GPM6A Variant (4:175633071A>G) Association with Depression and Claustrophobia-like

Disorders in Pakistani Population

Rida Arif1, Muhammad Labeeb Bajwa1, Sehreem Gill2, Rashid Saif1*

1
Decode Genomics, 323-D, Punjab University Employees Housing Scheme, Lahore, Pakistan
2
Department of Biochemistry, Kinnaird College for Women, Lahore, Pakistan
*Corresponding Author; rashid.saif37@gmail.com

Abstract:

Psychological and neurological disorders have taken special consideration in all populations
around the globe, general phobia is one of the major categories among this, particularly,
claustrophobia is the fear of confined places that varies in its intensities among people of
different origins. In general, depression is a serious mental illness that affects how you feel,
think, and respond to certain improvised intense situations. GPM6A-deficient mice foster
neuropsychiatric abnormalities which are provoked by stress-induced environments that
ultimately translate into depression and claustrophobia-like behavioral responses. The current
study reported GPM6A variant 4:175633071A>G association with depression and
claustrophobia-like disorders within the Pakistani population. This gene is prompted by stress in
humans which is located on 4q32-q34 that encodes a protein called glycoprotein M6A which
ultimately aids in synapse formation in the human brain. The subject mRNA variant r.2778T>C
transcript ID: NM_005277.5 (rs17061735A>G) located on the 8th exon is genotyped here and a
total of 53 samples were screened (cases=28, controls=25). This pilot study results showed that
21 & 7 samples were homozygous wild-type and heterozygous respectively among the cases
cohort, while all samples were found homozygous wild-type in the control cohort. Alternative
allele frequency among the cases & controls was 0.125 & zero respectively with χ2 association p-
value of 9.68×10-3. Furthermore, the subject variant may be genotyped with a large sample size
for more robust statistical significance. Alternatively, whole-genome association studies
(GWAS) may be designed to have better insight into this anxiety disorder in socio-economically
competitive societies around the globe.

Keywords: Depression, Claustrophobia, Homo sapiens, ARMS-PCR, GMP6A, rs17061725

Introduction:

Neuropsychiatric disorders provoke uncharacteristic behavior that alters the brain’s neural
network. The factors which may affect normal brain functioning are psychological,
environmental, and genetic predisposition. Finding the association of genetic variants with
neurological disorders is a potential area to explore, which may include claustrophobia,
depression, agoraphobia, and social anxiety/panic disorders. Depression and claustrophobia can
be caused by the dysfunction of the hippocampus; the part of the brain that controls how an
individual process fears and regulate emotions. According to world mental health
surveys, 12.5% of the population have claustrophobia among which the majority of them were
females [1]. On the other hand, the global estimated frequency of depressed patients was 3.44%
in 2017 which ascend 7-times after the COVID-19 outbreak in 2020 [2].
The genomic region of Chr.4 (4q32-q34) contains genes e.g., GPM6A and GPM6B which are
associated with different types of phobias as reported in several previous studies [3, 4]. Genetic
locus 4:175633071A>G (GCF_000001405.40) on exon 8th of GPM6A is considered to be
responsible for clinical depression and claustrophobia-like behaviors which are induced by stress
in the European population [3]. The gene called Glycoprotein M6A is a neuronal tetraspan
membrane glycoprotein that controls calcium channel activity and is involved in neuron
migration and stem cell differentiation. Initially, the GPM6A gene was considered to be an
antidepressant-responsive gene associated with stress present in the hippocampus of several
animal models with chronic stress as well [5-8]. It is previously established that the down-
regulation of GPM6A may lead to major neurological disorders [3, 4]. The population-based
postmortem statistical data also showed the altered expression of the GPM6A gene in the
hippocampus of suicidal cases with severe depression history [4]. So, the insight of genetic
polymorphism in the GPM6A gene is one of the contributing factors in the pathology of
schizophrenia, bipolar and claustrophobia-like disorders which can be modulated to overcome
such kind of neurological and behavioral anomalies in societies [9-11].

Current research discusses the relevance of general phobias, particularly claustrophobia and
depression associated with one of the variant r.2778T>C (c.*1834T>C) of GPM6A gene
transcript ID: (NM_005277.5) using ARMS-PCR genotyping technique within Pakistani
population with considerable sample size (Figure 1). No doubt, stress is a critical element in
provoking mental disorders, and anxiety-ridden behavior within the general population, but
particularly, aviation/space industry personnel (fighter & commercial pilots/astronauts/cabin-
crew) may be screened to have an insight of genetic potential of their responses against any
stress-induced challenging situations during flights and this screening test may be introduced in
their induction process as well for the general safety of passengers and for further genetic
counselling to propagate the healthy allele in the population.

Materials and Methods:

Sample collection and DNA extraction

A total of 53 blood samples were genotyped, including the depression/claustrophobia-like

disorders cohort (n=28) and control cohort (n=25) to study the association between GPM6A
locus 4:175633071A>G within the Pakistani population. K3-EDTA vacutainers were used to
collect samples of different gender and age groups experiencing multiple phobias and stored at
4οC till further usage. GDSBio (Guangzhou Dongsheng Biotech Co., Ltd) extraction kit was used
to extract genomic DNA by following manufacturer instructions.

