Appl Microbiol Biotechnol (2010) 88:905–913

DOI 10.1007/s00253-010-2825-7

APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY

Development of sucrose-utilizing Escherichia coli

K-12 strain by cloning β-fructofuranosidases
and its application for L-threonine production
Jeong Wook Lee & Sol Choi & Jin Hwan Park &
Claudia E. Vickers & Lars K. Nielsen & Sang Yup Lee

Received: 10 July 2010 / Revised: 2 August 2010 / Accepted: 3 August 2010 / Published online: 14 August 2010
# Springer-Verlag 2010

Abstract Sucrose is one of the most promising carbon
sources for industrial fermentation. To achieve sucrose
catabolism, the sucrose utilization operons have been
introduced into microorganisms that are not able to utilize
sucrose. However, the rates of growth and sucrose uptake
of these engineered strains were relatively low to be
successfully employed for industrial applications. Here,
we report a practical example of developing sucrose-
utilizing microorganisms using Escherichia coli K-12 as a
model system. The sucrose utilizing ability was acquired by
introducing only β-fructofuranosidase from three different
sucrose-utilizing organisms (Mannheimia succiniciproducens,
E. coli W, and Bacillus subtilis). Among them, the M.
succiniciproducens β-fructofuranosidase was found to be the
most effective for sucrose utilization. Analyses of the
underlying mechanism revealed that sucrose was hydrolyzed
into glucose and fructose in the extracellular space and both
liberated hexoses could be transported by their respective
J. W. Lee : S. Choi : J. H. Park (*) : S. Y. Lee (*)
Metabolic and Biomolecular Engineering National Research
Laboratory, Department of Chemical and Biomolecular
Engineering (BK21 Program), BioProcess Engineering Research
Center, Center for Systems and Synthetic Biotechnology,
and Institute for the BioCentury, KAIST,
Daejeon 305-701, Republic of Korea
e-mail: jinhwan@kaist.ac.kr
e-mail: leesy@kaist.ac.kr
S. Y. Lee
Department of Bio and Brain Engineering and Bioinformatics
Research Center, Department of Biological Sciences, KAIST,
Daejeon 305-701, Republic of Korea
C. E. Vickers : L. K. Nielsen
Australian Institute for Bioengineering and Nanotechnology
(AIBN), The University of Queensland,
St. Lucia, QLD 4072, Australia
uptake systems in E. coli K-12. To prove that this system can
also be applied for the production of useful metabolites, the
M. succiniciproducens β-fructofuranosidase was introduced
into the engineered L-threonine production strain of E. coli
K-12. This recombinant strain was able to produce 51.1 g/L
L-threonine by fed-batch culture, resulting in an overall yield
of 0.284 g L-threonine per g sucrose. This simple approach to
make E. coli K-12 to acquire sucrose-utilizing ability and its
successful biotechnological application can be employed to
develop sustainable bioprocesses using renewable biomass.
Keywords Sucrose . β-Fructofuranosidase .
Sucrose 6-phosphate hydrolase . Sucrase . L-threonine
Introduction
Sucrose appeared as an attractive raw material for cost
effective bio-based chemical production (Koutinas et al.
2004; Reid and Abratt 2005; Renouf et al. 2008). Sucrose is
the most abundant disaccharide on earth mostly extracted
from sugarcane and sugarbeet (Reid and Abratt 2005).
Sucrose is one of the least expensive carbon sources that
can be used as a feedstock (Koutinas et al. 2004). A recent
life cycle evaluation of sugarcane, sugarbeet, and corn also
suggested that sugarcane is advantageous with respect to
energy input, green house gas emission, and acidification
potential due to its high monosaccharide yield and the
additional energy from cane fiber being combustible
(Renouf et al. 2008).
In addition, sucrose has also a beneficial effect on
protection of cells from oxidative, heat, and acids stresses,
so it can be an appropriate carbon source to enhance bio-
product formation. Its positive influence on preservation of
a protein structure from several kinds of stresses including
906
high temperature, high pressure, and dehydration has been
documented by many researchers (Kilimann et al. 2006;
Molina-Hoppner et al. 2004; Prestrelski et al. 1993; Van
Opstal et al. 2003). Sucrose has also been used as a
cryoprotectant and a lyoprotectant for the safe and long-
term preservation of various types of biologically active
substances ranging from human tissues to pharmaceutical
proteins (Hovatta et al. 1996; Roy and Gupta 2004).
However, many of Escherichia coli strains cannot
metabolize sucrose, and less than 50% of the wild-type
strains can utilize sucrose as a sole carbon source including
E. coli W, EC3132, and O157:H7 (Jahreis et al. 2002).
Many of well-characterized and widely used E. coli strains
including E. coli K-12, B, and C, unfortunately cannot
catabolize sucrose as a sole carbon source. In particular,
E. coli K-12, the first E. coli strain to have its genome
sequenced, has been used for several decades as a model
bacterium as well as an industrial workhorse due to its
relatively short doubling time and easiness in genetic
modification. As there are countless examples of using
E. coli K-12 for the production of chemicals, biofuel,
biodegradable polymers, amino acids, secondary metabo-
lites, etc., development of sucrose-utilizing E. coli K-12 is
desirable for biotechnological applications.
These considerations have led many researchers to
attempt to develop an E. coli K-12 derivative possessing
sucrose–metabolizing capability. Most studies have focused
on the transfer of the sucrose operon by using either high-
or low-copy-number plasmids (Sahin-Toth et al. 1999;
Schmid et al. 1982, 1988; Tsunekawa et al. 1992;
Wohlhieter et al. 1975) and the use of different gene
sources (Garcia 1985; Scholle et al. 1987, 1990; Sprenger
and Lengeler 1988). Some improvements have been made,
for example increasing the stability of the plasmid contain-
ing sucrose operon by using low-copy-plasmid (Tsunekawa
et al. 1992), but these strains still suffer from low uptake
rate of sucrose and low growth rate.
Recently, we observed that the overexpression of SacC
enzyme in Mannheimia succiniciproducens resulted in the
hydrolysis of sucrose in extracellular space. From this
observation, we hypothesized that SacC enzyme from M.
succiniciproducens known as sucrose 6-phosphate hydro-
lase can also be used as sucrase in extracellular spaces. If
this enzyme exhibits sucrase activity in the extracellular
space, it will be possible to confer the sucrose-utilizing
capability to other microorganisms which do not have the
ability. Thus, we examined in this study whether a sucrose-
utilizing capability can be transferred by simply introducing
the M. succiniciproducens SacC enzyme to E. coli K-12.
The mechanism was also examined by measuring sucrose
hydrolysis activity in the culture medium. As SacC enzyme
from M. succiniciproducens is categorized as a β-
fructofuranosidase, the other β-fructofuranosidases including
Appl Microbiol Biotechnol (2010) 88:905–913
CscA from E. coli W and SacA from Bacillus subtilis were
also examined for their ability to confer the sucrose-
utilizing ability. Furthermore, we examined whether this
sucrose-utilizing ability can be successfully transferred to a
metabolically engineered E. coli K-12 strain producing a
useful bioproduct; in this study, an L-threonine-producing
E. coli K-12 strain was examined as a model system. The
results suggest that the strategy reported here can be widely
applicable for developing sucrose-utilizing industrial strains
that do not have innate sucrose-utilizing ability.
Materials and methods
Bacterial strains, plasmids, and genetic manipulation
The strains, plasmids, and primers used in this study are
listed in Table 1. All DNA manipulations were carried out
by following standard protocols (Sambrook 2001). E. coli
Top10 (Invitrogen, Carlsbad, CA) was used as a cloning
host for recombinant DNA manipulations. E. coli K-12
W3110 was used as a production host and was cultivated at
37°C in either LB medium or M9 minimal medium
containing sucrose as a sole carbon source.
Genomic DNAs from M. succiniciproducens, E. coli,
and B. subtilis were prepared using the genomic DNA
extraction kit (Intron Biotechnology, Inc., Seongnam,
Korea). To construct the pTac15KsacCMS plasmid, the
sacC gene was amplified by PCR with primers P1 and P2
(Table 1) using M. succiniciproducens genomic DNA as a
template. The EcoRI-SacI-digested PCR fragment was
cloned into the EcoRI-SacI-digested pTac15K to make
pTac15KsacCMS. The same procedure was applied to
construct plasmids pTac15KcscAEW and pTac15KsacABS
with the primers P3–P4 and P5–P6 using the genomic DNA
of E. coli W (KCTC 1039; Korean Collection for Type
Cultures, Daejeon, Korea) and B. subtilis 168 (KCTC 1028)
as templates, respectively. Successful cloning of these three
genes was confirmed by sequencing (Solgent, Daejeon,
Korea). Three plasmids constructed were then introduced
individually into E. coli K-12W3110. When required,
ampicillin and kanamycin were added at the final concen-
trations of 50 and 25 μg/mL, respectively. Unless otherwise
stated, all chemicals used in this study were of reagent
grade and purchased from either Sigma–Aldrich (St. Louis,
MO) or Junsei Chemical (Tokyo, Japan).
Fermentation and metabolite measurement
Overnight preculture of E. coli was carried out in 10 mL
LB. A 5% (v/v) inoculum was transferred to a 25-mL flask
containing 100 mL M9 medium (per liter: 33.9 g Na2HPO4,
15 g KH2PO4, 2.5 g NaCl, 5 g NH4Cl, and 0.36 g MgSO4)
Appl Microbiol Biotechnol (2010) 88:905–913 907

