppressed in alkaline soils. detection limits of the qPCR assays, the root endophytic
Irrespective of soil type, both microcosm experiments habit of the inoculants and their abilities to colonize
showed strong correlations between culture-dependent wheat roots down through the soil profile. Levels detected
(CFU) and culture-independent (qPCR) quantification of in the wheat rhizosphere are comparable to those
inoculants at 28 (r > 083) and 56 (r > 091) days reported by Gerin et al. (2018) using duplex qPCR for
postinoculation. These results are consistent with studies quantification of T. asperellum (log 33) and T. gamsii
comparing CFU and qPCR methods for detection of T. (log 46) conidia per gram of grape wood tissue and soil.
atroviride strain SCI in controlled microcosm (Savazzini Levels of root and rhizosphere soil colonization by
et al. 2008) and field experiments (Savazzini et al. 2009), strains LTR-2, Tr904 and Tk7a at 0–10 cm rooting depth
and for quantifying T. harzianum in peat and compost were directly comparable on a bread wheat (Expt. 3) and
(Beaulieu et al. 2011). In contrast, Kim and Knudsen durum wheat (Expts. 4 and 5) in two different cropping
(2016) found that whilst DNA quantification of T. har- soils at 56, 84 and 112 days postinoculation. These results
zianum in soil did not strictly correlate with CFU or further indicate the inoculants’ abilities to actively colo-
mycelial biomass, qPCR did reflect relative changes in the nize and persist in diverse wheat rhizosphere environ-
inoculant abundance. ments.
In the present study, the wheat colonization experi- The effectiveness of inoculants to colonize, proliferate
ment (Expt. 3) highlighted the importance of determin- and persist in association with roots is important for
ing Trichoderma colonization of soil and rhizosphere the suppression of plant pathogenic fungi such as F.
niches. Inoculant populations (CFU and qPCR) were at pseudograminearum, the causal agent of Fusarium
least six-fold higher (P < 0001) in rhizosphere soil com- crown rot of wheat. Our controlled environment crown
pared with bulk soil. Colonization of rhizosphere soil by rot suppression assays demonstrated that inoculants
inoculants LTR-2, Tr904 and Tk7a was also significantly LTR-2, Tr904, A5MH and Tk7a all actively colonized
greater at 0–10 cm rooting depth than at 10–20 cm and wheat crown and root tissues in the presence of high
ranged from 4 9 104 (log 46 Tr904) to 4 9 105 (log 55 inoculum levels of F. pseudograminearum at 84–
Tk7a) conidia equivalents per gram of soil. Inoculants 112 days postemergence. All inoculant strains except
LTR-2 and Tr904 persisted at these levels up to 56 days Tk7a also colonized wheat rhizosphere soils at levels
after inoculation, with strain Tk7a obsrerved below the 10- (LTR-2 and Tr904) to 100-fold (A5MH) greater

