ORIGINAL RESEARCH

published: 30 June 2017

doi: 10.3389/fmicb.2017.01226

Functional Characterization of Novel

Faecalibacterium prausnitzii Strains
Isolated from Healthy Volunteers: A
Edited by:
Step Forward in the Use of
Andrea Gomez-Zavaglia,
Center for Research and Development F. prausnitzii as a Next-Generation
in Food Cryotechnology (CIDCA,
National Council for Scientific and
Technological Research
Probiotic
(CONICET)-Argentina-Capital),
Argentina
Rebeca Martín 1 † , Sylvie Miquel 1, 2 † , Leandro Benevides 1, 3 , Chantal Bridonneau 1 ,
Véronique Robert 1 , Sylvie Hudault 1 , Florian Chain 1 , Olivier Berteau 1 , Vasco Azevedo 3 ,
Reviewed by:
Jean M. Chatel 1 , Harry Sokol 1, 4, 5 , Luis G. Bermúdez-Humarán 1 , Muriel Thomas 1 and
Mireia Lopez Siles,
Philippe Langella 1*
University of Girona, Spain
Maria de los Angeles Serradell, 1
Commensals and Probiotics-Host Interactions Laboratory, Micalis Institute, Institut National de la Recherche Agronomique,
CONICET La Plata (CCT) and Instituto AgroParisTech, Université Paris-Saclay, Jouy-en-Josas, France, 2 Université Clermont Auvergne, Centre National de la
de Ciencias de la Salud-UNAJ, Recherche Scientifique UMR 6023 Laboratoire Microorganismes: Génome et Environnement, Clermont-Ferrand, France,
Argentina 3
Department of General Biology, Federal University of Minas Gerais, Belo Horizonte, Brazil, 4 AVENIR Team Gut Microbiota
*Correspondence: and Immunity Equipe de Recherche Labélisée (ERL), Institut National de la Santé et de la Recherche Médicale
Philippe Langella U1157/UMR7203, Faculté de Médecine Saint-Antoine, Université Pierre et Marie Curie, Paris, France, 5 Service de
philippe.langella@infra.fr Gastroentérologie, Hôpital Saint-Antoine, Assistance Publique—Hôpitaux de Paris, Paris, France
†
These authors have contributed
equally to this work. Faecalibacterium prausnitzii is a major member of the Firmicutes phylum and one of the
most abundant bacteria in the healthy human microbiota. F. prausnitzii depletion has
Specialty section:
This article was submitted to been reported in several intestinal disorders, and more consistently in Crohn’s disease
Food Microbiology, (CD) patients. Despite its importance in human health, only few microbiological studies
a section of the journal
Frontiers in Microbiology
have been performed to isolate novel F. prausnitzii strains in order to better understand
Received: 03 April 2017
the biodiversity and physiological diversity of this beneficial commensal species. In
Accepted: 16 June 2017 this study, we described a protocol to isolate novel F. prausnitzii strains from feces
Published: 30 June 2017
of healthy volunteers as well as a deep molecular and metabolic characterization of
Citation:
these isolated strains. These F. prausnitzii strains were classified in two phylogroups and
Martín R, Miquel S, Benevides L,
Bridonneau C, Robert V, Hudault S, three clusters according to 16S rRNA sequences and results support that they would
Chain F, Berteau O, Azevedo V, belong to two different genomospecies or genomovars as no genome sequencing has
Chatel JM, Sokol H,
Bermúdez-Humarán LG, Thomas M
been performed in this work. Differences in enzymes production, antibiotic resistance
and Langella P (2017) Functional and immunomodulatory properties were found to be strain-dependent. So far, all F.
Characterization of Novel
prausnitzii isolates share some characteristic such as (i) the lack of epithelial cells
Faecalibacterium prausnitzii Strains
Isolated from Healthy Volunteers: A adhesion, plasmids, anti-microbial, and hemolytic activity and (ii) the presence of DNAse
Step Forward in the Use of activity. Furthermore, Short Chain Fatty Acids (SCFA) production was assessed for the
F. prausnitzii as a Next-Generation
Probiotic. Front. Microbiol. 8:1226.
novel isolates as these products influence intestinal homeostasis. Indeed, the butyrate
doi: 10.3389/fmicb.2017.01226 production has been correlated to the capacity to induce IL-10, an anti-inflammatory

Frontiers in Microbiology | www.frontiersin.org 1 June 2017 | Volume 8 | Article 1226

Martín et al.
cytokine, in peripheral blood mononuclear cells (PBMC) but not to the ability to block
IL-8 secretion in TNF-α-stimulated HT-29 cells, reinforcing the hypothesis of a complex
anti-inflammatory pathway driven by F. prausnitzii. Altogether, our results suggest that
some F. prausnitzii strains could represent good candidates as next-generation probiotic.
Keywords: probiotic, commensal,
immune-modulatory properties
INTRODUCTION
Despite a large number of bacteria, archaea, viruses, and
unicellular eukaryotes inhabit the human body, only a few
bacterial genera (Bacteroides, Clostridium, Bifidobacterium, and
Faecalibacterium) predominate in the human gut microbiome
(Schmidt, 2013). Nowadays it is recognized that Faecalibacterium
prausnitzii represents around 5% from the total fecal microbiota
in healthy adults (Hold et al., 2003). Furthermore, this bacterium
has been proposed to be a sensor and an actor of the human
intestinal health. Indeed, the levels of F. prausnitzii have been
found to be decreased in patients suffering from intestinal and
metabolic disorders such as inflammatory bowel diseases (IBD),
irritable bowel syndrome (IBS), colorectal cancer (CRC), obesity,
and celiac disease among others (Balamurugan et al., 2008; Sokol
et al., 2008; Neish, 2009; De Palma et al., 2010; Furet et al., 2010;
Rajilic-Stojanovic et al., 2011) as well as in frail elderly (van
Tongeren et al., 2005). Moreover, this species may be a biomarker
of choice to assist in Ulcerative colitis (UC) and Crohn’s disease
(CD) discrimination (Lopez-Siles et al., 2017).
F. prausnitzii has been only described in detail recently
probably because it is very difficult to grow as it is an Extremely
Oxygen Sensitive (EOS) bacterium (Duncan et al., 2002). Similar
to other EOS bacteria, little is known about the biology of F.
prausnitzii despite its relevance in the human gut ecosystem
(Miquel et al., 2014). Most of the data referring F. prausnitzii
are based on metagenomic studies (Miquel et al., 2013), with
only few studies with isolated strains and functional approach
(Duncan et al., 2002; Ramirez-Farias et al., 2009; Lopez-Siles
et al., 2012; Foditsch et al., 2014). This gap between metagenomic
and microbiological data is striking for microbiota-derived EOS
bacteria. To reduce this gap, it is now essential to increase the
knowledge of several commensal bacterial strains in order to
better understand the beneficial effect of this species.
Most of the commercial probiotics do not include dominant
commensal human isolates. This is a reason why these probiotic
strains do not colonize the human gut and their effects persist
only during a short period of time (Schmidt, 2013). Nowadays,
there is an increasing interest in the use of commensal bacteria
as potential probiotic agents. The reasons are multiple and
the most evident is that the role of commensal bacteria in
homeostatic crosstalk has started to be unraveled in the last
decade (Wrzosek et al., 2013). The domestic probiotic market,
with a turnover approaching $7 billion in Europe and $1.7
billion in the US in 2013 (Schmidt, 2013), is expected to grow
in the next years. However, these next-generation probiotic-
commensal candidates must meet the same criteria than the
conventional ones. It means that they should (i) be isolated
Frontiers in Microbiology | www.frontiersin.org 2 June 2017 | Volume 8 | Article 1226
Functional Characterization of F. prausnitzii Strains
Faecalibacterium, molecular and metabolic characterization,
and well-characterized, (ii) achieve safety requirements, such as
the acceptable resistance to antibiotics or the lack of lytic and
adhesion capacities, and (iii) show beneficial effects on the host
before being considerate as a probiotic. In this sense, the Food
and Agriculture Organization of the United Nations (FAO) and
the European Food Safe Administration (EFSA) have established
several guidelines for the correct definition and evaluation of
probiotics on food (FAO/WHO, 2002; Pineiro and Stanton, 2007;
Binnendijk and Rijkers, 2013). Regarding F. prausnitzii, although
little is known about its safety, there is a clear potential of this
species as a next-generation probiotic. This was already proposed
for livestock animals with the isolation and characterization of F.
prausnitzii strains from stool of calves and piglets (Foditsch et al.,
2014) but also for patients with intestinal dysbiosis-associated
illness with the development of specific formulation keeping this
EOS bacteria alive at ambient air (Khan et al., 2014). Besides,
its beneficial anti-inflammatory effect has been only analyzed in
vitro and in vivo with the reference strain F. prausnitzii A2-165
(Sokol et al., 2008) and the biofilm forming strain HTF-F (Rossi
et al., 2015). As the probiotic properties are usually strain-specific
ones (Pineiro and Stanton, 2007), individual studies are required
to assess the anti-inflammatory properties of other F. prausnitzii
isolated strains.
The aim of this work is to isolate a collection of novel
F. prausnitzii strains from healthy volunteers in order to
characterize them as potential probiotic bacteria in accordance
with Novel Food regulatory (Miquel et al., 2015a). We have also
validated the collection of viable isolated strains by metabolic and
safety tests in order to better understand their biology especially
in the gastrointestinal tract. Furthermore, the anti-inflammatory
properties of all these strains were validated in vitro in order to
identify the best potential F. prausnitzii strain to be used as a
next-generation probiotic.
MATERIALS AND METHODS
Isolation of Novel Extremely Oxygen
Sensitive (EOS) Strains
A cohort of healthy volunteers was first established (Table 1)
to collect freshly emitted fecal samples used as inocula. All
volunteers signed informed consent to provide the samples
and an agreement of confidentiality. The complete isolation of
EOS strain procedure was performed in an anaerobic chamber
(N2 = 90%, CO2 = 5% and H2 = 5%). Briefly, fecal samples
were homogenized and serial dilutions performed in order to
plate dilutions 10−8 and 10−9 on YBHI [Brain–heart infusion
medium supplemented with 0.5% yeast extract (Difco)] agar
Martín et al. Functional Characterization of F. prausnitzii Strains

