Bioresource Technology 128 (2013) 547–552

Contents lists available at SciVerse ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

A novel pathway construction in Candida tropicalis for direct xylitol conversion

from corncob xylan
Xiaoxiao Guo, Ruihua Zhang, Zhe Li, Dazhang Dai, Chun Li ⇑, Xiaohong Zhou
School of Life Science, Beijing Institute of Technology, Beijing 100081, PR China

h i g h l i g h t s

" A new b-xylanase gene was discovered from Aspergillus terreus.

" The co-expression plasmid of xylanase and xylosidase was constructed.
" A novel xylan transforming pathway was integrated in Candida tropicalis BIT-Xol-1.
" Xylanase and xylosidase were secretively expressed in the engineered C. tropicalis.
" It simultaneously saccharify and transform xylan to xylitol efficiently.

a r t i c l e i n f o a b s t r a c t

Article history: In this study, an integrated xylitol production pathway, directly using xylan as the substrate, was con-
Received 15 August 2012 structed in Candida tropicalis BIT-Xol-1 which could efficiently convert xylose into xylitol. In order to con-
Received in revised form 29 October 2012 solidate this bioprocessing, a b-1,4-xylanase gene (atn) and a b-xylosidase gene (atl) were cloned from
Accepted 29 October 2012
Aspergillus terreus, and were constructed onto episomal plasmid pAUR123. Additionally, combination
Available online 7 November 2012
of the individual atn and atl expression cassette was also cloned onto pAUR123. After transforming,
the positive C. tropicalis transformants co-expressing xylanase and xylosidase produced larger hydrolysis
Keywords:
zones than those expressing xylanase alone, when incubated on xylan-congo red plates. The engineered
Xylanase
Xylosidase
C. tropicalis/pAUR-atn-atl-3 (C. tropicalis PNL3) secrete heterologous xylanase and xylosidase simulta-
Xylan neously, with the activities of 48.17 and 11.56 U/mL, respectively. The xylitol yields by C. tropicalis
Xylitol PNL3 utilizing xylan and corncob were 77.1% and 66.9%, respectively. The integrated pathway of xylitol
Candida tropicalis production was feasible and efficient in utilization of xylan-rich renewable biomass via combining sac-
charification and transformation of xylan in engineered C. tropicalis.
Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction
Xylitol, a natural occurring five carbon sugar alcohol, is one of
the most expensive polyol sweeteners and has specific health
claims in the world market. As an alternative sugar, owning the
properties of low energy and inhibition against the metabolism
of dental plaque formation, xylitol was widely used in oral hygiene
and pharmaceutical products to reduce tooth decay and ear infec-
tion (Mäkinen, 2000). Additionally, xylitol also works as a sucrose
substitute for diabetics since it does not require insulin for its met-
abolic regulation (Emodi, 1978).
The traditional production of xylitol involves direct chemical
hydrogenation of D-xylose derived from hemicelluloses xylan
hydrolysates of biomass materials over a Raney–Nickel catalyst,
which includes high pressure and temperature as well as expensive
⇑ Corresponding author. Tel./fax: +86 10 68913171.
E-mail addresses: lichun@bit.edu.cn (C. Li), zhouxh@bit.edu.cn (X. Zhou).
separation and purification steps. Some research efforts have fo-
cused on xylitol production using Escherichia coli by xylose reduc-
tion during growth on glucose (Cirino et al., 2006; Khankal et al.,
2008) or xylose (Cirino et al., 2006; Cirino and Akinterinwa,
2009). Additionally, the biotransformation of D-arabitol into xylitol
was also investigated with focus on the conversion of D-xylulose
into xylitol (Zhou et al., 2012). Alternately, xylitol production from
D-xylose through bioconversion has been proposed as an alterna-
tive process utilizing microorganisms such as yeasts, bacteria and
filamentous fungi (Chang and Knight, 1960; Antti et al., 2005; Con-
verti and Dominguez, 2001). Among these, yeasts are generally con-
sidered to be more efficient producers of xylitol than bacteria or
filamentous fungi. Many studies have investigated biological meth-
ods of xylitol production by three different types of yeasts (Jin et al.,
2005). First, there are wild type xylose utilizing yeasts, such as C.
guilliermondii (Meyrial et al., 1991), C. boindii (Vandeska et al.,
1995), C. tropicalis (Kim et al., 1999), C. parapsilosis and Debaryomy-
ces hansenii (Prakash et al., 2011). In addition, recombinant

