Journal of Pharmacological Sciences 149 (2022) 53e59

Contents lists available at ScienceDirect

Journal of Pharmacological Sciences

journal homepage: www.elsevier.com/locate/jphs

Full Paper

Protective effects of tadalafil on damaged podocytes in an adriamycin-

induced nephrotic syndrome model
Natsumi Tomita a, Yuji Hotta a, *, Aya Naiki-Ito b, Akimasa Sanagawa a, Tomoya Kataoka c,
Yoko Furukawa-Hibi a, Satoru Takahashi b, Kazunori Kimura a, c
a
Department of Hospital Pharmacy, Graduate School of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe do-ri, Mizuho-ku, Nagoya 467-8603,
Japan
b
Department of Experimental Pathology and Tumor Biology, Graduate School of Medical Sciences, Nagoya City University, 1-Kawasumi, Mizuho-cho,
Mizuho-ku, Nagoya 467-8601, Japan
c
Department of Clinical Pharmaceutics, Graduate School of Medical Sciences, Nagoya City University, 1-Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-
8601, Japan

a r t i c l e i n f o a b s t r a c t

Article history: Podocyte injury is responsible for nephrotic syndrome. Previously, we found that tadalafil, a phospho-
Received 6 January 2022 diesterase 5 inhibitor, might have protective effects on podocytes. Here, we investigated the effects of
Received in revised form tadalafil in a nephrotic syndrome model and human podocyte cells.
21 February 2022
We divided adriamycin (ADR)-induced nephrotic syndrome model rats into the following groups:
Accepted 18 March 2022
Available online 25 March 2022
control þ vehicle, control þ tadalafil, ADR þ vehicle, and ADR þ tadalafil. The tadalafil-treated groups
were orally administered 10 mg/kg tadalafil for 2 weeks. Renal parameters were measured. Immuno-
histology and immunofluorescence assays of glomerular injury were performed. Human primary
Keywords:
Nephrotic syndrome
podocytes were treated with or without tadalafil, and ADR. Cell viability and permeability assays were
Podocyte injury performed.
PDE5 inhibitor ADR þ vehicle exhibited severe proteinuria compared with control þ vehicle and control þ tadalafil.
Animal model ADR þ tadalafil attenuated proteinuria compared with ADR þ vehicle. Wilms’ tumor 1 (WT1) immu-
Glomerular filtration barrier nostaining revealed that the number of WT1-positive cells was decreased by ADR; however, this
decrease was prevented by ADR þ tadalafil. In human podocytes, tadalafil increased the viability of ADR-
treated cells, which was abrogated by KT5823, a cGMP-dependent protein kinase (PKG) inhibitor.
Moreover, tadalafil prevented albumin permeability in ADR-treated cells. ADR treatment alone increased
the permeability of albumin compared with the control.
Tadalafil might inhibit kidney injury progression by preventing damage to podocytes and dysfunction
of the glomerular filtration barrier.
© 2022 The Authors. Production and hosting by Elsevier B.V. on behalf of Japanese Pharmacological
Society. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/
licenses/by-nc-nd/4.0/).

1. Introduction associated with clinical problems such as poor prognosis, long

Nephrotic syndrome causes chronic kidney disease (CKD) and
leads to end-stage kidney disease.1e3 It manifests as severe pro-
teinuria and low serum albumin level due to dysfunction of the
glomerular filtration barrier.4 Steroids and immunosuppressants
are widely used as symptomatic treatments; however, they are
* Corresponding author. Fax: þ81 52 836 3413.
E-mail address: yhotta@phar.nagoya-cu.ac.jp (Y. Hotta).
Peer review under responsibility of Japanese Pharmacological Society.
treatment, and steroid resistance.5e7
Podocyte injury is the cause of nephrotic syndrome. Podocyte
injury in nephrotic syndrome is caused by several conditions, such as
immune disorders, adverse effects of treatments including antiviral
therapy and anthracycline nonsteroidal anti-inflammatory drug
(NSAID) use, and gene mutations.4,8,9 Podocyte injury leads to
podocyte foot process effacement and podocyte loss,11,12 leading to
CKD progression. The podocyte slit diaphragm is an important
structure for the glomerular filtration barrier,13e15 which filters body
waste into urine; however, it retains proteins and blood components
that are necessary for the body. Podocyte injury causes the slit