than those detected in planta. Inoculant Tk7a was strains of Trichoderma harzianum and their capacity to
observed to be a poor rhizosphere soil colonist. control allium white-rot under field conditions. Soil Biol
Trichoderma gamsii strains Tk7a and A5MH and T. Biochem 38, 1823–1830.
harzianum Tr904 significantly suppressed biomass of Beaulieu, R., Lopez-Mondejar, R., Tittarelli, F., Ros, M. and
pathogenic F. pseudograminearum in crown and root tis- Pascual, A.J. (2011) qRT-PCR quantification of the
sue of mature wheat plants (Zadoks stage 8–9) by 35-fold biological control agent Trichoderma harzianum in peat
to 5750-fold, increasing wheat biomass by 12–32% rela- and compost-based growing media. Bioresour Technol 102,
tive to the pathogen-only controls. Prior to this study, 2793–2798.
Black, J., Dean, T., Byfield, G., Foarde, K. and Menetrez, M.
there have been no reports of T. harzianum or T. gamsii
(2013) Determining fungi rRNA copy number by PCR. J
inoculants suppressing growth of the crown rot pathogen
Biomol Tech 24, 32–38.
F. pseudograminearum in wheat roots and crown tissues.
Chaverri, P., Branco-Rocha, F., Jaklitsch, W.M., Gazis, R.O.,
Previous research has reported that inoculation with T.
Degenkolb, T. and Samuels, G.J. (2015) Systematics of the
harzianum and T. koningii, a species closely related to T.
Trichoderma harzianum species complex and the
gamsii (Kubicek et al. 2019), decreased survival of F. identification of commercial biocontrol strains. Mycologia
pseudograminearum inoculum in wheat straw (Wong 107, 558–590. https://doi.org/10.3852/14-147.
et al. 2002). Trichoderma gamsii strain 6085 was reported Cordier, C., Edel-Hermann, V., Martin-Laurent, F., Blal, B.,
to suppress growth and mycotoxin production of the Steinberg, C. and Alabouvette, C. (2007) SCAR-based real
related head blight pathogen F. graminearum on rice, but time PCR to identify a biocontrol strain (T1) of
not on wheat straw (Matarese et al. 2012) and T. harzia- Trichoderma atroviride and study its population dynamics
num strain T22 decreased visual symptoms of wheat in soils. J Microbiol Meth 68, 60–68.
crown rot caused by F. culmorum (Moya-Elizondo and Druzhinina, I.S., Kopchinskij, A.G., Komo n, M., Bissett, J.,
Jacobsen 2016). Szakacs, G. and Kubicek, C.P. (2005) An oligonucleotide
To our knowledge, this is the first report of qPCR barcode for species identification in Trichoderma and
assays being applied to quantify T. afroharzianum, T. har- Hypocrea. Fungal Genet Biol 42, 813–828.
zianum and T. gamsii inoculants in the wheat rhizosphere Druzhinina, I.S., Seidl-Seiboth, V., Herrera-Estrella, A.,
and their suppressive efficacies against F. pseudogramin- Horwitz, B.A., Kenerley, C.M., Monte, E., Mukherjee,
earumin planta. These qPCR assays provide objective P.K., Zeilinger, S. et al. (2011) Trichoderma: the genomics
diagnostic tools to monitor the population dynamics of of opportunistic success. Nat Rev Microbiol 9, 749–759.
T. gamsii, T. afroharzianum and T. harzianum strains fol- Duffy, B.K., Simon, A. and Weller, D.M. (1996) Combination
lowing inoculation of agricultural soils and information of Trichoderma koningii with fluorescent pseudomonads
required for registration of inoculant products as bio-pes- for control of take-all on wheat. Phytopathology 86, 188–
194.
ticides. We are currently using this approach in field
Edel-Hermann, V., Aime, S., Cordier, C., Olivain, C.,
studies to define agro-ecological factors effecting rhizo-
Steinberg, C. and Alabouvette, C. (2011) Development of
sphere colonization and disease suppressive efficacies of
a strain-specific real-time PCR assay for the detection and
Trichoderma inoculants in cereal cropping systems.
quantification of the biological control agent Fo47 in root
tissues. FEMS Microbiol Lett 322, 34–40.
Acknowledgements Feinstein, L.M., Sul, W.J. and Blackwood, C.B. (2009)
Assessment of bias associated with incomplete extraction
This work was supported by the Australian Grains Research of microbial DNA from soil. Appl Environ Microbiol, 75,
and Development Corporation (CSP00162) and a Research 5428–5433. http://dx.doi.org/10.1128/aem.00120-09
Fellowship (Harvey) from Shandong Provincial Govern- Feng, X.M., Holmberg, A.-I., Sundh, I., Ricard, T. and Melin,
ment, China. Drs Qingxia Zhang and Xinjian Zhang were P. (2011) Specific SCAR markers and multiplex PCR for
also supported by the Chinese Scholarship Council. quantification of two Trichoderma biocontrol strains in
environment samples. Biocontrol 56, 903–913.
Conflict of Interest Fisher, N.L., Burgess, L.W., Toussou, T.A. and Nelson, P.E.
(1982) Carnation leaves as a substrate and for preserving
No conflict of interest declared. cultures of Fusarium species. Phytopathology 72, 151–153.
Gerin, D., Pollastro, S., Raguseo, C., De Miccolis Angelini,
References R.M. and Faretra, F. (2018) A ready-to-use single and
duplex-TaqMan-qPCR assay to detect and quantify the
Avila Mirandaa, M.E., Herrera Estrellab, A. and Pe~ na biocontrol agents Trichoderma asperellum and Trichoderma
Cabriales, J.J. (2006) Colonization of the rhizosphere, gamsii. Front Microbiol 9, 1–9. https://doi.org/10.3389/
rhizoplane and endorhiza of garlic(Allium sativum L.) by fmicb.2018.02073.