TABLE 1 | Studied cohort of healthy humans’ volunteers and new F. prausnitzii strain identified.

Subject Sex Age (years) Fecal SCFA (mM) CFU/g % EOS Identified F. prausnitzii strains Cultivability of the strain

Butyrate Propionate Acetate

A M 81 nd nd nd 4.4 × 109 51 CNCM-I4540 Yes

B F 59 nd nd nd 8.7 × 109 30.7 X
C M 54 nd nd nd 8.0 × 109 67.7 CNCM-I4541 Yes
CNCM-I4542 Yes
S3C12 No
S3G1 No
D M 54 21.7 14.8 65.4 8.0 × 109 69 X
E F 60 nd nd nd 3.5 × 1010 40 X
F M 53 3.7 4.4 11.6 3.0 × 109 35.4 X
G F 26 3 3.9 14 2.0 × 109 37.5 X
H F 56 15.8 10.2 27.6 4.8 × 109 56.2 CNCM-I4574 Yes
CNCM-I4543 Yes
I M 59 10.1 9.5 27.3 7.8 × 109 33 S9G3 No
S9D8 No
J M 34 9.9 12.3 26.8 7.7 × 109 30.7 CNCM-I4644 Yes
CNCM-I4544 Yes
S10H3 No
K F 60 1.1 2 5.3 2.0 × 109 28.1 X
L M 40 1.7 2 6.9 7.4 × 109 29.6 CNCM-I4575 Yes
CNCM-I4573 Yes
S13A12 No
S13E3 No
M F 51 2.5 3.1 10.8 4.6 × 109 53.1 CNCM-I4546 Yes

All the isolates were obtained from human fecal samples of healthy volunteers consuming omnivorous diets. F, female; M, male; nd, not determined, X, no identified F. prausnitzii strain.

supplemented with rumen fluid 20%. After 4 days of incubation
at 37◦ C, single colonies were obtained on plates and 96 varied
colonies were selected and isolated in duplicate on YHBHI
supplemented with rumen fluid 20% agar plate. A group of
plates was placed brought out of the anaerobic chamber for
1 h to eliminate EOS strains and after a long period of
incubation (usually between 48 h and 4 days), we performed a
negative screening. The EOS colonies were further re-isolated
and a specific F. prausnitzii PCR (primers Fprau07/Fprau02) was
done to identify strains of this specie (Table 2). Finally, a 16S
rRNA gene sequencing was performed after complete 16S rRNA
amplification using primer FP1 to FP5 (Table 2; MWG France).
The viable isolates were stocked at −80◦ C with 16% of glycerol.
Bacterial Strains, Cell Culture, and Growth
Conditions
The reference strains A2-165 (DSM 17677; Duncan et al., 2002),
L2/6 (Barcenilla et al., 2000) and M21/2 (Louis et al., 2004) and
the F. prausnitzii isolated strains (Table 1) were grown at 37◦ C in
YBHI medium supplemented with cellobiose (1 mg/ml; Sigma),
maltose (1 mg/ml; Sigma), and cysteine (0.5 mg/ml; Sigma) in
an anaerobic chamber filled with N2 = 90%, CO2 = 5% and
H2 = 5%.
HT-29 (ATCC HTB-38) (LGC-Standars) cell line was grown
in Dulbecco’s Modified Eagle’s minimal essential medium
(DMEM) (Sigma-Aldrich) supplemented with 10% (w/v) heat-
inactivated fetal bovine serum (FBS) (GibcoBRL, Eragny, France)
and with penicillin G/ streptomycin (5,000 IU/mL, 5,000 µg/mL)
(Sigma-Aldrich). Cultures were incubated in 25 cm2 tissue
culture flasks (Nunc, Roskilde, Denmark) at 37◦ C in a 5% (v/v)
CO2 atmosphere until confluence.
16S rRNA Gene Analysis
DNA was extracted from isolated colonies of the different F.
prausnitzii strains by alkaline lysis in 50 µL of NaOH 0.5 M
during 30 min and 50 µL of Tris 1M pH7 and 100 µL H2 O were
added. 16S rRNA sequences were amplified using FP1 and FP2
primers (Table 2) and PCR products purified with the Wizard
SV Gel. PCR Clean-Up system (Promega) was used to obtain
bidirectional partial 16S rRNA gene sequences by using primers
FP1, FP2, FP3, FP4, and FP5 (Table 2). All DNA sequences were
confirmed by sequencing (Eurofins MWG Operon, Ebersberg,
Germany). Sequences for the novel isolates were deposited in
the NCBI database under the accession numbers MF185398 to
MF186168.
Phylogenetic analysis based on 16S rRNA were performed
using the multiple sequence alignment—CLUSTALW
(Thompson et al., 1994) integrated in MEGA6 software (Tamura
et al., 2013). After that, the most appropriate evolutionary
model was defined and the evolutionary history was inferred

Frontiers in Microbiology | www.frontiersin.org 3 June 2017 | Volume 8 | Article 1226