Table 1 Strains, plasmids, and primers used in this study

Strain or plasmid Descriptiona Source

E. coli TOP10 Strr, cloning host (Kim et al. 2008)

E. coli K-12 W3110 Wild type, production host (Kim et al. 2008)
TH28C W3110 ΔlacI, thrAC1034T, lysCC1055T, Pthr::Ptac, ΔlysA, ΔmetA, ilvAC290T, Δtdh, (Lee et al. 2007)
ΔiclR, Pppc::Ptrc, ΔtdcC, Pacs::Cmr-Ptrc
pTac15K Kmr, low-copy number expression vector for E. coli (4.0 kb) (Qian et al. 2009)
pTac15KsacCMS pTac15K derivative containing sacC gene from M. succiniciproducens (5.6 kb) This study
pTac15KcscAEW pTac15K derivative containing cscA gene from E. coli W (5.4 kb) This study
pTac15KsacABS pTac15K derivative containing sacA gene from B. subtilis (5.4 kb) This study
pBRThrABCR3 Apr, thrABC and rhtABC overexpression vector (11.7 kb) (Lee et al. 2007)
Primer Sequence (5′ to 3′) Comment and restriction site
P1 ACTCCGGAATTCATGCGGTCGTTTTTACCGC EcoRI
P2 ACCTGCGAGCTCATTTTATTCCGCAAGCGGGT SacI
P3 ACTCCGGAATTCATGACGCAATCTCGATTGCA EcoRI
P4 ACCTGCGAGCTCCCGTTGTTCCACCTGATATTATG SacI
P5 GCATAGAATTCATGACAGCACATGACCAGGAGCT EcoRI
P6 GCATAGAGCTCCTACATAAGTGTCCAAATTCCGACATTC SacI
a
Bold letters indicate restriction site
Ap ampicillin; Cm chloramphenicol; Km kanamycin; r resistance

