MODULE 2

Genetics, Variation
and Natural Selection
 Lesson 1
Structure and Role
of Nucleic Acids
 Objectives
● Compare the structure of RNA and DNA.
● Explain the importance of hydrogen bonds and base pairing in
DNA replication.
● Describe the role of DNA and RNA in protein synthesis.
● Explain the relationship between the sequence of nucleotides and
the amino acid sequence in a polypeptide.
● Explain the relationship between the structure of DNA, protein
structure and the phenotype of an organism.
 Nucleic Acids
● The fourth biomolecule.
● Two types
○ RNA
○ DNA
● Nucleotide is the monomer unit of nucleic acids.
Nucleic Acids
 What is a nucleotide?
● Each nucleotide in DNA and RNA contains:
○ a phosphate group
○ a pentose (deoxyribose or ribose)
○ an organic base
■ Adenine, guanine, cytosine and thymine (uracil in RNA).
 What is a nucleotide?

To which of the two nucleic acids does the above nucleotide belong? Why?
The sugar (ribose vs. deoxyribose)
 The Bases

What are some differences between purines and pyrimidines?

RNA or
DNA? Why?

Diagram showing how the sugar phosphate

backbone is formed.
 Polynucleotide

RNA or
DNA? Why?
Polynucleotide
 RNA vs. DNA
Similarities
● Both RNA and DNA are made up of a polynucleotide chain. s
● Both contain purine and pyrimidine bases. s
● Hydrogen bonding occur between adjacent purine and pyrimidine
bases (guanine pairs with cytosine in both). s
● Both store genetic information in the form of the genetic code. f
 RNA vs. DNA
●
 RNA vs. DNA
Differences
● DNA consists of deoxyribose (2’ OH replaced by H) while RNA consists of
ribose. s
● In DNA the bases are adenine (A), guanine (G) cytosine (C) and thymine (T),
while in RNA thymine is replaced by uracil. s
● DNA has two polynucleotide chains forming a double helix, while RNA has
one polynucleotide chain. s
● In eukaryotes, DNA is found in the nucleus, mitochondria and chloroplast,
while RNA is moves from the nucleus into the cytoplasm to be translated. s
 RNA vs. DNA
Differences
● The ratio of bases in DNA is 1:1, meaning for every purine there is a
pyrimidine (A:T = 1:1, C:G = 1:1 and A+G:C+T = 1:1), while in RNA the ratio of
bases varies. This is because there is base pairing in DNA, while there is
hardly any base pairing in RNA. s
● DNA is very stable due to the presence of base pairs, while RNA is not as
stable as DNA (mRNA is even less stable than rRNA and tRNA). s
 RNA vs. DNA
Differences
● DNA can be replicated, while RNA cannot in living cells. f
● The role of DNA is to store information to be transcribed into
messenger RNA, while the role of RNA is to translate the information it
stores into a polypeptide chain. f
 DNA Replication
● As organisms grow and new cells are formed, exact copies of the
DNA must be generated for each cell.
● The DNA must be replicated before cell division so new cells
formed by mitosis and meiosis will contain the genetic material of
the organism.
 DNA Replication
● During replication, the sequence of nitrogenous bases and their
pairing scheme (A-T, C-G) on the DNA must be kept constant and
specific so the correct information will be transmitted from one
generation to the next.
● DNA replication is described as semiconservative.
● This is done in three main steps.
1.Uncoiling of the double helix
2.Complementary base pairing on both strands
3.Polymerization and coiling
 DNA Replication

DIAGRAM SHOWING SEMI-CONSERVATIVE REPLICATION

DNA Replication
 DNA Replication
● DNA Replication is an enzyme catalyzed process. The enzymes
involved are:
○ Topoisomerase
○ Helicase
○ Primase
○ DNA polymerase
○ Exonuclease
○ DNA ligase
DNA Replication
DNA Replication
DNA Replication
 Protein Synthesis
There are 3 types of RNA in cells, all of which are involved in protein
synthesis.

● Ribosomal RNA (rRNA)

● Transfer RNA (tRNA)
● Messenger RNA (mRNA)
Protein Synthesis
 Protein Synthesis
Ribosomal RNA (rRNA)

● Manufactured in the nucleus by DNA

● Found in the cytoplasm of the cell
● A major component of ribosomes which are the sites of protein
synthesis.
 Protein Synthesis
Ribosomes
 Protein Synthesis
Transfer RNA (tRNA)

● Made by nuclear DNA.

● Carries amino acids one by one to the protein chains growing at
the ribosome.
● There are at least 20 types of tRNA each one carrying a different
amino acid.
 Protein Synthesis
Transfer RNA (tRNA)
 Protein Synthesis
Messenger RNA (mRNA)

● Made in the nucleus

● Is a mirror copy of part of one strand of the DNA helix therefore of
many types.
● Associate with ribosomes
● Acts as a template for protein synthesis.
 Protein Synthesis
Messenger RNA (mRNA)

RNA bases (A, U, C, G)

 Protein Synthesis
THE GENETIC CODE

● The length of DNA that codes for one polypeptide is called a gene.
● The genetic code consists of 64 triplets of nucleotides called
codons.
● With three exceptions, each codon codes for one of the 20 amino
acids used in the synthesis of proteins.
● Most of the amino acids are encoded by more than one codon.
CODONS
 Protein Synthesis
● The codon, AUG has 2 functions:
○ START codon - signals the start of translation
○ Incorporation of the amino acid Met (methionine) into the
polypeptide chain.
● The 3 STOP codons (UAG, UGA and UAA) do not code for amino
acids.
 Protein Synthesis
● Protein synthesis consists of two main stages:
1. Transcription

2. Translation
 Protein Synthesis
● Protein synthesis consists of two main stages:
○ Transcription
○ Translation
Protein Synthesis - Transcription
1. Transcription (mRNA formation)
● Parts of DNA unwind and function as a template for assembling
mRNA.
● Different RNAs assemble from different genes.