Hagn, A., Wallisch, S., Radl, V., Munch, J.C. and Schloter, M. quantify a biocontrol fungus. Appl Soil Ecology 98, 285–
(2006) A new cultivation independent approach to detect 288.
and monitor common Trichoderma species in soils. J King, D., Hocking, A.D. and Pitt, J. (1979) Dichloran-rose
Microbiol Methods 69, 86–92. Bengal medium for enumeration and isolation of molds
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence from foods. Appl Environ Microbiol 37, 959–964.
alignment editor and analysis program for Window 95/98/ Kubicek, C.P., Steindorff, A.S., Chenthamara, K., Manganiello,
NT. Nucleic Acids Symp Ser 41, 95–98. G., Henrissat, B., Zhang, J., Feng, C., Kopchinskiy, A.G.
Harvey, P.R., Butterworth, P.J., Hawke, B.C. and Pankhurst, et al. (2019) Evolution and comparative genomics of the
C.E. (2001) Genetic and pathogenic variation among most common Trichoderma species. BMC Genom 20, 485.
cereal medic and sub-clover isolates of Pythium irregulare. Kullnig-Gradinger, C.M., Szakacs, G. and Kubicek, C.P. (2002)
Mycol Res 105, 85–93. Phylogeny and evolution of the genus Trichoderma: a
Harvey, P.R., Stummer, B.E., Warren, R.A., Zhang, Q., Zhang, multigene approach. Mycol Res 106, 757–767. https://doi.
X., Li, J. and Yang, H. (2014) Trichoderma gamsii and T. org/10.1017/S0953756202006172.
harzianum suppress Pythium-Rhizoctonia root disease Leslie, J.F. and Summerall, B.A. (2006) The Fusarium
complexes in southern Australian cropping systems. In Laboratory Manual. Ames, IA: Blackwell Publishing.
Proceedings of 13th international workshop on Trichoderma https://doi.org/10.1002/9780470278376.
and Gliocladium Shanghai, China. p 32. Lievens, B., Brouwner, M., Vanachter, C.R.C., Cammue, B.P.A.
Haugland, R.A., Varna, M., Wyner, L.J. and Vesper, S.J. and Thomma, B.P.H.J. (2006) Real-time PCR for
(2004) Quantitate PCR analysis of selected Aspergillus, detection and quantification of fungal and oomycete
Penicillium and Paercilomyces species. Syst Appl Microbiol tomato pathogens in plant and soil samples. Plant Sci 171,
27, 198–210. 155–165.
Hoagland, D.R. and Arnon, D.I. (1938) The water culture Longa, C.M.O., Savazzini, F., Tosi, S., Elad, Y. and Pertot, I.
method of growing plants without soil. Calif Univ Agric (2009) Evaluating the survival and environmental fate of
Exp Stn Circ 347, 36–39. the biocontrol agent Trichoderma atroviride SC1 in
Hermosa, M., Grondona, I., Dıaz-Mınguez, J., Iturriaga, E. vineyards in northern Italy. J Appl Microbiol 106, 1549–
and Monte, E. (2001) Development of a strain-specific 1557.
SCAR marker for the detection of Trichoderma atroviride Lu, Z., Tombolini, R., Woo, S., Zeilinger, S., Lorito, M. and
11, a biological control agent against soilborne fungal Jansson, J.K. (2004) In vivo study of Trichoderma-
