Journal of

FOOD LEGUMES
An Official Journal of Indian Society of Pulses Research and Development (Registration No. 877)
ISSN: 0970-6380; Online ISSN: 0976-2434

The Indian Society of Pulses Research and Development (ISPRD) was founded in April 1987 with the following
objectives:
• To promote research, development and extension activities in pulses
• To facilitate close association amongst pulse workers nationally and internationally
• To publish “Journal of Food Legumes”, a quality research journal of the Society
Membership: any person interested in pulses research and development is eligible for membership of the Society
by becoming ordinary, life or corporate member by paying respective membership fee as detailed below:
Membership Fee Indian (Rs.) Foreign (US$)
Ordinary (Annual) 500 40
Life member 5000 400
Admission Fee 50 10
Libarary/Institute 5000 400
Corporate Member 7500 –
Contribution to the Journal, except in case of invited articles, is open to the members of the society only. Any
non-member submitting a manuscript will be required to become at least an annual member. Members will be
entitled to receive the Journal and other communications issued by the Society. Renewal of the subscription is due
in January each year. If the subscription is not received by February 15, the membership will stand cancelled and
can be revived by paying readmission fee of Rs. 50/-. The membership fee will be paid through online bank
transfer as per given details:
Account Holder’s name: INDIAN SOCIETY OF PULSES RESEARCH AND DEVELOPMENT
Name of the Bank: Union Bank of India
Address: Kalyanpur-Kanpur 208024
Account No.: 349502010003620
IFSC Code: UBIN0534951
Communication regarding transfer of membership fee alongwith the transfer receipt should be communicated
to Secretary, ISPRD, ICAR-Indian Institute of Pulses Research, Kanpur-208024, India at secretary.isprd@gmail.com.

EXECUTIVE COUNCIL 2020-2023

Chief Patron
Dr Trilochan Mohapatra
Patron Co-Patron
Dr TR Sharma Dr NP Singh
President: IP Singh, ICAR-IIPR, Kanpur
Vice-President: Rajeev Varshney, ICRISAT, Hyderabad
Secretary: Aditya Pratap, ICAR-IIPR, Kanpur
Joint Secretary: CS Praharaj, ICAR-IIPR, Kanpur
Treasurer: DR Mishra, ICAR-IIPR, Kanpur
Councilors
AK Srivastava, ICAR-IIPR, Kanpur; Ravinder Singh, PAU, Ludhiana; C. Bharadwaj, ICAR-IARI, New Delhi;
Mudalgiriyappa, GKVK UAS, Bengaluru; S.S. Punia, CoA, Bharatpur, Rajasthan; RP Singh, RAK College, Sehore
Editor-in-Chief
Meenal Rathore
ICAR-Indian Institute of Pulses Research, Kanpur, India
Editorial Board
SK Sharma, Palampur, India; Pooran Gaur, ICRISAT, Hyderabad, India; Nguyen, Henry T, Columbia, USA; Suk-Ha
Lee, Seoul, Korea; Kadambot Siddique, Perth, Australia; Shiv Kumar, ICARDA, Morocco; Ramakrishnan Madhavan
Nair, WorldVeg, Hyderabad, India; Liao Boshou, China; Sushil Chaturvedi, Jhansi, India; AR Sharma, Jhansi, India;
Jayamani P, Coimbatore, India; PS Basu, Kanpur, India; Jitendra Kumar, Kanpur, India; Dinesh Yadav, Gorakhpur,
India; Harsh Nayyar, Chandigarh, India; Harsh K Dikshit, New Delhi, India; A Amarender Reddy, Hyderabad, India;
Uma Sah, Kanpur, India; Mohd. Akram, Kanpur, India; Gaurav K Taggar, Ludhiana, India; ; Sanjeev Kumar, Patna,
India; Sanjay Singh Rathore, New Delhi, India; Narendra Kumar, Kanpur, India; Prasoon Verma, Kanpur, India;
Senthil Kumar, Kanpur, India
 Journal of
FOOD LEGUMES
An Official Journal of Indian Society of Pulses Research and Development
ISSN: 0970-6380; Online ISSN: 0976-2434

Vol. 34(1) Januay-March, 2021

Contents
CURRENT AFFAIRS
1. Can India sustain high growth of pulses production? 1
Pooran Gaur

RESEARCH PAPERS
2. Genetic diversity and phylogeography of mungbean yellow mosaic
India virus in Central India 4
Rakesh Kumar Singh, Parveen Ghazi Ansari, Shruti Kaushik, Gaurav Raghuwanshi,
Ashok Krishna, Takashi Wada and Hiroaki Noda
3. Potential resistant donors for yellow mosaic disease identified from
endemic wild Vigna species 10
Gita Kumari, Aditya Pratap, Roopa Lavanya, G Mohd. Akram, Revanasidda,
Meenal Rathore, Latha Madhavan, Yogendra Singh and NP Singh
4. Genetic studies for biofortification traits in chickpea 17
Satvinder Singh, Karthick S Babu, Anju Arora, RK Panwar and SK Verma
5. Use of novel chitin amended formulation of Trichoderma asperellum and
Pseudomonas fluorescens to induce systemic induced resistance in
chickpea [Cicer arietinum L.] against biotic stresses 21
P Jaisani and NM Gohel
6. Effect of PSB, FYM with variable levels of P on the yield attributes and
productivity of black gram in Shiwalik hills of Himachal Pradesh 31
Ashish Sharma, Pawan Pathania and Munish Sharma
7. Profitability of legume-maize cropping systems under legume residue
management practices 38
Monika Shukla, AC Sadhu, KD Mevada and Pratik Patel
8. Effect of frontline demonstrations of gram in Sirohi district of
South-Western Rajasthan 44
Dileep Kumar and Lokesh Kumar Jain
9. Enhancement of productivity in chickpea through frontline demonstrations
on farmers’ field 48
Shalu Abraham, Ishwar Singh, Eshu Sahu, Praveen Jamrey and Manish Arya
10. IPA 15-2 (Sharada): A high yielding, wilt and sterility mosaic disease resistant
pigeonpea cultivar for North East Plain Zone 51
Satheesh Naik SJ, Abhishek Bohra, Farindra Singh, Dibendu Datta, IP Singh,
Raj Kumar Mishra, Hriday Narayan Maurya and NP Singh

SHORT COMMUNICATION
11. Yellow mosaic disease status of mungbean genotypes grown in South-Eastern
Rajasthan 57
DL Yadav, SL Yadav, Khajan Singh, Pratap Singh and Manju Meena
12. Effect of pre-storage infestation levels of Callosobruchus analis (F.) on mungbean 60
Rajnish Dwivedi, Sanjay M Bandi, Revanasidda, Prastuti Mishra and Bansa Singh
13. An improved screening method for identification of resistance to
bruchids in pulses 64
Revanasidda, Aditya Pratap, Debjyoti Sen Gupta, AK Parihar, Sanjay M Bandi,
Mohd. Akram, Bansa Singh and NP Singh

COMMENTARY
15. A hidden threat of deteriorating nutritional quality of pulses under
climate change 68
PS Basu

16. List of Referees 70

17. Instructions to Authors 71

 Journal of Food Legumes 34(1): 1-3, 2021

Current Affairs
Can India sustain high growth of pulses production?
POORAN GAUR

Former Director, Dr Pooran Gaur (PhD Crop Science - University of

Research Program - Asia, Saskatchewan, Canada, former Director of ICRISAT's
International Crops Research Institute Asia Research Program based in Hyderabad, India an
for the Semi-Arid Tropics (ICRISAT), Honorary Fellow of the Indian Society of Pulses
Hyderabad, India Research and Development (ISPRD) is an Adjunct
Professor of the University of Western Australia. A plant
breeder and geneticist by training, he has over three
Email: pmgaur@gmail.com
decades of experience in chickpea genetics and breeding.
He led the global chickpea breeding program of
ICRISAT for 17 years (2001-2017) during which 65
chickpea varieties were released in eight countries from
ICRISAT-bred material. He was Chair of the International Steering Committee
for the Seventh International Food Legume Research Conference (IFLRC-VII)
held in Morocco in 2018. He is recipient of Doreen Margaret Mashler Award,
the highest scientific award of ICRISAT. He has published over 180 journal
articles, edited three books and contributed over 60 papers/chapters in
proceedings and books.

India has made remarkable progress in
enhancing production of pulses during the past 15
years. During 2005-06, the total production of pulses
in India was 13.38 million MT, which increased to
25.58 million MT during 2020-21. This shows an
impressive growth of 91% or a compound annual
growth rate (CAGR) of 4.42%. During 2020-21,
chickpea had a lion’s share of 49.3% in the total pulses
production. Among remaining pulses, pigeonpea
contributed 16.2%, mungbean 10.3%, urdbean 9.3%,
lentil 4.9% and other pulses 9.9%. During the past 15
years, the highest growth in production was observed
for mungbean (178%), followed by chickpea (125%),
urdbean (90%), pigeonpea (51%) and lentil (34%).
This is a big leap by India towards attaining self-
sufficiency in pulses. This has been possible because
of the recent mission mode approach adopted by the
country in boosting pulses production. The
contributing factors to this success include (1)
availability of high yielding cultivars well adapted to
different environments and growing conditions, (2)
improved crop production technologies, (3) enhanced
uptake of improved cultivars and production
technologies through knowledge empowerment of
farmers and by ensuring supply of quality seed and
other inputs (establishing 15 seed hubs, conducting
large number of demonstrations on improved cultivars
and best production technologies, etc), (4) expansion
of the area of pulses in rice-fallows, spring/summer
season and other non-traditional areas, and (5)
government policies in favor of pulses.
The dedicated efforts of Indian Council of
Agricultural Research (ICAR) through Indian Institute
of Pulses Research (IIPR) and various All India
Coordinated Research Projects (AICRPs) on Pulses
and a network of partners have made significant
achievements in development of high yielding cultivars
and their production technologies. Partnership of
ICAR with international institutes, particularly
ICRISAT in chickpea (desi and kabuli) and pigeonpea;
ICARDA in lentil, chickpea (kabuli) and grasspea; and
World Vegetable Center in mungbean and urdbean,
have been very fruitful. Germplasm and breeding
materials supplied by these institutes have contributed
to development of several widely grown cultivars. For
example, short-duration chickpea varieties, such as
JG 11 and JAKI 9218, developed in collaboration with
ICRISAT contributed significantly to expanding
chickpea area in southern India. The National Food
Security Mission (NFSM) launched by the Ministry of
Agriculture and Farmers Welfare, Government of India
in 2007 boosted efforts on outreach activities on pulses.
One of the greatest success stories for pulses in
India is the spectacular increase in area and
productivity of chickpea in central and southern India,
outperforming rest of the world (all chickpea growing
countries excluding India) in chickpea production.
During the past four decades (1979-2019), chickpea
production in central and southern India increased
by 445% (from 1.27 to 6.95 million MT) due to 177%
increase in area (2.42 to 6.71 million ha) and 97%
increase in yield (527 to 1036 kg/ha), while in the rest
2 Journal of Food Legumes 34(1), 2021
of the world, chickpea production increased by 133 %
(1.85 to 4.31 million MT) due to 49% increase in area
(2.80 to 4.17 million ha) and 57% increase in yield
(659 to 1033 kg/ha). This outstanding achievement
by India in chickpea production in central and
southern India largely remained unnoticed, as bulk of
this increased production went in compensating for
the huge reduction in chickpea production occurred
in northern India, which was due to replacement of
chickpea with wheat and other irrigated crops in about
4 million ha (almost equivalent to the total chickpea
area of the rest of the world). Expansion of wheat area
was crucial for India for ensuring food security and,
fortunately, expansion in chickpea area in central and
southern India fully compensated for the loss in
chickpea area occurred in Northern India.
India has ample opportunities and capabilities
to sustain this high growth of pulses production. There
is a need to maintain this momentum and make
adequate and sustained investments in pulses research
and developments and provide favorable policy
support for boosting pulses production.
The crop improvement programs are now better
equipped to develop varieties in relatively shorter
period and meeting the existing and evolving
requirements of farmers, consumers and the industries.
The crop improvement scientists now have access to
advanced tools and techniques to realize high genetic
gains. These include genomics resources and high
throughput phenotyping methods for achieving high
precision and efficiency in breeding; rapid generation
advancement methods for speed breeding; novel
crossing methods, such as multiparent advanced
generation intercross (MAGIC) method for enhancing
genetic recombination; and efficient data management
systems for making better decisions. The research
programs need to be adequately funded so that these
can develop/upgrade research facilities and have
trained human resources needed to integrate modern
tools and techniques and gain enhanced efficiency.
Some the areas which need greater attention in
development of varieties/hybrids include (1) improved
resilience to climate change and adaptability to new
niches (early maturity, heat tolerance, etc), (2) region-
specific hybrids of pigeonpea with suitable maturity
duration and efficient seed production and genetic
purity assessment system, (3) traits that facilitate
mechanization (suitability to machine harvesting,
herbicide tolerance), (4) further enhanced nutritional
quality (protein, iron and zinc contents), and (5) traits
needed by the industries. The crop improvement
programs should consider exploitation of wild species
for introgression of novel genes conferring resistance/
tolerance to existing and emerging biotic and abiotic
stresses and controlling other desired traits for which
genetic variability in the cultivated germplasm is not
adequate.
Though pulses already have appreciable amount
of protein and micronutrients, opportunities exit for
further enhancing protein content by 20 to 30% and
some of the micronutrients, such as iron (Fe) and zinc
(Zn), by 50 to 100%. The crop improvement programs
should aim for mainstreaming these traits in
development of breeding materials, so that all future
varieties have higher contents of protein and
micronutrients, and the consumers can get higher
nutritional benefits even if they consume the same
quantity of pulses.
India still has vast scope of bringing additional
area under pulses cultivations. Concerted efforts need
to continue on expanding area of pulses in rice-fallows
available in eastern and southern states and promoting
spring/summer cultivation of mungbean and urdbean
in areas with assured irrigation.
Wide yield gaps still exist between the realized
and potential yields of pulses with varying range
across crops and geographies. There is a need to map
yield gaps for each pulse crop in major growing
geographies, identify the major contributing factors to
yield gaps, and develop suitable strategies for bridging
the yield gaps. This will involve targeted development
of improved varieties and production technologies
and enhancing their adoption by empowering the
farmers with required knowledge and inputs supply.
Crop production technologies which are expected
to have high potential impacts on production of pulses
need to be given special attention. These include (1)
planting methods, such as raised bed and ridge and
furrow methods, to avoid water logging in rainy season
pulses, (2) integrated water management and efficient
irrigations systems to ensure need-based supplemental
irrigations to post rainy season pulses, (3) soil-test
based application of fertilizers to meet the requirements
of both macro and micronutrients, (4) enhanced
mechanization in pulses cultivation, and (5)
promoting conservation agriculture. It is also
important to promote efficient and cost-effective seed/
grain storage methods to minimize losses during
storage. Development of pulses value chain involving
farmers among the value chain actors would be
important to provide much-needed additional income
to farmers.
Pulses would continue to be important in India
in the diets of people for nutritional benefits and in
sustaining agriculture production systems. The
demand of pulses will continue to escalate because of
population growth and increasing awareness of
consumers about the nutritional benefits of pulses.
 Can India sustain high growth of pulses production? 3

There are not many countries exporting pulses that
are in high consumption in India (desi chickpea,
pigeonpea, mungbean, and urdbean). Thus, India
should continue concerted efforts towards achieving
self-sufficiency in pulses. The rapid strides taken by
India in pulses production in the recent years and the
vast opportunities available for increasing both area
and productivity of pulses in the country suggest that
India is well-positioned to achieve self-sufficiency in
pulses.
 Journal of Food Legumes 34(1): 4-9, 2021

Genetic diversity and phylogeography of mungbean yellow mosaic

India virus in Central India
RAKESH KUMAR SINGH*1, PARVEEN GHAZI ANSARI1, SHRUTI KAUSHIK1,
GAURAV RAGHUWANSHI1, ASHOK KRISHNA1, TAKASHI WADA2 and HIROAKI NODA2,3

1
Department of Plant Pathology, Rajmata Vijayaraje
Scindia Krishi Vishwavidyalaya, (RVSKVV),
College of Agriculture, Indore 452 001, M.P., India;
2
Japan International Cooperation Agency (JICA)
Soybean Project, ADR Building Research Campus,
College of Agriculture, Indore 452 001, M.P., India;
3
National Institute of Agrobiological Sciences,
Owashi, Ibaraki 305-8634, Japan
*E-mail: rakesh0429@gmail.com
Received: Feburary 23, 2021,
Accepted: June 05, 2021
Handling Editor: Dr. Mohd. Akram,
ICAR-Indian Institute of Pulses Research, Kanpur
ABSTRACT
Mungbean yellow mosaic India virus (MYMIV) is widely prevalent
in Central India and threatens many food legumes, including
soybean, mungbean and blackgram. Three isolates of MYMIV from
the state of Madhya Pradesh, India were fully anlayzed on the
basis of their sequences; two genomic components of the virus,
DNA-A and DNA-B, eoncoded seven and two genes, respectively,
and showed general features in the intergenic region. Phylogenetic
analyses of a number of MYMIV isolates classified them into three
general groups and virus map location illustrated that MYMIV has
been differentiated on the basis of geographical distribution in the
Indian subcontinent.
Key words: Begomovirus, Central India, Geographical distribution,
Legumes, MYMIV

INTRODUCTION referred to as DNA-A and DNA-B. Each of the twinned

Food legumes such as soybean, mungbean and
blackgram are important agricultural crops in India
as well as in other countries of the world. Within India,
the state of Madhya Pradesh (MP) produces 50 % of
soybean grains in Kharif (rainy) season (June–
September) (SOPA 2016). However, large quantity of
economic losses are estimated for grain legumes by
infection of viruses in India (Varma and Malathi 2003;
Wrather et al. 1997). The most serious virus disease in
soybean in MP is yellow mosaic disease (YMD), which
is caused by begomoviruses belongs to the family
Genimiviridae.
Geminiviruses possess circular single-stranded
DNA genome packed in twinned particles, and are
divided into nine genera, Becurtovirus, Begomovirus,
Capulavirus, Curtovirus, Eragrovirus, Grablovirus,
Mastrevirus, Topocuvirus and Turncurtovirus,
collectively composed of more than 360 species (ICTV
2016; Zerbini et al. 2017). The genus Begomovirus
currently includes more than 320 species (Zerbini
et al. 2017) and is the largest genus among plant viruses
with respect to the number of species included (Brown
et al. 2015). Begomoviruses are transmitted by whitefly
Bemisia tabaci (Ansari et al. 2017; Navas-Castillo et al.
2011; Varma et al. 2011). Most begomoviruses are
monopartite, having DNA-A and often associated with
beta satellite DNA (Zhou 2013). In contrast, some
begomoviruses have bipartite genomes, which are
virus particles possesses one of the genome
components. Therefore, two virus particles, each
containing a different genome component (DNA-A or
DNA-B), are usually required for successful infection
(Brown et al. 2015).
Legume crops showing symptoms of YMD
include soybean (Glycine max), mungbean (Vigna
radiata), blackgram (V. mungo), pigeonpea (Cajanus
cajan), mothbean (V. aconitifolia) and common bean
(Phaseolus vulgaris) (John et al. 2008). Four species of
begomoviruses have been reported to cause YMD in
legume crops in India, i.e.,Mungbean yellow mosaic
virus (MYMV), Mungbean yellow mosaic India virus
(MYMIV), Dolichos yellow mosaic virus (DoYMV) and
Horsegram yellow mosaic virus (HgYMV) (Haq et al.
2011; John et al. 2008; Qazi et al. 2007). These viruses
have bipartite genomes and are refered as legume
yellow mosaic viruses (LYMVs). The former two
species, MYMV and MYMIV, are most prevalent (Borah
and Dasgupta, 2012) and MYMIV is widely found in
legume plants in India (Naimuddin et al. 2011a;
Naimuddin et al. 2011 b; Reddy et al. 2015).
The present study was undertaken aiming at
molecular characterization of MYMIV collected from
legume plants in Madhya Pradesh and also to see the
geographical differentiation of MYMIV in Indian
subcontinent.
 Singh et al.: Genetic diversity and phylogeography of mungbean yellow mosaic India virus in Central India 5