2. Translation (polypeptide formation)

● mRNA, tRNA and rRNA interact to build polypeptide chains.
Protein Synthesis - Transcription
TRANSCRIPTION

● DNA is the template for making messenger RNA during

transcription.
● This occurs in the nucleus of a eukaryotic cell.
Protein Synthesis - Transcription
● So the DNA of a gene is not used to make polypeptides in the
nucleus.
● Instead, RNA copies of the gene's code are made.

Process of Transcription.
● One strand of the gene's DNA is used to make many copies of
messenger RNA, which have a matching code.
Protein Synthesis - Transcription
TRANSCRIPTION
Protein Synthesis - Transcription
TRANSCRIPTION

● The enzyme RNA polymerase is the enzyme responsible for

transcription.
● The enzyme moves along the template strand in the 3’ to 5’
direction.
● The RNA polymerase stops when it reaches a sequence called the
termination signal.
Protein Synthesis - Transcription
Table comparing DNA
replication and transcription
 Transcription - Activity
1. Make mRNA copies of the DNA strands below:
Example: DNA Strand: AATTGCGATA
mRNA Strand: UUAACGCUAU

DNA Strand 1: ATACGACATAGGAACTATTTAAGTA

mRNA Strand:

DNA Strand 2: AAAGGGCCCGATAGAACGTATAGTA

mRNA Strand:

DNA Strand 3: GGGCCCGATAGGGAAAATTAGATCCT

mRNA Strand:
 Protein Synthesis - Translation
TRANSLATION

● The mRNA passes out of the nucleus and attaches to ribosomes on

the rough endoplasmic reticulum.
Diagram showing protein synthesis
in a typical eukaryotic cell
 Protein Synthesis - Translation
● Ribosomes assemble amino acids into polypeptides.
● The instructions for assembling amino acids in the correct
sequence come in the form of mRNA which are produced in the
nucleus.
 Protein Synthesis - Translation
● The rough
endoplasmic
reticulum has a
supply of transfer
RNA molecules that
bind to specific
amino acids.
 Protein Synthesis - Translation
● The tRNA molecules pick up their specific amino acids from the
cytoplasm and bring them to the mRNA on the ribosome.
● The tRNA molecules have anticodons that bind to the
corresponding mRNA codon.
● Only two tRNA fit into a ribosome at any one time.
● This is INITIATION.
 Protein Synthesis - Translation
● The two amino acids are brought side by side and peptide bonds
form between them.

Diagram showing translation at a

ribosome
 Protein Synthesis - Translation
● The ribosome moves along the mRNA, exposing the next codon.
● A third tRNA brings a third amino acid, which joins the second one.
● The first tRNA leaves.
● This stage is called ELONGATION.
● The polypeptide chain grows until a ‘STOP’ codon is reached. This
process is translation.
● This stage is called TERMINATION.
 Protein Synthesis - Translation
An animation of
the process of
translation.
 Protein Synthesis - Activity
2. Determine the sequence of polypeptides that would be formed from
the following section of DNA.

5’ ATGCCTCGGATAATCGCCCGGATTTGGATCACTGTCTAGATTA 3’
3’ TACGGAGCCTATTAGCGGGCCTAAACCTAGTGACAGATCTAAT 5’
Genes to Phenotypes
 Genes to Phenotypes
● The nuclei contains DNA that is associated with histone proteins to
form chromatin.
● Where it is tightly coiled it appears darker under the microscope
and is known as heterochromatin.
● This is inactive DNA that is not being used in transcription.
● The less tightly coiled DNA appears lighter under the microscope
and is known as euchromatin and is more active as the DNA is able
to be transcribed.
Genes to Phenotypes
Genes to Phenotypes
 Genes to Phenotypes
● Chromosomes become visible as separate structures during nuclear
division (mitosis/meiosis).
● This happens after they have replicated, so the chromosomes are
double structures consisting of two molecules of DNA that are
tightly packed to make two sister chromatids which are identical.
● During metaphase the chromosomes are clearly visible as separate
structures.
● At this stage the chromosomes are arranged into homologous
pairs.
Genes to Phenotypes
 Genes to Phenotypes
● The arrangement of chromosomes into pairs is a karyotype.
● The chromosomes of each pair are the same size, they have the
same shape, the centromere is always in the same place and they
have the same genes (but may have alternative forms of these
genes).
● The sex chromosomes., X and Y, are not like this as only a small
part of the Y chromosome is homologous with the X chromosome.
● The non-sex chromosomes are known as autosomes.
 Genes to Phenotypes
●

Diagram of the human karyotype

 Genes to Phenotypes
● The sequence of amino acids in a protein is controlled by genes.
● After translation, the polypeptide chain folds into secondary and
tertiary structures.
● This protein can be used inside the cell or passed through the RER
to the Golgi body where it is modified.
Genes to Phenotypes

Diagram showing what happens after translation

 Genes to Phenotypes
● The phenotype of an organism is all its features, both internal and
external that are the direct results of genes action (for example,
sickle cell anaemia), and the interaction between genes and the
environment (for example the color of one's skin)
Table showing the
relationship between
specific genes and
the phenotype.