plant pathogens. Curr Genet 38, 343–350. pathogen-plant interactions, using constitutive and
Herrera, M.L., Vallor, A.C., Gelfond, J.A., Patterson, T.F. and inducible green fluorescent protein reporter systems. Appl
Wickes, B.L. (2009) Strain-dependent variation in 18S Environ Microbiol 70, 3073–3081.
ribosomal DNA copy numbers in Aspergillus fumigates. J Matarese, F., Sarrocco, S., Gruber, S., Seidl-Seiboth, V. and
Clin Microbiol 47(5), 1325–1332. Vannacci, G. (2012) Biocontrol of Fusarium head blight:
Huang, X., Chen, L., Ran, W., Shen, Q. and Yang, X. (2011) interactions between Trichoderma and mycotoxigenic
Trichoderma harzianum strain SQR-T37 and its bio- Fusarium. Microbiology 158, 98–106.
organic fertilizer could control Rhizoctonia solani Moya-Elizondo, E.A. and Jacobsen, B.J. (2016) Integrated
damping-off disease in cucumber seedlings mainly by management of Fusarium crown rot of wheat using
mycoparasitism. Appl Microb Cell Physiol 91, 741–755. fungicide seed treatment, cultivar resistance and induction
Hynes, S.S., Chaudhry, O., Providenti, M.A. and Smith, M.L. of systemic acquired resistance (SAR). Biol Control 92,
(2006) Development of AFLP-derived, functionally specific 153–163.
markers for environmental persistence studies of fungal Obanor, F. and Chakraborty, S. (2014) Aetiology and
strains. Can J Microbiol 32, 453–461. toxigenicity of Fusarium graminearum and F.
Jaklitsch, W.M., Samuels, G.J., Dodd, S.L., Lu, B.S. and pseudograminearum causing crown rot and head blight in
Druzhinina, I.S. (2006) Hypocrea rufa/Trichoderma viride: Australia under natural and artificial infection. Plant
a reassessment, and description of five closely related Pathol 63, 1218–1229.
species with and without warted conidia. Stud Mycol 56, Oskiera, M., Szczech, M., Stepowska, A., Smoliriska, U. and
135–177. Bartoszewski, G. (2017) Monitoring of Trichoderma
Jimenez-Fernandez, D., Montes-Borrego, M., Jimenez-Diaz, species in agricultural soil in response to application of
R.M., Navas-Cortes, J.A. and Landa, B.B. (2011) In planta biopreparations. Biol Control 113, 65–72.
and soil quantification of Fusarium oxysporum f. sp. ciceris Petrovic, T., Burgess, L.W., Cowie, I., Warren, R.A. and
and evaluation of Fusarium wilt disease in Chickpea with Harvey, P.R. (2013) Diversity and fertility of Fusarium
a newly developed quantitative polymerase chain reaction sacchari from wild rice (Oryza australiensis) in Northern
assay. J Phytopathol 101, 250–262. Australia, and pathogenicity tests with wild rice, rice,
Kim, T.G. and Knudsen, G.R. (2016) Comparison of plate sorghum and maize. Eur J Plant Pathol 136, 773–788.
count, microscopy, and DNA quantification methods to