https://doi.org/10.1016/j.jphs.2022.03.003
1347-8613/© 2022 The Authors. Production and hosting by Elsevier B.V. on behalf of Japanese Pharmacological Society. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
N. Tomita, Y. Hotta, A. Naiki-Ito et al.
diaphragm to collapse, leading to a decrease in the expression of
nephrin and podocin, the major components of the slit dia-
phragm.16,17 The glomerular filtration barrier becomes vulnerable,
leading to severe proteinuria.1 Podocyte injuries in nephrotic syn-
drome involve general pathological changes. They are also observed
in other kidney diseases, such as diabetic kidney disease and renal
dysfunction with hypertension, causing CKD.10,18,19 Therefore, the
prevention of podocyte injury is key for preventing kidney
dysfunction and CKD progression. Mechanisms underlying podocyte
injury are being studied globally for its prevention20,21; however, a
breakthrough treatment is still undiscovered.
Previously, we reported that a phosphodiesterase (PDE) 5 in-
hibitor, tadalafil, is renoprotective despite decreasing the blood
pressure in an animal model with CKD and hypertension.19 Tadalafil
might maintain the glomerular filtration barrier by preventing
podocyte foot process effacement, podocyte loss, and glomerulo-
sclerosis. PDE5 inhibitors can improve hemodynamics by upregu-
lating cyclic 30 , 50 guanosine monophosphate (cGMP) and relaxing
smooth muscles in the body. In our previous study, the direct effect
of tadalafil on podocytes and glomerular filtration barrier function,
and its independence in the improvement of hypertension and
renal hemodynamics were inconclusive. Furthermore, PDE5
expression and its protective effects on human podocytes have not
been explored.
In this study, we used an adriamycin (ADR)-induced nephrotic
syndrome animal model that exhibits podocyte injury to investi-
gate the renoprotective effects of tadalafil. Moreover, we used
primary human podocyte cells and assessed the direct effects of
tadalafil on podocyte viability and glomerular filtration function
under experimental conditions.
2. Materials and methods
2.1. Experimental protocol
In this study, we used 6-week-old male Wistar rats (Japan SLC
Inc., Shizuoka, Japan). They were housed in a room with controlled
temperature, humidity, and light cycle with free access to normal
water. The rats were divided into the following four groups:
control þ vehicle (n ¼ 6), control þ tadalafil (10 mg/kg, n ¼ 6),
ADR þ vehicle (n ¼ 5), and ADR þ tadalafil treatment (n ¼ 5). We
excluded rats that were not administered ADRs to induce nephrotic
syndrome. Adriamycin (7.5 mg/kg) was injected into the rats via the
tail vein, and control groups were injected saline. Tadalafil was
administered orally with 0.5% hydroxypropyl methylcellulose once
a day. Control þ vehicle and ADR þ vehicle group rats were treated
with the hydroxypropyl methylcellulose as vehicle. Two weeks
after ADR injection, the rats were maintained in metabolic cages for
24-h urine collection. After urine collection, the rats were eutha-
nized via excessive anesthesia with isoflurane. Blood samples were
collected from the inferior vena cava and the kidneys were har-
vested. The right kidney was used for the histopathological as-
sessments. The Ethics Committee of Nagoya City University
(H29eP-05) approved the animal procedures. The procedures were
performed according to the guidelines of the National Institutes of
Health Science of Japan.
2.2. Blood and urine analyses
Blood and urine samples were collected 2 weeks after ADR or
vehicle injection. Serum creatinine (SCr), blood urea nitrogen
(BUN), serum albumin, and urinary protein to creatinine ratio were
determined to evaluate kidney function. We entrusted these mea-
surements to FUJIFILM VET Systems Co., Ltd. (Tokyo, Japan).
54
Journal of Pharmacological Sciences 149 (2022) 53e59
2.3. Immunostaining
The right kidney tissues were harvested 2 weeks after ADR or
vehicle injection. They were fixed in 10% formalin for 2 days, and
then replaced with 70% ethanol. All tissues were embedded in
paraffin and serially sectioned to a thickness of 3 mm. Immuno-
staining was performed using Leica BOND-MAX (Leica biosystems,
Wetzlar, Germany). After deparaffinization and rehydration, the
sections were stained with Wilms’ tumor 1 (WT1; 1:200; cat. no.
M3561, Dako, Tokyo, Japan) for 30 min. The sections were then
incubated with mouse secondary antibody (cat. no. BA-2001, Vector
Laboratories, Burlingame, CA, USA), streptavidin-HRP (Dako),
peroxide block (Leica), and diaminobenzidine (Leica) stain. For the
evaluation of WT1-positive cells, 30 glomeruli in each sample were
randomly chosen and the WT1-positive cells in each glomerulus
were counted. We then calculated the average number of WT1-
positive cells per glomeruli.
2.4. Immunofluorescence staining
The kidney sections were also used for nephrin and podocin
immunofluorescence assays. After deparaffinization and rehydra-
tion, the sections were incubated with anti-nephrin antibody
(1:2000; cat. no. ab216341, Abcam, Cambridge, UK) or anti-podocin
antibody (1:500; cat. no. JB51-33, Novus Biologicals, Centennial, CO,
USA) for 1 h. After washing with PBS, the sections were incubated
with a fluorescein goat anti-rabbit IgG antibody (secondary anti-
body, 1:100; cat. no. F2765, Invitrogen, Waltham, MA, USA).
2.5. Cell culture and treatment
Primary human renal glomerular epithelial cells (HRGEpCs; Cell
Applications, Inc. San Diego, CA, USA), passage 3e5, were used. The
cells were seeded at 1.5  10⁴ cells/well in a 96-well plate or
1.5  10⁵ cells/well in a 12-well plate. The cells were exposed to
ADR (500 nM; SigmaeAldrich Co. LLC, St. Louis, MO, USA) with or
without tadalafil (50 nM; SigmaeAldrich Co. LLC.) and KT5823, a
cGMP-dependent protein kinase (PKG) inhibitor (500 nM; Cayman
Chemical, Ann Arbor, MI, USA). After 24 h of exposure, cell viability
was assessed using the CCK-8 assay kit (Dojindo Laboratories,
Kumamoto, Japan). The samples were also used for polymerase
chain reaction (PCR), western blotting, and permeability assays
under the same conditions.
Human pulmonary artery smooth muscle cells (PASMCs; ATCC,
Manassas, VA, USA), passage 4, were used as positive controls for
PDE5 in PCR and western blotting.
2.6. RNA extraction
The total RNA was extracted from HRGEpCs using the Purelink
RNA mini kit (Thermo Fisher Scientific, Waltham, MA, USA), ac-
cording to the manufacturer's instructions. RNA concentration and
quality were measured using NANO DROP (Thermo Fisher Scienti-
fic). Thereafter, 1 mg of total RNA was reverse transcribed using the
ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO,
Osaka, Japan), according to the manufacturer's instructions.
cDNA was mixed with KOD FX Neo. The PCR conditions were as
follows: 95  C for 10 min, 95  C for 30 s, 60  C for 30 s, 72  C for 30 s,
38 cycles, and 72  C for 2 min. The PCR products were separated on
a 2% agarose gel. The primer sequences are listed in Table 1. The
agarose gel was stained with ethidium bromide. Bands were
detected using an ATTO printgraph (ATTO, Tokyo, Japan).
N. Tomita, Y. Hotta, A. Naiki-Ito et al. Journal of Pharmacological Sciences 149 (2022) 53e59