supplemented with 10 g/L sucrose (separately sterilized).
Cultures were incubated at 37°C and 200 rpm.
Batch fermentation under the anaerobic condition was
carried out in a 6.6-liter Bioflo 3000 reactor (New
Brunswick Scientific Co., Edison, NJ) with working
volumes of 2.5 L. An R/2 medium plus 20 g/L sucrose
was used. The R/2 medium contains per liter: KH2PO4,
6.75 g; (NH 4) 2 HPO 4, 2.0 g; C 6 H 8O 7 ·H 2 O, 0.85 g;
MgSO4·7H2O, 0.7 g; trace metal solution, 5 mL. The trace
metal solution contains per liter: FeSO4.7H2O, 10 g; CaCl2,
1.35 g; ZnSO4.7H2O, 2.25 g; MnSO4.4H2O, 0.5 g;
CuSO 4 . 5H 2 O, 1 g; (NH 4 ) 6 Mo 7 O 24 . 4H 2 O, 0.106 g;
Na2B4O7.10H2O, 0.23 g; 35% HCl, 10 mL. The fermenta-
tion in the Bioflo 3000 reactor was initiated by seeding 4%
(v/v) inoculum from overnight preculture in 100 mL LB
medium. The temperature was controlled at 37°C, 200 rpm,
and the pH was kept at 6.8 by the automatic addition of a
28% (v/v) ammonia solution. The fermentor was continu-
ously sparged with industrial-grade CO2 gas at a flow rate
of 0.2 vvm (CO2 volume/working volume/minute). The
quantification of sucrose, and fermentative products including
acetic, formic, lactic, and succinic acids, and ethanol were
performed by a high-performance liquid chromatography
(HPLC) as described previously (Lee et al. 2006b). The
OD600 was measured using an Ultrospec 3100 Pro spectro-
photometer (Amersham biosciences, Uppsala, Sweden) to
monitor the cell growth. The concentration of L -
threonine was analyzed by an amino acid analyzer (Sykam
S433; Sykam, Eresing, Germany) as described previously
(Park et al. 2007).
Fed-batch cultivation for L-threonine production
The L-threonine producing strain developed by introducing
pBRThrABCR3 and pTac15KsacCMS plasmids into TH28C
strain (Table 1) was grown in a semi-defined THM medium
at 31°C with a starting pH of 6.0. The THM1 medium
contains per liter: sucrose, 20 g; (NH4)2SO4, 15 g; KH2PO4,
2.0 g; MgSO4.7H2O, 2.0 g; yeast extract, 3 g; trace metal
solution, 5 mL. The medium was supplemented with 2 mM
L-lysine, L-methionine, and 0.8 mM L-isoleucine to over-
come the auxotrophy of the production strain. Seed culture
was prepared in 250-mL Erlenmeyer flask containing
100 mL of LB medium at 200 rpm at 31°C. Cells
at stationary phase were diluted to an initial optical density
of 0.2–0.3 into a 6.6-L bioreactor (Bioflo 3000, New
Brunswick Scientific Co., Edison, NJ) containing 2 L of
THM medium and cultivated aerobically by batch fermen-
tation at 31°C. Feeding solution for fed-batch cultivation
was made of 400 g/L sucrose, 20 g/L KH2PO4, 2.1 g/L
L-methionine and 2.1 g/L L-lysine. When the sucrose
concentration in the culture broth fell to 1 g/L, 100 mL of
feeding solution (thus, equivalent to 40 g sucrose, 2 g
KH2PO4, 0.42 g L-methionine, and 0.42 g L-lysine) was
added. L-isoleucine feeding is not necessary as cells are
only attenuated for its biosynthesis (Lee et al. 2007). The
pH was controlled at 6.0 by automatic feeding of 28% (v/v)
ammonia solution. Dissolved oxygen concentration was
maintained above 40% of air saturation by supplying air at
1 vvm and by automatically controlling the agitation speed
up to 1,000 rpm.
908
Activity of β-fructofuranosidase in extracellular space
To measure the extracellular sucrose hydrolysis activity of
the engineered E. coli K-12 strain, samples were taken from
the mid-exponential growth phase of the culture. Cells were
completely removed by centrifugation for 5 min at 4°C and
16,100×g, and the supernatant was filtered through 0.2-μm
pore-size filter (DISMIC-13HP, Toyo Roshi Kaisha Ltd.,
Japan). If the enzyme is present in the culture medium, it
can be heat denatured. Thus, the cell-free culture medium
was either non-denatured or denatured at 100°C for 10 min
to observe sucrose hydrolysis. The denatured and non-
denatured culture medium was incubated at 37°C for 2, 4,
and 6 h to measure the sucrose hydrolysis activity.
Reactions were stopped by denaturing again as described
above. The concentrations of sucrose and the resultant
hexoses, glucose and fructose, were quantified by HPLC as
described above. The sucrose hydrolysis activity was calcu-
lated as the difference in the remaining sucrose in the culture
medium before and after incubation. Total cellular proteins
were quantified by Bradford assay (Bradford 1976). One unit
(U) of enzyme activity was defined as the amount of enzyme
necessary to catalyze the hydrolysis of 1 μmol of sucrose per
minute.
Fig. 1 Fermentation profiles of E. coli strains in the medium
containing sucrose as a sole carbon source. Growth and metabolite
profiles obtained by flask culture of E. coli K-12 W3110 (pTac15K)
(a) and E. coli K-12 W3110 (pTac15KsacCMS) (b) aerobically in M9
medium containing 10 g/L sucrose. c Growth comparison among E.
coli strains including E. coli K-12 W3110 (pTac15K) (white square),
E. coli K-12 W3110 (pTac15KcscAEW) (filled circle), and E. coli
K-12 W3110 (pTac15KsacABS) (filled diamond). d Growth and
Appl Microbiol Biotechnol (2010) 88:905–913
Results
Transfer of the sucrose-utilizing ability into E. coli K-12
strain by introducing SacC enzyme
To see if the sucrose-utilizing ability can be transferred to a
strain which is unable to utilize sucrose, the M. succinicipro-
ducens SacC was introduced into the E. coli K-12 W3110
strain. As shown in Fig. 1a, the control strain E. coli
K-12 W3110 (pTac15K) could not grow in the minimal
medium containing sucrose as a sole carbon source.
Although a little growth in the first 5 h resulting from
residual nutrients in the LB medium inoculum was observed,
sucrose was not consumed at all (Fig. 1a). In contrast to the
control strain, E. coli K-12 W3110 (pTac15KsacCMS) over-
expressing the M. succiniciproducens sacC gene could
utilize sucrose and grew up to the OD600 of 4.0 (Fig. 1b).