Providenti, M.A., Mautner, S.I., Chaudhry, O., Bombardier, phytopathogen Sclerotinia sclerotiorum through
M., Scroggins, R., Gregorich, E. and Smith, M.L. (2004) transcriptome and expression profile analysis in
Determining the environmental fate of filamentous fungus Trichoderma harzianum. BMC Genom 15, 204.
Trichoderma reesei, in laboratory-contained intact soil-core Tang, W., Gao, J., Yang, H., Luo, D., Yan, Z., Mei, R., Ryder,
microcosms using competitive PCR and viability plating. M.H. and Rovira, A.D. (1996) Seed treatment by
Can J Microbiol 50, 623–632. microorganisms for control of take all and sharp eyespot
Providenti, M.A., Brgin, M., Hynes, S., Lamarche, C., Chitty, of wheat in field trials in China. In Advances in Biological
D., Hahn, J., Beaudette, L.A., Scroggins, R. et al. (2009) Control of Plant Diseases ed. Tang, W., Cook, R.J. and
Identification and application of AFLP-derived genetic Rovira, A. pp. 38–43. Beijing: China Agricultural
markers for quantitative PCR-based tracking of Bacillus University Press.
and Paenibacillus spp. released in soil. Can J Microbiol 55, Tellenbach, C., Grunig, C.R. and Sieber, T.N. (2010)
1166–1175. Suitability of quantitative real-time PCR to estimate the
Rinu, K., Sati, P. and Pandey, A. (2014) Trichoderma gamsii biomass of fungal root endophyte. Appl Environ Microbiol
(NFCCI 2177): a newly isolated endophytic, 76, 5764–5772.
psychrotolerant, plant growth-promoting, and antagonistic Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994)
fungal strain. J Basic Microbiol 54, 408–417. CLUSTAL W: improving the sensitivity of progressive
Rubio, M.B., Hermosa, M.R., Keck, E. and Monte, E. (2005) multiple sequence alignment through sequence weighing
Specific PCR assay for detection and quantification of position specific gap penalties and weight matrix choice.
DNA from the biocontrol strain Trichoderma harzianum Nucleic Acids Res 22, 4673–4680.
2413 in soil. Microb Ecol 49, 25–33. Varese, G.C., Angelini, P., Bencivenga, M., Buzzini, P.,
Ryder, M.H., Warren, R.A., Harvey, P.R., Tang, W., Yang, H., Donnini, D., Gargano, M.L., Maggi, O., Pecoraro, L. et al.
Zhang, X. and Zhang, B.X. (2005) Recent advances in (2011) Ex situ conservation and exploitation of fungi in
biological control of soil-borne root diseases of wheat, Italy. Plant Biosyst 145, 997–1005.
vegetables and cotton in China and Australia. Shandong Vuylsteke, M., Peleman, J.D. and vanEijk, M.J. (2007) AFLP-
Sci 18, 1–8. based transcript profiling (cDNA-AFLP) for genome-wide
Savazzini, F., Longa, C.M.O., Pertot, I. and Gessler, C. (2008) expression analysis. Nat Protoc 2, 1399–1413.
Real-time PCR for detection and quantification of the Whelan, J.A., Russell, N.B. and Whelan, M.A. (2003) A
biocontrol agent Trichoderma atroviride strain SCI in soil. method for the absolute quantification of cDNA using
J Microbiol Meth 73, 185–194. real-time PCR. J Immunol Methods 278, 261–269.
Savazzini, F., Longa, C.M.O. and Pertot, I. (2009) Impact of White, T.J., Bruns, T., Lee, S. and Taylor, J.W. (1990)
the biocontrol agent Trichoderma atroviride SCI on soil Amplification and direct sequencing of fungal ribosomal
microbial communities of a vineyard in northern Italy. RNA genes for phylogenetics. In PCR Protocols: A Guide to
Soil Biol Biochem 41, 1457–1465. Methods and Applications ed. Innis, M.A., Gelfand, D.H.,
Scherm, B., Schmoll, M., Balmas, V., Kubicek, C. and Migheli, Sninsky, J.J. and White, T.J. pp. 315–322. San Diego, CA:
Q. (2009) Identification of potential marker genes for Academic Press.
Trichoderma harzianum strains with high antagonistic Williams, J., Clarkson, J.M., Mills, P.R. and Cooper, R.M.
potential against Rhizoctonia solani by a rapid subtraction (2003) A selective medium for quantitative re isolation of
hybridization approach. Curr Genet 55, 81–91. Trichoderma harzianum from Agaricus bisporus compost.
Schroeder, K.L., Okubara, P.A., Tambong, J.T., Levesque, C.A. Appl Environ Microbiol 69, 4190–4191.
and Pualitz, T.C. (2006) Identification and quantification Wong, P.T.W., Mead, J.A. and Croft, M.C. (2002) Effect of
of pathogenic Pythium spp. from soils in Eastern temperature, moisture, soil type and Trichoderma species
Washington using real-time polymerase chain reaction. on the survival of Fusarium pseudograminearum in wheat
J Phytopathol 96, 637–647. straw. Australas Plant Pathol 31, 253–257.
Simon, A. and Sivasithamparam, K. (1988) Microbiological Zhang, X., Harvey, P.R., Stummer, B.E., Warren, R.A., Zhang,
differences between soils suppressive and conducive of the G., Guo, K., Li, J. and Yang, H. (2015) Antibiosis
saprophytic growth of Gaeumannomyces graminis var. functions during interactions of Trichoderma
tritici. Can J Microbiol 34, 860–864. afroharzianum and Trichoderma gamsii with plant
Steindorff, A.S., Ramada, M.H., Coelho, A.S., Miller, R.N., pathogenic Rhizoctonia and Pythium. Funct Integr
Pappas, G.J.J., Ulhoa, C.J. and Noronha, E.F. (2014) Genomics 15, 599–610.
Identification of mycoparasitism-related genes against the