0960-8524/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.biortech.2012.10.155
548 X. Guo et al. / Bioresource Technology 128 (2013) 547–552
Saccharomyces cerevisiae (Hallborn et al., 1991; Meinander et al.,
1999) expressing XYL1(xylose reductase gene) from Pichia stipitis
is known to convert xylose into xylitol. Moreover, mutant strains
of some native xylose metabolizing yeasts such as P. stipitis (Kim
et al., 2001) and C. tropicalis (Ko et al., 2006; Yoon et al., 2010) were
screened and could produce xylitol from xylose more efficiently.
Obviously, the substrate for all these yeast strains to produce xylitol
is xylose, which is obtained by acid hydrolysis of xylan present in
the hemicellulose. Environmental pollution and equipment corro-
sion caused by industrial hemicellulose hydrolysate preparation
using sulfuric acid is seriously significant (Boussarsar et al., 2009).
Moreover, several by-products derived from sugars and lignin
during the pretreatment of hemicellulosic raw materials negatively
affect the fermentation efficiency (Zhang et al., 2012). The develop-
ment of a new environment friendly xylitol producing bioprocess-
ing with moderate reaction conditions and low pollution was
practically imperative.
Corncobs is one of the most abundant agricultural wastes con-
taining about 30% xylan-type hemicelluloses (Santos et al., 2005),
which were recognized as satisfactory sources of xylitol synthesis
(Yuan et al., 2004). In the degradation process of xylan, endo-b-
1,4-xylanase (b-1,4-D-xylan xylanohydrolase, E.C.3.2.1. 8) and b-
xylosidase (b-1,4-D-xylan xylohydrolase, EC 3.2.1.37) play very
important roles that the former one randomly cleaves the b-1,4-
glycosidic linkages of xylan into short xylo-oligosaccharides and
the latter one hydrolyze xylo-oligosaccharides to D-xylose (Beg
et al., 2001). Many bacterial and fungal species are able to utilize
xylans as a carbon source, among which A. terreus is an efficient
producers of cellulolytic and xylanolytic enzymes (Hrmova et al.,
1989; Ghanem et al., 2000). Also, an A. terreus Li-20 strain previ-
ously obtained can produce high xylanase and xylosidase activitiy,
during the properties investigation of b-glucoronidase (Liu et al.,
2012).
In the previous work, a new strain named Candida tropicalis BIT-
Xol-1 which could efficiently convert xylose to xylitol was ob-
tained. In this paper, in order to achieve direct xylitol production
from corncob hemicellulose, a new xylan fermentation pathway
was constructed in the xylitol producing C. tropicalis BIT-Xol-1 by
heterologously co-expressing xylanase and xylosidase from A. ter-
reus. It leaves out the use of toxic catalyst, the expensive separation
and purification steps of xylose, and has the benefit of energy sav-
ing and environmental protection. This is the first report of direct
xylitol production from xylan in an engineered C. tropicalis strain
without addition of xylanolytic enzymes.
2. Methods
2.1. Strains and culture conditions
Xylanolytic enzymes producing strain A. terreus Li-20 and xyli-
tol producing strain C. tropicalis BIT-Xol-1 were both originally iso-
lated and stored in laboratory.
Aspergillus terreus Li-20 was used as the resource of total RNA to
clone the xylanase and xylosidase encoding genes. The fungus was
precultured in 30 mL liquid Czapek medium for 24 h at 30 °C with
170 rpm shaking, and then the mycelia were inoculated into the
induction medium containing 0.3% birchwood xylan (Sigma, US).
E. coli DH5a and C. tropicalis BIT-Xol-1 were used as the cloning
host and the expression host strain, respectively. The plasmids
pMD19-T (TaKaRa, Japan) and pAUR123 DNA (provided by Dr.
Liu, Central China Normal University) were used as cloning and
expression vector, respectively. Luria–Bertani (LB) medium was
used to grow E. coli cultures in broth and agar plates at 37 °C.
Ampicillin (100 lg/mL) was added to the medium to maintain
the plasmids. C. tropicalis cultures were maintained on YPD med-
ium (10 g/L yeast extract, 20 g/L peptone and 20 g/L glucose) con-
taining 0.5 lg/mL of Aureobasidin A (AbA) for plasmid
maintenance. YPD-xylan-AbA and YPD-corncob-AbA mediums