Interestingly, it was found that glucose and fructose were
detected in the culture medium from the beginning of the
cultivation. Concentrations of glucose and fructose in-
creased gradually until sucrose was completely depleted.
After the complete exhaustion of sucrose, the concen-
trations of both hexoses started to decrease; glucose
concentration decreased more rapidly because it is a more
metabolite profiles obtained by anaerobic batch fermentation of
E. coli K-12 W3110 (pTac15KsacCMS). Fermentation profiles are
represented with the following symbols except for (c) (the symbols are
as defined above): cell growth (white circle), sucrose (white square),
glucose (filled diamond), fructose (filled inverted triangle), acetic acid
(white diamond), formic acid (filled square), lactic acid (white
inverted triangle), succinic acid (filled circle), and ethanol (filled
triangle)
Appl Microbiol Biotechnol (2010) 88:905–913
preferred carbon source than fructose. Throughout the cell
growth, acetate was produced as the only fermentation end
product (Fig. 1b).
Sucrose hydrolysis in culture medium and the activity
of SacC
As hypothesized, E. coli K-12 W3110 (pTac15KsacCMS)
could grow in the medium containing sucrose as a sole
carbon source. Interestingly, glucose and fructose were
detected in the medium during the growth even though they
were not initially added as carbon sources (Fig. 1b). The
concentrations of glucose and fructose increased along with
the cell growth until sucrose was completely exhausted,
which suggested that sucrose might have been degraded in
the culture broth.
To verify that the recombinant E. coli K-12 strain
overexpressing the sucrose 6-phosphate hydrolase exhibits
sucrase activity in extracellular space, the sucrase activity in
the cell-free culture medium was measured. Cell-free
culture broth was either non-denatured or denatured and
was incubated at 37°C to examine sucrose hydrolysis. If the
sucrose hydrolysis activity exists in the medium, cell-free
medium will exhibit sucrose degradation without the
presence of cells. After the incubation, all the samples
were heat-treated to stop the reaction completely. As shown
in Fig. 2, non-denatured culture broth showed sucrose
hydrolysis activity while denatured culture broth did not.
The specific enzyme activities of non-denatured samples after
2, 4, and 6 h were 69.36±6.40, 50.19±3.48, and 38.41±
1.83 U/mg of protein, respectively, while the specific enzyme
activities of the denatured samples were 0.70±0.16, 0.77±
0.15, and 1.20±0.04 U/mg of protein (Fig. 2). This result
implies that the cell-free culture broth contains enzymes that
can degrade sucrose into glucose and fructose. This was
further supported by the finding that sucrose hydrolase
activity is almost completely destroyed when the medium
Fig. 2 Extracellular enzyme activity of sucrose hydrolysis. Cell-free
culture medium was either non-denatured or denatured at 100°C for
10 min before the measurement of the sucrose hydrolyzing activities.
Assays were performed by incubating at 37°C for 2, 4, and 6 h
909
was denatured in 100°C for 10 min. The activities exhibited
declining tendency along with the incubation time but it
lasted up to 6 h at least. Consequently, the hydrolysis of
sucrose indeed occurs in the extracellular space and liberated
glucose and fructose seem to be transported by their
respective uptake systems, mainly PTS systems (Fig. 3a).
Examination of other β-fructofuranosidases, CscA
from E. coli W and SacA from B. subtilis
As described above, the only enzyme introduced to confer the
sucrose-utilizing ability was sucrose 6-phosphate hydrolase
(EC 3.2.1.26). This enzyme is categorized as β-
fructofuranosidase, which catalyzes the hydrolysis of terminal
non-reducing β-D-fructofuranoside residues in β-D-fructofur-
anosides. For example, the hydrolysis of terminal fructose
residue from fructose-containing disaccharides, phosphory-
lated disaccharides, trisaccharides, and polysaccharides with
varying specificities can be acquired (Reid and Abratt 2005).
This category of enzyme includes β-fructofuranoside fructo-
hydrolase, invertase, saccharase, sucrose 6-phosphate hydro-
lase, glucosucrase, β-h-fructosidase, β-fructosidase, invertin,
sucrase, fructosylinvertase, alkaline invertase, and acid
invertase according to the enzyme database, BRENDA
(http://www.brenda-enzymes.org/).
To examine if the sucrose-utilizing ability described
above is not limited to sucrose 6-phosphate hydrolase from
M. succiniciproducens, other β-fructofuranosidases were
also examined. Sucrase encoded by the E. coli W cscA was
introduced into E. coli K-12 W3110 to make E. coli K-12
W3110 (pTac15KcscAEW). This strain was capable of
growing in a minimal medium containing sucrose as a sole
carbon source (Fig. 1c) and consumed 5.95 g/L sucrose in
47 h. In the case of introducing pTac15KsacABS harboring
the sucrose 6-phosphate hydrolase (SacA) from B. subtilis
as a representative Gram-positive bacterium into E. coli K-
12 W3110, the growth on sucrose medium was rather slow
compared with those of the recombinant strains over-
expressing SacC or CscA (Fig. 1c), and consumed only
0.51 g/L sucrose in 47 h.
Fermentation of recombinant E. coli K-12 harboring
β-fructofuranosidase activity under anaerobic condition
As many chemicals and biofuels are produced under
anaerobic condition, the effectiveness of the strategy of
expressing the heterologous β-fructofuranosidase to confer
sucrose-utilizing ability was examined in anaerobic culture
condition. E. coli K-12 W3110 (pTac15KsacCMS) was
cultivated with CO2 sparging to examine whether this strain
can also utilize sucrose in anaerobic culture condition. As
shown in Fig. 1d, cells grew to an OD600 of more than 2.5
by utilizing 22.13 g/L sucrose and produced 4.49 g/L
910 Appl Microbiol Biotechnol (2010) 88:905–913