Table 1 Table 2
Primer sequences for PCR. Renal parameters at 2 weeks.

Gene Sequence (50 e30 ) A

ACTB (NM_001101) Forward TGCTATCCCTGTACGCCTCT UPC Serum albumin (mg/dl)

Reverse CAGGACTCCATGCCCAGG
Controlþvehicle 1.69 ± 0.84 3.58 ± 0.51
PDE5 (NM_001083) Forward AACTCAACATAGAACCCACTGATCT
ContolþTad 0.80 ± 0.18 4.05 ± 0.61
Reverse CAATGTGCTAACAGTGGATGTTGT
ADRþvehicle 40.33 ± 13.26**,## 2.44 ± 0.28**,##
ADRþTad 15.54 ± 3.80*,##,☨☨ 2.68 ± 0.43**,##

B
2.7. Western blotting
SCr (mg/dl) BUN (mg/dl)

Proteins were extracted from HRGEpCs or PASMCs using the PRO- Controlþvehicle 0.24 ± 0.03 15.23 ± 1.38
ControlþTad 0.29 ± 0.04 16.11 ± 3.83
PREP Protein Extraction Solution (iNtRON Biotechnology Inc.,
ADRþvehicle 0.23 ± 0.02# 15.06 ± 1.05
Gyeonggi-do, Korea) and the BCA Protein Assay Reagent (Pierce ADRþTad 0.22 ± 0.02## 16.98 ± 2.64
Biotechnology, Waltham, MA, USA) was used to determine the total
A, UPC and serum albumin, B, SCr and BUN at 2 weeks.
protein concentration. Cell lysates containing 20 mg of total protein
UPC: urinary protein to creatinine ratio; SCr: serum creatinine; BUN: blood urea
were separated using 7.5% sodium dodecyl sulfate-polyacrylamide nitrogen; ADR: adriamycin; Tad: tadalafil.
gel electrophoresis and transferred on to a polyvinylidene difluor- N ¼ 5e6. Data (SD). Two-way ANOVA and Tukey’s test, *P < 0.05, **P < 0.01 vs.
ide membrane (Immobilin TM; Millipore Corp., Burlington, MA, Controlþvehicle, #P < 0.05, ##P < 0.01 vs. ControlþTad, ☨☨P < 0.01 vs. ADRþvehicle.
USA). The membranes were blocked with 5% skim milk in TBST and
incubated with either the primary rabbit anti PDE5 polyclonal anti-
body (1:5000; cat. no. ab14672, Abcam) in signal® 1 solution with 100 mg/ml albumin-Texas red (Thermo Fischer Scientific) and
(TOYOBO) or mouse anti-actin antibody (1:5000; cat. no. A5316, 10 mg/ml Inulin-FITC (Sigma Aldrich)econtaining medium. After
SigmaeAldrich) in TBST, followed by the secondary anti-rabbit 30 min, the medium in the lower side was collected, and the
immunoglobulin G (IgG; 1:20,000, GE Healthcare, IL, USA) in fluorescence intensity (FITC; Ex: 483 nm, Em: 530 nm, Texas red;
signal® 2 solution (TOYOBO) or anti-mouse IgG antibody conjugated Ex: 570 nm, Em: 630 nm) was measured (CLARIOstar; BMG Lab-
with horseradish peroxidase (1:20,000, GE Healthcare) in 5% skim tech, Offenburg, Germany). We calculated the albumin-to-inulin
milk in TBST. The bands were detected using AI600 (GE Healthcare). ratio as a glomerular filtration barrier function.

