Journal of Eukaryotic Microbiology ISSN 1066-5234

ORIGINAL ARTICLE

The Role of Iron Status in the Early Progression of

Metronidazole Resistance in Trichomonas vaginalis Under
Microaerophilic Conditions

Wendy Arg
aez-Correaa, Mar
ıa E. Alvarez-S
anchezb, Victor E. Arana-Arg
aezc, Mario A. Ram
ırez-Camachod,

Jazm
ın S. Novelo-Castilla , Tania I. Coral-Mart
ınezf & Julio C. Torres-Romeroa
e

a Laboratorio de Bioqu
ımica y Gene
tica Molecular, Facultad de Qu
ımica de la Universidad Auto
noma de Yucat
an, Me
rida 97069, Yucat

xico
an, Me
b Posgrado en Ciencias Geno
micas, Universidad Auto
noma de la Ciudad de Me
xico, Me
xico City 03100, Me
xico

noma de Yucat

c Laboratorio de Farmacolog
ıa, Facultad de Qu
ımica de la Universidad Auto an, Me
rida 97069, Yucat
an, Me
xico
d Centro de Informacio
n de Medicamentos, Facultad de Qu
ımica de la Universidad Auto
noma de Yucat
an, Me
rida 97069, Yucat
an, Me
xico
e Laboratorio de Espectroscop
ıa Ato
mica, Facultad de Qu
ımica de la Universidad Auto
noma de Yucat
an, Me
rida 97069, Yucat
an, Me
xico

noma de Yucat

f Laboratorio de Cromatograf
ıa, Facultad de Qu
ımica de la Universidad Auto an, Me
rida 97069, Yucat
an, Me
xico

Keywords
drug resistance; gene expression;
protozoan.
Correspondence
J.C. Torres-Romero, Laboratorio de Bio-
qu
ımica y Gene
tica Molecular, Facultad de
Qu
ımica de la Universidad Auto
noma de
Yucat
an, Calle 43 No. 613 x C. 90 Col.
Inal

ambrica, CP 97069 Me
rida, Yucat
an,
Me
xico
Telephone number: +52 (999) 922-57-11
Ext. 38124; Fax number: +52 (999) 922-57-
08; e-mail: julio.torres@correo.uady.mx
Received: 25 April 2018; revised 14 June
2018; accepted July 18, 2018.
Early View publication August 14, 2018
doi:10.1111/jeu.12671
ABSTRACT
Trichomonas vaginalis is the etiological agent of human trichomoniasis.
Metronidazole has high treatment success rate among trichomoniasis patients.
However, metronidazole-resistant T. vaginalis has been reported, contributing
in an increasing number of refractory cases. The mechanism of metronidazole
resistance in this parasite is still unclear. In the vaginal environment, where
the microaerophilic conditions prevail but the iron concentration is constantly
fluctuating, the metronidazole resistance profile of T. vaginalis could be
altered. In this study, we developed metronidazole-resistant strains of T. vagi-
nalis and evaluate if iron availability is important to the action of the drug. The
modulation of iron levels and iron chelation affected the actions of metronida-
zole both in susceptible and resistant strains. Interestingly, the early resistant
strains exhibited minor iron content. The results of transcription analysis in the
early resistant strains showed dysregulation in the expression of genes that
codified proteins involved in iron transporter, iron–sulfur cluster assemblage,
and oxidative stress response, which could not be observed in the late resis-
tant and susceptible strains. Our results indicate that iron content plays an
important role in the metronidazole action in T. vaginalis and likely to be
related to iron–sulfur proteins involved in metronidazole activation and oxida-
tive stress via Fenton reaction.

TRICHOMONAS vaginalis, a flagellate protist parasite, is
the causative agent of the condition termed trichomonia-
sis, which is the most prevalent nonviral sexually transmit-
ted infection (STI) in the world. The World Health
Organization (WHO) estimates an incidence of 276 million
new cases each year and prevalence of 187 million of
infected individuals. However, the epidemiology of this
STI is not completely known because the T. vaginalis
infections are not notifiable and surveillance is not done
(Kissinger 2015; Menezes et al. 2016).
Trichomonas vaginalis infection occurs in the female
and male urogenital tract and humans are the only natural
host for this parasite. Unlike in men, where spontaneous
resolution of the disease is common, trichomoniasis can
persist for long periods in the female urogenital tract.
Although trichomoniasis is not life threatening in itself, it
can be debilitating and increases the risk of adverse preg-
nancy outcomes, HIV infection, and, possibly, neoplasias
in the prostate and the cervix (Cudmore and Garber 2010;
Leitsch 2016).
Metronidazole, a member of the nitroimidazole drug
class, serves as drug of choice for treatment in T. vagi-
nalis infection. Metronidazole was introduced for the treat-
ment of trichomoniasis in 1959. However, clinical failure