(YPD medium with the addition of 5 g/L xylan and 15 g/L corncob
powder respectively and 0.5 lg/mL AbA both) were used as fer-
mentation mediums for xylitol production. The corncob powder
made by steam explosion, containing about 30% xylan-type hemi-
celluloses, was provided by Prof. Yuan, Beijing University of Chem-
ical Technology.
2.2. Total RNA extraction and gene clone
Total RNA was extracted from A. terreus Li-20 grown in xylan
induction media for 2 d using TRIzol method (Donald et al.,
2010). The quality and integrity of RNA was determined by gel
electrophoresis in 1% agarose containing 3.5% formaldehyde as de-
scribed by Sambrook (Sambrook et al., 1989). For cloning of full-
length xylanase and xylosidase coding genes without intron, the
total RNA was reverse transcribed with M-MLV reverse transcrip-
tase using M-MLV RTase cDNA Synthesis Kit (TaKaRa, Japan) fol-
lowing instructions provided by the manufacturers.
According to the published nucleotide sequences in GenBank,
primers were designed (Table 1). The mature xylanase gene (atn)
and xylosidase gene (atl) were amplified by PCR using the AtNF/
AtNR and AtLF/AtLR as the primers from the A. terreus Li-20 cDNA
under the following conditions: 94 °C for 5 min, 30 cycles of 94 °C
for 1 min, 50 °C for 1 min, 72 °C for 2 min, and a final extension at
72 °C for 10 min with Ex Tag (TaKaRa, Japan). The PCR products
were purified using a DNA gel purification kit (BioTeKe, Beijing,
China) and cloned into the pMD19-T plasmid. The resulting plas-
mids were then transformed into E. coli DH5a using the calcium
chloride method (Cohen et al., 1972). Transformants were screened
on LB-amp plates supplemented with 20 lg/mL X-Gal by conve-
nient blue-white selection. Plasmids (pMD19-T-atn and pMD19-
T-atl) were extracted and the atn and atl genes were sequenced
(Sangon, Shanghai, China).
The nucleotide sequences were entered into DNAMAN (Lynnon
Biosoft, Version 5.2.2) to predict the molecular weight and deduce
the amino acid sequences. The signal peptides were predicted
using SignalP (http://www.cbs.dtu.dk/services/SignalP). Homology
searches were carried out by comparing the nucleotide and the de-
duced amino acid sequences against GenBank database using the
BLAST server (http://www.ncbi.nlm.nih.gov/BLAST).
2.3. Construction of expression vectors and transformation
For the construction of xylanase expression vector, the atn gene
double-digested from the pMD19-T-atn plasmid with KpnI and SalI
(TaKaRa, Japan) was cloned into the multiple cloning sites of the
plasmid pAUR123 DNA, which had also been previously digested
with the same enzymes. The resulting plasmid was designated
pAUR-atn (Fig. 1A). Likewise, the 1.7-kp KpnI-XbaI DNA fragment
carrying the atl gene was obtained by double-digestion from the
Table 1
Oligonucleotides used in this study.
Primer Sequence (50 ? 30 ) Restriction
names sites
AtNF GGGGTACCATGGTTCGTCTTACTGTTCTTGCA KpnI
AtNR ACGCGTCGACTTATAAGGCGGAGA TAATTGCG SalI
AtLF GGGGTACCATGACGAACGACGACCACG KpnI
AtLR XbaI
GCTCTAGATCACTTCAAGTGGATATCTCCC
Fpnt DraIII
CCACTAGGTGGGATCCTCTAGCTCCCTAACATGTA
Rpnt DraIII
CCACTAGGTGATCCGTGTGGAAGAACGATTACAAC
 X. Guo et al. / Bioresource Technology 128 (2013) 547–552
Fig. 1. Schematic maps of plasmids construction for recombinant expression of xylanase coding gene (pAUR-atn) (A), xylosidase coding gene (pAUR-atl) (B), and
co-expression of atn and atl genes (pAUR-atn-atl) (C).
pMD19-T-atl plasmid and introduced into the KpnI-XbaI site of
plasmid pAUR123 DNA, in order to construct the xylosidase
expression vector named pAUR-atl (Fig. 1B). Plasmid pAUR-atn-
atl (Fig. 1C), used for co-expression of the atn and atl genes, was
constructed as follows. The ADH1P-atn-ADH1T cassette was ampli-
fied as a 2.0-kp DraIII fragment by PCR using Fpnt/Rpnt as the
primers with pAUR-atn plasmid as the template. This cassette
was cloned into the unique DraIII site of plasmid pAUR-atl to yield
pAUR-atn-atl.
The recombinant plasmids were transformed into E. coli DH5a,
respectively. The pAUR-atn, pAUR-atl and pAUR-atn-atl plasmids
were identified by PCR and used in the expression of these A. terre-