2.8. Transwell permeability assay 2.9. Statistical analysis

The Transwell assay method is shown in Fig. 1. HRGEpCs were
seeded on collagen 1 (KOKEN, Tokyo, Japan)-coated 24-well cell
culture insert (Corning, NY, USA) at 2  104 cells/well. After 4 h,
inserts were set in the 24-well plate; then, the medium was added
and the cells were incubated. The next day, 500 nM ADR was added
to the lower bottom with and without 50 nM tadalafil. After 24 h of
drug administration, the medium in the upper side was replaced
Data are expressed as mean ± standard deviation (SD). Com-
parisons were made using two-way ANOVA and Tukey's test for
animal study. One-way ANOVA and Tukey's or Dunnett's test were
performed for in vitro study. Differences were considered statisti-
cally significant at P < 0.05. All statistical analyses were performed
using EZR (version 1.55; Saitama Medical Center, Jichi Medical
University, Saitama, Japan).23

Fig. 1. Method of Transwell permeability assay. 1) Cell seeding on the lower side of the Transwell inserts. 2) Preparation for incubation in Transwell. 3) Medium changed in the
lower side, including DMSO or ADR with/without tadalafil. 4) Permeability of inulin and albumin assay. ADR: Adriamycin; Tad: tadalafil.

55
N. Tomita, Y. Hotta, A. Naiki-Ito et al. Journal of Pharmacological Sciences 149 (2022) 53e59

Fig. 2. WT1-positive cells in rat glomeruli. A) The black arrowheads are the WT1-immunostained kidney sections in each group: WT1-positive cells. B) The black columns represent
the analysis of the number of WT1-positive cells per glomerulus. Thirty glomeruli in each sample were evaluated, then the average of WT1-positive cells per glomerulus was
calculated; the black column represents control þ vehicle; the grey column represents control þ tadalafil; the light grey column represents ADR þ vehicle; the white column
represents ADR þ tadalafil. WT1: Wilms' tumor 1; ADR: Adriamycin; Tad: tadalafil. Data are expressed as mean (SD). n ¼ 5e6. Two-way ANOVA and Tukey's test: *P < 0.05,
**P < 0.01.

3. Results control þ vehicle and control þ tadalafil groups (P < 0.01). The
ADR þ tadalafil group showed lower urinary protein levels than
3.1. Renal parameters in model rats the ADR þ vehicle group (P < 0.01, Table 2A). The serum albumin
level was significantly lower in the ADR þ tadalafil and
Urinary protein levels in the ADR þ vehicle group after 2 ADR þ vehicle groups than in the control þ vehicle and
weeks were significantly higher than those in the control þ tadalafil groups (P < 0.01).

Fig. 3. Nephrin and podocin expression in rat glomeruli. Nephrin and podocin immunofluorescence in the kidney sections in each group. ADR: adriamycin; Tad: tadalafil; red
arrowhead: loss of expression for nephrin or podocin. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