© 2018 International Society of Protistologists

Journal of Eukaryotic Microbiology 2019, 66, 309–315 309
Iron Limit Metronidazole Resistance in Trichomonas vaginalis
of metronidazole treatment has been reported since such
date. Until now, the exact mechanisms of metronidazole
resistance in T. vaginalis remains unknown (Kissinger
2015; Watt and Jennison 1960).
Metronidazole is the most frequently prescribed drug
for anaerobic infections worldwide. However, despite high
carbon dioxide (CO2) requirements, T. vaginalis is not
strictly anaerobic and consumes oxygen (O2) at low levels,
which correlates with the microaerophilic conditions that
prevail in the vaginal environment (Cudmore et al. 2004;
O’Hanlon et al. 2013; Upcroft and Upcroft 2001). For this
reason, both aerobic and anaerobic resistance to metron-
idazole has been proposed in T. vaginalis. Aerobic resis-
tance of T. vaginalis is typically characterized by
decreased metronidazole toxicity by re-oxidizing nitroradi-
cal in presence of intracellular oxygen. On the other hand,
anaerobic resistance has been characterized by the
absence of hydrogenosomal iron-sulfur proteins that would
normally activate metronidazole, including pyruvate:ferre-
doxin oxidoreductase (PFO) and ferredoxin (Fdx) (Cudmore
et al. 2004; Weinstock et al. 2008).
The role of iron metabolism in drug response and resis-
tance has been established in several infectious microor-
ganisms, explicitly, yeast Candida albicans, protozoa
parasite Leishmania donovani, and bacterias as Escheri-
chia coli, Mycobacterium, and Pseudomonas species
(Me
hi et al. 2014; Pal et al. 2015; Prasad et al. 2006; Sen
et al. 2008; Yeom et al. 2010). Specifically, iron homeosta-
sis have been related to metronidazole resistance in Heli-
cobacter pylori and Bacteroides fragilis (Tsugawa et al.
2011; Veeranagouda et al. 2014). Iron has also been pro-
posed to be involved in metronidazole resistance of
T. vaginalis, particularly that involving the PFO/Fdx path-
way. Although an iron-independent mechanism of metron-
idazole activation via flavin reductase (FR) has been
described, iron metabolism in T. vaginalis is highly depen-
dent on FR1, and thus resistant parasites must adjust their
iron-dependent pathways in the absence of this enzyme
(Leitsch et al. 2009).
Recently, it was established that metronidazole resis-
tance in T. vaginalis predominantly occurs through pro-
cesses that restrict drug activation due to the number of
downregulated genes in resistant strains and that changes
in iron-dependent processes in this parasite represent con-
sequences of metronidazole resistance (Bradic et al.
2017). However, all data about resistance in T. vaginalis
has been found through the comparison of metronidazole-
susceptible and moderate-, and/or high-resistant strains
(Bradic et al. 2017; Leitsch et al. 2009; Weinstock et al.
2008). Herein, we focused on the role of iron status in the
mechanism of metronidazole resistance in T. vaginalis into
an evolutionary context in the early stages of conversion.
MATERIAL AND METHODS
Parasite culture
Trichomonas vaginalis strain MICH01, susceptible to
metronidazole (TvSt-MS), was grown in Diamond’s
310
Arg

