Name: Date:

IB Biology Period: Due:

Directions: Answer the following questions in full sentences. It is suggested that you use your notes, text,
and other resources.

1. Compare and contrast DNA and RNA using the table below. One example is given.

Feature RNA DNA

Number of Strands

Bases Present

Pentose Present

Name of Monomers

2. Scientists usually give DNA information as a sequence of nitrogenous bases without indicating the
presence of the phosphate group and the pentose. For example: “ATCGCGATAGCTAGCCCTGAG”.
Why would scientist do this without indicating the phosphate group and sugar component of each
nucleotide?

Turn to back 
3. Practice drawing the ladder of DNA in the below diagram. Finish the started strand by adding the
nucleotides A, C, T and their complementary strand.
G