Fig. 3 Schematic representation of the sucrose utilization system
developed and employed in this study (a), sucrose PTS system (b),
and sucrose permease system (c). Solid and dotted lines indicate
metabolic pathway and phosphoryl group transfer, respectively.
Because these three systems have different phosphate donors for the
sucrose utilization, the consumption of ATP during sucrose uptake
varies from one another. Sucrose utilization system described in this
study, sucrose PTS system, and sucrose permease system would most
likely consume 1, 1.5, and 2 mol of ATP, respectively, to produce
1 mol of FBP. SCR sucrose; GLC glucose; FRU fructose; PEP
phosphoenolpyruvate; PTS PEP-dependent phosphotransferase sys-
tem; G6P glucose 6-phosphate; F1P fructose 1-phosphate; FBP
fructose 1,6-bisphosphate; PYR pyruvic acid; PMS permease

acetic, 3.74 g/L formic, 4.19 g/L lactic, 5.10 g/L succinic
acid, and 2.66 g/L ethanol (Table 2 and Fig. 1d). Similar to
the aerobic cultivation (Fig. 1b), glucose and fructose were
released into the medium during the growth under
anaerobic condition (Fig. 1d).
Biotechnological application of the transferable sucrose
utilization system: application to L-threonine production
To examine whether the β-fructofuranosidase alone is truly
applicable to an industrially relevant bioprocess, the fed-batch
cultivation of an L-threonine producing E. coli K-12 strain
harboring the plasmid overexpressing SacC enzyme was
carried out using sucrose as a carbon source. The L-threonine
producing strain used was TH28C (pBRThrABCR3) strain
(Lee et al. 2007), which was transformed with the plasmid
pTac15KsacCMS. By fed-batch culture of the TH28C
(pBRThrABCR3 and pTac15KsacCMS) strain, the final
L-threonine concentration and volumetric productivity
obtained in 70 h were 51.1 g/L from 180 g/L sucrose and
0.73 g/L/h, respectively (Fig. 4). Sucrose was gradually
hydrolyzed to glucose and fructose by extracellular sucrase
activity of β-fructofuranosidase during the batch phase. The
concentrations of glucose and fructose increased accordingly
until 4–7 h, after which they decreased due to the uptake by
the cells; this again supports our hypothesis that sucrose is
hydrolyzed to glucose and fructose in the extracellular space
and transported by their respective uptake systems. During
the fed-batch phase, the concentration of sucrose was
maintained at almost zero, while the concentrations of glucose
and fructose were maintained between 0 and 10 g/L,
suggesting that sucrose was hydrolyzed to glucose and
fructose immediately after being fed into the culture medium
by highly active extracellular β-fructofuranosidase. Acetic
acid concentration was maintained at a level lower than
1.0 g/L until 47.8 h, after which cells started to accumulate
acetic acid up to a final concentration of 4.47 g/L. This
tendency of less acetic acid formation was the same as that