Figure 1: Genomic location and multiple sequence alignment of the genotyped variant in different species
Primers designing for ARMS-PCR

ARMS-PCR primers were designed against GPM6A transcript ID (NM_005277.5) and its
properties were calculated using OligoCalc software
(http://biotools.nubic.northwestern.edu/OligoCalc.html). Allele-specific primers to amplify wild
and mutant alleles with an additional mismatch at the fourth position of 3’-end were designed to
increase specificity. Moreover, two regular internal control (IC) primers were also designed.

Table 1: ARMS-PCR primer sequences and properties

ARMS/IC Tm Length Product
Sequence (5'-3')
Primers (ºC) (bases) size (bp)
60.
Forward Common TTCATTTTGCTTCCTTTTCTTTATGC 26
1
60.
Reverse Normal GATTAATTGTAATGCCTGCTGCAA 24 271
3
59.
Reverse Mutant ATTAATTGTAATGCCTGCTGCAG 23
2
PCR 60.
Forward (IC) TAACCCACAGCCTCCTACAC 20
5
618
60.
Reverse (IC) TCAGCATCCTCCTCTGGACT 20
5
amplification protocol

SimpliAmp thermocycler (Applied Biosystems) was used to amplify wild and mutant type
variants of GPM6A. For each sample, two PCR reactions were performed separately with each
common forward primer and normal & mutant allele-specific ARMS reverse primer. At the same
time, the internal control region was also amplified using a regular set of primers from the
adjacent region of the targeted locus in each tube. A reaction mixture of a total of 16µL was
prepared which contains 2µl of extracted genomic DNA, 1 µl of 10.0 mM of each primer (N or
M- reverse primer, forward common primer, Forward and reverse IC primers), 1 unit Taq
polymerase, 2.5mM MgCl2, 2.5mM dNTPs, 1X Taq buffer, and PCR grade water. The PCR
protocol was initiated with denaturation at 95οC for 5 min, followed by 30 cycles of denaturation
(95οC for 30s), annealing (60οC for 30s), and extension (72οC for 30s). After that, the final
extension was performed at 72οC for 10 min. Gel electrophoresis was conducted to visualize the
PCR amplicons.

Figure 2: Thermal cyclic conditions of ARMS-PCR

Statistical hypothesis testing

The genetic association of GPM6A locus r.2778T>C was evaluated using χ2 statistics with the
PLINK data analysis toolset.

Table 2: Association of the subject variant with depression & claustrophobia-like disorders in Pakistani population

Alternative
Genotypic information
Protein allele frequency
# of Chr. cDNA variant p-Value
variant Homo- Homo-
samples Position NM_005277.5 Hetero-
NP_005268.1 wild mutant Cases Controls
(TC/%)
(TT/%) (CC/%)
r.2778T>C
53 4:175633071 p.= 46/87 7/13 0/0 0.125 0 9.68×10-3
c.*1834T>C

Results:

Genetic association of depression and claustrophobia-like disorders with the GPM6A variant has
never been reported in the Pakistani population to our knowledge. Blood samples were taken
from people experiencing these kinds of neuropsychiatric conditions within the subject
population. Polymorphism of GPM6A could disrupt the dynamics of gene regulation, we
explored the association of this gene with the genetic susceptibility to depression and
claustrophobia-like disorders.

A total of 53 samples (cases=28, controls=25) were genotyped against 4:175633071A>G variant,

46 samples were homozygous wild-type (TT) making up 87% percent of the total sampled
population, and 7 were heterozygous (TC) showing a 13% whereas, none of the samples
appeared as homozygous mutant. Within the cases cohort, 21 samples were homozygous wild-
type, while 7 samples were heterozygous males which show gender specificity of this disorder
within our screened individuals. Similarly, all samples were homozygous wild-type in the control
cohort. The alternative (C) and wild-type (T) allele frequencies were 0.125 & 0.875 in cases
while 0 & 1 were in control cohort respectively with an overall p-value of 9.68x10-3. Hence, this
variant is variable in the Pakistani population similar to other European populations but to a
lesser extent as we did not observe any homozygous mutant genotype in our studied individuals.
 Figure 3: ARMS-PCR amplification of targeted variant within 53 samples
Discussion:

GPM6A is a cholesterol-linked tetraspan that attaches to other neuronal membrane proteins

which ultimately stimulates the endocytosis of µ-opioid receptors from the surface of neuronal
cells since µ-opioids are known to aid in the regulation of fear and anxiety in mice and humans
[12, 13]. The genetic variability in the respective gene may lead to any unexpected functioning
of the neuron that can cause general neuropsychiatric disorders which are often assumed to be an
accustomed response to an environment or condition followed by a traumatic experience [5, 14].
The trigger however in a handful of cases may still be related to experiencing narrow or closed
spaces, traumatic brain injury, and various other stressful situations [15].