8 Stummer2020

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

8 Stummer2020

Uploaded by

Copyright:

Available Formats

Journal of Applied Microbiology ISSN 1364-5072

Quantification of Trichoderma afroharzianum, Trichoderma

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 1

semi-selective media (King et al. 1979) have traditionally

2 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 3

Trichoderma afroharzianum and

Tr904- LTR-2- T.harz-ITS Tr905- Tr90 Tr905-

Tr904 Australia T. harzianium-HV + +

4 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Table 2 Primer sequences for qPCR of Trichoderma and Fusarium pseudograminearum

Species qPCR assay* Primer sequence (5’?3’) TM (°C) Reference

T. afroharzianium T.harz-ITS88 F CGGAGGACCAACCAAAACT 57 This study

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 5

6 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Culture-dependent (CFU) quantification of Trichoderma

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 7

8 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Amplification efficiency In vitro

Trichoderma afroharzianum T.harz-ITS88 LTR-2 & Tr904 E = 96–101 45 005 1

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 9

10 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Log conidia equivalents per gram soil*

qPCR Tk7a-ITS122† qPCR Tk7a-A106†

(a) Strain Tk7a

Log conidia equivalents per gram soil*

qPCR T.harz-ITS88† qPCR LTR-2-A80†

(b) Strain LTR-2

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 11

Log conidia g–1 soil

Log conidia g–1 soil

Log conidia g–1 soil

12 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 13

T28 T56 T28 T56

qPCR conidia equivalents (per gram root) Root isolation frequency

T28 T56 T28 T56

(100-fold) than that of strain Tk7a (Table 7), the lat-

14 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Log conidia equivalents (per gram)

Control Nil 000b 000b 000c 1324a

Log conidia equivalents (per gram)

Control Nil 000b 000c 000c 1032a

*Plant biomass: FTreatment = 0076. Significance determined at P = 010.

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 15

16 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 17

18 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

Journal of Applied Microbiology © 2020 The Society for Applied Microbiology 19

20 Journal of Applied Microbiology © 2020 The Society for Applied Microbiology

You might also like