aez-Correa et al.
trypticase–yeast extract–maltose (TYM medium) supple-
mented with 12% heat-inactivated horse serum. Para-
sites were incubated at 37 °C in microaerophilic
atmosphere in fully filled and sealed culture flasks. The
iron-supplemented medium was prepared by adding fer-
rous sulfate at different final concentrations (30, 60, and
120 lM). Iron was depleted by adding 2,20 -dipyridyl
(Sigma Chemical Co., St. Louis, MO), a membrane per-
meable Fe2+ chelator, at a final concentration of
100 lM.
Metronidazole resistance development
Three metronidazole-resistant strains of T. vaginalis strain
MICH01 (TvST-MRs) were developed for this study, as
described previously (Rasoloson et al. 2002), with some
modifications. Briefly, parasites growing under microaero-
philic conditions were exposed initially to low concentra-
tion of metronidazole: 0.25 lg/ml (~1.5 lM) for 48 h and
the surviving trophozoites were transferred to fresh
drug-free TYM medium and allowed to grow for 48 h.
The procedure was repeated with the same concentra-
tion for at least five times by serial transfers in 48 h
intervals before higher drug concentrations were used.
MICH01 trophozoites were adapted to 0.75 lg/ml
metronidazole (~4.5 lM = TvSt-MR1), then to 1.5 lg/ml
metronidazole (~9.0 lM = TvSt-MR2), and finally to
3.0 lg/ml metronidazole (~17.5 lM = TvSt-MR3) over a
period of 4 mo.
Metronidazole susceptibility assay
Susceptibility of trichomonads to metronidazole was deter-
mined in vitro. Briefly, 1.5 9 105 Trichomonas tropho-
zoites per ml were incubated in the presence of serially
diluted metronidazole (0–20 lg/ml for susceptible strains
and 0–200 lg/ml for resistant strains) in the TYM medium
(1.0 ml final volume), using microtubes at 37 °C. The via-
bility of the cells was determined by trypan blue exclusion
assay. Parasites were counted using a hemocytometer.
Minimum concentration of metronidazole, at which nonvi-
able cells were found, was considered as its MIC. The
experiment was repeated at least three times to confirm
the MIC.
Quantification of iron in T. vaginalis parasites
Parasites grown in normal medium for 48 h were
seeded at 107 ml1 in the different conditions tested.
Aliquots of approximately 108 parasites were harvested
and washed twice in ice-cold PBS (0.1 M sodium phos-
phate buffer pH 7.2, 0.15 M NaCl) and pellets were dis-
solved in 69% (v/v) nitric acid and digested by
microwave heating (T = 175 °C, P = 15 bar, 10 min ramp
from room temperature) by 10 min and analyzed by
flame atomic absorption spectroscopy (FAAS) in the M
series atomic absorption spectrometer (Thermo Fisher
Scientific-Life Technologies, Waltham, MA, USA).
© 2018 International Society of Protistologists
Journal of Eukaryotic Microbiology 2019, 66, 309–315
Arg