Martín et al.
TABLE 2 | Oligonucleotides used in this study and PCR product sizes.
Primer Oligonucleotide sequence (5′ –3′ ) PCR product size (bp)
Fprau07 CCATGAATTGCCTTCAAAACTGTT 141
Fprau02 GAGCCTCAGCGTCAGTTGGT
FP1 AGAGTTTGATCCTGGCTCAG 1,474
FP2 ACGGCTACCTTGTTACGACTT
FP3 GTTGCGGGACTTAACCCAACATC
FP4 GTTTTTCTTGAGTAGTGCAGAGG
FP5 GATGTTGGGTTAAGTCCCGCAAC
using the Maximum likelihood (ML) criterion, based on the
Kimura 2-parameter model (Kimura, 1980), with 1,000 bootstrap
replicates. A discrete Gamma distribution was used to model
evolutionary rate differences among sites [five categories (+G,
parameter = 0.1846)]. The rate variation model allowed for
some sites to be evolutionarily invariable ([+I], 64.70% sites).
Initial tree(s) for the heuristic search were obtained by applying
the Neighbor-Joining method to a matrix of pairwise distances
estimated using the Maximum Composite Likelihood (MCL)
approach and all positions containing gaps and missing data were
eliminated. The tree with the highest log likelihood (−3073.67) is
shown (Figure 3). The tree is drawn to scale, with branch lengths
measured in the number of substitutions per site. The analysis
involved 36 nucleotide sequences. There were a total of 1090
positions in the final dataset. In this analysis, sequences used
by Lopez-Siles et al. (Duncan et al., 2002; Ramirez-Farias et al.,
2009; Lopez-Siles et al., 2012) were included with the objective
of compare the new strains to the two phylogroups proposed by
that study. Eubacterium desmolans was used to root the tree.
Plasmid Presence
The presence of plasmids in the isolated strains were determined
following Wizard
R
Plus SV Minipreps DNA Purification System
(Promega) with modifications to adapt it for use with Gram
positive bacteria. Briefly, an extra lysis step was performed after
centrifugation of liquid overnight (ON) cultures by incubation
for 1 h at 37◦ C with lysozyme (Sigma; 10 mg/ml) in the cell
resuspension solution.
Scanning Electron Microscopy
Scanning electron microscopy analyses were performed on the
MIMA2 platform (INRA, France) with pure pellet of bacterial
culture suspended and fixed in 200 µL of glutaraldehyde and 3%
ruthenium red during 2 h in an anaerobic chamber and stored at
4◦ C. Scanning electron microscopy was performed as previously
reported (Joly et al., 2010).
Determination of Antibiotics Resistance
The minimum inhibitory concentrations (MIC) for 13 antibiotics
(including tetracycline, kanamycin, chloranphenicol, linezolid,
nupri/dalfopri, trimethoprim, gentamicin, erythromycin,
cefpirome, clindamycin, streptomycin, vanomycin, and
ampicillin) were determined on Wilkins-Chalgren agar (Difco)
according to the E-test procedure, in accordance with the
Frontiers in Microbiology | www.frontiersin.org
Functional Characterization of F. prausnitzii Strains
Use References
PCR F. prausnitzii specific Sokol et al., 2008
16S rRNA complete sequence amplification and sequencing This study
16S rRNA sequencing This study
16S rRNA sequencing This study
16S rRNA sequencing This study
conditions recommended by the supplier (Biomerieux, France).
The results were recorded after 48 h of incubation.
Anti-bacterial Assays
The anti-bacterial effect of F. prausnitzii supernatants were
investigated in vitro using the bacteriocin activity assay as
previously described (Ramirez-Farias et al., 2009). This anti-
bacterial effect was tested on six different bacterial species:
three aerobic bacteria (E. coli Nissle 1917, E. coli DH10B,
and Listeria monocytogenes 11765), one facultative anaerobic
bacterium (Lactococcus subsp cremoris MG1363), and two
obligate anaerobic bacteria (Clostridium perfringens ATCC13124
and Bifidobacterium infantis DSM20088/ATCC15697). YBHI
liquid medium alone was used as negative control.
Metabolic Activities
To determine the metabolic activities of the cultivable strains,
API-20A galleries and the gelatin degradation test of API-20E
galleries were used according to manufacturer’s instructions.
For detection of DNase and hemolytic activity, the strains were
grown ON and then plated into Methyl green-DNA agar plates
(Difco) or blood agar plates (Biomérieux) respectively. The
results were recorded after 48 h of incubation. The capacity
to grow in presence of mucin was assayed using a defined
medium (KH2 PO4 : 5.236 g/L, (NH4 )2 SO4 : 4 g/L, NaCl: 4 g/L,
CaCl2 : 30 mg/L, MgCl2 : 300 mg/L, MnCl2 : 30 mg/L, FeCl2 :
8 mg/L, Vitamin B12: 5 mg/L, Vitamin B1: 1 mg/L, Biotin: 1 mg/L,
PABA: 1 mg/L, Folic acid: 1 mg/L, Vitamin K: 2 mg/L, cystein
0.5 mg/mL) supplemented with 1.5% mucin (Type II, Sigma-
Aldrich).
Short Chain Fatty Acid (SCFA) Analysis
Supernatant concentrations of propionate, acetate, and butyrate
were analyzed using gas liquid chromatography (Nelson 1020,
Perkin-Elmer, St Quentin en Yvelines, France) as previously
described (Lan et al., 2008). Overnight culture (20 h) of F.
prausnitzii strains were used and culture media as negative
control; each measurement for performed at least in triplicate
except for fecal samples. SCFA concentrations are expressed
in mM.
Dosage of D- and L-Lactate
D- and L-lactate was measured in supernatant of bacterial
cultures. This supernatant was precipitated with trichloroacetic
acid (10%) and centrifuged at 4,500 g for 20 min at 4◦ C. Lactate
4 June 2017 | Volume 8 | Article 1226
Martín et al.
was then measured in the supernatants with the Biosentec
D/L lactic acid enzymatic kits according to the manufacturer
instructions (Biosentec, Toulouse, France). Overnight culture
(20 h) of F. prausnitzii strains were used and culture media as
negative control; each measurement was performed at least in
triplicate.
Adhesion Assays
Monolayers of HT-29 cells were seeded in 24-well tissue culture
plates (Nunc) with 1.83 × 105 HT-29 cells/well and cultivated
until confluence, culture medium was changed daily. Monolayers
were then infected in 1 ml of the cell culture medium without
antibiotics and with heat-inactivated FBS at a multiplicity of
infection (MOI) of 100 bacteria per epithelial cell. After, 3 h
of incubation at 37◦ C in anaerobic conditions (as describe
above), monolayers were washed three times in phosphate-
buffered saline (PBS; pH 7.2). The epithelial cells were then lysed
with 1% Triton X-100 (Sigma Chemical Company, St Louis,
Mo.) in water. Samples were plated onto YHBHI supplemented
agar plates to determine the number of CFU corresponding
to the total number of cell-associated bacteria. Adhesion to
mucin has been performed as previously described by Radziwill-
Bienkowska et al. (2014, 2016) Briefly, after an overnight coating
of 96 plates (Nunc) with a solution of 10 mg/ml of mucin [Type
III mucin from porcine stomach (lyophilized powder, Sigma-
Aldrich)] a bacterial suspension (OD600nm = 1) in PBS of each
strain was incubated 3-h at 37◦ C in the anaerobic chamber.
Bound cells were stained with crystal violet. Stained bacteria were
suspended in 96% ethanol and optical density was determined
at 583 nm. All the experiments were performed in triplicate.
The adhesion values have been normalized using Lactobacillus
rhamnosus GG (LGG) a positive control know by their good
adhesion properties to mucin (Martin et al., 2015). Results are
presented by the mean and the standard deviation.
Immuno-Modulatory Properties Using
HT-29 Cells
Anti-inflammatory assays were done following the procedure
described by Kechaou et al. (2012). Briefly, 50,000 HT-29 cells
per well were seeded in 24-well culture plates (Nunc). Twenty-
four h before bacterial co-culture (day 6), the culture medium
was changed for a medium with 5% heat-inactivated FBS and 1%
glutamine. On the day of co-culture, 10% of bacterial supernatant
or bacterial medium (YBHI) were added in DMEM in a total
volume of 500 µL. Cells were stimulated simultaneously with
human TNF-α (5 ng/ml; Peprotech, NJ) for 6 h at 37◦ C in 10%
CO2 . All samples were analyzed in triplicate. After co-incubation,
cell supernatants were collected and stocked at −80◦ C until
further analysis of interleukin-8 (IL-8) concentrations by ELISA
(Biolegend, San Diego, CA). Total protein was determined by
Bradford Reagent test (Sigma-Aldrich). Experiments have been
done at least in triplicate. Results are expressed as IL-8/protein
(pg/mg) and have been normalized using as reference value the
IL-8 produced after the co-incubation with PBS as a negative
control.
Frontiers in Microbiology | www.frontiersin.org
Functional Characterization of F. prausnitzii Strains
Experiments on Peripheral Blood
Mononuclear Cells (PBMCs)
The protocol used in this study was adapted from Kechaou
et al. (2012). Commercial PBMCs (StemCell Technologies,
France) from five healthy donors were used in this assay.
Donors presented the following characteristics: men, age under
65, body mass index <30, non-smoking, no drugs with anti-
inflammatory known effects taken during the 15 days prior
to sampling, and tested negative for HIV, hepatitis A and B
viruses. After reception, cells were stored in liquid nitrogen
until use. To prepare PBMCs for co-culture experiments with
bacteria, the vial were thawed at 37◦ C in a water bath and
then transferred into a medium containing RPMI-1640 medium
supplemented with 10% heat-inactivated FCS, 1% L-glutamine
and 0.1% Penicillin/Streptavidin (medium components were
bought from Lonza, Switzerland). DNase (100 µg/mL, Roche
Applied Science, France) was added to this mix to avoid cell
clumping. Cells were then centrifuged at 200 g for 15 min,
counted using trypan blue and spread on 24-well plates at 1 × 106
cells/well. Supernatants were added in triplicates (three wells per
donor) at 10% in a total volume of 1 ml. Plates were incubated for
24 h at 37◦ C with 10% CO2 . Culture supernatant were collected,
mixed with an antiprotease cocktail according to manufacturer’s
instructions (Complete EDTA-Free protease inhibitor, Roche
Applied Bioscience) and stored at −80◦ C until further analysis
of IL-10 concentrations by ELISA (Mabtech, Sweden).
Statistical Analysis
GraphPad software (GraphPad Sofware, La Jolla, CA, USA) was
used for statistical analysis. Results are presented as bar graphs
±SEM. Comparisons were realized with the non-parametric
Kruskal–Wallis test followed by a Dunn’s Multiple Comparison
test. Correlation test were performed using spearman test. A p <
0.05 was considered significant.
RESULTS AND DISCUSSION
Construction of EOS and F. prausnitzii
Libraries
The vast majority of intestinal bacteria are EOS and thus
mostly very difficult to culture (Qin et al., 2010). Although
metagenomic approaches recently allow identifying some
uncultivable organisms, the use of cultivable strains is requested
to determine their biological activities. In this study, we report
a method for isolation of novel EOS strains from human
fecal samples on a complete medium (Figure 1). For this, a
negative screening was performed through the exposition of
bacterial isolates to oxygen and in parallel, these same strains
were cultivated in an anaerobic chamber, which maintains a
consistent anaerobic environment to ensure proper conditions
for optimal EOS growth. We identified between 28.1 and
67.7% of EOS strains in the microbiota of healthy volunteers
(Table 1). Interestingly, the proportion of EOS strains in the
human microbiota was positively and significantly correlated
to the amount of fecal acetate (r = 0.7; p = 0.0433) and
tend to be correlated to the amount of fecal butyrate (r =
5 June 2017 | Volume 8 | Article 1226
Martín et al.
FIGURE 1 | Negative screening for isolation of new Extremely Oxygen
Sensitive (EOS) strains from human healthy feces.
0.6833; p = 0.0503). These observations suggest that EOS
population has an important metabolic impact that could
participate to intestinal homeostasis (Wrzosek et al., 2013). The
EOS isolates were identified by 16S rRNA gene sequencing
and among them F. prausnitzii candidate strains were selected
for further characterization. These isolation and screening set
up can have a small inspecificity rate and no-F. prausnitzii
strains can be recovered as well as the strain S13E3. After
three subcultures, cultivable strains were stored at −80◦ C in
16% glycerol. Among 17 identified F. prausnitzii strains, only
10 were cultivable in the tested conditions (Table 1) with an
OD600 nm lower than 2 corresponding to >1 × 108 CFU/mL
(Figure 2). There was no direct correlation between CFU counts
and OD600nm due to difference of viability between strains. We
substantially increased the number of cultured F. prausnitzii
isolates from human origin and provided new tools for a better
understanding of the diversity and microbial ecology of the
colon.
Phylogenetic Diversity of Faecalibacterium
prausnitzii
Full-length 16S rRNA gene sequences were determined for the
17 isolates of F. prausnitzii from healthy individuals (Table 1).
Frontiers in Microbiology | www.frontiersin.org
Functional Characterization of F. prausnitzii Strains
The sequences from the literature (Barcenilla et al., 2000;
Duncan et al., 2002; FEEDAP, 2012; Lopez-Siles et al., 2012)
were included in order to classify the new isolates in the two
phylogroups proposed by Lopez-Siles et al. (Barcenilla et al.,
2000; Duncan et al., 2002; FEEDAP, 2012; Lopez-Siles et al.,
2012; Figure 3). Each of these 16S rRNA sequences were unique,
came from a different colony, and share >97% 16S rRNA
sequences similarity. Cultivability of strains was not linked to
phylogroups affiliation (Figure 3). Of note, all strains have a
similar morphotype with cell wall extensions, like “swellings”
(Figure 4) already described but with yet unknown function
(Miquel et al., 2013). The average nucleotide identity between
strains of the two phylogroups (S3L/3 and L2/6 = 94%) supports
the hypothesis of the existence of two genomospecies without
phenotypic properties defined yet (Lopez-Siles et al., 2017).
Although, as was previously described for another library, there
was a tendency for some sequences to group by isolation
and individual with a clustering of strains (subgroup B of
the phylogroup II; Lopez-Siles et al., 2012). For example,
CNCM I-4574 and CNCM I-4543 strains were isolated from the
same volunteer and present 99.8% of homology at 16S rRNA
level.
Interestingly, the existence of strains that do not fit in any
phylogroup (as CNCM I-4541) suggest that biodiversity of F.
prausnitzii remains poorly known, maybe since only few strains
have been isolated. Moreover, the strain S13E3, could be not an
F. prausnitzii stain.
Resistance to Antibiotics
The MIC for the different antibiotics tested are represented
in the Table 3. Concerning the breakpoints for Gram positive
bacteria from EFSA (Duncan et al., 2004) which classify
bacteria as resistant or not to a specific antibiotic, all F.
prausnitzii isolates were susceptible to clindamycin, vancomycin,
ampicillin, quinupristin+dalfopristin, and chloramphenicol
(MICs lower than 0.25, 2, 1, 0.5, and 2 mg/L respectively).
Only one isolate, the CNCM I-4541 strain was resistant to
erythromycin (MICs > 0.5mg/L). Surprisingly, all tested strains
were resistant to streptomycin (MICs ranging from 14 to
50 mg/L) excepted for the CNCM I-4575 isolate. Regarding
gentamicin, kanamycin, and tetracycline, different results
were obtained for the different isolates: with up to 5 isolates
displaying resistance to higher concentrations of the tested
antibiotics than the determined breakpoint. Finally, three
antibiotics (not included in the EFSA guidance) were also
analyzed due to their importance in the clinical treatments:
trimetroprim, linezolid, and cefpirome. All strains were
resistant to trimethoprim, as expected for an anaerobic
bacteria (MICs >32 mg/L; data not shown), while they
tended to be susceptible to linezolid (MICs ranging from
0.032 to 3.3 mg/L) and resistant to cefpirome (from 4.66 to
>256 mg/L) which, when linked to the general susceptibility to
ampicillin, might indicate that the penicillin binding proteins
of Faecalibacterium are poorly recognized by cephalosporins.
Remarkably, CNCM I-4543 and CNCM I-4574 isolates were
resistant to cefpirome, a fourth-generation cephalosporin
6 June 2017 | Volume 8 | Article 1226
Martín et al. Functional Characterization of F. prausnitzii Strains