56
N. Tomita, Y. Hotta, A. Naiki-Ito et al.
Fig. 4. PDE5 expression in primary human podocyte cells. A) PCR and B) western
blotting of PDE5 and Actb expression in positive control (human pulmonary artery
smooth muscle cells) and primary human podocytes.
The SCr and BUN levels were also measured. SCr in the
control þ tadalafil group was different from that in the
ADR þ vehicle and ADR þ tadalafil groups (Table 2B); however, this
was merely an individual difference and does not suggest that
tadalafil alone affected renal function.
3.2. Podocyte injury in rat kidney section
WT1 immunostaining was performed to evaluate podocyte
injury. Representative images of WT1-stained kidney tissues in
each group are shown in Fig. 2A. The number of WT1-positive cells
per glomerulus was lower in the ADR þ vehicle group than in the
control group (P < 0.01). There were no significant differences be-
tween the ADR þ tadalafil group and control group; however, the
number of WT1-positive cells was significantly higher than in the
ADR þ tadalafil group compared with ADR þ vehicle group.
(P < 0.05, Fig. 2B).
Nephrin and podocin immunofluorescence images are shown in
Fig. 3. In both control þ vehicle and control þ tadalafil groups,
nephrin and podocin were expressed along the glomerular base-
ment membrane and the entire glomeruli. However, the
ADR þ vehicle group exhibited a lack of expression compared with
the control þ vehicle group. The ADR þ Tad group maintained the
expression of nephrin and podocin compared with the
ADR þ vehicle group.
3.3. PDE5 expression in human podocyte cells
We used human podocytes (HRGEpCs), and we confirmed PDE5
existence in the cells. Representative images are shown in Fig. 4.
PDE5 protein and mRNA expression in human podocytes was
confirmed by western blotting and PCR, respectively. Human
PASMCs were used as the positive controls (Fig. 4). We performed
repeated experiments (n ¼ 3).
3.4. Cell viability after tadalafil treatment with and without PKG
inhibitor
Twenty-four hours after ADR treatment, the viability of cells was
lower than that of untreated cells (Fig. 5). Tadalafil supplementa-
tion further increased cell viability (P < 0.05). However, KT5823
inhibited tadalafil-induced increase in cell viability (P < 0.01).
3.5. Effect of tadalafil on glomerular filtration barrier in human
podocyte cells
The glomerular permeability assay was performed using a
Transwell. ADR addition increased albumin/inulin permeability
57
Journal of Pharmacological Sciences 149 (2022) 53e59
compared with the control; however, the addition of tadalafil to
ADR reduced albumin leakage (Fig. 6).
4. Discussion
Previously, we reported that tadalafil has renoprotective effects
when attenuating podocyte damage in a rat model of CKD.19 In this
study, we aimed to clarify the direct effects of tadalafil on podocytes
using a rat model and primary human podocytes. The nephrotic
syndrome model induced by ADR shows podocyte damage and is
widely used in nephrology studies.24,25 Here, the ADR-induced
nephrotic syndrome model exhibited severe proteinuria 2 weeks
after ADR injection. Tadalafil treatment prevented the progression
of nephrotic syndrome. Podocyte number and nephrin and podocin
expression were maintained in the kidney section of the tadalafil-
treated rats; however, they decreased in the ADR group. Nephrin
and podocin are key components of the slit diaphragm and play
important roles in the glomerular filtration barrier.16,26 We did not
evaluate expressions of nephrin and podocin quantitively; how-
ever, the findings of this study suggest that nephrin and podocin
expressions were maintained by tadalafil and decreased urinary
protein. These findings suggest that tadalafil prevents the pro-
gression of nephrotic syndrome by protecting the slit diaphragm
and podocyte detachment, and attenuating proteinuria.
PDE5 expression has been reported in mouse and rat podo-
cytes.22,27 However, its expression in human podocytes has not
been reported. In this study, we determined the existence of PDE5
in primary human podocytes. We induced ADR injury in human
podocytes with and without tadalafil supplementation. We then
evaluated cell viability. Tadalafil rescued the viability of podocytes
after being exposed to ADR for 24 h. Similar to that in animals,
tadalafil might effectively prevent podocyte damage in humans.
PDE5 inhibitors can prevent cGMP degradation, which leads to
upregulation of the PKG pathway. To investigate whether tadalafil
attenuates podocyte loss via the PKG pathway, we added KT5823 to
Fig. 5. Cell viability after 24 h of ADR exposure and effects of tadalafil and KT5823. The
percentage was calculated with the control as 100%. ADR: adriamycin; Tad: tadalafil.
Data are expressed as mean (SD): n ¼ 3. One-way ANOVA and Dunnett's test: *P < 0.05,