MATERIALS AND METHODS each dNTP, 10 pmol primers and 1 U Ex-TaqDNA

Biological samples and DNA preparation
Whole MYMIV sequences were studied in three
virus-infected plant samples: blackgram collected from
College of Agriculture, Jabalpur (Jawaharlal Nehru
Agricultural University, Jabalpur) in July 2012,
(soybean at Rangoli, Sagar in September 2014, and
soybean at Jamuniya, Bhopal in September 2014. Total
plant DNA was extracted from leaves of the virus-
infected plants using cetyl trimethyl ammonium
bromide (CTAB)-based DNA extraction method
(Murray and Thompson 1980).
Rolling circle amplification, PCR and cloning
Viral DNA was amplified by rolling circle
amplification (RCA) using Templi Phi 100
Amplification Kit (GE Healthcare) from the samples
collected from Sagar and Bhopal according to
manufacturer’s instructions. In Jabalpur sample, the
viral DNA was directly amplified by PCR.
RCA product of Bhopal sample was digested
with Bam HI or Eco RI, (Fig 4) and the digested DNA of
approximately 2.8kb was directly cloned into the Bam
HI- or Eco RI-digested pBluescript II (Stratagene),
respectively.
DNA-A of Jabalpur sample after DNA isolation
and DNA-A of Sagar sample after RCA were PCR-
amplified using three sets of primers, DNA-A_f1/
DNA-A_r1, DNA-A_f2/DNA-A_r2 and DNA-A_f3/
DNA-A_r3 (Table 1). DNA-B of Jabalpur, Sagar and
Bhopal samples were amplified using three sets of
primers, DNA-B_f1/DNA-B_r1, DNA-B_f2/DNA-
B_r2 and DNA-B_f3/DNA-B_r3 (Table 1). PCR was
performed in total volume of 25 µl buffer (10 mM Tris-
HCl [pH 8.0]; 50 mM KCl; 1.5 mM MgCl2) with 0.2 mM
polymerase (Takara Bio, Shiga, Japan). The PCR
thermal program was 94oC for 1 min followed by 32
cycles of 94oC for 20 s, 52–56oC for 20 s, and 72oC for 1–
2 min, and 72oC for 3 min as a final extension after the
last cycle. The PCR products were separated by
electrophoresis on a 1per cent agarose gel and stained
with ethidium bromide (EtBr). Three parts of DNA-A
or DNA-B, whose expected sizes are ca. 1100–1500
bp, were cloned into pGEM-T (Promega, WI, USA)
using TA cloning method.
Sequencing
The recombinant plasmid (pBluescript II)was
used as sequencing template using T3 and T7 primers
and the above-described primers used for PCR of
DNA-A (Table 1). In pGEM-T, to which DNA-A of
Jabalpur and Sagar samples and DNA-B of Jabalpur,
Sagar and Bhopal samples were cloned, the inserts in
the plasmid were amplified by PCR using M13-20 and
M13-reverse primers. The PCR products were used as
templates for sequencing reaction using SP6 or T7
primers. The sequence analysis was performed using
Big-Dye Primer Cycle Sequencing Kits (Applied Bio-
systems, Life technologies), and the reaction products
were sequenced using a DNA Sequence analyser
(model 3730; Applied Biosystems). At least three clones
were sequenced, and polymerase errors were deleted.
DNA-A and DNA-B genome sequences of the three
MP isolateshave been deposited in the DNA databases
under the accession numbers of LC271790–LC271795.
Phylogenetic analyses
Phylogenetic analyses were performed using 73
virus isolates. To collect the genome sequences of
MYMIV DNA-A from the DNA databases, six genome
sequences (LC271790, AM950268, FM208836,

Table 1. PCR primers used for this study

Component Name Sequence (5’3’) Product size (bp)1
DNA-A DNA-A_f1 CCGCGACCGGTGTATTGG 1500
DNA-A_r1 TCCATATCAACTGCCGTAACTATGGA
DNA-A_f2 TGTTTACAACCACCARGAGGCAG 1106
DNA-A_r2 CCAAGCTACATTTCTTCATGGGCT
DNA-A_f3 ACATGGTTTTACCCGTGCGACTA 1310
DNA-A_r3 GGACCTATACAGTCGGTAAAACCGA
DNA-B DNA-B_f1 CCCCCTATCGGTGTATTGGTGTACT 1084
DNA-B_r1 CGCCGGGACAACGGCATAT
DNA-B_f2 AGCCTATGACACCGTCAAGAGGA 1105
DNA-B_r2 GCCCAAGCCCATTAGGCGT
DNA-B_f3 CCAAGTCTCACCTGGCTGTAGCA 1214
DNA-B_r3 ATACACCGATCGCGGGGCT
DNA-B_Gap_f2 CAGAGGGACCACCCACGTGCT 252
DNA-B_Gap_r2 CGTTTCGGTGTCTAAGCGCATGT
1
The product size includes both primer-annealing regions. The product size was calculated using genome sequences of Jabalpur
sample.
2
In the DNA-B of Bhopal and Sagar samples, a part of the circular genome sequences were undetermined after analyses using the
three primer sets for DNA-B. Therefore, DNA-B_Gap_f and _r were designed for determining the gap region.
6 Journal of Food Legumes 34(1), 2021
AM992618, AF314145 and AY9371) were used as
queries in blastN searches against the DNA database
of Japan (DDBJ). Top 30 blast hits in each search were
collected and duplicated sequences were eliminated.
Total of 71 DNA-A genome sequences including the
present three isolates from MP were aligned together
with two outgroup sequences of MYMV (FM242701
and D14703) using Clustal X (Larkin et al. 2007). All
gaps were deleted from the manually modified aligned
sequences, resulting into 2636 sites.
Phylogenetic analyses were conducted by
phyML 3.0 on line (http://www.atgc-montpellier.fr/
phyml/) (Guindon et al. 2010). The maximum
likelihood (ML) estimation was performed under
default settings with HKY 85 model. Bootstrap tests
were conducted by 500 resamplings. Neighbor-joining
(NJ) method in phylip (http://evolution.genetics.
washington.edu/phylip.html) was also used under
default settings with Kimura’s 2-parameter model.
Bootstrap tests were conducted by 1000 resamplings
for NJ.
RESULTS
Genome organization of DNA-A and DNA-B
Jabalpur and Sagar MYMIV isolates possessed
2747-b circular DNA-A, whereas Bhopal isolate 2746-
b circular DNA-A. These three DNA-A geneomes
possessed seven coding sequences as shown in other
MYMIV in the DNA databases. Virion-sense strand
encodes AV1 and AV2, and complementary-sense
strand encodes AC1, AC2, AC3, AC4 and AC5 (DNA
accession numbers of LC271790, LC271792 and
LC271794). DNA-B of MYMIV from Jabalpur and
Sagar composed of 2671-b and that of Bhopal 2661-b.
They encoded two genes, which is considered to be
related to the virus movement, BV1 on the virion-sense
strand and BC1 on the complementary-sense strand
(DNA accession numbers of LC271791, LC271793 and
LC271795).
Begomoviruses have similar sequences in the
intergenic non-coding region (IR), which includes
replication and transcription signals (Fontes et al.
1994). DNA-A and DNA-B components of
begomoviruses share a common region (CR) that
contains stem-loop structure with the highly conserved
nonanucleotide (TAATATTAC) (Malathi 2015; Pant
et al. 2001). In MP isolates, the stem-loop structure was
composed of complete 11 base-pair stem ( upper dotted
lines) and 12 base loop (solid-line box) in Figure 1.
TATA box like sequence TATATATA, which is
considered to affect transcription efficiency, was found
in upstream region of the stem-loop structure (dotted-
line box). Iterative sequence elements (iterons), which
are the recognition sequences for binding of the
Fig 1. Sequence alignment of common region of DNA-
A and DNA-B of three MYMIV isolates
replication associated protein,were also found in
upstream region of the TATA box in Figure 1. The
sequence (A/T)T(C/T) GGTGT were present in three
parts (Figure 1, solid-line arrows).
Phylogeographical analysis of DNA-A components
Ilyas et al. (2010) divided MYMIV isolates into
three groups, group I, II and III, based on phylogenetic
analyses of genome sequences, and gave special
consideration to the relation between the groups and
collection sites of MYMIV. MYMIV DNA-A
components were phylogeographically re-analyzed
including more isolates in India, with the purpose of
clarifying the relationship between phylogenetic
relatedness and geographic distribution in the Indian
subcontinent.
DNA-A genome sequences of 71 MYMIV isolates
were used for phylogenetic analyses with two
ourgroups of MYMV. MYMIV DNA-A compornents
could be divided into three groups in ML tree (Fig. 2),
which mostly correspond to group I, II and III shown
by Ilyas et al. (2010). However, three isolates,
AM992618, FM95599 and FM955600 were not clearly
assorted to groups. NJ tree showed quite similar
topology, with one exception that AM992618, which
was located at the most basal position of group I in the
ML tree, was included in relatively basal position of
group II in the NJ tree. In the phylogenetic analyses in
both ML and NJ, it was not predicable to which group
FM95599 and FM955600 belong because these two
isolates were located between group I and II, and
bootstrap values were not high enough to support their
affiliation. Although DQ400847 and AF126406 were
not supported by strong statistic values as the
members of group I in the present analyses (49% in
ML and 54% in NJ), it seems most reasonable for them
to be included into group I.
 Singh et al.: Genetic diversity and phylogeography of mungbean yellow mosaic India virus in Central India 7

Fig 2. Phylogenetic placement of MYMIV DNA-A components based on genome sequences obtained from NCBI. In
total, 2636 unambiguously aligned nucleotide sites underwent analysis for 71 MYMIV DNA-A compornents
including three newly determined sequences (LC271790, LC271792 and LC271794). For outgroup taxa, MYMV DNA-
A components (FM242701 and D14703) were used. Accession numbers in the DNA databases are used for each taxon
label. A maximum likelihood (ML) phylogeny is shown, whereas neighbor-joining (NJ) analysis gave substantially the
same results except the position of AM992618. Statistical support values 60% are shown at the nodes in the order of
ML/NJ. Bar indicates support values <60%. MYMIV groups, I, II and III (Ilyas et al. 2010), are shown on the right
side of the phylogeny. Location (country and city) of virus samples are shown in brackets after the accession
numbers. Underline indicates the state or region. Bar indicate information unavailable. ID, Indonesia; IN, India; NP,
Nepal; PK, Pakistan; TH, Thailand

Collection sites of MYMIV, which are referred DISCUSSION

from the DNA database or from some references
(Hameed and Robinson 2004; Ilyas et al. 2010; Lovejot
et al. 2015) and shown in Fig. 2. Three groups were
distinguished with different marks: black circle, white
circle and cross for group I, II and III, respectively. Each
mark at the sites includes plural isolates. MYMIV in
group I were widely distributed in India and northern
Pakistan and the members of group II in Pakistan,
Nepal and northeastern region of India (Kanpur and
Varanasi). Group III members were mainly found in
East India and Bangladesh; two isolates were from
West (Anand) and South India (Virinjipuram).
Three isolates of MYMIV showed typical features
of MYMIV reported in both DNA-A and DNA-B
(Figure 1). The genetically diverse MYMIV isolates
should lead to different pathological and
epidemiological effects among the crops, which are
important problems for viral control and protection in
this region. Current situation of MYMIV differentiation
was illustrated using phylogeographical approach
(Fig. 2, 3). The present results support those ofIlyas
et al. (2010); MYMIV isolateswere mainly divided into
three groups, group I, II and III, based on phylogenetic
analysis of DNA-A.
8 Journal of Food Legumes 34(1), 2021
Fig 3. Rolling circle amplification product digested with Eco R1
and Bam H1enzymes produced approximately 2.8 kb amplicon
One clade corresponding to group II was
consisted of 13 samples from all over Pakistan, five
samples from Nepal and five samples from India. The
Indian samples were from Varanasi and Kanpur,
which are in the state Uttar Pradesh, close to Nepal.
There were minor differences with the results of Ilyas
et al. (2010); group II members were not found in Central
and South India, and five Nepal samples were all
included in group II in the present analyses.
Group I, shown by another large clade containing
30 isolates, included isolates from all over India and
from north eastern Pakistan (Narowal, Islamabad and
Attock) (Hameed and Robinson 2004; Ilyas et al. 2010).
At the relatively basal position of group I clade in Fig.
2, most of the taxa are consisted of isolates from
Pakistan. Three isolates from India (Ludhiana,
Haryana and place undefined) are also situated in the
basal position; Ludhiana and Haryana are in northern
India and are close to Narowal, Pakistan. Apical part
of this clade, all isolates originated in wide area of
India. Three isolates collected in southern India,
KC911719, KC911720 (Coimbatore) and JX110618
(Tirupati) formed a monophyletic group, suggesting
relatedness in genetic background. Three isolates,
AM992618, FM955599 and FM95600, which were not
categorized into group I nor group II (Fig.2), were
collected from Pakistan cities, Nawabshah, Layyah
and Multan, respectively.
Group III included MYMIV collected from East,
West and South India and Bangladesh; many of
isolates were from the area including East India and
Bangladesh. MYMIV collected in Indonesia were also
the members of group III. More samples should be
collectedfor precise analyses.
Indo-China region is considered to be a center of
geminivirus origin because of the presence of
enormous diversity for geminiviruses (Nawaz-Ul-
Rehman and Fauquet 2009). It is also most likely that
the ancestor of MYMIV originated somewhere in the
Indian subcontinent. Variation in MYMIV caused by
mutation and recombination among begomoviruses
may be attributed to the broad host range of the virus
and its survival in non-host weeds (Girish and Usha
2005). In geohistorical consideration, movement or
spreading of MIMIV through wind-mediating long
flight of host whitefly, which affect geographical
distribution of MYMIV, may also be an important
factor. Virus sequence information of various isolates
from more different areas including South India is
required to draw much precise figure in MYMIV
geographical distribution and differentiation.
ACKNOWLEDGEMENTS
This work was supported by Japan International
Cooperation Agency (JICA) under a technical
cooperation program, “Project for Maximisation of
Soybean Production in Madhya Pradesh”. The authors
are grateful to K. Taniwaki, the project leader, S. S.
Tomar, the former project manager and H. S. Yadava,
Director of Research Services for their support and
encouragement for this work. The authors thank M.
Ohata, M. Ohnuki, H. Tanaka, K. Watanabe and S.
Tomita for their support in this study.
R. K. Singh received research grants (2012–2016)
from JICA. P. G. Ansari, S. Kaushik and G. Raghuwanshi
worked as a research fellow supported by JICA. T.
Wada and H. Noda were employed as short-term
experts by JICA for each visit to Madhya Pradesh.
REFERENCES
Ansari PG, Singh RK, Kaushik S, Krishana A, Wada T, and
Noda H (2017) Detection of symbionts and virus from
the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae),
the vector of Mungbean yellow mosaic India virus in
Central India. Appl Entomol Zool 52: 567–579
Borah BK, and Dasgupta I (2012) Begomovirus research in
India: a critical appraisal and the way ahead. J Biosci
37: 791–806
Brown JK, Zerbini FM, Navas-Castillo J, Moriones E,
Ramos-Sobrinho R, Silva JC, Fiallo-Olive E, Briddon
RW, Hernandez-Zepeda C, Idris A, Malathi VG, Martin
DP, Rivera-Bustamante R, Ueda S, Varsani A (2015)
Revision of Begomovirus taxonomy based on pairwise
sequence comparisons. Arch Virol 160: 1593–1619
Fontes EP, Gladfelter HJ, Schaffer RL, Petty IT, Hanley-
Bowdoin L (1994) Geminivirus replication origins
have a modular organization. Plant Cell 6: 405–416
Garcia-Andres S, Monci F, Navas-Castillo J, Moriones E
(2006) Begomovirus genetic diversity in the native
plant reservoir Solanum nigrum: Evidence for the
presence of a new virus species of recombinant nature.
Virology 350: 433–442
 Singh et al.: Genetic diversity and phylogeography of mungbean yellow mosaic India virus in Central India
Girish KR, Usha R (2005) Molecular characterization of
two soybean-infecting begomoviruses from India and
evidence for recombination among legume-infecting
begomoviruses from South-East Asia. Virus Research
108: 167–176
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk
W, Gascuel O (2010) New algorithms and methods to
estimate maximum-likelihood phylogenies: assessing
the performance of PhyML 3.0. Syst Biol 59: 307–321
Hameed S, Robinson DJ (2004) Begomoviruses from
mungbeans in Pakistan: epitope profiles, DNA A
sequences and phylogenetic relationships. Arch Virol
149: 809–819
Haq QM, Rouhibakhsh A, Ali A, Malathi VG (2011)
Infectivity analysis of a blackgram isolate of Mungbean
yellow mosaic virus and genetic assortment with
MYMIV in selective hosts. Virus Genes 42: 429–439.
ICTV (2016) Virus Taxonomy: 2016 Release, http://
ictvonline.org/virusTaxonomy.asp
Ilyas M, Qazi J, Mansoor S, Briddon RW (2010) Genetic
diversity and phylogeography of begomoviruses
infecting legumes in Pakistan. J Gen Virol 91: 2091–2101
Islam MN, Sony SK, Borna RS (2012) Molecular
characterization of mungbean yellow mosaic disease
and coat protein gene in mungbean varieties of
Bangladesh. Plant Tissue Cult & Biotech 22: 73–81
John P, Sivalingam PN, Haq QM, Kumar N, Mishra A,
Briddon RW, Malathi VG (2008) Cowpea golden
mosaic disease in Gujarat is caused by a Mungbean
yellow mosaic India virus isolate with a DNA B variant.
Arch Virol 153: 1359–1365
Jones DR (2003) Plant viruses transmitted by whiteflies.
Eur J Plant Pathol 109: 195–219
Larkin MA, Blackshields G, Brown NP, Chenna R,
Mcgettigan PA, Mcwilliam H, Valentin F, Wallace IM,
Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins
DG (2007) Clustal W and Clustal X version 2.0.
Bioinformatics 23: 2947–2948
Lefeuvre P, Martin DP, Hoareau M, Naze F, Delatte H,
Thierry M, Varsani A, Becker N, Reynaud B, Lett JM
(2007) Begomovirus ‘melting pot’ in the south-west
Indian Ocean islands: molecular diversity and
evolution through recombination. J Gen Virol 88: 3458–
3468
Lovejot K, Jadhav MS, Senthil N, Bharthi N, Malathi VG,
Nagarajan P (2015) Molecular cloning and
characterization of yellow mosaic virus from mung
bean from northern region of Tamil Nadu indicates
association of mungbean yellow mosaic India virus
DNA A with a recombinant DNA B. J Mycol Plant
Pathol 45: 173–181
Malathi VG (2015) Biology and pathogenesis of
begomoviruses. J Mycol Plant Pathol 45: 123–143
Murray MG, Thompson WF (1980) Rapid isolation of high
molecular weight plant DNA. Nucleic Acids Res 8:
4321–4325
9
Naimuddin K, Akram M, Pratap A (2011 a) First report of
natural infection of Mungbean yellow mosaic India
virus in two wild species of Vigna. New Disease
Reports 23: 21
Naimuddin K, Akram M, Sanjeev G (2011 b) Identification
of Mungbean yellow mosaic India virus infecting Vigna
mungo var. silvestris L. Phytopathol Mediterr 50: 94–100
Navas-Castillo J, Fiallo-Olive E, Sanchez-Campos S (2011)
Emerging Virus Diseases Transmitted by Whiteflies.
Annu Rev Phytopathol 49: 219–248
Nawaz-Ul-Rehman MS, Fauquet CM (2009) Evolution of
geminiviruses and their satellites. FEBS Lett 583: 1825–1832
Padidam M, Sawyer S, Fauquet CM (1999) Possible
emergence of new geminiviruses by frequent
recombination. Virology 265: 218–225
Pant V, Gupta D, Choudhury NR, Malathi VG, Varma A,
Mukherjee SK (2001) Molecular characterization of the
Rep protein of the blackgram isolate of Indian mungbean
yellow mosaic virus. J Gen Virol 82: 2559–2567
Prasanna HC, Sinha DP, Verma A, Singh M, Singh B, Rai
M, Martin DP (2010) The population genomics of
begomoviruses: global scale population structure and
gene flow. Virol J 7: 220
Qazi J, Ilyas M, Mansoor S, Briddon RW (2007) Legume
yellow mosaic viruses: genetically isolated
begomoviruses. Mol Plant Pathol 8: 343–348
Reddy BVB, Obaiah S, Prasanthi L, Sivaprasad Y, Sujitha
A, Krishna TG (2015) Mungbean yellow mosaic India
virus is associated with yellow mosaic disease of
blackgram (Vigna mungo L.) in Andhra Pradesh, India.
Arch Phytopathol Plant Protect 48: 345–353.
SOPA (2016) 2016 Soybean production by state. The
Soybean Processors Association of India http://
www.sopa.org/statistics/soybean-production-by-state/
Thompson WMO (2011) The whitefly, Bemisia tabaci
(Homoptera: Aleyrodidae) interaction with
geminivirus-infected host plants. Springer, Dordrecht.
Varma A, Malathi VG (2003) Emerging geminivirus
problems: A serious threat to crop production. Ann
appl Biol 142: 145–164
Varma A, Mandal B, Singh MK (2011) Global emergence
and spread of whitefly (Bemisia tabaci) transmitted
geminiviruses. In: Thompson, WMO (ed) The Whitefly,
Bemisia tabaci (Homoptera: Aleyrodidae): Interaction
with geminivirus-infected host plants. Springer,
Dordrecht, pp 205–292
Wrather JA, Anderson TR, Arsyad DM, Gai J, Ploper LD,
Porta-Puglia A, Ram HH, Yorinori JT (1997) Soybean
Disease Loss Estimates for the Top 10 Soybean
Producing Countries in 1994. Plant Disease 81: 107–110
Zerbini FM, Briddon RW, Idris A, Martin DP, Moriones E,
Navas-Castillo J, Rivera-Bustamante R, Roumagnac P,
Varsani A, Consortium IR (2017) ICTV Virus Taxonomy
Profile: Geminiviridae. J Gen Virol 98: 131–133.
Zhou X (2013) Advances in understanding begomovirus
satellites. Annu Rev Phytopathol 51: 357–381
 Journal of Food Legumes 34(1): 10-16, 2021

Potential resistant donors for yellow mosaic disease identified from

endemic wild Vigna species
GITA KUMARI, ADITYA PRATAP*, ROOPA LAVANYA, G1,
MOHD. AKRAM, REVANASIDDA, MEENAL RATHORE,
LATHA MADHAVAN2, YOGENDRA SINGH and NP SINGH

ICAR-Indian Institute of Pulses Research,
Kalyanpur, Kanpur - 208024, India;
1
Sam Higginbottom University of Agricultural
Technology and Sciences, Prayagraj – 211 008,
U.P.; 2ICAR-National Bureau of Plant Genetic
Resources, Regional Station, Trichur, Kerala
*Email: Aditya.Pratap@icar.gov.in
Received: April 08, 2021
Accepted: June 06, 2021
Handling Editor: Dr Jameel Akhtar,
ICAR-National Bureau of Plant Genetic Resources,
New Delhi
ABSTRACT
Yellow mosaic disease (YMD), caused by at least 3 different
Begomoviruses including Mungbean yellow mosaic India virus
(MYMIV), is one of the most destructive diseases of food legumes,
especially the Vigna spp. including mungbean and urdbean. Some
wild species of Vigna are valuable genetic resources offering number
of desirable traits including resistance to yellow mosaic disease.
Therefore, the present study aimed at screening wild relatives of
Vigna to identify potential resistant sources against MYMIV. A panel
of 102 endemic wild Vigna accessions along with 2 susceptible checks
was screened during 2017-20 against MYMIV under natural field
conditions. The identity of the virus involved in causing YMD was
ascertained as MYMIV in PCR by using specific primers. Thirty-
five accessions were found resistant to MYMIV with no visible
symptoms of the disease on plants. These included 12 accessions of
V. umbellata, 10 of V. trilobata, 7 of V. aconitifolia, 2 each of
V. vexillata and V. stipulaceae and 1 accession each of V. silvestris
and V. hainiana. Simultaneously, 47 accessions were categorized as
moderately resistant. The resistant accessions could be valuable
genetic resources in introgression breeding programmes while few
of them, especially of V. umbellata, V. aconitifolia and
V. stipulaceae can be directly used as a cultivar after their agronomic
evaluation in target environments.