aez-Correa et al.
Isolation of RNA and first strand cDNA synthesis
Total RNA was isolated from susceptible and resistant
T. vaginalis trophozoites using RNAeasy (QIAGEN, Hilden,
Germany) following the manufacturer’s instructions. The
isolated RNA (150 ng) was treated with DNase (Roche,
Basel, Switzerland), to ensure that there was no contami-
nation with genomic DNA in the qRT-PCR analysis. First-
strand cDNA was synthesized using RevertAid First Strand
cDNA Synthesis Kit (Thermo Fisher Scientific-Life Tech-
nologies) using DNase-treated RNA following manufac-
turer’s instructions.
Real-time PCR analysis
Quantitative reverse trancriptase PCR (qRT-PCR) was per-
formed to quantify the fold change in expression of target
genes with cDNA equivalent to 30 ng RNA using Thermo
Scientific Maxima SYBR Green/ROX qPCR Master Mix (2X)
in StepOne real-time PCR instrument (Applied Biosystems,
Foster City, CA, USA). Thermal cycling was performed using
two-step cycling protocol according to the company’s pro-
cedures as follow: 10 min initial activation step at 95 °C fol-
lowed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s
(annealing and extension). DDCt method was used to com-
pare the relative expression of the metronidazole suscepti-
ble vs. metronidazole resistance conditions (Livak and
Schmittgen 2001). The DNATopII gene was used as internal
control to normalize the expression (dos Santos et al. 2015).
The primers used for the study were designed specifically
for real-time PCR and have been detailed in Table 1.
Statistical analyses
Statistical analyses were conducted with GraphPad Prism
6.0 (GraphPad, San Diego, CA, USA). Statistically signifi-
cant expression changes were calculated using one-way
ANOVA. The level of significance was also determined by
the Bonferroni method comparing all groups vs. the con-
trol (P < 0.05).
RESULTS
The MIC against strain TvSt-MS confirmed susceptibility
(15.2 lg/ml) to metronidazole in microaerophilic
Table 1. List of primers used in this study for real-time PCR analysis
Genes Forward
TvPfo AGGGCAAGAACTGGGATCAG
TvFdx TGCATCTGCAAGCACGTTTC
TvHyd GGAACTCGCACCAATTGACC
TvZIP4 AAGGCCTTGCCTTGGGAATC
TvSOD-Fe GGGAACATGCTTGGTACATCG
TvIscA GCGTTTGCACAGAAGAAGCC
© 2018 International Society of Protistologists
Journal of Eukaryotic Microbiology 2019, 66, 309–315
Iron Limit Metronidazole Resistance in Trichomonas vaginalis
conditions. Moreover, when the metronidazole susceptibil-
ity was tested in the presence of iron, a dose-dependent
decline in viability rates was observed in trophozoites of
TvSt-MS in media containing different increased concen-
trations of FeSO4 (Fig. 1). Exposure of TvSt-MS to media
containing 60 lM of FeSO4 significantly decreased the
MIC of metronidazole to 9.1 lg/ml. Further increments in
the level of FeSO4 to 120 lM significantly decrease the
viability rates (~45%) compared to those observed in
trophozoites of TvSt-MS cultured in medium containing
only metronidazole.
To check if an increase in the susceptibility of T. vaginalis
to metronidazole due to iron supplementation is limited to
nonresistant strains, we performed MIC tests for three
early low-resistant strains. In addition, a ferrous iron chelat-
ing agent (2,20 -dipyridyl—DIP) was used to validate the iron
effect. Comparison of MICs for early low-resistant strains
with those for wild-type strain showed that metronidazole
MICs for TvSt-MR1, TvSt-MR2, and TvSt-MR3 strains were
~2-, ~4-, and ~6-times higher than for TvSt-MS, respectively
(Table 2). Interestingly, when parasite cultures were sup-
plemented with iron by addition of exogenous FeSO4
(120 lM), it significantly increased the sensitivity to metro-
nidazole only in the first two resistant strains (TvSt-MR1
and TvSt-MR2). No significant differences were detected in
the MIC values for TvSt-MR3 strain grown in different con-
centrations of iron. The addition of DIP (100 lM) to iron-rich
medium caused the rapid recovery of MIC values for all
resistant strains, showing that increased sensitivity to
metronidazole was due to iron effect.
In order to confirm the role of iron in the metronidazole
susceptibility of T. vaginalis trophozoites, we measured
the intracellular iron content of both susceptible and
metronidazole-resistant parasites grown in different iron
conditions. No significant changes in the iron contents for
all strains cultured in standard TYM medium were
observed (Fig. 2). However, following iron supplementa-
tion with FeSO4 (120 lM), the levels of cytosolic iron
were increased in all strains, but when we performed a
comparison of iron content in both susceptible and
metronidazole-resistant parasites, revealed that the extent
of iron levels for TvSt-MR1 and TvSt-MR2 strains was sig-
nificantly lower (P < 0.05) than that in the TvSt-MS and
TvSt-MR3 strains, which showed similar iron levels. The
latter difference in iron decrease was more significant
Primer sequences (50 -30 )
Reverse
AATTCGATGAGTGGCTGGCG
GTGTGATAGCGCAAGCAAGG
TATGCCGTGAGCAACTGCAA
ACGCGAAAGCTTCAACTGGT
GCAGCCTTTAAGTTCTGCTCA
TACTGGAAACCTGCGCATCC
311
Iron Limit Metronidazole Resistance in Trichomonas vaginalis
100
80
Trophozoite viability (%)
60
40
20
0 10
0 3 6 9
Metronidazole concentraon (μg/ml)
Figure 1 Assessment of metronidazole activity against Trichomonas
vaginalis in response to iron. The effect of metronidazole on the viabil-
ity of trophozoites of T. vaginalis was measured in normal medium
and in the presence of 30-, 60-, and 120 lM of ferrous sulfate
(FeSO4) to confirm the effect of iron supplementation on susceptibili-
ties. Mean and standard deviations of at least three independent sets
of experiments are shown.
Table 2. Impact of iron in the MICs of metronidazole-resistant strains
of Trichomonas vaginalis
MIC (lg/ml)
Metronidazole-
resistant strains Normal FeSO4
of T. vaginalis medium (120 lM)
Strain TvSt-MR1 31.15  3.52* 19.53  4.66*
Strain TvSt-MR2 60.94  4.49* 47.11  3.24*
Strain TvSt-MR3 94.06  8.19 87.41  5.17
*P < 0.05.
(P < 0.01) for the first metronidazole resistant-strain (TvSt-
MR1). Interestingly, when trophozoites were cultured in
the presence of DIP (100 lM) in addition to FeSO4, the
intracellular iron levels decrease substantially (Fig. 2),
restoring intracellular iron content to the observed in nor-
mal medium.
Earlier studies had demonstrated diminished transcrip-
tion, and in some instances iron-regulated expression, of
several genes in metronidazole-resistant strains of T. vagi-
nalis, including TvHyd (Hydrogenase-Fe), TvFdx (ferre-
doxin), and TvPfo (PFO) involved in metronidazole
activation. Therefore, transcription levels of these genes
were measured of both susceptible and metronidazole-
resistant parasites using qRT-PCR analysis (Fig. 3). No
changes in transcription levels of TvHyd, TvFdx, and TvPfo
between TvSt-MS and TvSt-MRs strains were seen,
except for TvHyd whose level of expression was seen
increased in TvSt-M3 in comparison with the parent
susceptible strain.
Drug treatments might result in alteration in iron trans-
port and iron-related oxidative stress. Therefore, transcrip-
tion levels of the genes that are known to be regulated by
312
Arg