FIGURE 2 | Growth profile of F. prausnitzii strains. (A) OD600 nm determination after 20 h growth in YBHI supplemented medium and (B) determination of viable
bacteria: the CFU/mL numeration in the same cultures. Each measurement have been done at least in triplicate.

FIGURE 3 | Phylogenetic tree of F. prausnitzii strains based on 16S rRNA gene sequences. The tree was constructed with the MEGA6 software package using the
Maximum Likelihood method. The bootstrap values above 70% are shown next to the branches. The F. prausnitzii isolates incorporated in this study have circles
besides. The black circles represent the cultured strains and white circles represent uncultured isolates. Colors (purple, blue, and green) and letters (A, B, and C)
indicate the tree groups with high bootstrap values, formed by our cultured strains.

stable against most plasmid- and chromosome-mediated beta-
lactamases (Wiseman et al., 1997), with a MIC higher than
256 mg/L.
The analysis of antimicrobial resistance is of major
importance due to the fast evolution of antibiotic resistance in
response to the extensive use of antimicrobials. However, the
microbiological breakpoints marked by the EFSA for most of
Gram positive bacteria is probably not the most correct for the
analysis of F. prausnitzii isolates as no so many information
about their natural or acquired resistance patters is reported, to
our knowledge, up to day in the literature. Foditsch et al. (2014)
have identify that more of the 50% of the F. prausnitzii strains
that they isolated from fecal samples of healthy calves and piglets
were resistant to tetracycline, amikacin, cefepime, and cefoxitin
comparing the MIC values with the standard values determined
by CLSI for Bacteroides fragilis ATCC 25285. This fact highlights
the need of more microbiological studies of antibiotic resistance
in this species in order to determine a correct standard values for
Faecalibacterium as well as the search for genes codifying for the
most important resistance mechanisms for, at least, some of the
antibiotics tested in this study.
Metabolic Activities
Enzymatic activities detected by API-20A gallery system are
reported in Table 4. Interestingly, only one enzyme was detected
and active in all the tested strains: the beta-galactosidase.
Otherwise, all the strains were not able to ferment mannose
or raffinose, to reduce nitrate and to produce indole (data not
shown). Furthermore, all the isolates were negative for the
presence of urease, arginine dihydrolase, beta-glucosidase, alpha-
arabinosidase, N-acetyl-beta-glucosaminidase, glutamic acid
decarboxylase, alkaline phosphatase, phenylalanine arylamidase,
leucine arylamidase, pyroglutamic acid arylamidase, tyrosin
arylamidase, alanine arylamidase, glutamyl glutamic acid
arylamidase, and serin arylamidase (data not shown). These
results confirm previous observations where no strain was able

Frontiers in Microbiology | www.frontiersin.org 7 June 2017 | Volume 8 | Article 1226

 Martín et al.

indicate 2 µm. Arrows indicates “swelling.”

Frontiers in Microbiology | www.frontiersin.org

phylogroup II. Strains were grown in YBHI liquid medium 20 h. Scale bars
FIGURE 4 | Scanning electron microscopy images of F. prausnitzii strains

energy source (Duncan et al., 2002; Lopez-Siles et al., 2012).