Key words: Asiatic Vigna, Genetic resources, Resistance, White fly,

Wild Vigna, YMD

INTRODUCTION YMD in mungbean and other Vigna species (Malathi

Numbers of biotic and abiotic stresses have been
reported to adversely affect the pulse crops leading to
significant losses in their seed yield as well as grain
and nutritional quality. More than a dozen viruses
including different species of yellow mosaic disease-
causing Begomoviruses, Alfalfa mosaic virus (AMV),
Bean golden yellow mosaic virus (BGYMV), Cowpea yellow
mosaic virus (CPMV), and Dolichos yellow mosaic virus
(DoYMV) inflict the pulse crops at different growth
stages. Among these, YMD caused by Begomoviruses
(Family Geminiviridae, genus Begomovirus) is one of the
most prevalent and devastating diseases, especially
in the Vigna group of crops (Singh et al. 2020; Nair et al.
2019). Molecular analysis of YMD-causing viruses
revealed the association of four bipartite begomovirus
species viz., Mungbean yellow mosaic India virus
(MYMIV), Mungbean yellow mosaic virus (MYMV),
Horsegram yellow mosaic virus (HgYMV) and Dolichos
yellow mosaic virus (DoYMV) with pulse crops (Akram
et al., 2015; Naimuddin et al. 2016). Among them,
MYMIV, MYMV, and HgYMV are known to cause
and John, 2008; Naimuddin et al., 2016), whereas
DoYMV is reported from Dolichos bean and cowpea
(Naimuddin and Akram, 2010). High incidence and
severity of YMD has been reported in South East Asia
causing about 75-100% yield loss when occurring in
severe form (Sudha et al. 2013; Kitsanachandee et al.
2013). The polyphagous insect-vector white fly (Bemisia
tabaci), transmits YMD-causing viruses in a persistent
manner (Singh et al. 2020) and therefore, the disease
incidence also depends upon the retention period of
white fly on the host plant (Karthikeyan et al., 2012). 
With >200 species, Vigna is an important genus
of flowering plants of the legumes family with a
pantropical distribution (Pratap et al. 2014a). Among
these, 10 species having significant agronomic
potential are domesticated and these contribute
significantly towards food and nutritional security,
especially of the vegetarian population. Besides yield
contributing traits, wild accessions of several of these
Vigna species are expected to harbour many survival-
related traits (Pratap et al. 2014a) while many of these
 Kumari et al.: Yellow mosaic disease resistant endemic Vigna accessions
are considered as a reservoir of valuable genetic
resources for biotic and abiotic stress tolerance and
seed quality traits (Pratap et al. 2020, 2021; Nair et al.
2019). A plethora of genes conferring resistance/
tolerance to these stresses have already been
transferred cultivated germplasm (Pratap et al. 2018).
Several accessions including those of V. umbellata,
V. trilobata, and V. mungo (Nagaraj et al. 1981; Singh
et al. 2003; Gautam et al. 2014); V. radiata var. sublobata
(Singh and Ahuja 1977; Gautam et al. 2014) and
V. mungo var. silvestris (Reddy and Singh, 1993) have
been reported to be highly resistant to YMD. Although,
the YMD management strategy is mainly based on
limiting white fly population by using insecticides but
it is ineffective, temporary and has negative
environmental influence. Contrary to this, deployment
of robust donors in breeding programme for
introgression of disease resistance genes is the most
economical and eco-friendly method to overcome
susceptibility to biotic stresses in crop plants (Pratap
et al. 2009). Therefore, availability of suitable donors
with YMD resistance in intense form and their
deployment in introgression breeding requires a
reliable screening and identification of wild and
cultivated germplasm. Therefore, the present study was
undertaken with an objective to screen the wild genetic
resources of Vigna to identify resistant sources to YMD
caused by MYMIV.
MATERIALS AND METHODS
The present study was conducted on a panel of
104 genetically diverse genotypes of Vigna spp.
including 102 wild accessions belonging to 19
different species and 2 YMD susceptible checks viz.,
DGGV 2 (mungbean) and Barabanki Local (urdbean)
(Table 1). The experimental materials including the
susceptible checks are available in the gene bank of
ICAR-IIPR, Kanpur and were either initially procured
from ICAR-National Bureau of Plant Genetic
Resources, Regional Station, Trichur or collected from
diversity rich hot-spots of Western Ghats, Himalayan
region, Central Plateau, and North-Eastern regions of
India (Table 1). All accessions including susceptible
checks were grown in cemented pots of 1 meter
diameter consecutively for 4 years (2017-20) during
Kharif (monsoon) season in the Vigna wide
hybridization garden established at Main Research
Campus, ICAR-Indian Institute of Pulses Research,
Kanpur. Each cemented pot has been specially
designed with its base hollow and drainage holes in
the periphery to drain excess water and maintain
optimum moisture condition. Each pot contained a
potting mixture of FYM, sand and fertile soil in 1:1:2
ratios. In order to counter staggered/reduced
germination in the wild accessions due to their hard
11
and waxy seed coat, seed scarification was done
following Pratap et al. (2015). In each accession, 20
seeds were sown in individual pot around the
periphery maintaining an equal distance of 5-7 cm.
between two plants. Care was taken to grow each
accession in the same pot every year to avoid mixture
due to natural pod shattering and dispersal of seeds.
The recommended package of practices for growing
mungbean and urdbean in the zone was followed to
raise healthy plants while no insecticide was sprayed
in order to maintain the natural whitefly population
in the experiment. After sowing, all the pots were
individually observed on weekly intervals for
recording the yellow mosaic disease. The Factorial
Analysis of Mixed Data (FAMD), a model suitable to
measure the latent variables, was deployed (Sebastien
et al. 2008) to determine the distribution of accessions
based on the yellow mosaic disease score (1-9) used to
categorize the resistance reactions.
Observation of yellow mosaic disease
The YMD score was recorded periodically using
1-9 scale as described in Table 2 (AICRP, MULLaRP,
2020). However, only final recording which was done
45-60 days after sowing has been taken in to
consideration for the reaction categorization of the
genotypes.
RESULTS AND DISCUSSION
A panel of 102 diverse Vigna accessions
belonging to 19 Vigna species were screened against
YMD caused by MYMIV consecutively for four years
under field condition at Main Research Farm of IIPR,
Kanpur. In the Northern part of India, especially
Kanpur region, where the study was conducted, YMD
is reported to be caused by MYMIV as already verified
in earlier studies (Naimuddin and Akram 2010;
Naimuddin et al., 2011; Naimuddin et al., 2014;) and
during the period of study using the same protocol on
many accessions every year. The observations on YMD
in all these accessions recorded during Kharif 2017-
20 are presented in Table 1.
It was observed that during all the four crop
seasons, the YMD score was recorded minimum as
1 on a number of accessions. However, the maximum
score varied as it was recorded 6 in 2018, 7 in 2017
and 2019 and 8 in 2020 on the same accessions. This
indicated that yellow mosaic disease severity was
higher in the year 2020. The highest YMD score was
recorded on both the susceptible checks during all the
crop growing seasons. It was further observed that the
disease severity scores varied even within a sub-
species and was not limited to a group or the
geographical area of collection of different accessions
12 Journal of Food Legumes 34(1), 2021

Table 1. Disease reaction of endemic wild Vigna accessions for yellow mosaic disease during 2017-20
S. No. Identification Name of the species Source/ YMD Score Average Reaction
number Collected from 2017 2018 2019 2020 YMD Category
score
1 IC277021 V. sylvestris Western ghats 1 1 1 1 1 R
2. IC248326 V. vexillata Not known 1 1 1 1 1 R
3 IC248343 V. vexillata Not known 1 1 1 1 1 R
4 LRM/13-43 V. trilobata Not known 1 1 1 1 1 R
5 LRM/13-34 V. trilobata Not known 1 1 1 1 1 R
6 LRM/13-32 V. trilobata Not known 1 1 1 1 1 R
7 IC276983 V. trilobata Madhya Pradesh 1 1 1 1 1 R
8 IC331436 V. trilobata South east region 1 1 1 1 1 R
9 IC331454 V. trilobata Central plateau 1 1 1 1 1 R
10 IC331456 V. trilobata Central plateau 1 1 1 1 1 R
11 Trichy local V. trilobata Western Ghats 1 1 1 1 1 R
12 Kumur local V. trilobata Western Ghats 1 1 1 1 1 R
13 IIPRW17-3 V. trilobata Not known 1 1 1 1 1 R
14 RBL-50 V. umbellata Not known 1 1 1 1 1 R
15 IC251445 V. umbellata Thrissur, Kerala 1 1 1 1 1 R
16 PRR 2007-2 V. umbellata Himalayan region 1 1 1 1 1 R
17 PRR 2008-2 V. umbellata Himalayan region 1 1 1 1 1 R
18 RB-5-1 V. umbellata North-east region 1 1 1 1 1 R
19 IC251439 V. umbellata North-east region 1 1 1 1 1 R
20 IC251442 V. umbellata North-east region 1 1 1 1 1 R
21 IC251446 V. umbellata North-east region 1 1 1 1 1 R
22 IC251447 V. umbellata Thrissur, Kerala 1 1 1 1 1 R
23 IC528878 V. umbellata Not known 1 1 1 1 1 R
24 IC197812 V. umbellata Not known 1 1 1 1 1 R
25 IIPRW 17-1 V. umbellata Not known 1 1 1 1 1 R
26 LRM/13-11 V. aconitifolia Not known 1 1 1 1 1 R
27 LRM/13-33 V. aconitifolia Not known 1 1 1 1 1 R
28 TMV-1 V. aconotifilia Not known 1 1 1 1 1 R
29 LRM/13-26 V. aconitifolia Not known 1 1 1 1 1 R
30 LRM/13-37 V. aconitifolia Not known 1 1 1 1 1 R
31 LRM/13-38 V. aconitifolia Not known 1 1 1 1 1 R
32 LRM/13-36 V. aconitifolia Not known 1 1 1 1 1 R
33 IC331450 V. hainiana South east region 1 1 1 1 1 R
34 Trichy Local-1 V. stipulaceae Western Ghats 1 1 1 1 1 R
35 Trichy Local-2 V. stipulaceae Western Ghats 1 1 1 1 1 R
36 IC251385 V. mungo var. mungo Thrissur, Kerala 1 2 3 3 2.25 MR
37 IC251393 V. mungo var. mungo Thrissur, Kerala 2 2 3 5 3 MR
38 IC251383 V. mungo var. mungo Thrissur, Kerala 3 3 4 6 4 MR
39 IC251386 V. mungo var. mungo Thrissur, Kerala 3 3 4 4 3.5 MR
40 IC251390 V. mungo var. mungo Thrissur, Kerala 2 2 3 4 2.75 MR
41 IC260725 V. radiata Thrissur, Kerala 2 3 4 4 3.25 MR
42 IC571775 V. radiata Not known 3 3 4 4 3.5 MR
43 IC251425 V. radiata var. radiata Thrissur, Kerala 3 3 5 5 4 MR
44 IC251426A V. radiata var. radiata Thrissur, Kerala 3 2 5 5 3.75 MR
45 IC251431 V. radiata var. radiata Thrissur, Kerala 2 2 3 2 2.25 MR
46 IC251423 V. radiata var. setulosa Thrissur, Kerala 2 2 4 5 3.25 MR
47 IC349699 V. radiata var. sublobata Thrissur, Kerala 2 3 4 4 3.25 MR
48 IC256158 V. radiata var. sublobata Thrissur, Kerala 3 2 4 4 3.25 MR
49 IC253924 V. radiata var. sublobata Thrissur, Kerala 2 2 4 5 3.25 MR
50 IC251416 V. radiata var. sublobata Thrissur, Kerala 2 2 4 5 3.25 MR
51 IC253920 V. radiata var. sublobata Himalayan region 2 2 4 6 3.5 MR
52 JAP/10-47 V. trinervia var. bourneae Thrissur, Kerala 1 2 3 3 2.25 MR
53 IC247407 V. trinervia var. bourneae Thrissur, Kerala 3 2 5 6 4 MR
54 IC210563 V. trinervia var. bourneae Thrissur, Kerala 1 2 4 2 2.25 MR
55 IC277036 V. sylvestris Thrissur, Kerala 2 3 4 4 3.25 MR
56 IC277014 V. sylvestris Western ghats 3 3 6 4 4 MR
57 IC203864 V. dalzeliana Thrissur, Kerala 2 2 5 4 3.25 MR
58 IC331615 V. dalzeliana Himalayan region 3 3 4 4 3.5 MR
59 RBL-6 V. umbellata Not known 3 3 5 4 3.75 MR
60 IC251440 V. umbellata Thrissur, Kerala 3 3 4 6 4 MR
61 IC251441 V. umbellata Thrissur, Kerala 2 2 2 4 2.5 MR
62 IC248343 V. vexillata Not known 3 4 5 4 4 MR
 Kumari et al.: Yellow mosaic disease resistant endemic Vigna accessions 13

63 IC251435 V. trilobata Thrissur, Kerala 1 2 3 4 2.5 MR

64 IC251436 V. trilobata Thrissur, Kerala 2 3 3 4 3 MR
65 IC251437 V. trilobata Thrissur, Kerala 3 3 5 4 3.75 MR
66 LRM/13-24 V. trilobata Not known 2 2 4 4 3 MR
67 LRM/13-30 V. trilobata Not known 2 3 4 5 3.5 MR
68 JAP/10-9 V. trilobata Western ghats 2 2 3 5 3 MR
69 JAP/10-7 V. trilobata Western ghats 2 2 3 4 2.75 MR
70 IC349701 V. trilobata Western ghats 2 2 5 5 3.5 MR
71 JAP/10-7 V. trilobata Western ghats 2 2 3 2 2.25 MR
72 LRM/13-44 V. aconitifolia Not known 2 3 5 6 4 MR
73 IC331448 V. hainiana South east region 3 3 4 4 3.5 MR
74 IC251376 V. hainiana Central plateau 2 4 4 5 3.75 MR
75 IC251381 V. hainiana Central plateau 2 3 3 4 3 MR
76 IC298665 V. unguiculata Thrissur, Kerala 2 2 3 3 2.5 MR
77 NS B007 V. unguiculata Himalayan region 2 2 4 4 3 MR
78 TCR 279 V. unguiculata Not known 2 2 3 2 2.25 MR
79 Goa Cowpea 3 V. unguiculata Not known 2 2 4 4 3 MR
80 JAP/10-51 V. trinervia Western Ghats 2 3 2 2 2.25 MR
81 IIPRW17-2 V. khandalensis Not known 2 3 4 5 3.5 MR
82 IC251372 V. glabrescens Central plateau 2 2 5 6 3.75 MR
83 IC 251432 V. radiata Thrissur, Kerala 3 3 5 6 4.25 MS
84 IC251433 V. radiata Thrissur, Kerala 3 3 5 6 4.25 MS
85 IC251434 V. radiata Thrissur, Kerala 3 3 6 6 4.5 MS
86 IC251394 V. mungo var. mungo Thrissur, Kerala 3 4 5 6 4.5 MS
87 IC251396 V. mungo var. mungo Thrissur, Kerala 3 4 6 5 4.5 MS
88 IC251387 V. mungo var. mungo North- East Region 4 3 5 7 4.75 MS
89 IC251427 V. radiata var. radiata Thrissur, Kerala 3 4 6 4 4.25 MS
90 IC247406 V. radiata var. sublobata Thrissur, Kerala 3 3 6 5 4.25 MS
91 IC277039 V. sylvestris Thrissur, Kerala 3 4 7 6 5 MS
92 IC277031 V. sylvestris Western ghats 2 3 6 7 4.5 MS
93 IC251419 V. radiata var. setulosa Thrissur, Kerala 3 4 4 6 4.25 MS
94 IC210575 V. pilosa Thrissur, Kerala 3 3 6 5 4.25 MS
95 IC210576 V. pilosa Western ghats 3 3 6 7 4.75 MS
96 IC210580 V. pilosa Western ghats 3 4 5 6 4.5 MS
97 IC251444 V. umbellata Thrissur, Kerala 3 4 5 6 4.5 MS
98 Mung Seed-1 V. radiata Not known 2 4 6 5 4.25 MS
99 IC251397 V. mungo var. mungo Thrissur, Kerala 4 4 7 7 5.5 S
100 IC247408 V. dalzeliana Thrissur, Kerala 4 4 7 7 5.5 S
101 IC251438 V. trilobata Thrissur, Kerala 3 3 7 7 5 S
102 JAP/10-5 V. trilobata Western ghats 3 4 7 7 5.25 S
103 DGGV 2 V. radiata Susceptible check 6 6 7 8 6.75 S
104 Barabanki Local V. mungo Susceptible check 7 6 7 8 7 S

Table 2. Disease Scoring Scale for YMD

Score Symptoms Reaction
1 No visible disease symptoms on leaves R
2 Small yellow specks with restricted spread covering 0.1 to 5% leaf area
3 Yellow mottling of leaves covering 5.1 to 10% leaf area MR
4 Yellow mottling of leaves covering 10.1 to 15% leaf area
5 Yellow mottling of leaves covering 15.1 to 30% leaf area MS
6 Yellow discoloration of 30.1 to 50% leaf area S
7 Pronounced yellow mottling and discoloration of leaves and pods, reduction in leaf size and stunting of plants HS
covering 50.1 to 75% foliage
8 Severe yellow discoloration of leaves covering 75.1 to 90% of foliage, stunting of plants and reduction in pod
size
9 Severe yellow discoloration of entire leaves covering above 90.1% of foliage, stunting of plants and no pod
formation
R = Resistant, MR = Moderately Resistant, MS = Moderately Susceptible, S = Susceptible, HS= Highly Susceptible

(Table 1) since a variable range of disease severity and
resistance were observed within the different sub-
species. Similar observations on variable disease
incidence in endemic Vigna sub-species have also been
reported earlier (Singh et al. 2020; Gautam et al. 2014;
Sudha et al. 2013) suggesting the need for their
evaluation in multiple seasons and multiple locations.
Variable disease incidence among the different
accessions in the present study could be further
attributed to their inherent genetic potential as well as
14 Journal of Food Legumes 34(1), 2021

the prevailing environmental conditions. As per LRM/13-33, LRM/13-26, LRM/13-37, LRM/13-38,

earlier studies, YMD incidence and its severity greatly LRM/13-36, TMV-1); 2 each of V. stipulaceae (Trichy
depends upon the white fly population during crop Local-1, Trichy Local-2) and V. vexillata (IC248326,
season as well as their retention period on foliar parts IC248343) and 1 accession each of V. sylvestris
of the plants (Anokhe et al. 2018; Karthikeyan et al. (IC277021) and V. hainiana (IC331450) (Figure 1).
2014; Czosnek, 2008; Czosnek et al. 2002). Further, FAMD analysis also grouped the accessions
Comparatively drier environment during Kharif 2019 into four major groups viz, resistant, moderately
and 2020 as compared to 2017 and 2018 (data not resistant, moderately susceptible and susceptible as per
given) due to less rainfall during the peak crop growth the disease scoring data and categorization of disease
could be another reason for increased white fly reactions (Figure 2). While categorizing the resistant
population in the initial two years of study. White fly reactions it was also considered that none of these
population is also reported to be highly affected by the should have witnessed any other reaction than
planting locations and season (Laosatit et al. 2020). resistant in any of the years and these accessions have
Under field conditions, the higher temperature been consistently resistant to MYMIV. Keeping in view
favours, while high-rainfall and high-humidity limit that none of the above accessions was affected by YMD
the white fly population (Rahman et al., 2006; Islam et
al., 2012). Likewise, high-altitude regions with low-
humidity also influence the YMD incidence and
disease severity (Alam et al. 2014).
Among the different accessions, 35 (33.65%)
accessions were categorized as resistant with no visible
disease symptoms on plants. Simultaneously, 47
accessions (45.19%) were categorized as moderately
resistant, 16 accessions (15.38%) as moderately
susceptible and the remaining 6 accessions (5.77%)
including the 2 susceptible checks were susceptible.
The 35 resistant accessions included 12 accessions of
V. umbellata (IC251445, PRR-2007-2, PRR-2008-2, RB-
5-1, IC251439, IC251442, IC251446, IC251447, RBL- Fig 1. Vigna accessions identified as resistant: LRM/13-
50, IC528878, IC197812, IIPRW 17-1; 10 of V. trilobata 11: V. aconitifolia (A), PRR-2008-2: V. umbellata (B), LRM-
(LRM/13-43, LRM/13-34, LRM/13-32, IC276983, 13-34: V. trilobata (C), RBL-50: V. umbellata (D),
IC331436, IC331454, IC331456, Trichy local, Kumur moderately susceptible: LRM/13-44: V. aconitifolia (E),
local and IIPRW17-3; 7 of V. aconitifolia (LRM/13-11, and susceptible: DGGV 2 (F)