Table 2 Results of E. coli

K-12 W3110 (pTac15KsacCMS) Sucrose and fermentative Initial concentration Final concentration Yield Specific yield
cultivation in M9 medium products (g/L) (g/L) (g/g Sucrose) (g/g DCW)
containing sucrose as a sole
carbon source Sucrose 22.13 0 – –
Acetic acid 0 4.49 0.20 4.49
Formic acid 0 3.74 0.17 3.74
Lactic acid 0 4.19 0.19 4.19
Succinic acid 0 5.10 0.23 5.11
Ethanol 0 2.66 0.12 2.66
Biomassa 0.14 1.00 0.04 –
a
Conversion factor, Total 22.13 21.18 0.95 20.19
1 OD600 =0.37 gDCW/L, was used
Appl Microbiol Biotechnol (2010) 88:905–913
Fig. 4 Fed-batch profile of engineered E. coli K-12 strain TH28C
(pBRThrABCR3 and pTac15KsacCMS) strain in the medium contain-
ing sucrose as a carbon source. Fermentation profile is represented
with the following symbols: cell growth (white circle), sucrose (white
square), glucose (filled diamond), fructose (filled inverted triangle),
acetic acid (white diamond), and L-threonine (white triangle)
observed in the fermentation of the parent strain, TH28C
(pBRThrABCR3), in the medium containing glucose as a
carbon source (Lee et al. 2007). The overall L-threonine
yield was 0.284 g L-threonine per g sucrose, which is
almost comparable to that (0.294 g L-threonine per g glucose)
obtained with glucose as a carbon source (Lee et al. 2007).
Thus, it could be concluded that the sucrose-utilizing ability
by the simple introduction of β-fructofuranosidase can
indeed be transferred to an engineered E. coli K-12 strain
which is unable to utilize sucrose, thus opening up the
possibility of converting glucose-based industrial E. coli
K-12 strains developed to date to sucrose-utilizing versions.
Discussion
Sucrose has recently been attracting much attention due to
its great advantages as a raw material for biotechnological
applications. It is less expensive than other common
carbohydrates (Koutinas et al. 2004) and can be used as a
protectant of proteins from many types of stresses. Here, we
report a simple strategy of developing sucrose-utilizing
microorganism by introducing β-fructofuranosidases using
E. coli K-12 as an example. The strategy developed here
can also be applied to the numerous industrially important
microorganisms which do not utilize sucrose. This enzyme
can hydrolyze terminal non-reducing β-D-fructofuranoside
residues in β-D-fructofuranosides so that sucrose can be
degraded into glucose and fructose in the extracellular
space.
None of these proteins contain a signal peptide, which
typically is composed of a positively charged N-terminal
region, a hydrophobic region of at least six residues, and a
C-terminal region possessing polar uncharged amino acids
(Emanuelsson et al. 2007). It is interesting to note that the
predictive programs such as SignalP (http://www.cbs.dtu.
dk/services/SignalP/), which is the most widely used
911
prediction tool for the signal peptide (Emanuelsson et al.
2007), do not predict that β-D-fructofuranosides examined
in this study are secretory proteins. However, it is also
interesting to note that considerable number of proteins
which are supposed to be present in the cytoplasmic space
were found in the extracellular space during our previous
studies on the secreted proteome of E. coli strains in high cell
density cultivation (Xia et al. 2008). As nucleic acids and the
most abundant cytoplasmic proteins were not detected in the
extracellular proteome, it was concluded that cell lysis is not
responsible for the secretion of these proteins. This phenom-
enon has also been observed in other publications (Antelmann
et al. 2001; Hirose et al. 2000; Lee et al. 2006a; Li et al.
2004). The proteins containing no secretion signal peptide
secreted through different mechanisms are commonly
referred to as non-classically secreted proteins (Hirose et al.
2000; Jeffery 2003; Vizcaino et al. 2010).
As β-fructofuranosidase is the key enzyme for sucrose
utilization, it is not surprising to find that all of sucrose-
utilizing bacteria have this category of enzyme. Interest-
ingly, CscA and SacA have 30% and 35% amino acid
sequence identities with SacC from M. succiniciproducens,
respectively, which is relatively low compared to SacC
from Aggregatibacter aphrophilus NJ8700 and SacC from
Actinobacillus succinogenes 130Z having 73% and 69%
identities with the M. succiniciproducens SacC, respective-
ly. Thus, it seems that β-fructofuranosidases from other
organisms, when transferred to a strain unable to utilize
sucrose, will allow sucrose utilization as in the case of
M. succiniciproducens β-fructofuranosidase.
Interestingly, there have been several reports on the
extracellular sucrase activity when sucrases from various
bacteria were introduced into E. coli K-12 strains. Over-
expression of sucrase from either Vibrio alginolyticus or
Bacteriodes fragilis in E. coli K-12 derivatives allowed cell
growth on sucrose and sucrase activities were found in the
extracellular medium (Scholle et al. 1987, 1990). In addition,
overexpression of the E. coli B-62 cscA gene in E. coli K-12