(Table 4). Beta-glucuronidase activity has been previously

to metabolize arabinose and raffinose among others as the sole

the same metabolic profile and donor. And the third metabolic
II), which are the only ones resistant to cefpirome, share also
strains CNCM I-4543 and CNCM I-4574 (group B, phylogroup
the group A from phylogroup I (CNCM I-4546 and M21/2). The
included in three different profiles. Two of them corresponds to
While six strains showed individual profiles, the other seven are
reported in some F. prausnitzii isolates (Lopez-Siles et al., 2012).
histidine-arylamidase), differences inter-strains were detected
leucyl glycerine-arylamidase, glycine-arylamidaseycine, and
alpha-glucosidase, beta-glucuronidase, arginine arylamiase,
For all the other enzymes (6 phospho-beta galactosidase,

8
TABLE 3 | Minimum inhibitory concentrations (MIC) (mg/L) for the different antibiotics tested.

EFSA Breakpoint GEN STR KM ERY CLI VAN TET QD CM AMP CPO LZD
(other Gram +)

4 8 16 0.5 0.25 2 2 0.5 2 1 nd nd

A2-165 1.37 ± 0.12 96 ± 18.47 8.67 ± 1.76 0.20 ± 0.08 0.016 ± 0 0.27 ± 0.05 0.016 ± 0 0.03 ± 0.01 0.08 ± 0.02 0.11 ± 0.02 9±1 1.25 ± 0.25
L2-6 4.33 ± 0.88 32 ± 7.15 0.42 ± 0.08 0.10 ± 0.02 0.023 ± 0 0.47 ± 0.12 4.21 ± 0.62 0.58 ± 0.46 20 ± 5.66 0.06 ± 0.03 24 ± 4.62 0.62 ± 0.12
M21/2 4.75 ± 1.49 21 ± 4.43 51 ± 45 0.05 ± 0.01 0.016 ± 0 0.25 ± 0 1.09 ± 0.63 0.016 ± 0 0.15 ± 0.03 0.04 ± 0.03 16.67 ± 7.86 0.75 ± 0
CNCM I-4540 1.25 ± 0.25 21.33 ± 2.67 122.67 ± 66.83 0.11 ± 0.02 0.016 ± 0 0.71 ± 0.18 0.016 ± 0 0.011 ± 0.004 0.05 ± 0.04 0.11 ± 0.02 24 ± 4.62 0.04 ± 0.06
CNCM I-4541 1.62 ± 0.47 24 ± 0 14 ± 2 20 ± 4 0.016 ± 0 0.125 ± 0 8±0 0.27 ± 0.24 0.17 ± 0.07 0.06 ± 0 40 ± 8 1.25 ± 0.25
CNCM I-4542 2.87 ± 1.12 23.67 ± 3.26 20 ± 4 0.11 ± 0.07 0.016 ± 0 0.67 ± 0.17 0.016 ± 0 0.016 ± 0 0.29 ± 0.40 0.08 ± 0.03 20.67 ± 7.69 3.17 ± 1.42
CNCM I-4543 2 ± 0.40 16 ± 0 20 ± 4 0.08 ± 0.02 0.016 ± 0 0.29 ± 0.04 0.2 ± 0.002 0.07 ± 0.03 0.31 ± 0.09 0.12 ± 0 ≥256 ± 0 1.25 ± 0.38
CNCM I-4544 6 ± 1.15 21.2 ± 7.31 100 ± 52.41 0.12 ± 0 0.016 ± 0 0.92 ± 0.08 0.016 ± 0 0.023 ± 0 0.11 ± 0.02 0.09 ± 0.02 53.33 ± 5.33 0.5 ± 0
CNCM I-4546 10 ± 66 50.67 ± 13.33 256 ± 0 0.22 ± 0.61 0.018 ± 0.002 0.56 ± 0.31 2.6 ± 0.6 0.16+0.07 1.25 ± 1.51 0.07 ± 0.02 24.8 ± 6.24 3±1
CNCM I-4573 7±1 32 ± 0 234 ± 21.33 0.01 ± 0.03 0.024 ± 0.007 0.28 ± 0.05 0.028 ± 0.003 0.04 ± 0.005 0.38 ± 0 0.25 ± 0 22 ± 3.83 3.3 ± 0.8
CNCM I-4574 1.75 ± 0.25 14 ± 0 6±2 0.07 ± 0.02 0.016 ± 0 0.25 ± 0 0.016 ± 0 0.03 ± 0.01 0.09 ± 0.02 0.22 ± 0.03 ≥256 ± 0 0.5 ± 0.14
CNCM I-4575 1.25 ± 0.25 5±1 4±1 0.07 ± 0.01 0.016 ± 0 0.5 ± 0 0.032 ± 0 0.03 ± 0.03 0.016 ± 0 0.084 ± 0.02 4.67 ± 1.67 0.03 ± 0.01
CNCM I-4644 0.91 ± 0.08 9.33 ± 1.33 135 ± 69.84 0.10 ± 0.05 0.026 ± 0.01 0.23 ± 0.02 0.83 ± 0.32 0.04 ± 0.01 0.079 ± 0.04 0.026 ± 0.01 9.333 ± 1.33 0.58 ± 0.08

Gentamicin (GEN), streptomycin (STR), kanamycin (KM), erythromycin (ERY), clindamycin (CLI), vancomycin (VAN), tetracycline (TET), quinupristin/dalfopristin (QD), chloramphenicol (CM), ampicillin (AMP), cefpirome (CPO), and linezolid
(LZD). Experiments have been done in triplicate and the results are expressed as the media ± SEM. nd, Not defined. In bold, Resistances.
Functional Characterization of F. prausnitzii Strains

June 2017 | Volume 8 | Article 1226

Martín et al. Functional Characterization of F. prausnitzii Strains

TABLE 4 | Metabolic capacities of F. prausnitzii strains detected by API 32A galleries.

bGal bGP αGLU bGUR ArgA Lga GlyA HisA

beta− beta Galactosidase Alpha beta Arginine Leucyl Glycine Glycine Histidine
galactosidase 6 phosphate glucosidase glucuronidase Arylamidase Arylamidase Arylamidaseycine Arylamidase

A2−165 + + + + + + + +
L2−6 + − + + + + + +
M21/2 + − − − + − + +
CNCM I−4540 + + − − − − − −
CNCM I−4541 + + − − + − − −
CNCM I−4542 + + − − − − − −
CNCM I−4543 + + − + + + + −
CNCM I−4544 + − − − − − − −
CNCM I−4546 + − − − + − + +
CNCM I−4573 + − − − + − + +
CNCM I−4574 + + − + + + + −
CNCM I−4575 + + − + + − + +
CNCM I−4644 + − − − + + + +

+, Presence; −, absence. Experiments have been done in triplicate.

profile is shared by strains CNCM I-4540 and CNCM I-4542 that
belong to the group C of phylogroup II.
It is now well-establish that F. prausnitzii is an acetate-
consumer and butyrate-producer species (Duncan et al., 2002;
Lopez-Siles et al., 2012). Here, we report that in pure cultures,
our new isolated strains are also able to produce butyrate and
this production is significantly and positively correlated to their
growth (OD600nm ; r = 0.8462; p = 0.003; Figures 5A,B). It is
interesting to highlight that the production level of butyrate was
not linked to a particular phylogroup (Phylogroup I 3.91 mM ±
0.43 and Phylogroup II 4.89 mM ± 0.62). Moreover, all strains
could metabolize acetate present in the culture medium at around
the same level (Figure 5A). This consumption was not directly
correlated to bacterial growth (r = −0.3132, p = 0.2975) and
tended to be more correlated to butyrate production (r = −0.544,
p = 0.0546). This observation is in agreement with the literature
which describes that most of the carbon present in the butyrate
produced (around 85%) is derived from external acetate, with
only 15% provided directly from glucose (FEEDAP, 2012).
F. prausnitzii can also produce a few amount of D-lactate
(FEEDAP, 2012). Indeed, among our strain collection, no L-
lactate was detected and only few amounts of D-lactate were
detected (1.09 mM ± 0.15 and 1.07 mM ± 0.39 phylogroup I and
II respectively; data not shown). This production, not correlated
with phylogroup affiliation, was correlated to the OD600nm (r
= 0.6209, p = 0.0235). Bacterial D-Lactate production can be
viewed as harmful since accumulation of this metabolite into the
blood may be neurotoxic and leads to acidosis (Mack, 2004).
In particular, humans with short bowel syndrome (in which
small intestine has been surgically removed), the D/L fecal lactate
ratio seems to be the most relevant index with a higher D-
encephalopathy risk (Mayeur et al., 2013). However, in healthy
adults, there is no lactate detectable in fecal samples, because
lactobacilli (main producer of D-lactate) are minor groups in
microbiota and lactate is degraded by other major bacterial
groups (36, He, 2008 #41). This observation also suggested
that the weak production of D-lactate by F. prausnitzii strains,
major component of the microbiota, could not have metabolic
deleterious impact on the host.
All strains were unable to growth in the presence of mucin
as the only carbon source in a defined medium (data not
shown). This data agrees with previous results where no evidence
of fermentation of porcine gastric mucin by F. prausnitzii
was detected (Lopez-Siles et al., 2012). Nevertheless, SCFA
concentrations and OD600nm measures taken after 2 days of
incubation showed the ability of the different strains to survive
but metabolically inactive as it could be deduced by the absence
of butyrate in the supernatants of the cultures and the almost
minimal OD600nm recorded (data no shown). A decrease in
butyrate production due to non-optimal growth conditions have
been already reported for F. prausnitzii A2-165 strain (Lopez-
Siles et al., 2012). This characteristic pointed out the intrinsic
growth requirements of this species which, in addition to be an
EOS, needs strain specific nutritional environment and has the
ability to switch between substrates derived from the diet or the
host (Lopez-Siles et al., 2017).
Lytic Activities
Gelatin is a heterogeneous mixture of water-soluble protein
that is usually used in microbiological procedures to detect the
presence of proteolytic activities. None of the strains were able
to degrade gelatin in the conditions recommended by the API
gallery supplier (data not shown). However, when the strains
were inoculated in the gallery in a defined medium instead of
API suspension medium, they were able to degrade partially this
compound after 3 days of incubation. This fact suggests that the
strains are able to hydrolyze gelatin although, maybe due to the
growth limitations present in this culture media, the existence of
this compound is not enough to allow the metabolic development
of this activity in the strains.
The presence of hemolytic activity was tested using blood
agar plates. None of the strains showed hemolytic activity
under the conditions tested. In contrast, all the strains reveal
a DNAse activity in green methyl-DNA medium (data not