Fig 2. FAMD plot grouping accessions based on yellow mosaic disease score (1-9) disease reactions “resistance (left)
and ‘susceptibility’ (right)
 Kumari et al.: Yellow mosaic disease resistant endemic Vigna accessions
in any of the years and the plant growth and
development remained normal, these could be
deployed in introgression breeding for YMD resistance
in Vigna crops, especially mungbean and urdbean.
Resistance to YMD has also been reported in
accessions of V. umbellata, V. trilobata, and V. mungo in
earlier studies (Nagaraj et al. 1981; Singh et al. 2003;
Gautam et al. 2014). Likewise, the sub-gene pool of
wild types in accession PLN 5 of V. radiata var. sublobata
(Singh and Ahuja 1977) and IW 3390 of V. mungo var.
Silvestris (Reddy and Singh 1993) were also identified
as potential sources of MYMV resistance, and TC 1966
of V. radiata var. sublobata was identified to carry
bruchid tolerance gene (Tomooka et al. 1992). Among
the above accessions identified as resistant to YMD,
the accession IC 251442 of V. umbellata has also been
reported to be photo-and thermo-period insensitive
(Pratap et al. 2014b) as well as resistant to bruchid
(Callosobruchus maculatus F.) (Revanasidda et al. 2021,
communicated). Therefore, this accession can be
especially a valuable genetic resource and be efficiently
deployed towards introgression of YMD resistance as
well as photo-thermo period insensitivity and bruchid
tolerance in mungbean and urdbean. In earlier
experiments, V. radiata × V. umbellata crosses were
successfully generated to transfer resistance to MYMV
and other desirable traits into mungbean (Verma and
Brar, 1996). Pal et al. (2005) successfully produced
inter-specific crosses between V. mungo and V.
umbellata. Mung bean × rice bean crosses were also
generated to incorporate MYMV resistance and other
desirable traits into mungbean (Verma and Brar 1996).
Singh et al. (2003) also produced successful hybrids
between V. radiata and V. umbellata and the hybrids
possessed intermediate morphology with MYMV
resistance. Remaining accessions had variable levels
of susceptibility with 10 accessions and the two checks
being highly susceptible.
CONCLUSION
This study identified 35 Vigna accessions which
are resistant to YMD caused by MYMIV with no visible
symptoms (YMD score is 1) of the disease consecutively
for four years. The identified resistant accessions could
be utilized to develop mapping populations to map
genomic regions conferring the resistance to MYMIV.
Further, fine mapping would help in cloning of genes
that would help in understanding the molecular
mechanism of resistance and could be introgressed in
the susceptible but otherwise agronomically superior
accessions through marker-assisted selection. These
accessions could also be directly used as a cultivar
after their agronomic evaluation in target
environments. This study also advocates identifying
more such wild genetic and cultivated genetic
15
resources which could be used in Vigna improvement
programmes.
REFERENCES
Akram M, Naimuddin, Agnihotri AK, Gupta S and Singh
NP. 2015. Characterization of full genome of Dolichos
yellow mosaic virus based on sequence comparison,
genetic recombination and phylogenetic relationship.
Annals of Applied Biology 67: 354-363.
Alam AKM, Somta P, Srinives P 2014. Identification and
confirmation of quantitative trait loci controlling
resistance to mungbean yellow mosaic disease in
mungbean [Vigna radiata (L.) Wilczek]. Molecular
Breeding 34: 1497–1506.
Anokhe, A., Mandal, B., and Subramanian, S. 2018.
Characterization of mungbean yellow mosaic virus
transmission by Asia-I and Asia II-1 genetic group of
Bemisia tabaci Gennadius. J. Entomol. Zool Stud. 6: 487–491.
Czosnek, H. 2008. Acquisition, circulation and transmission
of begomoviruses by their whitefly vectors, in Viruses
in the environment 37/661(2) (Trivandrum: Research
Signpost). ISBN: 978-81-308-0235-0.
Czosnek, H., Ghanim, M., Ghanim, M. 2002. Circulative
pathway of begomoviruses in the whitefly
vector Bemisia tabaci–insights from studies with tomato
yellow leaf curl virus. Annals of Applied Biology 140:
215–231.
Gautam, N. K., Akram, M., Akhtar, J., Khan, Z., Dwivedi,
N. K., Latha, M., & Ram, B. 2014. Responses of wild
Vigna species/sub-species to yellow mosaic disease
viruses, detected by a PCR-based method.
Phytopathologia Mediterranea 53: 428-437.
Islam, M. N., Sony, S. K., Borna, R. S. 2012. Molecular
characterization of mungbean yellow mosaic disease and
coat protein gene in mungbean varieties of Bangladesh.
Plant Tissue Culture and Biotechnology 22: 73–81.
Karthikeyan, A., Sudha, M., Nagrajan, P., Pandiyan, M.,
Raveendran, M., Senthil, N., & Angappan, K. 2012.
Using SSR marker to identify the MYMV resistance
gene in mungbean [Vigna radiata (L.) Wilczek]. Romanian
Journal of Plant Biology 97: 99-105.
Kitsanachandee R, Somta P, Chatchawankanphanich O,
Akhtar KP, Shah TM, Nair RM, et al. 2013. Detection of
quantitative trait loci for mungbean yellow mosaic
India virus (MYMIV) resistance in mungbean (Vigna
radiata (L.) wilczek) in India and Pakistan. Breed. Sci.
63: 367–373. doi: 10.1270/jsbbs.63.367
Laosatit, K., Somta, P., Chen, X., Srinives, P. 2020. Genomic
Approaches to Biotic Stresses, in The Mungbean
Genome, Compendium of Plant Genomes. Ed. Nair,
R. M. (Switzerland AG: Springer Nature), Pp 133–167.
Malathi VG and John P. 2008. Geminiviruses infecting
legumes. In: Characterization, Diagnosis &
Management of Plant Viruses, Volume 3: Vegetables
and Pulse Crops (G.P. Rao, P. Lava Kumar and Ramon
J. Holguin-Pena, Ed.), Stadium Press LLC, Texas, USA.
Pp 97-123.
16 Journal of Food Legumes 34(1), 2021
Nagaraj N C, Muniyappa V, Satyan BA, Shanmugam N,
Jayarajan R and Vidhyasekaran, P. 1981. Resistance
source for mungbean yellow mosaic virus. In:
Proceedings of the National Seminar on Disease
Resistance in Crop Plants, pp. 69–72.
Naimuddin and Akram M. 2010. Detection of mixed
infection of begomoviruses and their molecular
characterization based on CP gene sequences. Journal
of Food Legumes 23: 191-195.
Naimuddin, Akram M, Gupta S and Agnihotri AK. 2014.
Ageratum conyzoides harbours Mungbean yellow mosaic
India virus. Plant Pathology Journal 13: 59-64.
Naimuddin, Akram M, Pratap A, Chaubey BK and Joseph
KJ. 2011. PCR based identification of the virus causing
yellow mosaic disease in wild Vigna accessions. Journal
of Food Legumes 24: 14-17.
Naimuddin, Akram M and Singh NP. 2016. Yellow mosaic
of mungbean and urdbean: current status and future
strategies. Journal of Food Legumes 29: 77-93
Nair RM, Pandey AK, War AR, Bindumadhava H, Shwe
T, Alam AKMM, Pratap A, Malik SR, Karimi R,
Mbeyagala EK, Douglas CA, Rane J and Schafleitener
R. 2019. Biotic and abiotic constraints in mungbean
production-Progress in genetic improvement.
Frontiers in Plant Science 10: 1340.
Pal SS, Sandhu JS, Singh I. 2005. Exploitation of genetic
variability in inter-specific cross between Vigna mungo
× V. umbellata. Indian Journal of Pulses Research 18: 9–11.
Pratap A and Gupta SK. 2009. Biotechnological
Interventions in Host Plant Resistance. In: Rajinder
Peshin and Ashok K. Dhawan (eds.) Integrated Pest
Management: Innovation, Dissemination and Impact.
Springer Publishers, Dordrecht, U.K. pp.183-207.
Pratap A, Basu PS, Gupta S, Malviya N, Rajan N, Tomar R,
Latha M, Nadarajan N and Singh NP. 2014b.
Identification and characterization of sources for photo-
and thermo-insensitivity in Vigna species. Plant
Breeding 133: 756-764.
Pratap A, Das A, Kumar S and Gupta S. 2021. Current
perspectives on introgression breeding in food
legumes. Frontiers in Plant Science. doi.org/10.3389/
fpls.2020.589189.
Pratap A, Douglas C, Prajapati U, Kumari G, War AR,
Tomar R, Pandey AK, Dubey S. 2020. Breeding progress
and future challenges: Biotic stresses. In. Nair R.M. et
al (eds.) The Mungbean Genome, Compendium of Plant
Genomes. https://doi.org/10.1007/978-3-030-20008-4-5.
Pratap A, Gupta S, Malviya N, Rajan N, Tomar R, Latha M,
John JK, Singh NP. (2015). Genome scanning of Asiatic
Vigna species for discerning population genetic
structure based on microsatellite variation. Molecular
Breeding 35: 1-13.
Pratap A, Malviya N, Tomar R, Gupta DS and Kumar J.
2014a. Vigna. In: Pratap, A. And Kumar, J. (eds.) Alien
Gene Transfer in Crop Plants, Volume 2: Achievements
and Impacts, Springer Business+ Science Media, New
york, USA. Pp. 163-190.
Pratap A, Prajapati U, Singh CM, Gupta S, Rathore M,
Malviya N, Tomar R, Gupta AK, Tripathi S and Singh
NP. 2018. Potential, constraints and applications of in
vitro methods in improving grain legumes. Plant
Breeding 137: 235-249.
Rahman AHMA, Akanda AM and Alam AA. 2006.
Relationship of whitefly population build up with the
spread of TYLCV on eight tomato varieties. Journal of
Agriculture & Rural Development 4: 67-74.
Reddy MV, Singh KB. 1993. Rate reducing resistance to
Ascochyta blight in chickpeas. Plant Disease 77: 231–233.
Sebastien Le, Julie Josse, Francois Husson. 2008. Facto
Mine R: An R Package for Multivariate Analysis. Journal
of Statistical Software 25: 1-18.
Singh BV, Ahuja MR. 1977. Phaseolus sublobatus Roxb. A
source of resistance to yellow mosaic virus for
cultivated mung. Indian Journal of Genetics and Plant
Breeding 37: 130–132
Singh KP, Monika Sareen PK, Kumar A. 2003.
Interspecifific hybridization studies in Vigna radiata L.
Wilczek and Vigna umbellata L. National Journal of Plant
Improvement 5: 16-18.
Singh CM, Pratap A, Gupta S, Biradar RS and Singh NP.
2020. Association mapping for mungbean yellow
mosaic India virus resistance in mungbean (Vigna
radiata L. Wilczek). 3 Biotech 10: 1-12.
Sudha M, Karthikeyan A, Anusuya P, Ganesh NM,
Pandiyan M, Senthil N, et al., (2013). Inheritance of
resistance to mungbean yellow mosaic virus (MYMV)
in inter and intra specific crosses of mungbean (Vigna
radiata). American Journal of Plant Sciences 4: 1924.
Tomooka N, Lairungruang C, Nakeeraks P, Egawa Y,
Thavarasook C. 1992. Development of bruchid
resistant mungbean using wild mungbean germplasm
in Thailand. Plant Breeding 109: 60–66.
Verma MM, Brar JS. 1996. Breeding approaches for
increasing yield potential of mungbean. In: Asthana
AN, Kim DH (eds) Recent advances in mungbean
research. Indian Society of Pulses Research and
Development, Kanpur, India, pp 102–123.
 Journal of Food Legumes 34(1): 17-20, 2021

Genetic studies for biofortification traits in chickpea

SATVINDER SINGH*, KARTHICK S BABU, ANJU ARORA, RK PANWAR and SK VERMA

Department of Genetics and Plant
Breeding, Govind Ballabh Pant
University of Agriculture and
Technology, Pantnagar-263145
*Email: singhsatvinder519@gmail.com
Received: May 14, 2021
Accepted: June 8, 2021
Handling Editors: Dr Harsh Dixit,
ICAR-NBPGR, New Delhi and
Dr. Yogesh Tiwari,
ICAR-Indian Institute of Pulses
Research, Kanpur
ABSTRACT
Chickpea, being a valued crop, serves nutrition for an expanding population
and its importance in terms of nutrition for body health has been highlighted
frequently by nutritionists. Keeping in view the importance of Fe and Zn
micronutrients in human diet as their deficiencies cause serious health hazards,
the present analysis was carried out to determine the potential of parents (PKG
2, ICC 19, ICC 21, ICC 22 and ICC 24) and their crosses for Zn and Fe
micronutrient content through diallel. Heterosis was also estimated to identify
superior combinations. The gene action for combining ability was found to be
non-additive type for Fe and Zn content. The gca effects for Fe content was
found to be good in parents ICC 19, ICC 21 and PKG 2. While for Zn content,
ICC 22 and ICC 19 was found to be good. The crosses, ICC 19 × ICC 24, PKG 2
× ICC 19 and ICC 19 × ICC 22 showed significant and higher positive sca
effects for Fe content while for Zn content the crosses, ICC 19 × ICC 22, ICC 19
× ICC 24 and PKG 2 × ICC 21 may be considered good combiners. Out of 10
crosses, a cross PKG 2 × ICC 19 showcased significant positive heterosis over
mid, better and check parents for Fe content and ICC 19 × ICC 24 depicted
superiority over mid and better parents for Zn content and they also showed
significant sca effects in desirable direction. Hence, crosses PKG 2 × ICC 19 and
ICC 19 × ICC 24 could be found beneficial in biofortification programme in
combating nutrient deficiency.

Key words: Biofortification, Chickpea, Genetics, Iron, Zinc

INTRODUCTION metabolic disorder related to these nutritional factors.

So, improving the nutritional value of such type of
Chickpea (Cicer arietinum L.) is a valued crop and
food will improve the nutritional status of entire
provides nutrition for an expanding population. The
population. Genetic biofortiûcation is a cost-effective
importance of chickpea in terms of nutrition for body
strategy to address iron (Fe) and zinc (Zn) deficiencies
health has been highlighted frequently by nutritionists.
prevalent worldwide. Being a rich and cheap protein
Chickpea is the third most important legume food crop
source, chickpea, a food legume grown and consumed
after dry beans and peas produced in the world and
across the globe, is a good target for biofortification.
good source of dietary protein, carbohydrates and
Understanding the association of above mentioned
minerals like Fe and Zn. The protein content of
traits and their nature is necessary for effective
chickpea seed ranges from 16.7% - 30.6% and 12.6% to
selection. Further, the selection of parents for
29.0% for desi and kabuli types, respectively while the
hybridization should be on the basis of genetic value
range of Fe content from 3-14 mg/100 g, Zn content
which helps to predict gene action i.e., additive and
from 2.2-20 mg/100 g, Mg content from 107.4-168 mg/
non-additive type of gene action involved in expression
100 g and Ca content from 68-269 mg/100 g found in
of the traits. For the evaluation of genetic makeup of
chickpea seeds (Wood and Grusak, 2007). Because of
chickpea genotypes and their further use in chickpea
specific qualities, pulses are known as ‘Unique Jewels’
improvement program, information regarding their
of Indian crop husbandry (Swaminathan, 1981).
mean performance and combining ability is very
Micronutrient malnutrition affects more than helpful. An attempt was therefore made to understand
half of the world population, particularly in combining ability effects of the parents and their
developing countries. Iron, zinc and vitamin A variances to obtain information on the genetics of Fe
deficiencies are the most serious health constraints and Zn biofortification.
worldwide (Jorge et al. 2008). Considering the
MATERIALS AND METHODS
importance of chickpea as a dietary element across a
major part of global population, protein and The field experiment was conducted with five
micronutrient rich chickpeas have a potential to chickpea genotypes of Kabuli type at N.E.B.C.R.C.
improve health issues. In unrefined cereal and legume G.B.P.U.A.&T., Pantnagar (Uttarakhand) during rabi
foods the low bio-availability of Fe and Zn causes 2018-19. The parents were screened for desired
18 Journal of Food Legumes 34(1), 2021

morphological and quantitative characters viz. PKG 2 Table 1. Components of genetic variance for traits under
(Ascochyta blight resistant), ICC 19 (pod borer resistant study in chickpea
and low leaf feeding), ICC 21 (early maturing and high Characters σ²GCA σ²SCA σ² /σ²
Fe content 361.62 1585.80 0.22
yield), ICC 22 (extra-large seeded), ICC 24 (early
Zn content 17.42 64.89 0.26
maturing) and the crosses were made in half diallel
Table 2. General combining ability effects of parents for
scheme for obtaining F1 seeds of 10 crosses. Fifteen
traits under study in chickpea
genotypes (10 F1s and 5 parental lines) were evaluated
Characters PKG 2 ICC 19 ICC 21 ICC 22 ICC 24
in randomized block design with two replications and
Fe content 12.08‫٭٭‬ 10.74‫٭٭‬ 15.78‫٭٭‬ -9.54‫ ٭٭‬-29.08‫٭٭‬
planted in a single row of 1.5 m with 45 cm row to row
Zn content -3.22‫٭٭‬ 0.70‫٭‬ -0.66‫٭‬ 6.77‫ ٭٭‬-3.59‫٭٭‬
and 10 cm plant to plant distance at the same location
during rabi 2019-20. *Significant at 5% level, **Significant at 1% level.