us xylanolytic enzyme genes in C. tropicalis BIT-Xol-1.
The pAUR-atn, pAUR-atl and pAUR-atn-atl plasmids were trans-
formed into C. tropicalis BIT-Xol-1, respectively, using a Gene Pulser
Xcell™ Electroporation System (Bio-Rad, USA) working at 1600 V
and 6.0 ms. The transformants were grown at 30 °C on YPD-AbA
plates for 2 d. For the screening of the positive transformants with
the ability to utilize xylan as the sole carbon source, single colonies
were transferred onto YPD-xylan-congo red-AbA agar plates (YPD-
xylan -AbA medium with the addition of 1 g/L congo red) in order
to observe the hydrolyzed zones caused by recombinant xylanolyt-
ic enzymes.
549
2.4. Expression of recombinant enzymes and xylitol fermentation
The positive C. tropicalis transformants, which could produce
visible hydrolyzed zones on YPD-xylan-congo red-AbA agar plates,
were grown in 5 mL of fresh YPD-AbA medium and cultured for 2 d
at 30 °C to get the seed liquid. The seed liquid was then inoculated
into a 1 L Erlenmeyer flask containing 300 mL YPD-xylan-AbA
medium with the inoculation amount of 5% and incubated at
30 °C for 4 d shaking at 170 rpm. The culture supernatants were
obtained by sampling and centrifugation every 12 h and used to
analyze the xylanase and xylosidase activities and to detect the
metabolites. The C. tropicalis BIT-Xol-1/pAUR123 strain was also
incubated under the same conditions as a control. Expression of se-
creted proteins were analyzed by SDS–PAGE.
2.5. Enzyme activity assay
The xylanase activity was assayed using birchwood xylan (Sig-
ma, US) as the substrate according to the method of Bailey (Bailey
et al., 1992). The amount of reducing sugars released was deter-
mined by the standard dinitrosalicylic acid method (Miller,
1959). One unit of xylanase activity (abbreviated as IU) was
defined as the amount of enzyme producing 1 lmol of reducing su-
550 X. Guo et al. / Bioresource Technology 128 (2013) 547–552
gar (xylose) from the substrate solution per min under the assay
conditions.
The enzyme activity of xylosidase was measured using p-nitro-
phenyl-b-D-xylopyranoside (pNPX, Sigma, US) as the substrate. The
reaction mixture, consisting of 50 lL of appropriately diluted en-
zyme solution and 200 lL of 5 mM pNP-X in 0.2 M acetate buffer
(pH5.4) was incubated at 50 °C for 10 min. The reaction was termi-
nated by adding 750 lL of 2 M Na2CO3, and the amount of p-nitro-
phenol (pNP) released was measured at 410 nm. One unit of
xylosidase activity was defined as the amount of enzyme that re-
quired to liberate1 lmol of pNP per minute under the conditions
described above.
2.6. HPLC analysis
Concentrations of D-glucose, D-xylose and xylitol in the culture
supernatant were analyzed with high-performance liquid chroma-
tography (HPLC) using an Aminex HPX-87H ion-exclusion column
(300  7.8 mm; Bio-Rad Laboratories, CA) with 5 mM H2SO4 in
water as the mobile phase and a flow rate of 0.6 mL/min at 65 °C.
Peak detection was carried out by means of a refractive index
detector (model RID-10A; Shimadzu, Kyoto, Japan).
Xylitol yield was determined by the ratio of final xylitol concen-
tration to the initial xylan concentration.
3. Results and discussion
3.1. Genes cloning and sequences analysis
The atn gene encoding endo-b-1,4-xylanase and the atl gene
encoding b-xylosidase were amplified and sequenced from cDNA
of A. terreus Li-20, respectively. The nucleotide sequence of the
atn gene has been deposited in the GeneBank database under the
accession No. JQ087496, while the accession No. of the atl gene is
JQ087497.
The 981-bp atn gene open reading frame encoded a protein of
326 aa with a calculated molecular weight of 35 kDa. SignalP anal-
ysis indicated the presence of an N-terminal signal peptide at ami-
no acid residues 1–20, the mature form of AtN protein has an
estimated molecular weight of 33 kDa. The open reading frame of
atl gene was 1671-bp, which encodes for a protein (AtL) contains
556 aa with a calculated molecular mass of 63.5 kDa without signal
peptide. Additionally, AtN and AtL were classified as a member of
the Glycosyl hydrolase family 10 and 43 respectively, by sequence
similarity searching in GenBank.