Frontiers in Microbiology | www.frontiersin.org 9 June 2017 | Volume 8 | Article 1226

Martín et al.
FIGURE 5 | SCFA metabolism of F. prausnitzii strains in vitro. (A) Acetate and butyrate concentrations after 20 h growth of strain in YBHI supplemented medium. The
concentration of control media was subtracted for each measurement have been done at least in triplicate. (B) Correlation between OD600 nm and butyrate production.
shown). Furthermore, the presence of a magnesium dependent
DNase activity has been previously reported in at least three
of five strains already sequenced [A2-165 (gi:257439194), SL3/3
(gi:295105207), and L2/6 (gi:295102777)].
The presence of these extracellular activities is often linked to
a virulence status in some bacterial species such as Enterococcus
spp. (Eaton and Gasson, 2001). However, these factors also
contribute to the survival of microorganisms in the mammalian
gut being characteristic of several members of the natural
microbiota (Sanders et al., 2010). This can be the case of
Faecalibacterium isolates, which are extremely well-adapted to
the gut environment (Lopez-Siles et al., 2012).
Antibacterial Activities
We investigated antibacterial properties of F. prausnitzii
supernatants, using the bacteriocin activity assay. We did not
reveal any antibacterial effect on several anaerobic and aerobic
bacterial species under the conditions tested. This fact is a
desirable characteristic of a strain to be considered as a probiotic
candidate.
Ability to Stimulate the Immune Response
The reference strain F. prausnitzii A2-165 is well-known for
its immuno-modulatory properties and more specifically for its
anti-inflammatory effects both in vitro and in vivo in different
murine models of colitis (Sokol et al., 2008; Martin et al., 2014).
To determine whether the newly isolated F. prausnitzii strains
are able to modulate the immune response, we tested in vitro
the immuno-modulatory properties of the supernatants from all
the isolates in two different cellular models: HT-29 and PBMC.
The first one is based on the capacity to block IL-8 production
(a pro-inflammatory cytokine) induced by TNF-α stimulation in
HT-29 epithelial cells and the second is based on the stimulation
of PBMC cells and the measure of the anti-inflammatory cytokine
IL-10. As shown in Figure 6A, all the strains tend to decrease IL-8
concentrations. However, this decrease was not equivalent in all
the strains and does not correlate either with growth ratio (r =
−0.2857, p = 0.344) or butyrate production (r = −0.3357, p =
0.2869).
Frontiers in Microbiology | www.frontiersin.org
Functional Characterization of F. prausnitzii Strains
For the PBMC assay, although all the strains tend to increase
the production of IL-10 cytokine, only four strains (two controls
and two new isolates from this study) were able to induce
statistically significant increase production of this cytokine
(Figure 6B) The two most performing strains (A2-165 and
4543) belong to the phylogroup II, group B. Notably, the IL-
10 production was correlated with both growth ratio (r =
0.6813, p = 0.0103) and butyrate production (r = −0.6923, p
= 0.0126). This different phenotype may suggest the presence of
different molecule(s) responsible of the anti-inflammatory effects
in vitro. The anti-inflammatory properties of butyrate have been
already reported in the literature (Fusunyan et al., 1999; Kamitani
et al., 1999) and its ability to block IL-8 production under the
conditions tested in this study were confirmed in vitro in similar
concentrations to those founds in F. prausnitzii supernatants
(data not shown). However, its role remains controversial as
its effects seems to be dose- and time-dependent as well as
depended on the cellular model used (Martin et al., 2013).
For instance, regarding cells from intestinal origin, butyrate
has been found to decrease the secretion of IL-8 in Caco-2
and HIPEC cells and, in contrast to this study, to enhance IL-
8 production in HT-29 and HT-29 MTX cells (Bocker et al.,
2003).
However, several authors have found different candidate
molecules/structures responsible for F. prausnitzii anti-
inflammatory effects. MAM protein, found in F. prausnitzii
supernatant, has been found to block NF-κB activation and the
production of the pro-inflammatory cytokine IL-8 (Quevrain
et al., 2016). F. prausnitzii is also able to produce bioactive
anti-inflammatory molecules such as shikimic and salicylic acids
(Miquel et al., 2015b). Besides, Rossi and co-workers showed
the ability of F. prausnitzii strain HTF-F and its extracellular
polymeric matrix to develop immunomodulatory effects through
the TLR2 dependent modulation of IL-12 and IL-10 cytokine
production in human monocyte-derived dendritic cells (Rossi
et al., 2015) and F. prausnitzii has been found to be a strong
inducer of regulatory T cells secreting IL-10 (Sarrabayrouse et al.,
2014). All these results point out the complex anti-inflammatory
mechanisms underlying this species.
10 June 2017 | Volume 8 | Article 1226
Martín et al.
FIGURE 6 | Immuno-modulation capacities of F. prausnitzii strains in vitro.
(A) IL-8 production in HT-29 TNF-α stimulated cells. Experiments have been
done at least in triplicate. Results are expressed as IL-8/ protein (pg/mg) and
have been normalized using as reference value the IL-8 produced after the
co-incubation with PBS as a negative control. (B) IL-10 production in
peripheral blood mononuclear cells. Experiments have been done at least in
triplicate. Results are expressed as IL-10 concentration (pg/mL). Significant
differences from the control (YBHI) was specified as: *p < 0.05 and ***p <
0.001.
Adhesion to Epithelial Cells In vitro
In parallel, we also sought for the adhesion capacities of the
new F. prausnitzii isolates to the intestinal epithelial cells HT-
29 and mucin. All the tested strains were not able to adhere to
HT-29 cells in vitro (data not shown) in anaerobic conditions.
Regarding mucin, some of the strains were able to adhere to
this compound after 3 h of incubation in the anaerobic chamber
(Figure 7), Even if our conditions were not representative of
physiological conditions (death of our eukaryotic cells), this
result gives ecological clues about the processes of colonization
of the gastro-intestinal tract by F. prausnitzii. In fact, this species
is a late but major commensal colonizer of the gut which
Frontiers in Microbiology | www.frontiersin.org
Functional Characterization of F. prausnitzii Strains
FIGURE 7 | Adhesion to mucin of F. prausnitzii strains. Experiments have been
done in triplicate. The adhesion values have been normalized using
Lactobacillus rhamnosus GG (LGG) a positive control know by their good
adhesion properties to mucin (50). Results are presented by the mean and the
standard deviation.
implantation requires a likely copro-cooperation maybe for the
establishment of a trophic chain (Wrzosek et al., 2013).
CONCLUDING REMARKS
The development of new probiotic products containing human
isolated strains with beneficial properties for the host requires
the development of new techniques in order to: (i) isolate strains
belonging to the major groups of the intestinal microbiota, (ii)
determinate their safe status and (iii) infer in their potential
beneficial effects. This study meets these entire three requests.
Work with anaerobic and more precisely EOS bacteria are a
prerequisite to succeed in the isolation of representative strains
that can impact on intestinal homeostasis. For this reason, in this
study, we have used a new procedure to isolate EOS strains from
feces that has enabled us to build a collection of F. prausnitzii
strains. The lack of knowledge about this species prompts us
to further analyze their genetic diversity by comparing the new
isolates with those already available in the databases. This has
allowed us to point out the high diversity of our collection
ranged on two different phylogroups with different clusters.
F. prausnitzii strain genomes should be established or/and a
metabolic comparison of several strains in the same culture
conditions whether the phylogroups belong to genomovars or
genomospecies.
Regarding safety concerns, this study is the first step toward
a better understanding of F. prausnitzii properties. Up to date,