Extraction and Estimation of Fe and Zn Content
The micronutrients in the chickpea seeds viz. Fe
and Zn were analyzed by Atomic Absorption
Spectroscopy (AAS) method and expressed in terms
of mg/100g. The sun dried F2 seeds were ground to
form fine powder weighing 0.5 g and 10 ml of
concentrated HNO3 was added and was kept
overnight while covering the mouth of the flask. Then
heated the flask for 30 minutes on hot plate. After
cooling 10 ml mixture of HNO3:HClO4 (4:1) were
added and kept at 40°C till the mixture reduced to half
and became clear (Raghuramulu, 2003). The samples
were filtered with Whatman 42 (2.5 µm particle
retention) filter paper. Thus, sufficient amount of
deionized water was added to make the final volume
up to 50 ml. The diluted filtrate was used for analysis
of Zn and Fe concentration by AAS using suitable
hollow cathode lamps. The mineral is estimated using
the following formula:
µg miner al/ ml dilution factor
pp m miner al =
m l of aliquot  g of samp le
Biometrical and genetical analysis
The analysis of combining ability for parental
lines and their crosses were estimated by following
method 2 and model I (fixed effect model) of Griffing
(1956). Heterosis is expressed as % increase or decrease
in the performance of F1 hybrid over the better parent,
mid parent and standard parent. It was computed as
suggested by Hayes et al. (1955) and Fonseca and
Paterson (1968).
RESULTS AND DISCUSSION
The estimates of general combining ability
variance (ó2 GCA), specific combining ability variance
Table 3. Summary table for general combining ability
of parents under study in chickpea
Characters PKG 2 ICC 19 ICC 21 ICC 22 ICC 24
Fe content G G G P P
Zn content P G P G P
(ó² SCA) and the ratio of ó2 GCA to ó2 SCA showed the
preponderance of non-additive gene action
(dominance and epistasis) in controlling the
expression of Fe as well as Zn content (Table 1).
Jayalakshmi et al. 2018 also reported non additive gene
action for Fe content in chickpea. The desirable gca
effect may serve as a path in differentiating
outstanding parents with desirable alleles for different
component traits as furnished in table 2. The high gca
effects for Fe content was found significant and positive
in three parents viz. ICC 21, PKG 2 and ICC 19 whereas
the magnitude of gca effects for Zn content was found
significant and positive in ICC 22 and ICC 19.
Regarding biofortification, the parental line ICC 19
exhibited good general combining ability for Fe and
Zn content while PKG 2 and ICC 21 were good
combiners for only Fe content and ICC 22 for only Zn
content. But the parent ICC 24 was a poor combiner
for both Fe and Zn content (Table 3). Grewal et al. (2020),
also reported high Zn and Fe content in few genotypes
of chickpea. Thavarajah and Thavarajah (2012) also
found high content of Fe and Zn in few lines of
chickpea.
On the basis of estimates of sca effect the specific
cross combination can also be identified and can be
further utilized in hybrid development programme.
The sca effect represents non additive gene action
which is non-fixable. Significant positive or negative
sca effects were identified in F1 generation for
micronutrient i.e., Fe and Zn content. None of the
crosses were found having significant sca effects in

Table 4. Estimates of specific combining ability (sca) effects for crosses in chickpea
Characters PKG 2 × PKG 2 × PKG 2 × PKG 2 × ICC 19 × ICC 19 × ICC 19 × ICC 21 × ICC 21 × ICC 22 ×
ICC19 ICC 21 ICC 22 ICC 24 ICC 21 ICC 22 ICC 24 ICC 22 ICC24 ICC 24
Fe content 36.51‫٭٭‬ 21.76‫٭٭‬ 6.69‫٭٭‬ -44.26‫٭٭‬ -78.79‫٭٭‬ 35.38‫٭٭‬ 43.76‫٭٭‬ 25.32‫٭٭‬ -9.91‫٭٭‬ -4.13‫٭٭‬
Zn content 2.79‫٭٭‬ 4.25‫٭٭‬ -12.45‫٭٭‬ 1.78‫٭‬ 0.12 13.01‫٭٭‬ 5.42‫٭٭‬ -3.06‫٭٭‬ -1.14 -11.19‫٭٭‬
*Significant at 5% level, **Significant at 1% level.
 Singh et al.: Genetic studies for biofortification traits in chickpea 19

Table 5. Per cent increase or decrease of the F1 over mid parent (relative heterosis), better parent (heterobeltiosis) and
standard parent (economic heterosis) in Fe and Zn content in chickpea genotypes
Crosses Fe content (Heterosis over) Zn content (Heterosis over)
Mid parent Better parent Standard parent Mid parent Better parent Standard parent
PKG 2 × ICC19 ‫٭٭‬ 45.43 5.03‫٭‬ -6.08 -16.14‫٭٭‬ -58.21‫٭٭‬
PKG 2 × ICC 21 13.82‫٭٭‬ -1.99 -1.99 8.79 7.94 -45.36‫٭٭‬
PKG 2 × ICC 22 40.83‫٭٭‬ -4.68‫٭‬ -31.16‫٭٭‬ -55.10‫٭٭‬ -66.36‫٭٭‬ -66.36‫٭٭‬
PKG 2 × ICC 24 -63.28‫٭٭‬ -75.18‫٭٭‬ -82.07‫٭٭‬ -8.95 -14.89‫٭‬ -57.59‫٭٭‬
ICC 19 × ICC 21 -70.26‫٭٭‬ -75.57‫٭٭‬ -75.57‫٭٭‬ 21.60‫٭٭‬ 7.05 -45.81‫٭٭‬
ICC 19 × ICC 22 97.28‫٭٭‬ 37.84‫٭٭‬ -11.41‫٭٭‬ 44.73‫٭٭‬ 0.23 0.23
ICC 19 × ICC 24 79.57‫٭٭‬ 25.30‫٭٭‬ -19.47‫٭٭‬ 45.59‫٭٭‬ 37.48‫٭٭‬ -40.43‫٭٭‬
ICC 21 × ICC 22 35.73‫٭٭‬ -14.74‫٭٭‬ -15.03‫٭٭‬ -18.97‫٭٭‬ -39.30‫٭٭‬ -39.30‫٭٭‬
ICC 21 × ICC24 -27.40‫٭٭‬ -54.44‫٭٭‬ -54.59‫٭٭‬ -10.77‫٭‬ -16.59‫٭٭‬ -58.44‫٭٭‬
ICC 22 × ICC 24 23.45‫٭٭‬ 23.10‫٭٭‬ -68.71‫٭٭‬ -50.13‫٭٭‬ -64.23‫٭٭‬ -64.35‫٭٭‬
*Significant at 5% level, **Significant at 1% level

desirable direction for the trait (Table 4). The high sca
effects for Fe content was found significant in crosses,
ICC 19 × ICC 24, PKG 2 × ICC 19, ICC 19 × ICC 22 and
ICC 21 × ICC 22. Although the magnitude of high sca
effects for Zn content was observed significant and
positive in crosses namely ICC 19 × ICC 22, ICC 19 ×
ICC 24 and PKG 2 × ICC 21 and may be considered
good combiners for the trait. The desirable sca effects
may not be of practical utility until and unless per se
performance of the combinations are compared to that
of respective mid parent, better parent and standard
parent performance. The cross PKG 2 × ICC 19 showed
significant and positive heterosis over mid, better and
standard parents. While for Zn content none of the
crosses was positive over check parent but three
crosses viz. ICC 19 × ICC 24, ICC 19 × ICC 22 and ICC
19 × ICC 21 exhibited significant positive heterosis
over mid parent and only one cross ICC 19 × ICC 24
exhibited significant positive heterosis over better
parent (Table 5). Considering biofortification, the cross
PKG 2 × ICC 19 exhibited superiority for Fe content
and showcased significant sca in desired direction and
also had significant positive heterosis over mid, better
and standard parents. While for Zn content, the cross
ICC 19 × ICC 24 showed significant positive sca as
well as heterosis for mid and better parents but found
inferior to check parent. Hence these could be found
beneficial in biofortification programme in combating
nutrient deficiency and also could be utilized in future
breeding programmes for improvement of respective
traits.
Thus, it is concluded that parent ICC 19 and
crosses namely PKG 2 × ICC 21, ICC 19 × ICC 22, PKG
2 × ICC 19 and ICC 19 × ICC 24 may be considered
superior for biofortification based on gca and sca
effects. The cross PKG 2 × ICC 19 also showcased
significant positive heterosis over mid, better and check
parents for Fe content. However, for both Zn and Fe
content, the cross-combination ICC 19 × ICC 24 was
found superior over mid and better parents. Hence
these promising parent and crosses can be utilized in
future breeding programs for combating nutrient
deficiency.
REFERENCES
Fonesca S, and Patterson F. 1968. Hybrid vigour in a seven
parent diallel cross in common wheat crop. Crop Sci.
1: 85-88.
Griffing B. 1956. Concept of general and specific combining
ability in relation to diallel crossing systems.
Australian Journal of Biological Sciences 9: 463-493.
Gaur S, Bhardwaj R, Arora A and Gaur AK. 2020. Estimation
of combining ability and heterosis by using diallel
mating design in Kabuli genotypes of chickpea.
International Journal of Chemical Studies. 8(3): 2260-
2264.
Grewal SK, Sharma KP, Bharadwaj RD, Hegde V, Tripathi
S, Singh S, Jain PK, Agrawal PK and Mondal B. 2020.
Understanding genotypic variation and identification
of promising genotypes for iron and zinc content in
chickpea (Cicer arietinum L.). Journal of Food
Composition and Analysis 88: 103458.
Hayes HK, Immer FR and Smith DC. 1955. Methods of
plant breeding. Mc Graw Hill Book Co. Inc., New York.
Pp. 432.
Jorge EM, Wolfgang HP and Peter B. 2008. Biofortified
crops to alleviate micronutrient malnutrition. Current
Opinions in Plant Biology 11: 166–170.
Jayalakshmi V, Trivikrama RA and Nagamadhuri KV.
2018. Genetic diversity and variability for protein and
micro nutrients in advance breeding lines and chickpea
varieties grown in Andhra Pradesh. Legume Research
An International Journal 42(6): 768-772.
Misra G, Saha AJ, Salaskar D and Reddy KS. 2020. Baseline
status and effect of genotype, environment and
genotype × environment interactions on iron and zinc
content in Indian chickpeas (Cicer arietinum L.).
Euphytica 216(9): 137.
20 Journal of Food Legumes 34(1), 2021
Panse VG and Sukhatme 1967. Statistical Methods for
Agricultural Workers, ICAR, New Delhi, pp. 145-152.
Raghuramulu N, Madhavan NK and Kalyanasundaram S.
2003. A Manual of Laboratory Techniques. National
Institute of Nutrition, Indian Council of Medical
Research, Hyderabad, India. Pp. 56-58.
Swaminathan MS. 1981. Improving pulse production and
productivity challenges ahead. Pulse Crops Newsletter
1(2): 25.
Thavarajah D and Thavarajah P. 2012. Evaluation of
chickpea (Cicer arietium L.) micronutrient composition:
biofortification opportunities to combat global
micronutrient malnutrition. International Food
Research Journal 49: 99-104.
Wood JA and Grusak MA. 2007. Nutritional value of
chickpea. In ‘Chickpea breeding and management’.
(Eds SS Yadav, R Redden, W Chen, and B Sharma).
CAB International: Wallingford, UK. Pp. 101-142.
 Journal of Food Legumes 34(1): 21-30, 2021

Use of novel chitin amended formulation of Trichoderma asperellum and

Pseudomonas fluorescens to induce systemic induced resistance in
chickpea [Cicer arietinum L.] against biotic stresses
P JAISANI* and NM GOHEL

Department of Plant Pathology,
B.A. College of Agriculture,
Anand Agricultural University,
Anand-388 110, Gujarat, India
*E-mail: amdavadi_15@rediffmail.com
Received: January 16, 2021
Accepted: June 8, 2021
Handling Editor: Dr. Senthilkumar M,
ICAR-Indian Institute of Pulses Research,
Kanpur
ABSTRACT
Genetic diversity of antagonistic P. fluorescens, compatibility testing with
fungicides at various concentrations and inducing higher tolerance in
bioagents to fungicides, bioefficacy of tolerant bioagents against biotic
stresses in chickpea grown in different soil stress conditions were studied
during doctoral research (2017-18 and 2018-19). The nineteen isolates were
obtained on King’s B medium (KB) designated as Pseudomonas fluorescens
(Pf-1 to Pf-19) from chickpea. All the characteristics were dominant for the
taxonomical classification of P. fluorescens. 16s rRNA specific region of the
ribosomal operon was amplified for the precise species-level identification
of P. fluorescens. ph1D gene was amplified in all nineteen isolates of
P. fluorescens and ech42 region in T. asperellum indicated good diversity of
biocontrol activity based on antibiotics genes. The infected plants showed
typical characteristic symptoms of dry root rot and wet root rot and exhibited
discoloration of tap roots, longitudinal cracking of the stems, stunting,
wilting, etc. which revealed firm association of M. phaseolina and R. solani.
Internal Transcribed Spacer (ITS) region based sequencing of M. phaseolina
and R. solani proved accurate species-level identification of both pathogens.
P. fluorescens (Pf-5 from kheda) and native T. asperellum showed the highest
inhibition against M. phaseolina and R. solani in vitro. The highest
compatibility of T. asperellum and P. fluorescens was recorded with metalaxyl
followed by thiram, mancozeb and copper oxychloride. Higher ED50 values
for radial growth indicated maximum tolerance of T. asperellum and P.
fluorescens for metalaxyl followed by thiram. T. asperellum and P. fluorescens
grew cent per cent against metalaxyl. The combined application of chitin
amended bioformulation of T. asperellum and P. fluorescens gave highest
seed germination, shoot and root length as well as vigour index and stood
superior as compared to control in promoting growth parameters in chickpea
under paper towel method as well as lowest per cent disease incidence in
chickpea for the management of diseases caused by M. phaseolina and
R. solani during pot studies as compared to control. The combination of
chitin amended T. asperellum + P. fluorescens (talc bioformulation) under
pathogen stress condition exhibited increased PO and PPO activities in the
root tissues of chickpea from 10 to 30 days after sowing and declined
thereafter in all the inoculated treatments. Whereas in the case of pathogen
inoculated control, it gradually declined from 10th days after sowing itself
depecting induced systemic resistance action.

Key words: Biocontrol efficacy, P. fluorescens, ph1D, T. asperellum, 16srRNA

Abbreviations: BLAST-Basic Local Alignment Search Tool, CFU-Colony

Forming Unit, DAS-Days After Sowing, ED50-Effective dose, PO-Peroxidase,
PPO-Polyphenol oxidase