aez-Correa et al.
*
Normal medium 60 **
30 μM FeSO4 TvSt-MS strain
60 μM FeSO4 50 TvSt-MR1 strain
Intracellular Iron Content (µM)
120 μM FeSO4 TvSt-MR2 strain
TvSt-MR3 strain
40
30
20
12 15
0
TYM medium TYM medium TYM medium
+ FeSO4 (120 µM) + FeSO4 (120 µM)
+ Dipyridyl (100 µM)
Figure 2 Metronidazole resistance of Trichomonas vaginalis is linked
to iron content. Susceptible and metronidazole-resistant strains of
T. vaginalis were grown on TYM medium alone (control) in the pres-
ence of 120 lM of FeSO4, showing lowest iron content in the early
stages of metronidazole resistance. Supplementation of 100 lM for
2,2, dipyridyl showing restoring iron values compared to control. Cul-
ture pellets were analyzed by atomic absorption spectrometry for their
content in iron. Mean and standard deviations of at least three inde-
pendent sets of experiments are shown. *P < 0.05, **P < 0.01.
this metal and that have been implicated in iron transport
FeSO4
(120 lM) + Dip
(TvZIP4), Fe-S cluster assembly (TvIscA), and oxidative
(100 lM) stress protection (TvSOD-Fe) were measured. The qRT-
PCR analysis showed significant difference between
36.35  3.51 TvST-MS and TvSt-MR strains in the expression of TvZIP4,
69.02  4.75 TvIscA, and TvSOD-Fe genes (Fig. 3). Interestingly, tran-
101.12  6.86 scription levels of TvZIP4 and TvIscA genes were down-
regulated in TvSt-MR1 strain and maintain diminished in
TvSt-MR2 strain, while their expression levels in the TvSt-
MR3 strain were restored to similar values observed in
the TvST-MS strain. In contrast, expression levels of the
TvSOD-Fe gene were upregulated in TvSt-MR1 strain,
after normalized levels were observed in TvSt-MR2 strain,
to later being downregulated in the TvSt-MR3 strain.
DISCUSSION
It has been reported that iron metabolism in several
microorganisms is relevant for the activity of diverse
antimicrobial agents and that this situation could change
evolution of antibiotic resistance (Me
hi et al. 2014).
Indeed, in aerobic or microaerophilic habitats, the involve-
ment of iron metabolism in the antimicrobial activity
includes alterations in drug-mediated redox stress, which
may induce an additional oxidative damage via Fenton
reaction, by the formation of either highly reactive hydro-
xyl radicals or iron–oxo intermediates (Bresgen and Eckl
2015; Mart
ınez and Rojo 2011).
A high iron dependency has been reported for T. vagi-
nalis, which favors its growth and regulates some of the tri-
chomonal virulence properties (Lehker and Alderete 1992).
Here, we explored if iron availability affects the susceptibil-
ity of T. vaginalis to metronidazole. Our results demonstrate
© 2018 International Society of Protistologists
Journal of Eukaryotic Microbiology 2019, 66, 309–315
Arg

aez-Correa et al. Iron Limit Metronidazole Resistance in Trichomonas vaginalis

Figure 3 Evaluation of differential gene expression in metronidazole-susceptible and metronidazole-resistant strains of Trichomonas vaginalis by
real-time PCR analysis. Compared with TvSt-MS and TvSt-MR3, TvSt-MR1 and TvSt-MR2 strains showed a significant decrease of both TvZIP4
and TvIscA expression. In resistant TvSt-MR1 strain, a significant increase of TvSOD-Fe expression was observed. No significant differences
between the four strains were seen for expression of TvHyd, TvFdx, and TvPfo. Significances are indicated for comparison with the TvSt-MS
strain. *P < 0.05, **P < 0.01.