little was known about F. prausnitzii resistance to antibiotics, lytic
activities or adhesion properties. Here, we have shown for the
first time the profile of all these characteristics in a collection of
human Faecalibacterium strains. A positive remark is that all the
strains were not antibacterial producers, not hemolytic and weak
11 June 2017 | Volume 8 | Article 1226
Martín et al.
producer of D-lactate. Furthermore, although some of the strains
were able to adhere to mucin, this trait can be considered as factor
favoring durable implantation and a highly effective probiotic
(Miquel et al., 2015a). However, further analyses are required to
better determine the presence of acquired or natural resistances
as well as to distinguish between the pathogenic or adaptative
nature of some of the properties detected such as the presence
of DNase activity.
Finally, the anti-inflammatory properties of all the strains
have been analyzed. There is a well-known correlation between
F. prausnitzii dysbiosis and a large set of human diseases such
as IBD and IBS (Miquel et al., 2013). Recent studies using
F. prausnitzii strains in in vivo models provide arguments
concerning its beneficial effect on the host (Sokol et al., 2008;
Wrzosek et al., 2013; Martin et al., 2014). The presence of the anti-
inflammatory properties of these strains also opens the possibility
to test them in murine models in order to further determine
their beneficial effects before testing them in human clinical
trials.
AUTHOR CONTRIBUTIONS
RM, SM, JC, HS, LGBH, MT, and PL participate in the design
of the project. RM, SM, JC, HS, OB, VA, LGBH, MT, and PL
designed the experiments. RM, SM, LB, CB, VR, SH, and FC
REFERENCES
Balamurugan, R., Rajendiran, E., George, S., Samuel, G. V., and Ramakrishna,
B. S. (2008). Real-time polymerase chain reaction quantification of
specific butyrate-producing bacteria, Desulfovibrio and Enterococcus
faecalis in the feces of patients with colorectal cancer. J. Gastroenterol.
Hepatol. 23(8 Pt 1), 1298–1303. doi: 10.1111/j.1440-1746.2008.
05490.x
Barcenilla, A., Pryde, S. E., Martin, J. C., Duncan, S. H., Stewart, C. S.,
Henderson, C., et al. (2000). Phylogenetic relationships of butyrate-producing
bacteria from the human gut. Appl. Environ. Microbiol. 66, 1654–1661.
doi: 10.1128/AEM.66.4.1654-1661.2000
Binnendijk, K. H., and Rijkers, G. T. (2013). What is a health benefit? An
evaluation of EFSA opinions on health benefits with reference to probiotics.
Benef. Microbes 4, 223–230. doi: 10.3920/BM2013.0019
Bocker, U., Nebe, T., Herweck, F., Holt, L., Panja, A., Jobin, C., et al. (2003).
Butyrate modulates intestinal epithelial cell-mediated neutrophil migration.
Clin. Exp. Immunol. 131, 53–60. doi: 10.1046/j.1365-2249.2003.02056.x
De Palma, G., Nadal, I., Medina, M., Donat, E., Ribes-Koninckx, C., Calabuig,
M., et al. (2010). Intestinal dysbiosis and reduced immunoglobulin-coated
bacteria associated with coeliac disease in children. BMC Microbiol. 10:63.
doi: 10.1186/1471-2180-10-63
Duncan, S. H., Hold, G. L., Harmsen, H. J., Stewart, C. S., and Flint, H. J.
(2002). Growth requirements and fermentation products of Fusobacterium
prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii
gen. nov., comb. nov. Int. J. Syst. Evol. Microbiol. 52(Pt 6), 2141–2146.
doi: 10.1099/00207713-52-6-2141
Duncan, S. H., Holtrop, G., Lobley, G. E., Calder, A. G., Stewart, C. S., and Flint,
H. J. (2004). Contribution of acetate to butyrate formation by human faecal
bacteria. Br. J. Nutr. 91, 915–923. doi: 10.1079/BJN20041150
Eaton, T. J., and Gasson, M. J. (2001). Molecular screening of Enterococcus
virulence determinants and potential for genetic exchange between
food and medical isolates. Appl. Environ. Microbiol. 67, 1628–1635.
doi: 10.1128/AEM.67.4.1628-1635.2001
EFSA Panel on Additives and Products or Substances used in Animal Feed
(FEEDAP) (2012). Guidance on the assessment of bacterial susceptibility
Frontiers in Microbiology | www.frontiersin.org
Functional Characterization of F. prausnitzii Strains
performed the experiments and analysis. RM and SM draft the
manuscript. VR, CB, FC, JC, HS, LGBH, MT, and PL revised the
manuscript critically. All the authors have read and approved the
last version of the manuscript.
FUNDING
This paper was a part of FPARIS collaborative project selected
and supported by the Vitagora Competitive Cluster and
funded by the French FUI (Fond Unique Interministériel; FUI:
n◦ F1010012D), the FEDER (Fonds Européen de Développement
Régional; Bourgogne: 34606), the Burgundy Region, the Conseil
Général 21 and the Grand Dijon. This work was also supported
by Merck Médication Familiale (Dijon, France) and Biovitis
(Saint Etienne de Chomeil, France). RM and SM receive a salary
from the same grants.
ACKNOWLEDGMENTS
Authors thank Prof. Juan Evaristo Suárez for the critical reading
of the manuscript and Stéphanie Courau and Pascal Molimard
for fruitful discussions during the project. We gratefully
acknowledge T. Meylheuc for scanning electron microscopy
(MIMA2 platform, INRA, France) and Harry Flint for the
reference Faecalibacterium strains.
to antimicrobials of human and veterinary importance. EFSA J. 10:2740.
doi: 10.2903/j.efsa.2012.2740
FAO/WHO (2002). FAO/WHO and Agriculture Organization Guidelines for
the Evaluation of Probiotics in Food. London: Food and Agriculture
Organization, 11.
Foditsch, C., Santos, T. M., Teixeira, A. G., Pereira, R. V., Dias, J. M., Gaeta, N.,
et al. (2014). Isolation and characterization of Faecalibacterium prausnitzii from
calves and piglets. PLoS ONE 9:e116465. doi: 10.1371/journal.pone.0116465
Furet, J. P., Kong, L. C., Tap, J., Poitou, C., Basdevant, A., Bouillot, J. L., et al.
(2010). Differential adaptation of human gut microbiota to bariatric surgery-
induced weight loss: links with metabolic and low-grade inflammation markers.
Diabetes 59, 3049–3057. doi: 10.2337/db10-0253
Fusunyan, R. D., Quinn, J. J., Fujimoto, M., MacDermott, R. P., and
Sanderson, I. R. (1999). Butyrate switches the pattern of chemokine secretion
by intestinal epithelial cells through histone acetylation. Mol. Med. 5,
631–640.
Hold, G. L., Schwiertz, A., Aminov, R. I., Blaut, M., and Flint, H. J.
(2003). Oligonucleotide probes that detect quantitatively significant groups
of butyrate-producing bacteria in human feces. Appl. Environ. Microbiol. 69,
4320–4324. doi: 10.1128/AEM.69.7.4320-4324.2003
Joly, F., Mayeur, C., Bruneau, A., Noordine, M. L., Meylheuc, T., Langella,
P., et al. (2010). Drastic changes in fecal and mucosa-associated microbiota
in adult patients with short bowel syndrome. Biochimie 92, 753–761.
doi: 10.1016/j.biochi.2010.02.015
Kamitani, H., Ikawa, H., Hsi, L. C., Watanabe, T., DuBois, R. N., and Eling, T. E.
(1999). Regulation of 12-lipoxygenase in rat intestinal epithelial cells during
differentiation and apoptosis induced by sodium butyrate. Arch. Biochem.
Biophys. 368, 45–55. doi: 10.1006/abbi.1999.1284
Kechaou, N., Chain, F., Gratadoux, J. J., Blugeon, S., Bertho, N., Chevalier, C., et al.
(2012). Identification of one novel candidate probiotic Lactobacillus plantarum
strain active against influenza virus infection in mice by a large-scale screening.
Appl. Environ. Microbiol. 79, 1491–1499. doi: 10.1128/AEM.03075-12
Khan, M. T., van Dijl, J. M., and Harmsen, H. J. (2014). Antioxidants keep
the potentially probiotic but highly oxygen-sensitive human gut bacterium
Faecalibacterium prausnitzii alive at ambient air. PLoS ONE 9:e96097.
doi: 10.1371/journal.pone.0096097
12 June 2017 | Volume 8 | Article 1226
Martín et al.
Kimura, M. (1980). A simple method for estimating evolutionary rates of base
substitutions through comparative studies of nucleotide sequences. J. Mol. Evol.
16, 111–120. doi: 10.1007/BF01731581
Lan, A., Bruneau, A., Bensaada, M., Philippe, C., Bellaud, P., Rabot, S.,
et al. (2008). Increased induction of apoptosis by Propionibacterium
freudenreichii TL133 in colonic mucosal crypts of human microbiota-
associated rats treated with 1,2-dimethylhydrazine. Br. J. Nutr. 100, 1251–1259.
doi: 10.1017/S0007114508978284
Lopez-Siles, M., Duncan, S. H., Garcia-Gil, L. J., and Martinez-Medina, M.
(2017). Faecalibacterium prausnitzii: from microbiology to diagnostics and