INTRODUCTION stresses. Among biotic stress, the major fungal diseases

Chickpea (Cicer arietinum L.) is a legume belongs
to the family: Fabaceae. It is the world’s third most
important grain legume globally grown in over 40
countries (Anwar et al. 2009). However, the yield of
chickpea is greatly reduced due to various biotic
which infect the chickpea are dry root rot and wet root
rot. Dry root rot disease incited by soil-borne fungus
M. phaseolina (Tassi) Goid. is a major limiting factor in
the chickpea (Raguchander et al. 1993; Nene et al. 2012).
The pathogen attacks on all plant parts i.e. root, stem,
branches, petioles, leaves, pods and seeds. Moreover,
22 Journal of Food Legumes 34(1), 2021
seed infection of Rhizoctonia bataticola (M. phaseolina)
ranges from 2.2-15.7% which causes 10.8 per cent
losses in grain yield and 12.3 per cent in protein content
of seed (Kaushik et al. 1987). The infected seeds acted
as an important source of primary inoculum for new
areas (Sandhu and Singh 1998). Rhizoctonia solani
(teleomorph: Thanatephorus cucumeris) inciting wet root
rot disease is a plant pathogenic fungus with a wide
host range and worldwide distribution. It is seed and
soil-borne in nature. It causes various plant diseases
such as wet root rot, web blight, aerial blight, collar
rot, root rot, damping-off and wire stem. R. solani
attacks its host when they are in their juvenile stages
of development such as seeds and seedlings, which
are typically found in the soil. The disease cycle of
R. solani is important in regards to management and
control of the pathogen (Dorrance et al. 2003).
Increasing awareness on the deleterious effects of
indiscriminate usage of fungicides on the environment,
human and animal health has led to a search for
alternatives to manage biotic stress. Furthermore, the
usage of fungicides against plant pathogens produces
a negative impact on the nodulation of legumes by
nitrogen-fixing beneficial bacteria (Muthumilan and
Jeyarajan, 1996). The use of antagonistic fungi and
plant growth-promoting bacterial antagonist offers
great potential as alternatives to agrochemicals. A
number of biocontrol agents (BCAs) such as
Trichoderma spp. (Rettinassababady and Ramadoss
2000) and Pseudomonas fluorescens (Karthikeyan et al.
2005; Saravanakumar et al. 2007; Thilagavathi et al.
2007) have been used to manage root rots of pulses.
Among the fungal bioagents in management of plant
diseases, Trichoderma spp. has gained immense
importance as BCAs due to their high reproductive
capacity, ability to withstand stress conditions,
efficiency in the utilization of the nutrients, the capacity
to modify the rhizosphere, strong aggressiveness
against phytopathogenic fungi and efficiency in
promoting plant growth and defense mechanisms
(Chet et al. 1997). Among the plant growth promoting
rhizobacteria (PGPR), fluorescent pseudomonads are
the most exploited non-pathogenic bacteria for
biological control of soil-borne and foliar plant
pathogens which through rhizosphere colonization,
antibiosis, iron chelation by siderophore production
and induced systemic resistance (ISR). Fluorescent
pseudomonads are among the most effective
rhizosphere bacteria because they exert a beneficial
effect on plant growth promotion (Dubeikovsky et al.
1993; Raupach and Kloepper 1998). But, the efficacy
of bioagents is affected by predisposing ecological
factors, particularly biotic as well as abiotic stress.
Biocontrol agents are very susceptible to fungicides,
though they have been reported to be effective to the
tune of 50-60%. The biocontrol efficacy and plant
growth promoting activity of bioagents were further
increased by combining with other fungal antagonist
(Saravanan 2007; Lednev et al. 2008) or amended with
chitin or other materials (Benhamou et al. 1998;
Radjacommare et al. 2002; Bharathi et al. 2004).
Chickpea is grown in Gujarat under varied soil and
environmental condition and challenged by
M. phaseolina and R. solani as soil-borne pathogens
from seedling to maturity stages of crops. Stress
tolerant isolate of Trichoderma sp. and Pseudomonas sp.
having good biocontrol potential due to their high
hydrolytic enzyme or antibiotic production may be able
to survive in extreme conditions of biotic stress and
can lead to the efficient management of root rot
diseases. Hence, the present research was undertaken
to explore the genetic diversity of these stress tolerant
bioagents having good biocontrol potential in
chickpea grown in different soil stress conditions in
Gujarat and their potential in withstanding the adverse
biotic factors with respect to alleviating the yield losses
of the crop.
MATERIAL AND METHODS
Collection of Pseudomonas fluorescens and
Pathogens
Soil samples were collected from twelve different
districts growing chickpea i.e. Anand, Kheda,
Vadodara, Ahmedabad, Dahod, Mehsana, Kutch,
Junagadh, Bhavnagar, Banaskantha, Sabarkantha,
Navsari of Gujarat. The serial dilution plate technique
was used for isolation of the P. fluorescens.
Development of bacterial colonies were periodically
observed up to seventh day. The plates were observed
for the appearance of Pseudomonas colonies under the
microscope and sub-cultured on Nutrient Agar (NA)
Petri plates. Observations were recorded on
morphological characteristics like colony colour, type
and growth of colony after seven days of incubation
under ultraviolet (UV) light. Pathogens were collected
by tissue isolation technique from infected chickpea
plant which showed typical characteristic symptoms
of dry and wet root rot.
Molecular identification and characterization of
bioagents and pathogens
Molecular identification of P. fluorescens at species
level was done based on 16s rRNA gene using specific
primers as per the standard protocol for bacteria
(Nubel et al., 1996). The sequencing of the PCR product
was carried out in automated sequencer ABI 3730
genetic analyzer at Xcelris Genomics Co., Ahmedabad,
Gujarat. PCR detection and characterization of
endochitinase gene (ech 42) in T. asperellum and ph1D
gene in P. fluorescens were executed based on universal
 Jaisani and Gohel : Use of novel chitin amended formulation of Trichoderma asperellum
specific primer pairs for biocontrol activity analysis,
respectively. The pure cultures of pathogens were
identified through the Internal Transcribed Spacer
(ITS) region based sequencing method as per the
standardized protocols. Sequences were searched
using BLAST (Basic Local Alignment Search Tool)
program from the Gen Bank data base of NCBI
(National Centre for Biotechnology Information), USA
(Altschul et al. 1997).
Testing biocontrol efficacy of T. asperellum and
P. fluorescens isolates in management of seed and
soil-borne pathogens
Different P. fluorescens isolates and T. asperellum
(native AAU isolate with NCBI Accession No.
KM875466.1) were screened against test pathogens i.e.
M. phaseolina (dry root rot) and R. solani (wet root rot)
in vitro by dual culture method for bioefficacy analysis
(Dennis and Webster, 1971) using Nutrient Agar (NA)
and Potato Dextrose Agar (PDA) medium, respectively.
The experiment was carried out for both the pathogens
separately and per cent growth inhibition was
calculated by the following formula suggested by
Vincent (1947).
Growth inhibition (%) = (DC-DT)/( DC) × 100
Where, C = Mean diameter of mycelial colony in control
treatment (mm) and T = Mean diameter of mycelial
colony in treated set (mm).
Testing sensitivity and induction of higher
tolerance of efficient isolate of T. asperellum and
P. fluorescens against fungicides
Tolerance to fungicides in T. asperellum (native
AAU isolate) and efficient P. fluorescens were evaluated
using poisoned food technique with three different
concentrations. Observations on radial growth (colony
diameter) were recorded from 24 hours of incubation
at 28 ± 1°C temperature till the complete growth of test
antagonist in control plates. Per cent growth inhibition
(PGI) over control was calculated as described by
Vincent (1947). Observations on ED 50 values of
pesticides against T. asperellum and efficient
P. fluorescens were calculated by plotting the chemical
concentrations against percent inhibition on a log
probit scale as described by Horsfall (1956) using MS
Excel. The higher tolerance was induced by exposing
parent isolate to increasing concentrations of fungicide
i.e. metalaxyl 35 WS (1500, 3000, 6500 ppm) to generate
series upto fourth level and further stabilized by
maintaining on same concentration.
Effect of biopriming with efficient and fungicide
tolerant T. asperellum and P. fluorescens
One kilogram seeds of chickpea were taken
23
separately in sterilized conical flasks. The liquid
suspension of T. asperellum and efficient P. fluorescens
and the bioagents were prepared separately by mixing
50 g of chitin @ 0.5% and carboxy methyl cellulose
(CMC) @ 0.1% amended solid talc based formulation
with spore load of 2x108 CFU/g was dissolved in 250
ml of distilled water. Five gram of crab shell chitin
was slowly added into 100 ml of 0.25 N HCI with
vigorous stirring and kept overnight at 4°C. The
mixture was filtered through glasswool into 200 ml of
ice cold ethanol at 4°C with rapid stirring. The
resultant chitin suspension was centrifuged at 10,000
rpm for 20 min and the chitin pellets were washed
repeatedly with distilled water until the pH became
neutral. The concentration of colloidal chitin was
adjusted to 10 mg per ml. The seeds were treated with
the bioagents suspension for 10 hours at room
temperature. After 10 hours of treatment, the seeds were
air-dried. Bioprimed seeds were sown in the soil after
10 hours of treatment. Seeds were soaked in water
without bioagents for 10 hours served as control. The
plant growth-promoting activity of the biocontrol
agents was assessed based on the seedling vigour
index by the standard paper towel method (ISTA,
1993). Three repetitions were made for each treatment.
The root length and shoot length of individual
seedlings were measured and the per cent germination
of the seeds was calculated. The seedling vigour index
was calculated using the following formula given by
Abdul Baki and Anderson (1973).
Vigour Index = (Mean root length + Mean shoot
length) x Germination (%)
The pathogens were multiplied on sand maize
meal medium (9:1) for 15 days for mass production
individually. The soil was sterilized in an autoclave
at temperature 121 0C for 5 hours. The pots containing
sterilized soil was inoculated with above sand maize
meal inoculums @ 50 g/kg soil and keep left for 15
days for establishment of inoculum. The above-
bioprimed seeds of chickpea were inoculated with
pathogens i.e. M. phaseolina and R. solani separately
and sown in pots containing pathogen sick soil in
polyhouse condition. The disease incidence i.e. dry
root rot and wet root rot were recorded. The per cent
seedling mortality was calculated by using the
following formula given by Pandey et al. (1989)
Mortality (%) = (Number of seeds or seedlings
rotted) / (Total No.of seeds sown) × 100
The data obtained during the present
investigations were subjected to statistical analysis by
making use of analysis of variance technique. The
standard methods of analysis of variance for
completely randomized design was used in the
experiments. The test of significance among the
24 Journal of Food Legumes 34(1), 2021
treatments was worked out by ‘F’ test. The appropriate
standard error of mean ± S.Em was computed in each
case. For the treatments effects, which were found
significant, the critical difference (CD) at 5 per cent
level of probability was worked out to compare two
treatment means.
Analysis of Peroxidase (PO) and Polyphenol
oxidase (PPO) imparting systemic induced
resistance in chickpea against diseases
The activity of peroxidase (PO), polyphenol
oxidase (PPO) were estimated from root samples of
chickpea collected at 10 days intervals for 40 days after
inoculation with pathogen and pre-treatment with
fungicide tolerant T. asperellum and P. fluorescens
(Pf-5) following Worthington’s method as described
by Guilbault (1976). The enzyme activity was measured
as Enzyme activity/assay = Change in optical
density/min/g of fresh tissue/mg protein.
Fig 1a. Fluorescence observation under UV light and
microscopic view of P. fluorescens
Fig 1b. Cultural growth and microscopic view of
T. asperellum
Interaction of T. asperellum with chickpea
Association of T. asperellum with chickpea roots
after biopriming during studies was conducted with
the scanning electron microscopy (SEM) at SICART,
VV Nagar, Dist. Anand, Gujarat.
RESULTS
Collection of Pseudomonas fluorescens and
Pathogens
Nineteen isolates were obtained in the serial
dilution range of 10-2 to 10-5 on King’s B medium (KB)
designated as Pseudomonas fluorescens (Pf-1 to Pf-19).
The colony colour of all the isolates weres limish cream
and produced slight pigment. It was observed rod-
shaped bacterium under 100x objective of a light
microscope. The colonies of the isolates were
dominantly irregular, undulate, the convex, smooth,
and slimy, transparent and characteristic smell on KB
plate. The colony showed fluorescence on King’s B
agar medium when observed under UV light (Fig.1 a).
Isolates produced yellow-green diffusible pigment of
variable intensities on King’s B medium.
The diseased plant samples of chickpea were
subjected to tissue isolation to obtain the culture of the
pathogen inciting dry root rot and wet root rot.
Molecular identification and characterization of
bioagents and pathogens
16s rRNA gene was amplified in all the nineteen
isolates and gave amplicons ranging in size from 900-
1000 bp. Sequences so obtained were subjected for
BLAST analysis for its identity and confirmation, and
subsequently submitted to the National Centre for
Biotechnology Information (NCBI) GenBank. ech42
region in T. asperellum was amplified and gave
amplicon ranging in size from 450-500 bp (Fig. 2, ii),
and ph1D region in all the nineteen isolates of
P. fluorescens was amplified and gave amplicons
ranging in size from 600-700 bp (Fig.2, i).
Characterization of ph1D region in all the nineteen
isolates of P. fluorescens amplified regions from 600-
700 bp indicating good diversity of biocontrol activity
based on antibiotics genesfor 2,4-diacetyl-
phloroglucinol (2,4-DAPG). ech42 region in
T. asperellum was amplified and gave amplicon
ranging in size from 450-500 bp indicating good
diversity of biocontrol activity based on antibiotics
genes for endochitinase production.
Fig 2. (i) ph1D gene amplification from isolates of
P. fluorescens (ii) ech42 gene amplification from
T. asperellum.Testing biocontrol efficacy of T. asperellum
and efficient isolates of P. fluorescens in the management
of seed and soil-borne pathogens viz., M. phaseolina (dry
root rot) and R. solani (wet root rot) in vitro
Significantly minimum mycelial growth of M.
phaseolina i.e.13.18 mm was observed with Pf-5 (Kheda)
 Jaisani and Gohel : Use of novel chitin amended formulation of Trichoderma asperellum
with maximum growth inhibition of 85.36 per cent,
followed by Pf-1 (Anand) with 21.15 mm of mycelial
growth and 76.50 per cent growth inhibition (Fig.3, i).
There exhibited similar trend with minimum mycelial
growth (14.50 mm) of R. solani with isolate Pf-5 with
maximum growth inhibition of 83.89 per cent, followed
by isolate Pf-6(Kheda) which recorded 21.11 mm of
mycelial growth and 76.54 per cent of growth
inhibition. Similarly, native isolate of T. asperellum
significantly inhibited the mycelial growth of
M. phaseolina i.e. 86.21 per cent and R. solani i.e. 86.97
per cent (Fig. 3, ii).
Fig 3. Effectiveness of P. fluorescens and T. asperellum
in inhibiting mycelial growth of (i) M.phaseolina and
(ii) R. solani
Testing of sensitivity and induction of higher
tolerance of efficient isolate of T. asperellum and
P. fluorescens against fungicides
The effect of fungicides on radial growth of
T. asperellum at three different concentrations indicated
very little inhibition of radial growth of 4.63 per cent
by metalaxyl at a concentration of 200 ppm. The
bioagent could grow successively up to 400 ppm.
Among other pesticides tested viz.,thiram,
thiamethoxam, mancozeb and copper oxychloride
showed low inhibition i.e. 14.44, 18.88, 23.33 and 26.29
per cent to T. asperellum at 100, 150, 2000 and 600 ppm,
respectively. Carbendazim showed the highest
inhibition of radial growth of 97.77 per cent at a
concentration of 400 ppm. ED50 values for radial
growth indicated maximum tolerance of T. asperellum
for metalaxyl at 4786 ppm. It was followed by thiram
(4677 ppm) and thiamethoxam (3548 ppm). The similar
trend was recorded with P. fluorescens where Metalaxyl
showed little inhibition of bioagent with 25.18 per cent
radial growth at 400 ppm. Moderate inhibition of
23.88, 27.77, 31.84 and 35.36 per cent was observed
with thiram (100 ppm), copper oxychloride (600 ppm),
imidacloprid (150 ppm) and mancozeb (2000 ppm),
respectively. Carbendazim showed highest growth
inhibition i.e. 98.69 per cent at 400 ppm. ED50 values
for radial growth indicated maximum tolerance of P.
fluorescens for metalaxyl at 5248 ppm. It was followed
by thiram (3467 ppm) and copper oxychloride (2089
ppm). For inducing higher tolerance, T.asperellum and
25
P. fluorescensas used as parent bioagents subjected to
400 ppm of the fungicide. These bioagents were further
subjected to the higher dose of 1500 ppm, wherein 81
mm and 78 mm radial growth were obtained,
respectively. In successive transfers from second and
third i.e. 3000 and 6500 ppm, it grew cent per cent,
respectively with profuse and dark pigmentation seen
within the cultural radial growth pattern of
T. asperellum, while intense pigmented and profused
growth was observed in P. fluorescens which was
measured from periphery towards radially centered
(Fig. 4).
Fig 4. Induced tolerance in T. asperellum and P.
fluorescens against fungicide Metalaxyl at three different
concentration (ppm)
Effect of biopriming
Combination of chitin amended T. asperellum and
P. fluorescens (talc bioformulation) gave the highest seed
germination of 91.33 per cent. It was at par with the
treatment of T. asperellum (talc bioformulation)
(90.00%), P. fluorescens (talc bioformulation) (90.00 %)
and the lowest germination of seeds (78.66%) was
observed in seeds soaked in water as control.
Combination of chitin amended T. asperellum and
P. fluorescens (talc bioformulation) gave significantly
highest shoot length of 12.60 cm which was at par
with T. asperellum (talc bioformulation) (12.36 cm). The
significantly highest root length of 6.90 cm was
recorded in the combined application of chitin
amended T. asperellum and P. fluorescens (talc
bioformulation) which was at par with T. asperellum
(talc bioformulation) (6.70 cm) and P. fluorescens (talc
bioformulation) (6.53 cm). The highest vigour index
i.e.1781 was recorded in the combined application of
chitin amended T. asperellum and P. fluorescens (talc
bioformulation) followed by T. asperellum (talc
bioformulation) (1715) (Fig. 5).
Disease Incidence
The results that chitin amended talcbio
formulation treatment of T. asperellum +
26 Journal of Food Legumes 34(1), 2021
Fig 5. Effect of biopriming of chickpea seeds with
efficient and fungicide tolerant T. asperellum and
P. fluorescens on seed germination, growth and vigour
of seedlings (i) M. Phaseolina and (ii) R. solani.
T1: spore suspension of T. asperellum AAU isolate (2 x
10 8 CFU/ml), T 2: spore suspension of P. fluorescens (2
x 10 8 CFU/ml), T 3: T 1 + T 2, T 4 : T. asperellum AAU
isolate (talc bioformulation 2 x 10 8 CFU/g), T 5 : P.
fluorescens (talc bioformulation 2 x 108 CFU/g), T6: T4 +
T5 (chitin amended talc bioformulation ) , T7: Control
P. fluorescens in combination was the best treatment
which gave highest seed germination (85.00 %), shoot
length (14.46 cm), root length (7.26 cm), vigour index
(1846) and lowest disease incidence (16.66%) in
chickpea as compared to control (M. phaseolina).
Similarly, combined chitin amended bioformulation
of T. asperellum + P. fluorescens was the best treatment
which gave highest seed germination (91.67%), shoot
length (13.83 cm), root length (7.03 cm), vigour index
(1912) and lowest disease incidence (15.00%) in
chickpea as compared to control (R. solani) (Fig. 6).
Fig 6. Effect of biopriming of chickpea seeds with
efficient and fungicide tolerant T. asperellum and
P. fluorescens on incidence of dry root rot caused by
M. Phaseolina (Treatments as mentioned in Fig. 5)
Analysis of Peroxidase (PO) and Polyphenol oxidase
(PPO) imparting systemic induced resistance in
chickpea against diseases
At 10 days after sowing, significantly higher PO
and PPO activity was recorded in all the treatments as
compared to M. phaseolina and R. solani control. The
application of chitin amended T. asperellum +
P. fluorescens (talc bioformulation) in combination
(Table 1) significantly increased the activity steadily
of the peroxidase as well as polyphenol oxidase from
the 10th day up to the 30th day after M. phaseolina and
R. solani inoculation. The least PO and PPO activity
was recorded in M. phaseolina and R. solani inoculated
control. At 40 DAS, significantly higher PO activity
was recorded in all the treatments as compared to
pathogen inoculated control but decreased
successively as compared to 30 DAS (Table 1).
Interaction of T. asperellum with chickpea
SEM analysis have shown good level of root
colonization by T.asperellum around primary root
surfaces in chickpea and appressoria like structures
were also observed adhering to the root surface (Fig.
7). Similar mechanism have been reported earlier
where rhizosphere-competent strains colonized entire
root surfaces for several weeks (Thrane et al. 1997) or
months (Harman 2000). The colonization behaviour
of the bioagent may have resulted in increased levels
of defence-related plant enzymes, including various
peroxidases, chitinases, -1,3-glucanases, and the
lipoxygenase-pathway hydroperoxidelyase (Howell
et al. 2000; Yedidia et al. 1999 )
DISCUSSION
Characteristics were dominantly irregular,
undulate, convex, smooth and slimy, transparent and
characteristic smell on KB plate were regarded as
taxonomically useful characteristics for P. fluorescens.
Colony growth on King’s B media was surrounded by
fluorescent colour. Manjunatha et al. (2012) also
mentioned that pigmented rhizobacteria that were
Gram-negative rod shaped belonged to P. fluorescens
with pigment of colony as the most distinctive cultural
characteristics of the microorganism which results from
yellow to deep purple under different cultural
conditions. Native identified T. asperellum (NCBI
Accession No. KM875466.1) was used in the study
obtained from the Department of Plant Pathology,
BACA, AAU, Anand. T. asperellum covered the entire
Petri plate in three days with concentric rings of dense
conidial mass (Fig.1 b) and produced finer conidial
ornamentation, globose shaped conidia, paired
branches. Symmetric conidiophores terminating in
two or more phialides. Results similar to the present
investigation showing typical characters were
reported by Nagamani et al. (2002) and Chaverri et al.
(2003).
The pure cultures of pathogens i.e. M. phaseolina
and R. solani were maintained by periodical transfer
on PDA Petri plates throughout the investigations. The
fungus (M. phaseolina) colony grew fast on PDA and
 Jaisani and Gohel : Use of novel chitin amended formulation of Trichoderma asperellum
achieved a diameter of 90 mm in seven days at 27±1°C
temperature. Growth and microsclerotial bodies
production studied on PDA indicated that the
mycelium was pale white in colour in the initial stages
of the growth but, later turned to dark brown to black
as and when microsclerotial bodies started to form.
The mycelial growth was linear and fluffy. The fungus
mycelium of R. solani was fast-growing, white in colour
when young but later turn slightly brown. Sclerotia
were superficial, more or less globose with the flattened
lower surface. These generally appear as white initially
and later gradually change to light brown and then to
dark brown in colour. The mycelium of R. solani was
septate, hyaline. In older hyphae, the branching was
at a wider angle. Branching at a right angle was also
observed. The cultural and morphological characters
of M. phaseolina were closely identical with the
description of M. phaseolina (Tassi) Goid. given by Ash
(1927) and Goidanich (1947), while the cultural and
morphological characters of R. solani were in
accordance with the description of R. solani Kuhn given
by Prillieux and Delacroix (1891).
The results of molecular characterization of
bioagents and pathogens were in accordance with Kim
et al. (2013) report that the application of a PCR primer
sets targeting genes encoding the main identification
of P. fluorescens antibiotic group genes, phlD for 2,4-
diacetylphloroglucinol (2, 4-DAPG). The sequenced
rDNA region of M. phaseolina (accession No.
MK329054.1) and R. solani (accession No.
MK329055.1) covered the partial sequence including
internal transcribed spacer-1, 5.8s, internal transcribed
spacer-2 in range of 500-600 bp. A BLAST search for
the similarity of M. phaseolina and R. solani identity
showed the percentage similarity ranged from 99 to
100%. The more or less similar results were described
by Babu et al. (2007), who sequenced ITS- 1, 5.8 S rRNA
gene and ITS-2 region of M. phaseolina and other related
fungal species revealed three regions that were
conserved among the isolates.
All the P. fluorescens isolates and native
T. asperellum significantly inhibited the mycelial
growth of M. phaseolina and R. solani. P. fluorescens
(Pf-5) and native T. asperellum showing maximum
inhibition against both pathogens were selected for
further studies against biotic stress under pot
conditions.
The results of the compatibility study of bioagents
with pesticides are in conformity with the earlier
findings of Sawant and Mukhopadhyay (1990), Desai
and Kulkarni (2004) and Sushir et al. (2008) where
they reported compatibility of T. harzianum with
metalaxyl, moderate compatibility of mancozeb with
Trichoderma spp. Gaur and Sharma (2010) and Sushir
27
et al. (2015) reported metalaxyl as safer fungicide and
compatible with T. harzianum and T. viride whereas
thiram and mancozeb were moderately compatible.
Similar results of compatibility with P. fluorescens are
in accordance with the findings of Mathew (2003),
Surendran et al. (2012) where they found the
compatibility of P. fluorescens with mancozeb at the
recommended doses, except fungicide namely
carbendazim where the growth of bioagent was
completely arrested.
Higher tolerance up to 6500 ppm could be
induced in T. asperellum and P. fluorescens against
metalaxyl. Hence, it could be deduced that there might
be the possible role of fungicides in the formation of
new fungal biotypes and opined that the fungicides
may cause gene mutation, chromosome breakage,
mitotic non-disjunction and mitotic recombination
according to Hastie (1981).
Results similar to the present investigation on
seed biopriming were reported by El-Mougy and
Abdel-Kader (2008) and Nayaka et al.(2008) who
evaluated the effect of biopriming of faba bean and
maize seeds against root rot pathogens (R. solani,
F. solani and S. rolfsii) where they noticed that
bioprimed seeds showed a highly significant effect
causing complete reduction of root rot incidence at
both pre and post-emergence stages of plant growth
compared with the control treatment and increased
seed germination, vigour index, field emergence, yield
and 1000 seed weight in comparison with the control.
Vidhyasekaran and Muthamilan (1995), Yadav et al.
(2013) and Monalisa et al. (2017) reported that
biopriming of seeds with Trichoderma spp. and
Pseudomonas spp. increased rhizosphere population
and competency within soils. Seed treatment with the
antagonist formulation also increases seed
Colonization of
T. asperellum on
chickpea roots
i
ii
Fig 7. Association of T. asperellum with chickpea root
surface (i) colonization and (ii) appresoria development
and mycelial growth
28 Journal of Food Legumes 34(1), 2021

Table 1. Peroxidase activity in chickpea root tissue due to biopriming with efficient and fungicides tolerant
T. asperellum and P. fluorescens against dry and wet root rot caused by M. Phaseolina and R. solani
Treatments No. Peroxidase activity (ΔOD/ min / g of fresh tissue
M. Phaseolina R. solani
10 DAS 20 DAS 30 DAS 40 DAS 10 DAS 20 DAS 30 DAS 40 DAS
T1 3.146 e 3.701 e 3.758 e 3.175 e 2.373 e 2.545 e 2.863 e 2.444 d
T2 2.596 f 2.691 f 2.714 f 2.518 f 1.516 f 1.791 f 1.980 f 1.690 e
T3 5.651 d 5.814 d 6.037 d 5.326 d 4.432 d 4.615 d 4.878 d 4.598 c
T4 7.342 b 7.964 b 7.965 b 7.555 b 8.309 b 8.768 b 8.852 b 7.758 b
T5 6.633 c 6.852 c 6.933 c 6.535 c 7.759 c 7.892 c 8.016 c 7.896 b
T6 8.793 a 9.342 a 9.381 a 9.046 a 9.254 a 9.508 a 9.848 a 9.037 a
T7 1.892 g 1.872 g 1.388 g 1.259 g 1.147 g 1.253 g 0.801 g 0.775 f
SEm. ± 0.056 0.081 0.058 0.047 0.075 0.057 0.059 0.046
F-Test Sig. Sig. Sig. Sig. Sig. Sig. Sig. Sig.
CV% 1.89 2.58 1.85 1.62 2.62 1.91 1.92 1.63
Treatment means with the letter/letters in common are not significant by DNMRT at 5% level of significance