that iron supplementation results in increased sensitivity of
T. vaginalis to metronidazole in both susceptible- and resis-
tant strains (Fig. 1, Table 2). To confirm whether the
enhanced susceptibilities observed are due to iron only, we
diminished the iron concentrations in the supplemented
media by iron chelating, which restored the metronidazole-
resistant phenotypes similar to that for the corresponding
parent strains when grown on media without iron. These
results are similar to that seen in Bacteroides fragilis, where
its metronidazole susceptibility is dependent on the iron sta-
tus of the cell (Veeranagouda et al. 2014).
Our results revealed that the TvSt-MS strain can incor-
porate higher concentration of iron (Fe2+) compared to
TvSt-MR1 and TvSt-MR2 strains. This increase in intracel-
lular Fe2+ in the metronidazole-susceptible strain suggests
the presence of an important mechanism in T. vaginalis to
derive an oxidative stress induced by intracellular iron
accumulation. Also, we demonstrate a decrease in iron
content in the early low-resistant strains TvSt-MR1 and
TvSt-MR2 in comparison to the susceptible strain, which
supports that these changes in the intracellular iron con-
centration could play a role in the mechanism of metron-
idazole resistance in T. vaginalis.
This decrease in intracellular Fe2+ in the metronidazole-
resistant strains TvSt-MR1 and TvSt-MR2 could be related
to differential expression of iron-regulated genes, which
may have subsequent effects on the expression of redox
pathways that affect either metronidazole activation or
metronidazole toxicity as described previously (Bresgen
and Eckl 2015; Veeranagouda et al. 2014). With respect to
metronidazole activation in T. vaginalis, reduction of tran-
scription of TvHyd, TvFdx, and TvPfo genes has been
related to drug-resistance, principally in anaerobic condi-
tions (Kulda et al. 1993). In the case of the TvSt-MR1 and
TvSt-MR2 strains, no significant changes were observed in
the transcription of TvHyd, TvFdx, and Tvpfo genes, which
indicates that the expression of these genes is not respon-
sible for the metronidazole-resistance observed in these
strains, consistently with that reported for metronidazole
resistance in the presence of oxygen, denominated aerobic
resistance (Leitsch et al. 2009; Tachezy et al. 1993).
Our results have shown that the expression of TvZIP4,
TvIscA, and TvSOD-Fe genes change significantly in TvSt-
MR1 strain (Fig. 3). We previously suggested the possible
role of TvZIP4 as an iron transporter through the plasmatic
membrane in T. vaginalis (Fern
andez-Mart
ın et al. 2017).

© 2018 International Society of Protistologists

Journal of Eukaryotic Microbiology 2019, 66, 309–315 313
Iron Limit Metronidazole Resistance in Trichomonas vaginalis
The reduction in the expression of this putative iron trans-
porter in the early stages of metronidazole resistance is
similar to that seen in Bacteroides fragilis where the
increased metronidazole resistance was agreed to the
reduced cellular iron content due to a deficiency of a fer-
rous iron transporter (Veeranagouda et al. 2014). Indeed, it
has been shown that the deletion of the gene coding for
ferric reductase confers resistance to antibiotics in Pseu-
domonas (Yeom et al. 2010).
The disruption of iron transport may result in an imbal-
ance of intracellular iron content leading to deregulation of
iron-regulated genes, as in this case the TvIscA gene
(Beltr
an et al. 2013), which showed downregulation in
their expression which may have effect on the assem-
blage of Fe-S cluster required for the activation of the pro-
teins as TvHYD, TvFDX, and TvPFO, involved in
metronidazole reduction. This could have an effect on the
redox pathways by increasing the antioxidant activity of
SOD-Fe, reflected in an upregulation of their expression in
the TvSt-MR1 strain. Although a previous report not
revealed changes in the expression of the SOD-Fe gene in
Entamoeba histolytica isolates during metronidazole stress
(Iyer et al. 2014), they do not evaluated the expression of
SOD in the early stages of metronidazole resistance, since
they compared the susceptible strain against a strain
adapted to 20 M of metronidazole, similar to the observed
in this work between TvSt-MS and TvSt-MR3 (17.5 lM)
strain (Fig. 3).
In conclusion, the results indicate that the metronida-
zole susceptibility of the T. vaginalis strains is likely to be
dependent of the iron content of trophozoites, in which
iron uptake could play an important role. In the clinical
view, this could serve as a therapy against T. vaginalis
infection, with the co-administration of metronidazole
with agents that may increase the intracellular iron con-
tent to maximize treatment efficacy. However, it is
important to note that further analysis of the role of iron-
dependent oxidative stress and the metronidazole resis-
tance on T. vaginalis is required to understand the
molecular connection between metronidazole action and
iron content.
ACKNOWLEDGMENTS
This work was undertaken as part of a research project
supported by grant 237990 (to J.C. Torres-Romero) from
Consejo Nacional de Ciencia y Tecnolog
ıa (CONACYT),
Me
xico. W. Arg
aez-Correa was a scholarship recipient
from CONACYT.
LITERATURE CITED
Beltra
n, N. C., Horv