**P < 0.01.
N. Tomita, Y. Hotta, A. Naiki-Ito et al.
Fig. 6. Transwell permeability assay in human podocyte cells. Percentage was calculated with the no-cell seeded well as 100%. ADR: adriamycin; Tad: tadalafil. Data are expressed as
mean (SD): n ¼ 5. One-way ANOVA and Tukey's test: *P < 0.05, **P < 0.01.
ADR- and tadalafil-treated podocytes. This addition prevented the
improvement in cell viability. The PKG pathway is involved in cell
viability and apoptosis in other cells.28e30 Extracellular signal-
regulated kinase, cAMP response element binding protein, and
vasodilator-stimulated phosphoprotein, which are downstream of
PKG, are reported to be activated and to promote cell viability.31e33
In addition, the cGMP-dependent and PKG-independent pathways
are reported in the relaxation of the pulmonary artery by sildena-
fil.34 There is a possibility that the PKG-independent pathway is
also involved in the effects of tadalafil on human podocyte cell
function.
Using a Transwell assay, we developed an evaluation system
to measure the permeability of inulin or albumin and investi-
gated whether tadalafil maintained the barrier system. The
permeability of inulin in ADR with and without tadalafil
administration was similar to that of the control. Inulin was fully
filtered through the glomeruli. Cell number and cell density may
affect glomerular filtration. Therefore, we set the inulin perme-
ability of each well to 100% and calculated the albumin to inulin
permeability ratio to evaluate the filtration function. Moreover,
the albumin to inulin ratio revealed that tadalafil treatment
maintained the glomerular filtration barrier reduced by ADR
supplementation.
Improvement in cell viability and maintenance of the
glomerular filtration barrier revealed that tadalafil directly affects
human podocytes. Proteinuria, caused mainly by podocyte
dysfunction, is observed in the early phase of kidney disease, and
promotes the progression of renal dysfunction.2,35 Our investi-
gation revealed the effects of tadalafil on podocyte damage in both
animal and human podocytes, which is a key finding to prevent
podocyte injury.
This study had some limitations. First, we did not investigate the
class-effect of other PDE5 inhibitors, such as sildenafil and varde-
nafil. These PDE5 inhibitors are also renoprotective.36,37 Our find-
ings suggest that tadalafil affects podocyte injury through the PKG
pathway; therefore, this might be a class effect. However, both
sildenafil and vardenafil interact via their pyrazolopyrimidinone
and piperazine groups. Tadalafil has a different binding mode than
the other PDE5 inhibitors, and this characteristic is reported to be
due to interaction via its methylenedioxyphenyl group.38 Tadalafil
is more selective and has a higher affinity for PDE5 than that of
58
Journal of Pharmacological Sciences 149 (2022) 53e59
sildenafil and vardenafil. Also, tadalafil is known to be a long-acting
compound compared to sildenafil and vardenafil.39,40 Therefore,
tadalafil might exhibit distinct effects from those of sildenafil and
vardenafil. Second, we started the tadalafil treatment and induced
podocyte damage at the same time. Considering its clinical use, we
should investigate the effect after the damage has occurred. Third,
our study was performed only in rats. Pharmacokinetic differences
of tadalafil between humans and rats are unclear and we did not
investigate these differences in this study. There are some reports
that investigated the pharmacokinetics of tadalafil in rats or
humans41,42 and there seem to be pharmacokinetic differences of
tadalafil between the two species. Also, tadalafil exposure is known
to be changed by renal function in clinical studies.43 Therefore, we
should consider these differences and investigate the effects of
tadalafil on the human kidney.
There is a clinical report that demonstrates the effects of tada-
lafil on contrast-induced acute kidney injury in chronic kidney
disease patients.44 Other reports revealed that sildenafil attenuated
albuminuria in diabetic patients, who were previously treated with
antihypertensive drugs but did not show improvements in kidney
function.45,46 There is a possibility that tadalafil has renoprotective
effects on patients with kidney disease.
We found that tadalafil protected the podocytes. This insight
might be a clue for repositioning drugs and investigating new tar-
gets to treat kidney dysfunction.
Funding sources
None.
Declaration of competing interest
The authors indicated no potential conflicts of interest.
Acknowledgments
We would like to thank Editage (www.editage.com) for English
language editing.
N. Tomita, Y. Hotta, A. Naiki-Ito et al. Journal of Pharmacological Sciences 149 (2022) 53e59