Table 2. Polyphenol oxidase activity in chickpea root tissue due to biopriming with efficient and fungicides tolerant
T. asperellum and P. fluorescens against dry root rot caused by M. phaseolina
Polyphenol oxidase activity (ΔOD/ min / g of fresh tissue)
M. Phaseolina R. solani
Treatments No.
10 DAS 20 DAS 30 DAS 40 DAS 10 DAS 20 DAS 30 DAS 40 DAS
T1 0.603 e 0.626 e 0.740 e 0.673 d 1.086 f 1.555 e 1.612 d 1.527 d
T2 0.334 f 0.320 f 0.308 f 0.301 e 1.508 e 1.572 e 1.613 d 1.537 cd
T3 0.811 d 0.918 d 0.959 d 0.759 c 1.648 d 1.716 d 1.909 c 1.648 c
T4 1.667 b 1.756 b 1.953 b 1.841 a 2.109 b 2.213 b 2.417 b 2.326 a
T5 1.253 c 1.293 c 1.409 c 1.357 b 1.992 c 2.076 c 2.253 b 1.948 b
T6 1.974 a 1.997 a 2.281 a 1.873 a 2.236 a 2.449 a 2.664 a 2.408 a
T7 0.330 f 0.278 f 0.270 f 0.175 f 0.779 g 0.610 f 0.552 e 0.446 e
SEm. ± 0.014 0.014 0.015 0.016 0.019 0.016 0.028 0.035
f-Test Sig. Sig. Sig. Sig. Sig. Sig. Sig. Sig.
CV% 2.36 2.34 2.40 2.68 1.99 1.60 2.66 3.57
Treatment means with the letter/letters in common are not significant by DNMRT at 5% level of significance

germination and effectively controlled chickpea, rajma CONCLUSION

and common bean wilt disease and increased the yield.
The results of defense enzymes obtained were in
accordance with earlier studies by Thilagavathi et al.
(2007), who reported the greatest increase in
peroxidase activity by combinations of P. fluorescens
1+ T. viride 1 (80.6%); Pf1+Tv13 (77.6%) and Pf15+Tv1
as compared to lower increases by the individual
strains Pf1 (68.7%), Pf15 (67.2%), Bacillus subtilis 16
(68.9%), Tv1 (69.1%) and Tv13 (68.3%). Similarly, the
greatest activity of polyphenol oxidase occurred with
Pf1+Tv1, Pf1+Tv13 and Pf15+Tv1 as compared to
individual biocontrol strains which caused less
activity. Sreedevi et al. (2011) found T. harizanum
treatment along with challenge inoculation of the
M. phaseolina significantly increased the activity of
peroxidase and polyphenol oxidase by about 28.2 and
95.5 per cent, respectively in roots at 20 DAS compared
to untreated groundnut plants. Surekha et al. (2014)
demonstrated the role of T. viride as BCA in eliciting a
series of defense responses such as accumulation of
phenols, induction of (PO, PPO and PAL) enzymes
involved in the phenylpropanoid pathway, deposition
of lignin against Fusarium and Alternaria sp.
Stress tolerant Trichoderma sp. and Pseudomonas
sp. having good biocontrol potential due to their high
hydrolytic or antibiotic production may be able to
survive in extreme conditions of pathogen pressure
and can lead to the efficient management of biotic
stress. Novel bioformulation of chitin amended
T. asperellum and P. fluorescens in combination gave
best results in alleviating biotic stress in chickpea by
promoting growth parameters like germination, shoot
and root length, dry matter weight and reducing
disease incidence. There also occurred increase in
defense mechanism in plants by activation of PO and
PPO enzyme within plants.
Conflict of interest: The authors declare no conflict of interest.
REFERENCES
Abdulbaki A and Anderson J. 1973. Vigor determination
in soybean seed by multiple criteria. Crop Science 13:
630-633.
Altschul S, Madden T, Schaffer A, Zhang J, Zhang Z, Miller
W andLipman D. 1997. Gapped BLAST and PSI-BLAST.
A new generation of protein database search
programs. Nucleic Acid Research 25: 3389-3402.
 Jaisani and Gohel : Use of novel chitin amended formulation of Trichoderma asperellum
Anwar F, Sharmila, P and Saradhi P. 2009. No More Hurdle:
in vitro chickpea rooting and cent per cent
transplantation. Australian Journal of Basic and
Applied Science 3: 2491-2496.
Ashby S. 1927. Macrophomina phaseolina (Maub.) Comb. Nov:
The pycnidial stage of Rhizoctonia bataticola (Taub.)
Butler. Translational British Mycological Society 12:
141-147.
Babu B, Saxena A, Srivastava A andArora D.
2007.Identification and detection of M. phaseolina by
using species-specific oligonucleotide primers and
probe. Mycologia 99: 797-803.
Benhamou N, Kloepper J and Tuzun S. 1998.Induction of
resistance against Fusarium wilt of tomato by
combination of chitosan with an endophytic strain:
ultrastructure and cytochemistry of the host response.
Planta 204: 153-168.
Bharathi R, Vivekananthan R, Harish S, Ramanathan A
and Samiyappan R. 2004. Rhizobacteria-based bio-
formulations for the management of fruit rot infection
in chillies. Crop Protection 23: 835-843.
ChaverriP, Castlebury L, Overton B and Samuels G. 2003.
Hypocrea/Trichoderma: species with conidiophore
elongations and green conidia. Mycologia 95: 1100-1140.
Chet I, Inbar J and Hadar I. 1997. Fungal antagonists &
Mycoparasites. In: Wicklow DT, Soderstrom B, The
Mycota IV: Environmental and Microbial relationships.
Springerlink-Verlag, Berlin.
Dennis C and Webster J. 1971. Antagonistic properties of
species groups of Trichoderma II. Production of volatile
antibiotics. Translational British Mycological Society
57: 41-48.
Desai S and Kulkarni S. 2004. Effect of fungicides,
insecticides and weedicides on the growth and
sporulation of native Trichoderma harzianum Rifai.
Karnataka Journal of Agricultural Science 17: 57-62.
Dorrance A, Kleinhenz M, McClure S and Tuttle N. 2003.
Temperature, moisture and seed treatment effects on
Rhizoctonia solani root rot of soybean. Plant Disease. 87:
533-538.
Dubeikovsky A, Mordukhova E, Kochethovm V,
Polikarpova F and Boronin A. 1993. Growth promotion
of black current softwood cuttings by amount of indole-
3-acetic acid. Soil Biology and Biochemistry 25: 1277-1281.
El-Mougy N and Abdel-Kader M. 2008. Long term activity
of biopriming seed treatment for biological control of
faba bean root rot pathogens. Australian Plant
Pathology 37: 464-471.
Gaur R and Sharma R. 2010. Biocontrol of root rot in cotton
and compatibility of potential bioagents with
fungicides. Indian Journal of Plant Protection 38: 176-182.
Goidanich G. 1947. A revision of the genus Macrophomina
Petrak type species. Annalidella Sperimentazione
Agraria, Nuova Serie 1: 449–461.
Guilbault G.1976. Worthington’s Method. Handbook of
enzymatic methods of analysis. Marcel Dekker Inc.,
New York.
29
Harman G. 2000. Myths and dogmas of biocontrol.
Changes in perceptions derived from research on
Trichoderma harzianum T22. Plant Disease 84: 377–393
Hastie A.1981. The genetics of conidial fungi. In: Biology
of conidial fungi. Vol II., G. T. cole and B. Kendrick,
Academic Press, New York.
Horsfall J.1956. Principles of Fungicidal Action.Chronica
Botanica Co. Walthum, Mass.
Howell C, Hanson L, Stipanovic R and Puckhaber L. 2000.
Induction of terpenoid synthesis in cotton roots and control
of Rhizoctonia solani by seed treatment with Trichoderma
virens. Phytopathology 90: 248–252.
ISTA. 1993. Proceedings of the International Seed Testing
Association, International rules for seed testing. Seed
Science and Technology 21: 1–152.
Karthikeyan M, Jayakumar V, Radhika K, Bhaskaran R,
Velazhahan R and Alice D. 2005. Induction of resistance
in host against the infection of leaf blight pathogen
(Alternaria palandui) in onion (Allium cepa var.
aggregatum). Indian Journal of Biochemistry and Biophysics
42: 371-377.
Kaushik C, Chand J and Saryavir A. 1987.Seed borne nature
of Rhizoctonia bataticola causing leaf blight of mung
bean. Indian Journal of Mycology and Plant Pathology
17: 154-157.
Kim J, Parline M and Crowley D. 2013.Application of PCR
primers for detection of Pseudomonas spp. for antibiotic
genes in plant rhizosphere. Journal of Agricultural
Chemistry and Environment science 2: 8-15.
Lednev G, Kryukov V, Khodyrev V, Levchenko M,
Duisembekov B, Sagitov A andGlupov V. 2008.
Dynamics of mortality of the migratory locust under
synchronous infection with entomo-pathogenic fungi
(Beauveria bassiana, Metarhizium anisopliae) and bacteria
Pseudomonas sp. Contemporary Probl Ecology 1: 210-213.
Manjunatha S, Naik M, Patil M, Lokesha R andVasudevan
S. 2012. Isolation and characterization of native
fluorescent pseudomonads and antagonistic activity
against major plant pathogens. Karnataka Journal of
Agricultural Science 25: 346-349.
Mathew A.2003. Pseudomonas fluorescens–Antagonism,
compatibility with pesticides and alternate media for
mass multiplication. Proceedings of the 6th
International PGPR Workshop, Indian Institute of
Spices Research, Calicut, India.
Monalisa S, Beura J, Tarai R and Naik M. 2017. Seed quality
enhancement through biopriming in common bean
(Phaseolus vulgaris. L). Journal of Applied and Natural
Science 9: 1740–1743.
Muthamilan M and Jeyarajan R. 1996. Integrated
management of sclerotium root rot of groundnut
involving T. harzianum, Rhizobium and carbendazim.
Journal of Mycology and Plant Pathology 26: 204-209.
Nagamani A, Mahoharachary C and Agrawal D. 2002.
Monographic contribution on Trichoderma pers. ex Fr.,
Today and Tomorrow publications, New Delhi.
30 Journal of Food Legumes 34(1), 2021
Nayaka S, Niranjana S, Uday Shankar A, Niranjan Raj S,
Reddy M, Prakash H and Mortensen C. 2008. Seed
biopriming with novel strain of Trichoderma harzianum
for the control of toxigenic Fusarium verticillioides and
fumonisins in maize. Archives of Phytopathology and
Plant Protection 1: 1-19.
Nene Y, Reddy M, Haware M, Ghanekar A, Amin K, Pande
S and Sharma M. 2012. Field Diagnosis of Chickpea
Diseases and their Control. Information Bulletin No.
28 (revised), Patancheru, A.P., India: Int. Crops Res.
Institute for the Semi-Arid Tropics.
Nubel U, Engelen B, Felske A, Snaidr J, Wieshuber A,
Amann R, Ludwig W and Backhaus H. 1996. Sequence
heterogeneities of genes encoding 16s rRNAs in
Paenibacillus polymyxa detected by temperature gradient
gel electrophoresis. Journal of Bacteriology 178: 5636-5643.
Pandey H, ShuklaK andTewari G. 1989. Effect of moisture
stress, plant population density and pathogen
inoculation on charcoal stalk rot of sorghum. Annals
Applied Biology 116: 221-232.
Prillieux E and Delacroix M. 1891. Endoconidium temulentum
nov.gen. Bulletin de la Societe Mycologique de France
7: 116-117.
Radjacommare R, Nandakumar R, Kandan A, Suresh S,
Bharathi M, Raguchander T and Samiyappan R. 2002.
Pseudomonas-fluorescens based bioformulation for the
management of sheath blight and leaf folder in rice.
Crop Protection 21: 671-677.
Raguchander T, Rajappan K and Samiyappan R. 1993.
Influence of biocontrol agents and organic
amendments on soybean root rot. International Journal
of TropicalAgriculture 16: 247-252.
Raupach G and Kloepper J. 1998. Mixtures of plant growth-
promoting rhizobacteria enhance biological control
of multiple cucumber pathogens. Phytopathology 88:
1158-1164.
Rettinassababady C and Ramadoss N. 2000.Effect of
different substrates on the growth and sporulation of
Trichoderma viride native isolates. Agriculture Science
Digest 20: 150-152.
Sandhu A and Singh R. 1998.Role of seed-borne inoculum
in development of charcoal rot of cowpea. Journal of
Mycology and Plant Pathology 28: 193-195.
Saravanakumar D, Muthumeena K, Lavanya N, Suresh S,
Rajendran L, Raguchander T andSamiyappan R. 2007.
Pseudomonas induced defense molecules in rice against
leaf folder (Cnaphalocrocis medinalis) pest. Pest
Management Science 63: 714-721.
Saravanan A. 2007. Endophytic Beauveriab assiana (Bals.)
Vuill. mediated induced systemic resistance (ISR) for
the management of major pest and diseases of pigeon
pea and chickpea. (M.Sc. Thesis, Tamil Nadu
Agricultural University, Coimbatore, India).
Sawant I and Mukhopadhyay A. 1990. Integration of
metalaxyl with Trichoderma harzianum for the control
of Pythium damping-off in sugarbeet.Indian
Phytopathology 43: 535-541.
Sreedevi B, Charitha Devi M andSaigopal D. 2011.Induction
of defense enzymes in Trichoderma harzianum treated
groundnut plants against Macrophomina phaseolina.
Journal of Biological Control 25: 33–39.
Steel R and Torrie J. 1980.Principles and Procedures of
Statistics. McGraw Hill Book Co., New Delhi.
Surekha C, Neelapu N, Siva Prasad B and Sankar Ganesh
P. 2014. Induction of defense enzymes and phenolic
content by Trichoderma viride in Vigna mungo infested
with Fusarium oxysporum and Alternaria alternata.
International Journal of Agriculture Science and
Research 4: 31-40.
Surendran M, Kannan G, Nayar K andLeenakumary S.
2012. Compatibility of Pseudomonas fluorescens with
agricultural chemicals. Journal of Biological Control
26: 190-193.
Sushir M, Gaikwad R, Aghav S and Bhadane R.
2008.Induction of higher tolerance in Trichoderma
harzianum against pesticides. Asian Journal of
Bioscience 3: 137-139.
Sushir M, Suryawanshi K andPatole S. 2015.Sensitivity of
Trichoderma harzianum Rifai against systemic fungicides.
International Journal of Applied Research 1: 403-405.
Thilagavathi R, Saravanakumar D, Ragupathi N and
Samiyappan R. 2007. A combination of biocontrol
agents improves the management of dry root rot
(Macrophomina phaseolina) in green gram. Phyto-
pathology Mediterrean 46: 157-167.
Thrane C, Tronsmo A and Jensen D. 1997.Endo-1,3--
glucanase and cellulase from Trichoderma harzianum:
purification and partial characterization, induction of
and biological activity against plant pathogenic
Pythium spp. European JournalofPlant Pathology 103:
331–344.
Vidhyasekaran P and Muthamilan M. 1995. Development
of formulations of Pseudomonas fluorescens for control
of chickpea wilt. Plant Disease 79: 782-786.
Vincent J. 1947. Distortion of fungal hyphae in the presence
of certain inhibitors. Nature 159: 850.
Yadav S, Dave A, Sarkar A, Singh H andSarma B. 2013.
Co-inoculated biopriming with Trichoderma,
Pseudomonas and Rhizobium improves crop growth in
Cicer arietinum and Phaseolus vulgaris. International
Journal of Agriculture Environment and Biology 6:
255-259.
Yedidia I, Benhamou N and Chet I. 1999.Induction of
defense responses in cucumber plants (Cucumis sativus
L.) by the biocontrol agent Trichoderma harzianum.
Applied Environmental Microbiology 65: 1061–1070.
 Journal of Food Legumes 34(1): 31-37, 2021

Effect of PSB, FYM with variable levels of P on the yield attributes and
productivity of black gram in Shiwalik hills of
Himachal Pradesh
ASHISH SHARMA1, PAWAN PATHANIA1 and MUNISH SHARMA2*

1
Department of Agronomy,
Forages and Grassland Management,
and 2Department of Soil Science,
Chaudhary Sarwan Kumar Himachal
Pradesh Krishi Vishvavidyalaya,
Palampur-176062, HP, India
*Email: munishsharma0255@gmail.com
Received: January 25, 2021
Accepted: June 8, 2021
Handling Editor: Dr. SS Rathore,
ICAR-IARI, New Delhi
ABSTRACT
Pulses play an important role in sustainable food production aiming towards
food security and nutrition. Phosphorus is a key element involved in various
functions for growth and metabolism of pulses. Therefore, a field experiment
was carried out during Kharif 2016 to evaluate the effect of seed inoculation
and phosphorus levels on yield and quality of blackgram at the Research Farm
of Research Sub Station (Berthin), Bilaspur (H.P). Experimental site was sandy
clay loam in texture, slightly alkaline in reaction and medium in available
nitrogen, phosphorus and potassium. The experiment was laid out in a Factorial
Randomized Block Design (FRBD) with three replications and total sixteen
treatment combinations consisting of two levels of Phosphorus Solubilising
Bacteria (PSB) viz., no inoculation and with inoculation and four levels of
phosphorus viz., control, 20, 30 and 40 kg P2O5/ha and two levels of FYM viz.,
control and 10 t/ha. The experiment revealed significantly higher yield attributes
and productivity as obtained by application of Phosphorus Solubilising Bacteria
(PSB) + Phosphorus (40 kg/ha) + FYM (10t/ha) as compared to other treatments.

Key words: Black gram; Phosphorus; PSB inoculation; Yield attributes,

Productivity

INTRODUCTION crops in India is practically impossible. The only

Pulses occupy a unique position in the Indian
diet because of the constituting cheapest source of
vegetable protein for the vegetarian population of India
(Anonymous 2015). Legumes possess high nutritive
value and a balanced ratio of proteins (13-15%) and
carbohydrates (4-23%), which suggests that they are a
potential protein base food for the vegetarian
population all over the world. Moreover, the highly
nutritive proteins in legumes are considered as ‘poor
people’s meat (Iriti and Varoni 2017). Pulse cultivation
does not require intensive irrigation and can be carried
out in rain-deprived areas. From an environmental
perspective, pulses can fix atmospheric nitrogen and
improve soil fertility, which in turn reduces the
dependence of farmers on expensive fertilizers
(Venkidasamy et al. 2019).
Due to low and unstable production and
increasing population pressure, per capita availability
of pulses is 37g, against the minimum requirement of
52 g per capita per day of ICMR recommendation. In
order to ensure self-sufficiency, the pulse requirement
in the country is projected at 39 million tonnes by the
year 2050 (Anonymous 2015). To satisfy the demand
of pulses requirement of ever increasing population,
the production of pulses has to be increased either by
increasing the area or yield/unit area/day. Since the
cultivated area is limited, increase in area under pulse
alternative remain is to push up the yield/ha per unit
time. The early maturing cultivar may be grown on the
lands which remain vacant between two main crop
seasons, without dislocating the area under high
yielding cereals and without depleting the soil
nitrogen. Therefore, instead of keeping the land fallow,
it should be utilized for raising blackgram during
summer season.
Blackgram is third important pulse crops of
India, among all the pulses, Blackgram (Vigna mungo
L. Hepper) is a highly prized pulse for its biological
protein value and rich in phosphoric acid. It contains
about 24% protein, 60% carbohydrate, 1.3% fat, 0.194%
Ca, 0.192% Mg, 0.44% P, 0.526% K, 0.09% Fe, 0.0241
mg of vitamin, 0.43% lysine, 0.07% triptophane and
0.09% methionine, which are having good amino acid
balance. In Himachal Pradesh Black gram is grown in
Shivalik hill zone and Mid hill zones in an area of
about 1.7 million hectares with a total production of
1.20 million tonnes with an average productivity of
480 kg/hectares (Dwivedi et al. 2015). It is main legume
consumed in Himachal Pradesh as whole legume,
dehusked and splitted pulse (Modgil et al. 2019).
Phosphorus is a major nutrient element in legume
nutrition, as it is involved in several energy
transformation and biochemical reactions including
biological nitrogen fixation. Phosphorus is a structural
32 Journal of Food Legumes 34(1), 2021

part of the membrane system of the cell, the chloroplast
and mitochondria. Phosphorus is second most critical
plant nutrient but for pulses, it assumes primary
importance, owing to its important role in root
proliferation and thereby atmospheric nitrogen
fixation. Majority of phosphorous gets fixed in the soil
due to various factors. The yield and nutritional
quality of pulses is greatly influenced by application
of phosphorus. It plays a key role in various
physiological processes like root growth and dry
matter production, nodulation and nitrogen fixation
and also in metabolic activities especially in protein
synthesis. It also helps in establishing seedling quickly
and also hastens maturity as well as improves the
quality of crop produce (Sharma and Pathania 2019).
MATERIAL AND METHODS
The experimental site was located at 31041' N
latitude, 760 62' E longitude and situated at an
elevation of 661 meters above mean sea level. The site
falls in the sub-mountain and low hill zone of
Himachal Pradesh. Agro-climatically Berthin falls
under the sub-tropical warm sub humid zone of
Himachal Pradesh. The weather data during the
period of experimentation recorded at meteorological
observatory of Research Farm of Research Sub Station,
Berthin. The data reveals that weekly maximum and
minimum temperature ranged from 32.2 to 35.2 oC and
8.9 to 24.1oC, respectively during the growing season.
The total rainfall during the cropping season was
573.3 mm.
Before the commencement of the experiment,
composite soil sample from 0-15 cm depth was
collected from the experimental field before the sowing
of the crop. The soil sample was then air dried, ground,
passed through 2 mm sieve and analyzed for various
soil properties as per standard methods. The results
of analysis have been presented in Table 1.
Sixteen treatment combinations [two levels of
phosphorus solubilizing bacteria (no inoculation and
with inoculation), four levels of phosphorus (0, 20, 30
and 40 kg/ha) andtwo levels of farm yard manure
(0 and 10 t/ha)] were tested in Factorial Randomized
Block Design (FRBD) with three replications.
Healthy seeds of black gram were inoculated as
per the treatment with phosphorus solubilizing
bacteria (Bacillus polymyxa) before two hours of sowing.
A liquid solution of phosphorus solubilizing bacteria
was mixed in 10 per cent jaggery solution. The seeds
of black gram were mixed with this solution and dried
on a clean cloth in shade for about two hours. The
sowing was done in the afternoon.
Full dose of fertilizers was applied as per the
treatment manually in previously open furrows before
sowing the seeds. The nitrogen and potassium were
supplied through urea and MOP, respectively. FYM
was applied as per treatment at the time of seed bed
preparation.