Comparison analysis using nucleotide blast revealed that atn
gene sequence has significant identity with that of the known
xylanases from A. terreus BCC129 (98.47%, Chantasingh et al.,
2006), A. terreus NIH2624 (91.23%, GeneBank Accession No.
4323089), A. flavus NRRL3357 (67.21%, GeneBank Accession
No. 7920217) and A. oryzae RIB40 (65.04%, GeneBank Accession
No. 5999107).The sequence of the atl gene was identical to that
of reported xylosidases of A. terreus NIH2624, both of which were
approximately 680-bp longer at the 50 end than other xylosidase
coding genes referring to GeneBank database. This non-conserva-
tive sequence may play a special role in influencing the secretion,
stability and catalytic efficiency of the enzyme.
3.2. Heterologous expression of AtN and AtL in C. tropicalis BIT-Xol-1
The engineered yeast strains C. tropicalis BIT-Xol-1/pAUR-atn,
BIT-Xol-1/pAUR-atl, and BIT-Xol-1/pAUR-atn-atl were constructed
by introducing plasmids pAUR-atn for expression of A. terreus
xylanase, pAUR-atl for expression of A. terreus xylosidase, and
pAUR-atn-atl for co-expression of xylanase and xylosidase, respec-
tively. The presence of atn or/and atl genes in recombinant C. trop-
icalis were confirmed by colony PCR and by using xylan-congo red
plate screening. The presence of clear zones around C. tropicalis
BIT-Xol-1/pAUR-atn colonies indicated that xylan was hydrolyzed
efficiently by the recombinant xylanase, while the C. tropicalis
BIT-Xol-1/pAUR-atl expressing xylosidase alone cannot hydrolyze
xylan. Moreover, the positive C. tropicalis BIT-Xol-1/pAUR-atn-atl
transformants co-expressing xylanase and xylosidase could pro-
duce larger hydrolysis zones than those expressing xylanase alone,
confirming the more effective xylan conversion pathway con-
structed in C. tropicalis BIT-Xol-1. SDS–PAGE analysis of culture
supernatant also showed expected protein bands (Fig. 2).
The AtN and AtL activities of the engineered C. tropicalis strains
were determined with the culture supernatant. AtN activity was
assayed using birchwood xylan as the substrate. The BIT-Xol-1/
pAUR-atn and BIT-Xol-1/pAUR-atn-atl strains showed similar AtN
activities (46.33 and 48.17 U/mL, respectively), while no xylanase
activity was detected in strains BIT-Xol-1/pAUR123 (control strain)
and BIT-Xol-1/pAUR-atl. The atn gene was cloned into the expres-
sion vector with its own signal sequence and the AtN protein was
secreted into culture medium from the recombinant strains suc-
cessfully. These results indicated that the signal peptide from A.
terreus can be expressed functionally in C. tropicalis, promoting
the secretion of heterologous proteins. The enzyme activity of
xylosidase was measured using pNPX as the substrate. Similarly,
the BIT-Xol-1/pAUR-atl and BIT-Xol-1/pAUR-atn-atl strains showed
AtL activities of 10.15 and 11.56 U/mL respectively, while no xylos-
idase activity was detected in strains BIT-Xol-1/pAUR123 and BIT-
Xol-1/pAUR-atn. Although there was no putative signal sequence
in the atl gene predicted by SignalP analysis, the recombinant AtL
protein was also secreted into culture medium successfully like
as AtN. The atl gene without the first 680-bp at the 50 end was ob-
tained by PCR (named atl-5t) and the expression vector pAUR-atl-
5t was constructed and transformed into the C. tropicalis BIT-Xol-1
strain. The determination of enzyme activity showed that, there
was no detectable xylosidase activity in the culture broth of BIT-
Xol-1/pAUR-atl (data not shown). These results indicated that the
228-aa N-terminal fragment of AtL, which were coded by the first
684-bp at the 50 end of atl gene, was most likely a functional signal
peptide regulating secretion of this heterologous protein.
The above results demonstrated that active AtN and AtL were
successfully introduced into the xylose metabolizing C. tropicalis
Fig. 2. SDS–PAGE analysis of culture supernatant of recombinant C. tropicalis
strains. Lane 1: BIT-Xol-1; Lane 2: BIT-Xol-1/pAUR123; Lane 3: BIT-Xol-1/pAUR-
atn; Lane 4: BIT-Xol-1/pAUR-atn-atl; M: molecular weight standards.
 X. Guo et al. / Bioresource Technology 128 (2013) 547–552 551