athov
a, L., Jedelsk
y, P. L., Sedinov

a, M.,
Rada, P., Marcincikov
a, M., Hrd
y, I. & Tachezy, J. 2013. Iron-
induced changes in the proteome of Trichomonas vaginalis
hydrogenosomes. PLoS ONE, 8:e65148.
Bradic, M., Warring, S. D., Tooley, G. E., Scheid, P., Secor, W. E.,
Land, K. M., Po-Jung, H., Ting-Wen, C., Chi-Ching, L., Tang, P.,
Sullivan, S. A. & Carlton, J. M. 2017. Genetic indicators of drug
314
Arg

aez-Correa et al.
resistance in the highly repetitive genome of Trichomonas vagi-
nalis. Genome Biol. Evol., 9:1658–1672.
Bresgen, N. & Eckl, P. M. 2015. Oxidative stress and the homeo-
dynamics of iron metabolism. Biomolecules, 5:808–847.
Cudmore, S. L., Delgaty, K. L., Hayward-McClelland, S. F., Petrin,
D. P. & Garber, G. E. 2004. Treatment of infections caused by
metronidazole-resistant Trichomonas vaginalis. Clin. Microbiol.
Rev., 17:783–793.
Cudmore, S. L. & Garber, G. E. 2010. Prevention or treatment:
the benefits of Trichomonas vaginalis vaccine. J. Infect. Public
Health, 3:47–53.
Fern
andez-Mart
ın, K. G., Alvarez-S
anchez, M. E., Arana-Arg

aez, V.
E., Alvarez-S
anchez, L. C., Lara-Riegos, J. C. & Torres-Romero,
J. C. 2017. Genome-wide identification, in silico characterization
and expression analysis of ZIP-like genes from Trichomonas
vaginalis in response to Zinc and Iron. Biometals, 30:663–675.
Iyer, L. R., Singh, N., Verma, A. K. & Paul, J. 2014. Differential
expression and immunolocalization of antioxidant enzymes in
Entamoeba histolytica isolates during metronidazole stress.
Biomed. Res. Int., 2014:704937.
Kissinger, P. 2015. Trichomonas vaginalis: a review of epidemio-
logic, clinical and treatment issues. BMC Infect. Dis., 15:307.
Kulda, J., Tachezy, J. & Cerkasovova, A. 1993. In vitro induced
anaerobic resistance to metronidazole in Trichomonas vaginalis.
J. Eukaryot. Microbiol., 40:262–269.
Lehker, M. W. & Alderete, J. F. 1992. Iron regulates growth of
Trichomonas vaginalis and the expression of immunogenic tri-
chomonad proteins. Mol. Microbiol., 6:123–132.
Leitsch, D. 2016. Recent advances in the Trichomonas vaginalis
field. F1000Res., 5:162–169.
Leitsch, D., Kolarich, D., Binder, M., Stadlmann, J., Altmann, F. &
Duche ^ne, M. 2009. Trichomonas vaginalis: metronidazole and
other nitroimidazole drugs are reduced by the flavin enzyme
thioredoxin reductase and disrupt the cellular redox system.
Implications for nitroimidazole toxicity and resistance. Mol.
Microbiol., 72:518–536.
Livak, K. J. & Schmittgen, T. D. 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the 2DDCT
method. Methods, 25:402–408.
Mart
ınez, J. L. & Rojo, F. 2011. Metabolic regulation of antibiotic
resistance. FEMS Microbiol. Rev., 35:768–789.
Me
hi, O., Bogos, B., Cso € rgo
}, B., P