References 25. Wang XW, Tian RM, Yang Y, et al. Tripterygium glycoside fraction n2 amelio-
rates adriamycin-induced nephrotic syndrome in rats by suppressing
apoptosis. J Ethnopharmacol. 2020;257:112789.
1. Daehn IS, Duffield JS. The glomerular filtration barrier: a structural target for
26. Huber TB, Kottgen M, Schilling B, Walz G, Benzing T. Interaction with podocin
novel kidney therapies. Nat Rev Drug Discov. 2021;20:770e788.
facilitates nephrin signaling. J Biol Chem. 2001;276:41543e41546.
2. Iseki K, Ikemiya Y, Iseki C, Takishita S. Proteinuria and the risk of developing
27. Czirok S, Fang L, Radovits T, et al. Cinaciguat ameliorates glomerular damage by
end-stage renal disease. Kidney Int. 2003;63:1468e1474.
reducing ERK1/2 activity and TGF-ß expression in type-1 diabetic rats. Sci Rep.
3. Kolb A, Gallacher PJ, Campbell J, et al. Scottish Renal Biopsy Registry. A National
2017;7:11218.
registry study of patient and renal survival in adult nephrotic syndrome. Kidney
28. Wong JC, Fiscus R. Essential roles of the nitric oxide (no)/cGMP/protein kinase
Int Rep. 2020;6:449e459.
G type-Ia (PKG-Ia) signaling pathway and the atrial natriuretic peptide (ANP)/
4. Kidney Disease: Improving Global Outcomes (KDIGO) Glomerular Diseases
cGMP/PKG-Ia autocrine loop in promoting proliferation and cell survival of
Work Group. KDIGO 2021 Clinical practice guideline for the management of
OP9 bone marrow stromal cells. J Cell Biochem. 2011;112(3):829e839.
glomerular diseases. Kidney Int. 2021;100:S1eS276.
29. Carreira BP, Morte M, Lourenço A, et al. Differential contribution of the
5. Gbadegesin R, Lavin P, Foreman J, Winn M. Pathogenesis and therapy of focal
guanylyl cyclase-cyclic GMP-protein kinase G pathway to the proliferation
segmental glomerulosclerosis: an update. Pediatr Nephrol. 2011;26:
of neural stem cells stimulated by nitric oxide. Neurosignals. 2013;21(1e2):
1001e1015.
1e13.
6. Nishi S, Ubara Y, Utsunomiya Y, et al. Evidence-based clinical practice guide-
30. Meng-Luen L, Sulistyowati E, Jong-Hau H, et al. KMUP-1 ameliorates ischemia-
lines for nephrotic syndrome 2014. Clin Exp Nephrol. 2016;20:342e370.
induced cardiomyocyte apoptosis through the NO⁻cGMP⁻MAPK signaling
7. Radhakrishnan J, Cattran DC. KDIGO Clinical Practice guideline for glomerulo-
pathways. Molecules. 2019;24(7):1376, 8.
nephritis. Kidney Int. 2012;82:840e856.
31. Li-Ming Y, Wen-Cheng D, Xue D, et al. Melatonin protects diabetic heart against
8. Kidney Disease: Improving Global Outcomes (KDIGO) CKD-MBD Update Work
ischemia-reperfusion injury, role of membrane receptor-dependent cGMP-PKG
Group. KDIGO 2017 clinical practice guideline update for the diagnosis, eval-
activation. Biochim Biophys Acta (BBA) - Mol Basis Dis. 2018;1864(2):563e578.
uation, prevention, and treatment of chronic kidney disease-mineral and bone
32. Das A, Xi L, Kukreja RC. Protein kinase G-dependent cardioprotective mecha-
disorder (CKD-MBD). Kidney Int. 2017;7:1e59.
nism of phosphodiesterase-5 inhibition involves phosphorylation of ERK and
9. Sun L, Zhang X, Wang Z. NPHS2 gene polymorphism aggravates renal damage
GSK3beta. J Biol Chem. 2008;283(43):29572e29585.
caused by focal segmental glomerulosclerosis with COL4A3 mutation. Biosci
33. Arany I, Megyesi JK, Reusch J, et al. CREB mediates ERK-induced survival of
Rep. 2021;41. BSR20203248.
mouse renal tubular cells after oxidant stress. Kidney Int. 2005;68(4):
10. Schulz A, Müller NV, van de Lest NA, et al. Analysis of the genomic architecture
1573e1582.
of a complex trait locus in hypertensive rat models links Tmem63c to kidney
34. Pauvert O, Lugnier C, Keravis T, et al. Effect of sildenafil on cyclic nucleotide
damage. Elife. 2019;8:e42068.
phosphodiesterase activity, vascular tone and calcium signaling in rat pulmo-
11. da Silva CA, Gonçalves Dos Reis Monteiro ML, Araújo LS, et al. In situ evaluation
nary artery. Br J Pharmacol. 2003;139(3):513e522.
of podocytes in patients with focal segmental glomerulosclerosis and minimal
35. Fuhrman DY, Schneider MF, Dell KM, et al. Albuminuria, proteinuria, and renal
change disease. PLoS One. 2020;15:e0241745.
disease progression in children with CKD. Clin J Am Soc Nephrol. 2017;12:
12. Zhuang Q, Li F, Liu J, et al. Nuclear exclusion of YAP exacerbates podocyte
912e920.
apoptosis and disease progression in Adriamycin-induced focal segmental
36. Fang L, Radovits T, Szabo  G, Mo zes MM, Rosivall L, Ko € ke
ny G. Selective
glomerulosclerosis. Lab Invest. 2021;101:258e270.
phosphodiesterase-5 (PDE-5) inhibitor vardenafil ameliorates renal damage in
13. Grahammer F, Wigge C, Schell C, et al. A flexible, multilayered protein scaffold
type 1 diabetic rats by restoring cyclic 3',5' guanosine monophosphate (cGMP)
maintains the slit in between glomerular podocytes. JCI Insight Imaging.
level in podocytes. Nephrol Dial Transplant. 2013;28:1751e1761.
2016;1:e86177.
37. Wadie W, Abdel-Razek NS, Salem HA. Phosphodiesterase (1, 3 & 5) inhibitors
14. Frese J, Kettwig M, Zappel H, et al. Kidney injury by variants in the COL4A5
attenuate diclofenac-induced acute kidney toxicity in rats. Life Sci. 2021;277:
gene aggravated by polymorphisms in slit diaphragm genes causes focal
119506.
segmental glomerulosclerosis. Int J Mol Sci. 2019;20:519.
€ ndorff JS, Subramanian B, Pollak MR. Dysregulated 38. Byung-Je S, Kwang Y, Young H, et al. Structure of the catalytic domain of hu-
15. Sun H, Perez-Gill C, Schlo
man phosphodiesterase 5 with bound drug molecules. Nature.
Dynein-mediated trafficking of Nephrin causes INF2-related podocytopathy.
2003;425(6953):98e102, 4.
J Am Soc Nephrol. 2021;32:307e322.
39. Eros D, Sza ntai-Kis C, Kiss R, et al. Structure -activity relationships of PDE5
16. Kopp JB, Anders H, Susztak K, et al. Podocytopathies. Nat Rev Dis Prim. 2020;6:
inhibitors. Curr Med Chem. 2008;15(16):1570e1585.
68.
40. Ahmed W, Geethakumari AM, Biswas KH. Phosphodiesterase 5 (PDE5):
17. Jefferson JA, Shankland SJ. The pathogenesis of focal segmental glomerulo-
structure-function regulation and therapeutic applications of inhibitors. Bio-
sclerosis. Adv Chron Kidney Dis. 2014;21:408e416.
med Pharmacother. 2021;134:111128.
18. Wharram BL, Goyal M, Wiggins JE, et al. Podocyte depletion causes glomer-
41. Shen X, Chen F, Wang F, et al. The effect of grapefruit juice on the pharma-
ulosclerosis: diphtheria toxin-induced podocyte depletion in rats expressing
cokinetics of tadalafil in rats. BioMed Res Int. 2020:1631735.
human diphtheria toxin receptor transgene. J Am Soc Nephrol. 2005;16:
42. Forgue ST, Patterson BE, Bedding AW, et al. Tadalafil pharmacokinetics in
2941e2952.
healthy subjects. Br J Clin Pharmacol. 2006;61(3):280e288.
19. Tomita N, Hotta Y, Naiki-Ito A, et al. The phosphodiesterase 5 inhibitor tadalafil
43. Forgue ST, Phillips DL, Bedding AW, et al. Effects of gender, age, diabetes
has renoprotective effects in a rat model of chronic kidney disease. Phys Rep.
mellitus and renal and hepatic impairment on tadalafil pharmacokinetics. Br J
2020;8:e14556.
Clin Pharmacol. 2007;63(1):24e35.
20. Feng D, DuMontier C, Pollak MR. Mechanical challenges and cytoskeletal im-
44. Armaly Z, Artol S, Jabbour AR, et al. Impact of pretreatment with carnitine and
pairments in focal segmental glomerulosclerosis. Am J Physiol Ren Physiol.
tadalafil on contrast-induced nephropathy in CKD patients. Ren Fail.
2018;314:F921eF925.
2019;41(1):976e986.
21. Sol M, Kamps JAAM, van den Born J, et al. Glomerular endothelial cells as in-
45. Grover-Pa ez F, Rivera G, Ortíz R. Sildenafil citrate diminishes microalbuminuria
stigators of glomerular sclerotic diseases. Front Pharmacol. 2020;11:573557.
and the percentage of A1c in male patients with type 2 diabetes. Diabetes Res
22. Sonneveld R, Hoenderop JG, Isidori AM, et al. Sildenafil prevents podocyte
Clin Pract. 2007;78(1):136e140.
injury via PPAR- g-mediated TRPC6 inhibition. J Am Soc Nephrol. 2017;28:
46. Scheele W, Diamond S, Gale J, et al. Phosphodiesterase type 5 inhibition re-
1491e1505.
duces albuminuria in subjects with overt diabetic nephropathy. J Am Soc
23. Kanda Y. Investigation of the freely available easy-to-use software 'EZR' for
Nephrol. 2016;27(11):3459e3468.
medical statistics. Bone Marrow Transplant. 2013;48:452e458.
24. Guo J, Ananthakrishnan R, Qu W, et al. RAGE mediates podocyte injury in
adriamycin-induced glomerulosclerosis. J Am Soc Nephrol. 2008;19:961e972.

59