BIT-Xol-1 strain and were secreted into the culture medium. The
pathway of direct conversion of xylan to xylitol could be integrated
and possibly be consolidated in engineered C. tropicalis.

3.3. Xylitol production from pure xylan and corncob

For direct conversion of corncob xylan to xylitol, a xylan-fer-

menting engineered strain C. tropicalis BIT-Xol-1/pAUR-atn-atl-3
(named C. tropicalis PNL3) was constructed by introducing plasmid
pAUR-atn-atl into the xylitol-producing yeast strain C. tropicalis
BIT-Xol-1. The C. tropicalis PNL3 strain was used for the further
study of direct xylitol fermentation from xylan. As can be seen
from Fig. 3, due to the presence of glucose, there was no detectable
xylitol in the culture broth of C. tropicalis PNL3 at the initial stage of
fermentation in both YPD-xylan and YPD-corncob mediums. The
xylitol concentration increased rapidly as soon as glucose was ex-
hausted and reached the maximum of approximately 3.78 g/L
(60 h) and 3.01 g/L (84 h), respectively, when using pure xylan
and corncob hemicelluloses as substrates. Since the xylose residues
in the pure xylan was 98%, the xylitol yield was 77.1% based on the
definition, when using pure xylan as substrate. In the same way,
the xylitol yield was 66.9% when using corncob as substrate, as
the content of xylan was 4.5 g/L in the corncob powder. While xyli-
tol was not detected in the medium of strain BIT-Xol-1/pAUR123
inoculated as a control, demonstrating that the control strain could
not transform xylan at all. The results indicated that the C. tropicalis
PNL3 strain could produce and secrete xylanase and xylosidase
into the medium successfully, and convert xylan to xylitol in one
step via combined saccharification and transformation.
The relatively low-level conversion of xylitol may be caused by
the difference in optimal temperature between cell growth and en-
zyme activities. The optimum growth temperature of C. tropicalis
PNL3 is 30 °C while the optimum reaction temperatures of AtN
and AtL are both 50 °C (Fig. 4). The application of thermotolerant
yeast strains engineered to the simultaneous saccharification and
fermentation (SSF) process would overcome the drawback by per-
forming biomass accumulation, hydrolysis and fermentation at
elevated temperature. Moreover, the xylitol concentration no long-
er increased while unused xylan remained at later stage of fermen- Fig. 4. Effects of temperature on C. tropicalis cell growth (A) and on the recombinant
xylanase activity (B).
tation. This result was most likely attributable to the low activities
of the recombinant xylanase and xylosidase. For more complete
xylan saccharification, improvement of the activities of heterolo- centration in fermentation broth decreased slightly at anaphase,
gous expressed xylanolytic enzymes are required. The xylitol con- the cause of which was that the xylitol dehydrogenase (XDH) in
C. tropicalis strain could catalyze the oxidation of xylitol to D-xylu-
lose, therefore, the intermediate product xylitol cannot be accumu-
lated effectively. The yield of xylitol can be improved considerably
by blocking the metabolic step from xylitol to D-xylulose, using
XDH gene disruption method (Ko et al., 2006). In the future re-
search, this strategy will also be applied to the engineered C. trop-
icalis PNL3 to construct an XDH-defective mutant in order to
increase xylitol yield.