derivative also conferred the sucrose-utilizing ability to the
K-12 strain (Sahin-Toth et al. 1999). Taken together, the
results reported in these previous studies also support our
finding that the expression of β-fructofuranosidases alone
can confer the sucrose-utilizing capability to E. coli K-12
strains and possibly other microorganisms unable to utilize
sucrose.
It should be emphasized that most industrial E. coli
strains developed for the production of bioproducts of
interest are unable to utilize sucrose. As these industrial
E. coli strains have been developed by heavy metabolic
engineering and/or many rounds of mutation–selection
process, it is difficult, if not impossible, to transfer all these
genotypes into a sucrose-utilizing host strain. Thus, it is very
important to examine whether the simple sucrose-utilizing
912
system developed in this study can be transferred to these
industrial E. coli strains. As a proof-of-concept example, the
E. coli K-12 strain which was metabolically engineered at
the systems-level (Lee et al. 2007) was used as a test strain to
introduce the M. succiniciproducens β-fructofuranosidase.
The fed-batch culture result suggested that the engineered K-
12 strain could efficiently utilize sucrose as a carbon source
and produce L-threonine to a high concentration with a yield
comparable to that achieved with glucose as a carbon source.
Considering the low price of sucrose (Koutinas et al. 2004),
this strategy should be beneficial for converting glucose-
utilizing industrial E. coli strains to those capable of utilizing
sucrose.
Since sucrose hydrolysis results in liberation of glucose
and fructose, cells can utilize these hexoses using the standard
catabolic pathways. Thus, this strategy should be applicable to
already established strains which are optimized using glucose
and/or fructose as carbon sources. Compared with the sucrose
PTS and sucrose permease systems, the β-fructofuranosidase
system would consume less ATP as each released hexose is
presumably metabolized through the respective PTS system
(Fig. 3). To get 1 mol of fructose 1,6-bisphosphate, for
example, the β-fructofuranosidase system requires 1 mol of
ATP while the sucrose PTS and sucrose permease systems
require 1.5 and 2 mol of ATP, respectively (Fig. 3). As the
PTS system is much more energetically favored route than
hexokinase in respect of Gibbs free energy changes (Ould-
Moulaye et al. 1999), consumption of more PEP and less
ATP can be energetically more desirable during the uptake of
carbon source. In addition, since the β-fructofuranosidase
system for sucrose utilization seem to require two PTS
systems for glucose and fructose, the pyruvate pool (resulting
from dephosphorylation of PEP) would be increased.
Consequently, this sucrose-utilization system might be
particularly useful for the production of chemicals which
have pyruvate as an intermediate precursor.
In conclusion, we demonstrated that the sucrose-utilizing
ability can be conferred by simply transferring β-
fructofuranosidase of various origin to E. coli K-12 strain
as a model microorganism. It was found that this system is
enabled by hydrolyzing sucrose by β-fructofuranosidase
excreted into the medium. Furthermore, the proof-of-
concept experiments with the L-threonine producing E. coli
K-12 strain suggested that this β-fructofuranosidase system
can indeed be transferred to various industrial E. coli K-12
strains developed.
Acknowledgements This work was supported by the Korea–
Australia Collaborative Research Project on the Development of
Sucrose-Based Bioprocess Platform (10030795) from the Korean
Ministry of Knowledge Economy. Further support by World Class
University program (R322009000101420) by the Ministry of Education,
Science and Technology through the National Research Foundation is
appreciated.
Appl Microbiol Biotechnol (2010) 88:905–913
References
Antelmann H, Tjalsma H, Voigt B, Ohlmeier S, Bron S, van Dijl JM,
Hecker M (2001) A proteomic view on genome–based signal
peptide predictions. Genome Res 11:1484–1502
Bradford MM (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein–dye binding. Anal Biochem 72:248–254
Emanuelsson O, Brunak S, von Heijne G, Nielsen H (2007) Locating
proteins in the cell using TargetP, SignalP and related tools. Nat
Protoc 2:953–971
Garcia JL (1985) Cloning in Escherichia coli and molecular analysis
of the sucrose system of the Salmonella plasmid SCR-53. Mol
Gen Genet 201:575–577
Hirose I, Sano K, Shioda I, Kumano M, Nakamura K, Yamane K
(2000) Proteome analysis of Bacillus subtilis extracellular
proteins: a two-dimensional protein electrophoretic study. Micro-
biology 146:65–75
Hovatta O, Silye R, Krausz T, Abir R, Margara R, Trew G, Lass A,
Winston RM (1996) Cryopreservation of human ovarian tissue
using dimethylsulphoxide and propanediol–sucrose as cryopro-
tectants. Hum Reprod 11:1268–1272
Jahreis K, Bentler L, Bockmann J, Hans S, Meyer A, Siepelmeyer J,
Lengeler JW (2002) Adaptation of sucrose metabolism in the