prognostics. ISME J. 11, 841–852. doi: 10.1038/ismej.2016.176
Lopez-Siles, M., Khan, T. M., Duncan, S. H., Harmsen, H. J., Garcia-Gil, L. J.,
and Flint, H. J. (2012). Cultured representatives of two major phylogroups of
human colonic Faecalibacterium prausnitzii can utilize pectin, uronic acids,
and host-derived substrates for growth. Appl. Environ. Microbiol. 78, 420–428.
doi: 10.1128/AEM.06858-11
Louis, P., Duncan, S. H., McCrae, S. I., Millar, J., Jackson, M. S., and Flint, H. J.
(2004). Restricted distribution of the butyrate kinase pathway among butyrate-
producing bacteria from the human colon. J. Bacteriol. 186, 2099–2106.
doi: 10.1128/JB.186.7.2099-2106.2004
Mack, D. R. (2004). D(-)-lactic acid-producing probiotics, D(-)-lactic acidosis and
infants. Can. J. Gastroenterol. 18, 671–675. doi: 10.1155/2004/342583
Martin, R., Chain, F., Miquel, S., Lu, J., Gratadoux, J. J., Sokol, H., et al. (2014).
The commensal bacterium Faecalibacterium prausnitzii is protective in DNBS-
induced chronic moderate and severe colitis models. Inflamm. Bowel Dis. 20,
417–430. doi: 10.1097/01.MIB.0000440815.76627.64
Martin, R., Miquel, S., Ulmer, J., Kechaou, N., Langella, P., and Bermudez-
Humaran, L. G. (2013). Role of commensal and probiotic bacteria in human
health: a focus on inflammatory bowel disease. Microb. Cell Fact. 12:71.
doi: 10.1186/1475-2859-12-71
Martin, R., Sanchez, B., Urdaci, M. C., Langella, P., Suarez, J. E., and Bermudez-
Humaran, L. G. (2015). Effect of iron on the probiotic properties of the vaginal
isolate Lactobacillus jensenii CECT 4306. Microbiology 161(Pt 4), 708–718.
doi: 10.1099/mic.0.000044
Mayeur, C., Gratadoux, J. J., Bridonneau, C., Chegdani, F., Larroque, B., Kapel,
N., et al. (2013). Faecal D/L lactate ratio is a metabolic signature of microbiota
imbalance in patients with short bowel syndrome. PLoS ONE 8:e54335.
doi: 10.1371/journal.pone.0054335
Miquel, S. R., Martìn, Bridonneau, C., Robert, V., Sokol, H., Bermúdez-Humarán,
L., Thomas, M., et al. (2014). Ecology and metabolism of the beneficial intestinal
commensal bacterium Faecalibacterium prausnitzii. Gut Microbes 5, 146–151.
doi: 10.4161/gmic.27651
Miquel, S., Beaumont, M., Martin, R., Langella, P., Braesco, V., and Thomas,
M. (2015a). A proposed framework for an appropriate evaluation scheme for
microorganisms as novel foods with a health claim in Europe. Microb. Cell Fact.
14, 48. doi: 10.1186/s12934-015-0229-1
Miquel, S., Leclerc, M., Martin, R., Chain, F., Lenoir, M., Raguideau, S.,
et al. (2015b). Identification of metabolic signatures linked to anti-
inflammatory effects of Faecalibacterium prausnitzii. Mbio 6:e00300-15.
doi: 10.1128/mBio.00300-15
Miquel, S., Martin, R., Rossi, O., Bermudez-Humaran, L., Chatel, J., Sokol, H., et al.
(2013). Faecalibacterium prausnitzii and human intestinal health. Curr. Opin.
Microbiol. 16, 255–261. doi: 10.1016/j.mib.2013.06.003
Neish, A. S. (2009). Microbes in gastrointestinal health and disease.
Gastroenterology 136, 65–80. doi: 10.1053/j.gastro.2008.10.080
Pineiro, M., and Stanton, C. (2007). Probiotic bacteria: legislative framework–
requirements to evidence basis. J. Nutr. 137(3 Suppl. 2), 850S–853S.
Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K. S., Manichanh, C., et al.
(2010). A human gut microbial gene catalogue established by metagenomic
sequencing. Nature, 464, 59–65. doi: 10.1038/nature08821
Quevrain, E., Maubert, M. A., Michon, C., Chain, F., Marquant, R., Tailhades, J.,
et al. (2016). Identification of an anti-inflammatory protein from
Faecalibacterium prausnitzii, a commensal bacterium deficient in Crohn’s
disease. Gut 65, 415–425. doi: 10.1136/gutjnl-2014-307649
Radziwill-Bienkowska, J. M., Le, D. T., Szczesny, P., Duviau, M. P., Aleksandrzak-
Piekarczyk, T., Loubiere, P., et al. (2016). Adhesion of the genome-
sequenced Lactococcus lactis subsp. cremoris IBB477 strain is mediated by
Frontiers in Microbiology | www.frontiersin.org
Functional Characterization of F. prausnitzii Strains
specific molecular determinants. Appl. Microbiol. Biotechnol. 100, 9605–9617.
doi: 10.1007/s00253-016-7813-0
Radziwill-Bienkowska, J. M., Zochowska, D., Bardowski, J., Mercier-Bonin, M.,
and Kowalczyk, M. (2014). Lactococcus lactis IBB477 presenting adhesive and
muco-adhesive properties as a candidate carrier strain for oral vaccination
against influenza virus. Acta Biochim. Pol. 61, 603–607.
Rajilic-Stojanovic, M., Biagi, E., Heilig, H. G., Kajander, K., Kekkonen, R. A.,
Tims, S., and de Vos, W. M. (2011). Global and deep molecular analysis
of microbiota signatures in fecal samples from patients with irritable bowel
syndrome. Gastroenterology 141, 1792–1801. doi: 10.1053/j.gastro.2011.07.043
Ramirez-Farias, C., Slezak, K., Fuller, Z., Duncan, A., Holtrop, G., and Louis,
P. (2009). Effect of inulin on the human gut microbiota: stimulation of
Bifidobacterium adolescentis and Faecalibacterium prausnitzii. Br. J. Nutr. 101,
541–550. doi: 10.1017/S0007114508019880
Rossi, O., Khan, M. T., Schwarzer, M., Hudcovic, T., Srutkova, D., Duncan, S. H.,
et al. (2015). Faecalibacterium prausnitzii strain HTF-F and its extracellular
polymeric matrix attenuate clinical parameters in DSS-induced colitis. PLoS
ONE 10:e0123013. doi: 10.1371/journal.pone.0123013
Sanders, M. E., Akkermans, L. M., Haller, D., Hammerman, C., Heimbach, J.,
Hormannsperger, G., et al. (2010). Safety assessment of probiotics for human
use. Gut Microbes 1, 164–185. doi: 10.4161/gmic.1.3.12127
Sarrabayrouse, G., Bossard, C., Chauvin, J. M., Jarry, A., Meurette, G., Quevrain, E.,
et al. (2014). CD4CD8αα lymphocytes, a novel human regulatory T cell subset
induced by colonic bacteria and deficient in patients with inflammatory bowel
disease. PLoS Biol. 12:e1001833. doi: 10.1371/journal.pbio.1001833
Schmidt, C. (2013). The startup bugs. Nat. Biotechnol. 31, 279–281.
doi: 10.1038/nbt.2544
Sokol, H., Pigneur, B., Watterlot, L., Lakhdari, O., Bermudez-Humaran, L.
G., Gratadoux, J. J., et al. (2008). Faecalibacterium prausnitzii is an anti-
inflammatory commensal bacterium identified by gut microbiota analysis
of Crohn disease patients. Proc. Natl. Acad. Sci. U.S.A. 105, 16731–16736.
doi: 10.1073/pnas.0804812105
Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013). MEGA6:
molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30,
2725–2729. doi: 10.1093/molbev/mst197
Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving
the sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Res. 22, 4673–4680. doi: 10.1093/nar/22.22.4673
van Tongeren, S. P., Slaets, J. P., Harmsen, H. J., and Welling, G. W. (2005). Fecal
microbiota composition and frailty. Appl. Environ. Microbiol. 71, 6438–6442.
doi: 10.1128/AEM.71.10.6438-6442.2005
Wiseman, L. R., Lamb, H., and Cefpirome, M. (1997). A review of its antibacterial
activity, pharmacokinetic properties and clinical efficacy in the treatment of
severe nosocomial infections and febrile neutropenia. Drugs 54, 117–140.
doi: 10.2165/00003495-199754010-00013
Wrzosek, L., Miquel, S., Noordine, M. L., Bouet, S., Chevalier-Curt, M. J.,
Robert, V., et al. (2013). Bacteroides thetaiotaomicron and Faecalibacterium
prausnitzii influence the production of mucus glycans and the development of
goblet cells in the colonic epithelium of a gnotobiotic model rodent. BMC Biol.
11:61. doi: 10.1186/1741-7007-11-61
Conflict of Interest Statement: PL and HS are co-founders of the start-up
NextBiotiX aiming to use next-generation probiotics to fight and to prevent IBD.
The other authors declare that the research was conducted in the absence of
any commercial or financial relationships that could be construed as a potential
conflict of interest.
Copyright © 2017 Martín, Miquel, Benevides, Bridonneau, Robert, Hudault, Chain,
Berteau, Azevedo, Chatel, Sokol, Bermúdez-Humarán, Thomas and Langella. This
is an open-access article distributed under the terms of the Creative Commons
Attribution License (CC BY). The use, distribution or reproduction in other forums
is permitted, provided the original author(s) or licensor are credited and that the
original publication in this journal is cited, in accordance with accepted academic
practice. No use, distribution or reproduction is permitted which does not comply
with these terms.
13 June 2017 | Volume 8 | Article 1226