4. Conclusions

The direct transformation of xylan to xylitol was accomplished

Fig. 3. Bioconversion of xylan to xyltiol by C. tropicalis PNL3. Fermentation
experiments were performed with pure xylan (j) and corn cob (s) as substrates,
respectively.
by constructing a novel xylan conversion pathway in C. tropicalis. A
xylanase gene and a b-xylosidase gene were cloned and expressed
in the xylose assimilating C. tropicalis BIT-Xol-1 strain in their ac-
tive forms. The engineered C. tropicalis PNL3 strain could simulta-
neously saccharify and ferment xylan to xylitol with the product
titers of 3.78 g/L and 3.01 g/L, with the xylitol yields of 77.1% and
66.9%, using xylan and corncob as substrates respectively. This is
the first attempt to apply metabolic engineering of the xylan
metabolism pathway in C. tropicalis to integrate and consolidate di-
rect xylitol production bioprocess from corncob.
552 X. Guo et al. / Bioresource Technology 128 (2013) 547–552
Acknowledgements
This work was financially supported by the National High Tech-
nology Research and Development Program of China (863 Program)
(No. 2009AA02Z202), the Natural Science Foundation of China(Nos.
20976014 and 20117602) and the Ph.D. Programs Foundation of
Ministry of Education of China (No. 20091101110036).
References
Antti, N., Anne, P., Airi, P., von Weymarn, N., Matti, L., 2005. Production of xylitol
from D-xylose by recombinant Lactococcus lactis. J. Biotechnol. 118, 55–66.
Bailey, M.J., Biely, P., Poutanen, K., 1992. Interlaboratory testing of methods for
assay of xylanase activity. J. Biotechnol. 23, 257–270.
Beg, Q.K., Kappor, M., Mahajan, L., Hoondal, G.S., 2001. Microbial xylanases and their
industrial applications: a review. Appl. Microbiol. Biotechnol. 56 (3–4), 326–
338.
Boussarsar, H., Rogé, B., Mathlouthi, M., 2009. Optimization of sugarcane bagasse
conversion by hydrothermal treatment for the recovery of xylose. Bioresour.
Technol. 100, 6537–6542.
Chang, C., Knight, S.G., 1960. Metabolism of D-xylose by moulds. Nature 188, 79–81.
Chantasingh, D., Pootanakit, K., Champreeda, V., Kanokrattana, P., Eurwilaichitr, L.,
2006. Cloning, expression, and characterization of a xylanase 10 from Aspergillus
terreus (BCC129) in Pichia pastoris. Protein Expr. Purif. 46 (1), 143–149.
Cirino, P.C. et al., 2006. Engineering Escherichia coli for xylitol production from
glucose–xylose mixtures. Biotechnol. Bioeng. 95, 1167–1176.
Cirino, P.C., Akinterinwa, O., 2009. Heterologous expression of D -xylulokinase from
Pichia stipitis enables high levels of xylitol production by engineered Escherichia
coli growing on xylose. Metab. Eng. 11, 48–55.
Cohen, S.N., Chang, A.C.Y., Hsu, L., 1972. Nonchromosomal antibiotic resistance in
bacteria: genetic transformation of Escherichia coli by R-factor DNA. Proc. Nat.
Acad. Sci. 69 (8), 2110–2114.
Converti, A., Dominguez, J.M., 2001. Influence of temperature and pH on xylitol
production from xylose by Debaryomyces hannsenii. Biotechnol. Bioeng. 75, 39–
45.
Donald, C.R., Manuel, A.J., Gregory, J.H., Timothy, W.N., 2010. Purification of RNA
Using TRIzol (TRI Reagent). Cold Spring Harb Press, 6.
Emodi, A., 1978. Xylitol: its properties and food application. Food Technol. 32, 20–
32.
Ghanem, N.B., Yusef, H.H., Mahrouse, H.K., 2000. Production of Aspergillus terreus
xylanase in solid-state cultures: application of the Plackett-Burman
experimental design to evaluate nutritional requirements. Bioresour. Technol.
73, 113–121.
Hallborn, J., Walfridsson, M., Airaksinen, U., Ojamo, H., Hahn-Hägerdal, B., Penttila,
M., Keräsnen, S., 1991. Xylitol production by recombinant Saccharomyces