Escherichia coli wild-type strain EC3132. J Bacteriol 184:
5307–5316
Jeffery CJ (2003) Moonlighting proteins: old proteins learning new
tricks. Trends Genet 19:415–417
Kilimann KV, Doster W, Vogel RF, Hartmann C, Ganzle MG (2006)
Protection by sucrose against heat-induced lethal and sublethal
injury of Lactococcus lactis: an FT-IR study. Biochim Biophys
Acta 1764:1188–1197
Kim JM, Lee KH, Lee SY (2008) Development of a markerless gene
knock-out system for Mannheimia succiniciproducens using a
temperature–sensitive plasmid. FEMS Microbiol Lett 278:78–85
Koutinas AA, Wang R, Webb C (2004) Evaluation of wheat as generic
feedstock for chemical production. Ind Crop Prod 20:75–88
Lee JW, Lee SY, Song H, Yoo JS (2006a) The proteome of
Mannheimia succiniciproducens, a capnophilic rumen bacterium.
Proteomics 6:3550–3566
Lee SJ, Song H, Lee SY (2006b) Genome-based metabolic engineer-
ing of Mannheimia succiniciproducens for succinic acid produc-
tion. Appl Environ Microbiol 72:1939–1948
Lee KH, Park JH, Kim TY, Kim HU, Lee SY (2007) Systems
metabolic engineering of Escherichia coli for L-threonine
production. Mol Syst Biol 3:149
Li M, Rosenshine I, Tung SL, Wang XH, Friedberg D, Hew CL,
Leung KY (2004) Comparative proteomic analysis of extracel-
lular proteins of enterohemorrhagic and enteropathogenic Escher-
ichia coli strains and their ihf and ler mutants. Appl Environ
Microbiol 70:5274–5282
Molina-Hoppner A, Doster W, Vogel RF, Ganzle MG (2004)
Protective effect of sucrose and sodium chloride for Lactococcus
lactis during sublethal and lethal high-pressure treatments. Appl
Environ Microbiol 70:2013–2020
Ould-Moulaye CB, Dussap CG, Gros JB (1999) Estimation of Gibbs
energy changes of central metabolism reactions. Biotechnol Tech
13:187–193
Park JH, Lee KH, Kim TY, Lee SY (2007) Metabolic engineering of
Escherichia coli for the production of L-valine based on
transcriptome analysis and in silico gene knockout simulation.
Proc Natl Acad Sci USA 104:7797–7802
Prestrelski SJ, Tedeschi N, Arakawa T, Carpenter JF (1993)
Dehydration-induced conformational transitions in proteins and
their inhibition by stabilizers. Biophys J 65:661–671
Appl Microbiol Biotechnol (2010) 88:905–913
Qian ZG, Xia XX, Lee SY (2009) Metabolic engineering of
Escherichia coli for the production of putrescine: a four carbon
diamine. Biotechnol Bioeng 104:651–662
Reid SJ, Abratt VR (2005) Sucrose utilisation in bacteria: genetic
organisation and regulation. Appl Microbiol Biotechnol 67:
312–321
Renouf MA, Wegener MK, Nielsen LK (2008) An environmental life
cycle assessment comparing Australian sugarcane with US corn
and UK sugar beet as producers of sugars for fermentation.
Biomass Bioenergy 32:1144–1155
Roy I, Gupta MN (2004) Freeze-drying of proteins: some emerging
concerns. Biotechnol Appl Biochem 39:165–177
Sahin-Toth M, Lengyel Z, Tsunekawa H (1999) Cloning, sequencing,
and expression of cscA invertase from Escherichia coli B-62.
Can J Microbiol 45:418–422
Sambrook JRD (2001) Molecular cloning: a laboratory manual. Cold
Spring Harbor Lab Press, Cold Spring Harbor
Schmid K, Schupfner M, Schmitt R (1982) Plasmid-mediated uptake
and metabolism of sucrose by Escherichia coli K-12. J Bacteriol
151:68–76
Schmid K, Ebner R, Altenbuchner J, Schmitt R, Lengeler JW (1988)
Plasmid-mediated sucrose metabolism in Escherichia coli K12:
mapping of the scr genes of pUR400. Mol Microbiol 2:1–8
Scholle RR, Coyne VE, Maharaj R, Robb FT, Woods DR (1987)
Expression and regulation of a Vibrio alginolyticus sucrose
utilization system cloned in Escherichia coli. J Bacteriol
169:2685–2690
913
Scholle RR, Steffen HE, Goodman HJ, Woods DR (1990) Expression
and regulation of a Bacteroides fragilis sucrose utilization
system cloned in Escherichia coli. Appl Environ Microbiol
56:1944–1948
Sprenger GA, Lengeler JW (1988) Analysis of sucrose catabolism in
Klebsiella pneumoniae and in Scr+derivatives of Escherichia
coli K12. J Gen Microbiol 134:1635–1644
Tsunekawa H, Azuma S, Okabe M, Okamoto R, Aiba S (1992)
Acquisition of a sucrose utilization system in Escherichia coli K-
12 derivatives and its application to industry. Appl Environ
Microbiol 58:2081–2088
Van Opstal I, Vanmuysen SC, Michiels CW (2003) High sucrose
concentration protects E. coli against high pressure inactivation
but not against high pressure sensitization to the lactoperoxidase
system. Int J Food Microbiol 88:1–9
Vizcaino C, Restrepo-Montoya D, Rodriguez D, Nino LF, Ocampo M,
Vanegas M, Reguero MT, Martinez NL, Patarroyo ME, Patarroyo
MA (2010) Computational prediction and experimental assess-
ment of secreted/surface proteins from mycobacterium tubercu-
losis H37Rv. PLoS Comput Biol 6:e1000824
Wohlhieter JA, Lazere JR, Snellings NJ, Johnson EM, Synenki RM,
Baron LS (1975) Characterization of transmissible genetic
elements from sucrose-fermenting Salmonella strains. J Bacteriol
122:401–406
Xia XX, Han MJ, Lee SY, Yoo JS (2008) Comparison of the
extracellular proteomes of Escherichia coli B and K-12 strains
during high cell density cultivation. Proteomics 8:2089–2103