In the current study, a slight genetic association was observed in the GPM6A gene with
depression and claustrophobia-like behaviors within the Pakistani population. Seven
heterozygous individuals within the cases cohort out of a total of twenty-eight may show the
innate disposition of this ailment from light to mild intensity. A similar study from US and
Netherlands has revealed GPM6A (rs10520303) significant association with schizophrenia,
depression, and bipolar disorders with a significant p-value of 1⁄4 0.006 [9]. Another study from
China has also indicated GPM6A as one of the causal genes in triggering schizophrenia [16].
Moreover, an extensive study was also carried out in Germany disclosing the association of gene
GPM6A with mental disorders i.e., claustrophobia and claustrophobia-like behavior [3].

The present study suggests that genetic causes play a vital role in the onset of neurological
disorders, particularly in striving nations. In the future, GPM6A can be used as a biomarker for
screening depression and claustrophobia-like disorders in the general population, aviation/space
industry, and other stressful jobs. Furthermore, genetic counselling aspects may also be
addressed to aware the masses of the propagation of neurological and psychological disorders by
limiting the affected allele in the next generations. Getting genetic tests done for such kinds of
suffering may become a social norm for establishing healthy and inherited disease-free societies.

Conclusion:

The studied variant r.2778T>C showed a significant association with Pakistani depression &
claustrophobic victims with a very low alternative allele frequency of 0.125. The subject marker
may be used as a precursor for the genetic disposition of this anomaly. Furthermore, an inclusive
study may be designed with a large sample size to obtain a comprehensive genetic association of
the observed variant.

Ethical statement:

Blood samples were collected from voluntary camps with the permission of all
patients/individuals under the supervision of medical officers/staff and a consent form/letter is
provided as supplementary material in the manuscript.

Acknowledgement:

The authors acknowledged the medical centers and voluntary camps organizers for providing
blood samples.
Conflict of interest:

There is no conflict of interest among authors.

References:

1. Vadakkan, C. and W. Siddiqui, Claustrophobia. 2021: StatPearls Publishing, Treasure

Island (FL).
2. Bueno-Notivol, J., et al., Prevalence of depression during the COVID-19 outbreak: A
meta-analysis of community-based studies. International Journal of Clinical and Health
Psychology, 2021. 21(1): p. 100196.
3. El-Kordi, A., et al., A single gene defect causing claustrophobia. Transl Psychiatry, 2013.
3(4): p. e254.
4. Fuchsova, B., et al., Altered expression of neuroplasticity-related genes in the brain of
depressed suicides. Neuroscience, 2015. 299: p. 1-17.
5. Alfonso, J., et al., Gene expression analysis in the hippocampal formation of tree shrews
chronically treated with cortisol. Journal of Neuroscience Research, 2004. 78(5): p. 702-
710.
6. Alfonso, J., et al., Identification of genes regulated by chronic psychosocial stress and
antidepressant treatment in the hippocampus. European Journal of Neuroscience, 2004.
19(3): p. 659-666.
7. Cooper, B., E. Fuchs, and G. Flügge, Expression of the Axonal Membrane Glycoprotein
M6a Is Regulated by Chronic Stress. PLOS ONE, 2009. 4(1): p. e3659.
8. Monteleone, M.C., et al., Prenatal stress changes the glycoprotein GPM6A gene
expression and induces epigenetic changes in rat offspring brain. Epigenetics, 2014.
9(1): p. 152-160.
9. Boks, M.P.M., et al., Do mood symptoms subdivide the schizophrenia phenotype?
association of the GMP6A gene with a depression subgroup. American Journal of
Medical Genetics Part B: Neuropsychiatric Genetics, 2008. 147B(6): p. 707-711.
10. Greenwood, T.A., et al., Genome-Wide Association Study of Temperament in Bipolar
Disorder Reveals Significant Associations with Three Novel Loci. Biological Psychiatry,
2012. 72(4): p. 303-310.
11. Domschke, K., et al., Chromosome 4q31-34 panic disorder risk locus: association of
neuropeptide Y Y5 receptor variants. Am J Med Genet B Neuropsychiatr Genet, 2008.
147b(4): p. 510-6.
12. Wu, Q., et al., Post-transcriptional regulation of mouse mu opioid receptor (MOR1) via
its 3' untranslated region: a role for microRNA23b. Faseb j, 2008. 22(12): p. 4085-95.
13. Bowers, M.E., D.C. Choi, and K.J. Ressler, Neuropeptide regulation of fear and anxiety:
Implications of cholecystokinin, endogenous opioids, and neuropeptide Y. Physiol Behav,
2012. 107(5): p. 699-710.
14. Fishbain, D., et al., MR imaging as a trigger for persistent claustrophobia. AJR Am J
Roentgenol, 1989. 152(3): p. 653.
15. Bryant, R.A., et al., The psychiatric sequelae of traumatic injury. Am J Psychiatry, 2010.
167(3): p. 312-20.
16. Ma, C., et al., The integrated landscape of causal genes and pathways in schizophrenia.
Translational Psychiatry, 2018. 8(1): p. 67.