Papp, B. &
al, F., Nyerges, A.,
P
al, C. 2014. Perturbation of iron homeostasis promotes the
evolution of antibiotic resistance. Mol. Biol. Evol., 31:2793–
2804.
Menezes, C. B., Frasson, A. P. & Tasca, T. 2016. Trichomoniasis-
are we giving the deserved attention to the most common non-
viral sexually transmitted disease worldwide? Microb. Cell,
3:404–419.
O’Hanlon, D. E., Moench, T. R. & Cone, R. A. 2013. Vaginal pH
and microbicidal lactic acid when lactobacilli dominate the
microbiota. PLoS ONE, 8:e80074.
Pal, R., Hameed, S. & Fatima, Z. 2015. Iron deprivation affects
drug susceptibilities of mycobacteria targeting membrane integ-
rity. J. Pathog., 2015:1–10.
Prasad, T., Chandra, A., Mukhopadhyay, C. K. & Prasad, R. 2006.
Unexpected link between iron and drug resistance of Candida
spp.: iron depletion enhances membrane fluidity and drug diffu-
sion, leading to drug-susceptible cells. Antimicrob. Agents Che-
mother., 50:3597–3606.
Rasoloson, D., Vanacova, S., Tomkova, E., Razga, J., Hrdy, I.,
Tachezy, J. & Kulda, J. 2002. Mechanisms of in vitro develop-
ment of resistance to metronidazole in Trichomonas vaginalis.
Microbiology, 148:2467–2477.
© 2018 International Society of Protistologists
Journal of Eukaryotic Microbiology 2019, 66, 309–315
Arg

aez-Correa et al.
dos Santos, O., de Vargas Rigo, G., Frasson, A. P., Macedo, A. J.
& Tasca, T. 2015. Optimal reference genes for gene expression
normalization in Trichomonas vaginalis. PLoS ONE, 10:
e0138331.
Sen, G., Mukhopadhyay, S., Ray, M. & Biswas, T. 2008. Querce-
tin interferes with iron metabolism in Leishmania donovani and
targets ribonucleotide reductase to exert leishmanicidal activity.
J. Antimicrob. Chemother., 61:1066–1075.
Tachezy, J., Kulda, J. & Tomkova, E. 1993. Aerobic resistance of
Trichomonas vaginalis to metronidazole induced in vitro. Para-
sitology, 106:31–37.
Tsugawa, H., Suzuki, H., Satoh, K., Hirata, K., Matsuzaki, J.,
Saito, Y., Suematsu, M. & Hibi, T. 2011. Two amino acids
mutation of ferric uptake regulator determines Helicobacter
pylori resistance to metronidazole. Antioxid. Redox Signal.,
14:15–23.
© 2018 International Society of Protistologists
Journal of Eukaryotic Microbiology 2019, 66, 309–315
Iron Limit Metronidazole Resistance in Trichomonas vaginalis
Upcroft, P. & Upcroft, J. A. 2001. Drug targets and mechanisms
of resistance in the anaerobic protozoa. Clin. Microbiol. Rev.,
14:150–164.
Veeranagouda, Y., Husain, F., Boente, R., Moore, J., Smith, C. J.
& Rocha, E. R. 2014. Deficiency of the ferrous iron transporter
FeoAB is linked with metronidazole resistance in Bacteroides
fragilis. J. Antimicrob. Chemother., 69:2634–2643.
Watt, L. & Jennison, R. F. 1960. Clinical evaluation of metronida-
zole. Br. Med. J., 2:902–905.
Weinstock, H., Trees, D. & Papp, J. 2008. Antimicrobial resis-
tance to sexually transmitted infections. In: Fong, I. W. &
Drlica, K. (ed.), Antimicrobial Resistance and Implications for
the 21st Century. Springer, Boston, MA. 2008:77–96.
Yeom, J., Imlay, J. A. & Park, W. 2010. Iron homeostasis affects
antibiotic-mediated cell death in Pseudomonas species. J. Biol.
Chem., 285:22689–22695.
315