cerevisiae. Nature Biotechnol. 9, 1090–1095.
Hrmova, M., Biely, P., Vrsanska, M., 1989. Cellulose- and xylan-degrading enzymes
of Aspergillus terreus and Aspergillus niger. Enzyme Microb. Technol. 11, 610–
616.
Jin, Y.S., Cruz, J., Jeffries, T.W., 2005. Xylitol production by a Pichia stipitis D-
xylulokinase mutant. Appl. Microbiol. Biotechnol. 68, 42–45.
Khankal, R. et al., 2008. Role of xylose transporters in xylitol production from
engineering Escherichia coli. J. Biotechnol. 134, 246–252.
Kim, J.H., Ryu, Y.W., Seo, J.H., 1999. Analysis and optimization of a two-substrate
fermentation for xylitol production using Candida tropicalis. J. Ind. Microbiol.
Biotechnol. 22, 181–186.
Kim, M.S., Chung, Y.S., Seo, J.H., Jo, D.H., Park, Y.H., Ryu, Y.W., 2001. High-yield
production of xylitol from xylose by a xylitol dehydrogenase defective mutant
of Pichia stipitis. J. Microbiol. Biotechnol. 11, 564–569.
Ko, B.S., Kim, J., Kim, J.H., 2006. Production of xylitol from D-xylose by a xylitol
dehydrogenase gene-disrupted mutant of Candida tropicalis. Appl. Envir.
Microbiol. 72 (6), 4207–4213.
Liu, Y.L., Huangfu, J., Qi, F., Li, C., et al., 2012. Effects of a non-conservative sequence
on the properties of b-glucuronidase from Aspergillus terreus Li-20. PloS One 7
(2), e30998.
Mäkinen, K.K., 2000. The rocky road of xylitol to its clinical application. J. Dent. Res.
79, 1352–1355.
Meinander, N.Q., Boels, I., Hahn-Hägerdal, B., 1999. Fermentation of xylose/glucose
mixtures by metabolically engineered Saccharomyces cerevisiae strains
expressing XYL1 and XYL2 from Pichia stipitis with and without
overexpression of TALl. Bioresour. Technol. 68, 79–87.
Miller, G.L., 1959. Use of dinitrosalicylic acid reagent for determination of reducing
sugars. Anal. Chem. 31, 426–428.
Meyrial, V., Delgenes, J.P., Molletta, R., Navarro, J.M., 1991. Xylitol production from
D-xylose by Candida guilliermondii. Biotechnol. Lett. 13, 281–286.
Prakash, G., Varma, A.J., Prabhune, A., Shouche, Y., Rao, M., 2011. Microbial
production of xylitol from D-xylose and sugarcane bagasse hemicellulose using
newly isolated thermotolerant yeast Debaryomyces hansenii. Bioresour. Technol.
102, 3304–3308.
Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory
Manual. Cold Spring Harbour Laboratory Press, New York.
Santos, J.C., Converti, A., Carvalho, W., Mussatto, S.I., Silva, S.S., 2005. Influence of
aeration rate and carrier concentration on xylitol production from sugarcane
bagasse hydrolyzate in immobilized-cell fluidized bed reactor. Process.
Biochem. 40, 113–118.
Vandeska, E., Amartey, S., Kuzmanova, S., Jeffries, T.W., 1995. Effects of
environmental conditions on production of xylitol by Candida boidinii. World
J. Microbiol. Biotechnol. 11, 213–218.
Yoon, B.H., Jeon, W.Y., Shim, W.Y., Kim, J.H., 2010. Enhancement of xylitol
production by constitutive expression of codon-optimized xylose reductase
gene in Candida tropicalis. J. Biotechnol. 150, 345.
Yuan, Q.P., Zhang, H., Qian, Z.M., Yang, X.J., 2004. Pilot-plant production of xylo-
oligosaccharides from corncob by steaming, enzymatic hydrolysis and
nanofiltration. J. Chem. Technol. Biotechnol. 79, 1073–1079.
Zhang, J.M., Geng, A.L., Yao, C.Y., Lu, Y.H., Li, Q.B., 2012. Effects of lignin-derived
phenolic compounds on xylitol production and key enzyme activities by a
xylose utilizing yeast Candida athensensis SB18. Bioresour. Technol. 121, 369–
378.
Zhou, P., Li, S., Xu, H., Feng, X.H., Ouyang, P.K., 2012. Construction and co-expression
of plasmid encoding xylitol dehydrogenase and a cofactor regeneration enzyme
for the production of xylitol from D-arabitol. Enzyme Microb. Tech. 51, 119–124.