Table 1. Initial soil properties of experimental soil (0-15 cm)

Soil properties
pH
Organic carbon (g/kg)
Available Nitrogen (kg/ha)
Available Phosphorus (kg/ha)
Available Potassium (kg/ha)
Content in soil Analytical method employed
7.5 1:2.5 soil water suspension (Jackson 1967)
9 Rapid titration method (Walkely and Black 1934)
512.3 Alkaline permanganate method (Subbiah and Asija 1956)
24.9 Olsen’s method (Olsen et al. 1954)
216 Ammonium acetate extraction method (AOAC 1970)

Table 2. Effect of PSB, FYM with variable levels of P on primary branches per plant, pods per plant, grains per pod and
1000-grain weight
Treatment Primary branches/plant Pods/plant Grains/pod 1000-grain weight
FYM (t/ha)
0 4.2 18.1 7.2 34.1
10 4.5 19.8 7.8 35.8
LSD (P=0.05) 0.2 1.2 0.4 NS
PSB inoculation
No inoculation 4.2 18.3 7.3 33.7
Inoculation 4.5 19.5 7.7 36.1
LSD (P=0.05) 0.2 1.2 NS 1.7
Phosphorus(kg/ha)
0 4.1 17.5 6.8 33.6
20 4.3 18.5 7.4 35.2
30 4.3 19.6 7.9 34.8
40 4.7 20.0 7.9 36.1
LSD (P=0.05) 0.3 1.6 0.5 NS
 Sharma et al.: Effect of PSB, FYM with variable levels of P on the yield attributes and productivity
RESULTS AND DISCUSSION
Effect of PSB, FYM with variable levels of P on yield
attributes
Primary branches/plant
The data in Table 2 indicated that significant
variation in number of branches per plant was found
with the application of farm yard manure. The number
of branches per plant was observed significantly
higher under FYM applied @ 10t/ha. The number of
primary branches per plant in FYM applied treatments
were 4.5 as compared to control (4.2) which were 7.14
per cent higher. Similar findings were also reported
by Vikrant et al. (2005) and J at et al. (2012).
Significantly the highest number of branches (4.5)
per plant was recorded due to the application of PSB
inoculation over control (4.2). The significant increase
in number of primary branches per plant with PSB
application might be due to the fact the PSB solubilize
organic phosphorus to available forms which resulted
in increasing availability of P for vital functions of
black gram plants. Application of phosphorus 40kg
P2O5/ha registered significantly highest number of
branches per plant (4.7) at harvest as compared to other
phosphorus levels. Number of primary branches were
found statistically similar in 20kg P2O5/ha (4.3) and
30 kg P2O5/ha (4.3) treatments and control [0 kg
application of phosphorus (4.1)]. The cell division and
development due to increasing levels of phosphorus
probably resulted in more meiotic activities, thus the
development of more apical bud primordial took place
which produced more number of branches (Yadav and
Shrivastava 1997). Further due to adequate supply of
phosphorus which plays important role in conversion
of solar energy into chemical energy and it has also
beneficial effect on root proliferation that increases the
absorption of plant nutrients and moisture from soil.
These findings are substantiated with those reported
by Thakur and Negi (1985), Shah et al. (1994), Singh
Table 3. Effect of PSB, FYM with variable levels of P on productivity and crude protein content
Treatment Seed yield (kg/ha)
FYM (t/ha)
0 730.0
10 915.7
LSD (P=0.05) 7.5
PSB inoculation
No inoculation 786.6
Inoculation 859.0
LSD (P=0.05) 7.5
Phosphorus (kg/ha)
0 774.1
20 805.8
30 848.8
40 862.7
LSD (P=0.05) 10.6
33
and Singh (2000), Vikrant et al. (2005), Kumar et al.
(2006), Singh et al. (2006), Mahetele and Kushwaha
(2011), Nawange et al. (2011)and Tomar et al. (2013).
Number of Pods/plant
Data pertaining to number of pods per plant given
in Table 2 revealed that application of farm yard
manure remarkably influenced the number of pods
per plant and numerically higher value of number of
pods per plant was found with the FYM applied @ 10
t/ha (19.8) as compared to control (18.1).Data further
indicated that application of PSB also significantly
influenced the number of pods per plant. Significantly
the highest number of pods per plant with the
application of PSB (19.5) was recorded as compare to
control (18.3).
A perusal of data presented in Table 2 revealed
that the number of pods per plant was significantly
influenced by the phosphorus application. The number
of pods per plant was recorded significantly higher
with 40 kg P2O5/ha (20.0), but it was at par with 30 kg
P2O5/ha (19.6) and 20 kg P2O5/ha (18.5). However, 0
P2O5/ha (control) produced significantly lower
number of pods per plant (17.5) as compared to other
treatments except 20 kg P2O5/ha. In general, overall
improvement in yield attributing character may be
because of phosphorus increased the photosynthesis
activity of plant and helps to develop a more extensive
root system and thus enables the plant to extract more
water and nutrients from soil depth, resulting in better
development of plant growth and yield attributes.
Positive responses in terms of yield attributes due to
application of phosphorus have also been reported by
Thakur and Negi (1985), Sarkar (1992), Vikrant et al.
(2005), Gupta et al. (2006), Kumar et al. (2006), Sharma
and Rana (2006), Singh et al. (2006), Parmar and
Thanki (2007), Thenua and Kumar (2007), Patil et al.
(2011), Bairwa et al. (2012) and Kumawat et al. (2013).
Straw yield (kg/ha) Crude protein (%)
1493.8 20.8
1572.5 22.0
70.9 0.8
1483.3 20.9
1582.9 21.8
70.9 0.8
1367.5 20.7
1506.7 21.0
1614.2 21.6
1644.2 22.3
100.3 1.2
34 Journal of Food Legumes 34(1), 2021
Number of grains/pod
Data pertaining to number of grains per pod as
influenced by various levels of Farm Yard Manure,
PSB and phosphorus application are given in Table 2.
Application of FYM did exert their significant
influence on number of grains per pod. Significantly
the highest number of grains per pod was observed
under the application of 10t/ha over control. Mahetele
and Kushwaha (2011) have reported that similar
results with FYM on number of grains per pod.
The data further indicated that application of
PSB significantly not influenced the number of grains
per pod as compare to control given in Table 2. Increase
in number of grains due to inoculation of phosphate
solubilizing micro-organisms was because of more
phosphorus availability which led to efficient
translocation of phosphates and desired metabolites
to reproductive parts resulting in retention of more
number of flowers. Similar observations were recorded
by Gupta et al. (2006).
The data in Table 2 clearly indicated that the effect
of phosphorus application on number of seeds per
pod was significant. The treatment 40 kg P2O5/ha
recorded significantly higher number of grains per pod
(7.9) over control (6.8), but it was statistically at par
with the treatments 30 kg P2O5/ha (7.9) and 20 kg
P2O5/ha (7.4). This may perhaps be due to the reason
that phosphorus helped in proliferation of root system
and thus resulted in increasing the nutrient absorption
by the increasing the absorption surface. Thus, the
higher absorption of nutrients may have favourably
influenced the yield attributes (Trivedi 1996).
Availability of water soluble phosphorus from applied
single super phosphate causing vigorous growth,
initiating more number of lower buds in the plants
thereby increasing pods per plant and grains per pod
was reported by Reddy and Swamy (2000).
Test weight (1000-grain weight)
Data given in Table 2 revealed that application
of farm yard manure showed non-significant variation
on test weight of black gram seed. Similar types of results
were also reported by Mahetele and Kushwaha (2011).
But the application of PSB have success test
weight data in Table 2 clearly indicates that there is
significant effect of PSB on 1000-grain weight over
control. This may be due to better availability of
phosphorus to the plants, which resulted in more 1000-
grain weight. Tomar et al. (1993) and Tomar (1998)
have reported similar results with seed inoculation
on 1000 grain weight.
The test weight of blackgram seed was not
significantly affected by any level of phosphorus.
However, numerically higher value of test weight was
recorded with 40 kg P2O5/ha.
Effect of PSB, FYM with variable levels of P on
productivity and crude protein content
Grain yield (kg/ha)
The difference in seed yield of blackgram due to
different level of FYM was found to be significant.
Application of FYM @ 10 t/ha recorded significantly
the highest seed yield than control. Application of
FYM resulted 915.7 kg/ha grain yield as compared to
no application (730.0 kg/ha). The increase in grain
yield of blackgram with FYM application may be
attributed to better root development, more nutrient
availability, resulting in vigorous plant growth and
dry matter production which resulted in higher yield.
(Gaind and Gaur 1991). The increase in uptake of
nutrients by seed of blackgram at harvest might be
attributed to the increase in concentration of nutrient
and yield. The above findings are in complete
agreement with Kumar and Puri (2002), Reddy et al.
(2004), Vikrant et al. (2005), Ghanshyam et al. (2010),
Sharma and Abraham (2010), Shete et al. (2011), Jat
et al. (2012) and Tomar et al. (2013).
PSB results furnished in Table 3 indicated that
PSB inoculation level significantly increased seed yield
(9.20%) over control.The yield with PSB application
was 859.0 kg/ha whereas, in control plots the yield
was 786.6 kg/ha. Increase in grain yield due to PSB
application was 9.20 per cent over control. Phosphorus
solubilizing bacteria increased the availability of
phosphorus to plants through solubilization effect and
translocation of nutrients through mycelium
(Chhonkar 2001). Also PSB is known to produce
vitamins and Indole Acetic Acid (IAA) and gibberellins
like substances. These growth factors in combination
with better nutritional condition due to increased
availability of P in soil might have played an important
role in increasing the grain yield. Ahmad and Jha
(1982), Pramanik and Singh (2003), Paratey and Wani
(2005) reported an increase in yield of soybean due to
inoculation with PSB. Positive response of PSB in
increasing the yield of blackgram was also reported
by Tomar et al. (1993).
The effect of phosphorus levels on seed yield was
found to be significant. Significantly higher seed yield
was observed @ 40 kg P2O5/ha. There was a consistent
increase in grain yield with increase in P level from 0
to 40 kg P2O5/ ha. 40 kg P2O5/ha level was at par with
30kg P2O5/ha level but it was significantly superior
over 0 kg P2O5/ha and 20 kg P2O5/ha levels. There
was an increase of 88.6 kg and 56.9 kg grains in 40 kg
P2O5/ha level over control and 20 kg P2O5/ha level.
The increase in grain yield was to the extent of 11.45%.
 Sharma et al.: Effect of PSB, FYM with variable levels of P on the yield attributes and productivity
The improvement in yield with increased supply of P
might be due to profuse nodulation leading to increase
nitrogen fixation which in turn had positive effect on
photosynthetic organ resulted in higher grain yield
under the present study, number of pods per plant
and grains per pod increased with the increase in the
rates of phosphorus upto 40 kg P2O5/ha that might be
dependent upon these yield attributing characters.
These results are in conformity with the finding of Shah
et al. (1994), Mourya (2000), Tanwar et al. (2003), Patel
et al. (2004), Vikrant et al. (2005), Gupta et al. (2006),
Singh et al. (2006), Parmar and Thanki (2007), Thenua
and Kumar (2007), Kanojia and Sharma (2008), Verma
and Singh (2008), Ghanshyam et al. (2010), Mahetele
and Kushwaha (2011), Nawange et al. (2011), Patil
et al. (2011), Bairwa et al. (2012), Kumawat et al. (2013)
and Tomar et al. (2013).
Straw yield (kg/ha)
The data presented in Table 3 clearly indicates
that straw yield of blackgram was remarkably
influenced by farm yard manure. Significantly the
highest straw yield was recorded with the application
of FYM @ 10 t/ha recorded over control.The increase
in straw yield was to the extent of 5.27 per cent with
FYM application over control. The control plot was
considered inferior in this regard. Improvement in soil
physicochemical properties through incorporation of
FYM resulted in increasing the availability and uptake
of nutrients. Similar results were also reported by
Kumar and Puri (2002), Sharma and Abraham (2010),
Shete et al. (2011).
The straw yield was markedly influenced due to
PSB inoculation and was produced significantly
higher straw yield as compared to control. There was
an increase of 99.6 kg straw yield due to application of
PSB over control and it was to the extent of 6.71 per
cent.
The data in Table 3 clearly indicated that the effect
of phosphorus application on straw yield was found
significant. Significantly higher straw yield was
observed with the application of 40 kg P2O5/ha (1644.2
kg) but this treatment was statistically at par with @
30 kg P2O5/ha (1614.2 kg) over other treatments. The
per cent increase in the straw yield of black gram was
20.23 per cent with 40 kg P2O5/ha over control (0 kg
P2O5/ha).
Crude protein content (%) in seed
The mean data on crude protein content in seed
as influenced by Farm Yard Manure, PSB and
phosphorus levels are presented in Table 3. The
variation in protein content of blackgram due to farm
yard manure was found significant. Application of
35
farm yard manure @ 10 t/ha (22.0%) was recorded
significantly the highest protein content than control
(20.8%). The probable reason of increase in protein
content in seed because of favourable effect of FYM on
microbial activity which resulted in higher supply of
N throughout the crop growth period resulted in
higher protein.These results are in agreement with
those of Raju et al. (1991), Vikrant et al. (2005), Shete
et al. (2010), Chesti et al. (2012), Jat et al. (2012). The
results furnished in Table 3 indicated that the crude
protein content was significantly higher with PSB
inoculation (21.8%) as compared to no inoculation
(20.9%).
The effect of phosphorus on protein content was
found to be significant. However, maximum crude
protein content of black gram seed was obtained with
the application of phosphorus @ 40 kg P 2O5/ha
(22.3%). Increase in protein content with phosphorus
application might be attributed to balanced nutrition
and increased availability of nutrients. Similar type of
results was also found by Vikrant et al. (2005) and
Meena et al. (2006).
CONCLUSION
Blackgram (Vigna mungo L.) a leguminous crop,
is the one of the most important and extensively grown
crop. It builds up the soil fertility by fixing large
amounts of atmospheric nitrogen through the root
nodules and also by leaf fall on the ground at maturity.
Through, the fertilizers have played a prominent role
in increasing the productivity of crops in the country.
But continuous and imbalanced use of fertilizers
caused deterioration of soil health. The advantage of
combining organic and inorganic sources of nutrients
in integrated nutrient management has been superior
to the use of each component separately.
REFERENCES
Anonymous. 2015. Vision 2050, ICAR-Indian Institute of
Pulses Research, Kanpur.
Bairwa RK, Nepalia V, Balai CM, Chauhan GS and Ram B.
2012. Effect of phosphorus and sulphur on growth and
yield of summer mungbean. Journal of Food Legumes
25: 211-214
Chesti MH, Tahir Ali and Bhat MA. 2012. Effect of organic
and inorganic phosphorus sources on quality of
greengram (Vigna radiata) under temperate condition
of Jammu and Kashmir. Legume Research 35: 47-49
Dwivedi AP, Mishra A, Singh SK and Singh M. 2015.
Analysis of yield gaps in black gram (Vigna mungo) in
district Bilaspur of Himachal Pradesh. Himachal
Journal of Agricultural Research 41: 49-54.
Gaind S and Gaur AC. 1991. Thermotolerant phosphate
solubilizing micro-organisms and their interaction
with mungbean. Plant and Soil 133: 141-149
36 Journal of Food Legumes 34(1), 2021
Ghanshyam, Kumar R and Jat RK. 2010. Productivity and
soil fertility as affected by organic manures and
inorganic fertilizers in greengram (Vigna radiata L.) -
wheat (Triticum aestivum L.) system. Indian Journal of
Agronomy 55: 16-21
Gupta A, Sharma V, Sharma GD and Chopra C. 2006.Effect
of biofertilizer and phosphorus levels on yield
attributes, yield and quality of urdbean (Vigna mungo
L.). Indian Journal of Agronomy 51: 142-144
Iriti M and Varoni EM. 2017. Pulses, healthy, and
sustainable food sources for feeding the planet.
International Journal of Molecular Sciences 18: 255
Jat A, Arvadia MK, Tandel B, Patel TU and Mehta RS. 2012.
Response of saline water irrigated greengram to land
configuration, fertilizers and farm yard manure in Tapi
command area of South Gujarat. Indian Journal of
Agronomy 57: 270-274
Kanojia Y and Sharma DD. 2008.Effect of phosphorus
nutrition and agrochemicals on the productivity of
soybean. Legume Research 31: 51-53
Kumar P and Puri UK. 2002. Response of frenchbean
varieties to phosphorus and farm yard manure
application. Indian Journal of Agronomy 47: 86-88
Kumar S, Reager ML and Pareek BL. 2006. Yield
components of mothbean (Vigna aconitifolia) influenced
by phosphorus and biofertilizers. Annals of
Agricultural Research 27: 227-229
Kumawat P, Tiwari RC, Golada S, Godara AS, Garhwal R
and Choudhary R. 2013. Effect of phosphorus sources,
levels and biofertilizers on yield attributes, yield and
economics of blackgram. Legume Research 36: 70-73
Mahetele D, Kushwaha HS. 2011. Productivity and
profitability of pigeonpea as influenced by farm yard
manure, phosphorus solubilizing bacteria and
phosphorus fertilization under rainfed condition.
Journal of Food Legumes 24: 72-74
Meena LR, Singh RK and Gautam RC. 2006. Effect of
moisture conservation practices, phosphorus levels
and bacterial inoculation on growth, yield and
economics of chickpea. Legume Research 29: 68-72
Modgil R, Kaundal S and Sandal A. 2019.Bio-Chemical
and Functional Characteristics of Black Gram (Vigna
mungo) Cultivars Grown in Himachal Pradesh, India.
International Journal of Current Microbiology and
Applied Sciences 8: 2126-2137.
Mourya BM. 2000. Growth and yield of pigeonpea as
influenced by association of soybean and phosphorus
application. GAU Research Journal 25: 15-19
Nawange DD, Yadav AS and Singh RV. 2011. Effect of
phosphorus and sulphur application on growth, yield
attributes and yield of chickpea. Legume Research 34:
48-50
Parmar PP and Thanki JD. 2007. Effect of irrigation,
phosphorus and biofertilizers on growth and yield of
rabi greengram (Vigna radiata L.) under South Gujarat
condition. Crop Research 34: 100-102
Patel RM, Patel AG and Tikka SB. 2004.Response of
summer mungbean to date of sowing and levels of
fertilizers. GAU Research Journal 29: 42-44
Patil SC, Jagtap DN and Bhale VM. 2011. Effect of
phosphorus and sulphur on growth and yield of
moongbean. International Journal of Agricultural
Sciences 7: 348-351
Raju MS, Verma SC and Ramaiah NV. 1991. Effect of
phosphorus in relation to FYM vs Rhizobium
inoculation on nutrient uptake by chickpea cultivars
under rainfed condition. Indian Journal of Agricultural
Research 25: 43-48
Reddy BP and Swamy SN. 2000. Effect of farmyard manure,
phosphate solubilizing bacteria and phosphorus on
yield and economic of blackgram (Phaseolus mungo).
Indian Journal of Agricultural Sciences 70: 694-696
Reddy GS, Maruthi V and Rekha MS. 2004. Assessing the
method application of farmyard manure on dryland
crops. Indian Journal of Agronomy 49: 104-107
Sarkar RK. 1992. Response of summer greengram to
irrigation and phosphorus application. Indian Journal
of Agronomy 37: 123-125
Shah SK, Sharma GL and Vyas AK. 1994. Growth
parameters, biomass production and nutrient uptake
by blackgram as influenced by phosphorus,
potassium and plant-growth regulators. Indian Journal
of Agronomy 39: 481-483
Sharma A and Pathania P 2019.Effect of FYM, PSB
Inoculation and Phosphorus Levels on Growth and
Developmental Stages of Blackgram. International
Journal of Current Microbiology and Applied Sciences
8: 2450-2457.
Sharma RP and Rana SS. 2006.Response of rajmash
varieties to phosphorus in cold arid region of
Himachal Pradesh. Indian Journal of Pulses Research
19: 231-233
Sharma V and Abraham T. 2010. Response of blackgram
to nitrogen, zinc and farm yard manure. Legume
Research 33: 295-298
Shete PG, Thanki JD, Baviskar VS and Bhoye KP. 2011.
Yield, nutrient uptake and economics of greengram as
influenced by land configuration, inorganic fertilizers
and FYM levels. Green Farming 2: 425-427
Singh AK and Singh SS. 2000. Effect of planting dates,
nitrogen and phosphorus levels on yield contributing
factors in frenchbean. Legume Research 23: 33-36
Singh B, Singh CP and Parihar SS. 2006.Growth and yield
enhancement of mungbean by sources and levels of
phosphorus and phosphate solubilizing microbes.
Annals of Agricultural Research 27: 210-212
Tanwar SPS, Sharma GL and Chahar MS. 2003. Effect of
phosphorus and biofertilizers on yield, nutrient
content and uptake by blackgram. Legume Research
26: 39-41
Thakur RC and Negi SC. 1985. Effect of fertilizers and
Rhizobium inoculation in blackgram. Indian Journal of
Agronomy 30: 501-504
 Sharma et al.: Effect of PSB, FYM with variable levels of P on the yield attributes and productivity
Thenua OVS and Kumar P. 2007. Effect of intercropping,
phosphorus levels and bio-fertilizers on the
performance of blackgram. Annals of Agricultural
Research (New Series) 28: 213-218
Tomar SS, Pathan MA, Gupta KP and Khandkar UR. 1993.
Effect of phosphate solubilizing bacteria at different
levels of phosphate on blackgram (Phaseolus mungo).
Indian Journal of Agronomy 38: 131-133
Tomar TS, Kumar S and Tomar S. 2013.Effects of plant
density, nitrogen and phosphorus on blackgram (Vigna
mungo L. Hepper). Annals of Agricultural Research
(New Series) 34: 374-379
Trivedi SK. 1996. Response of blackgram (Phaseolus mungo
L.) to nitrogen, phosphorus and sulphur. Legume
Research 19: 7-9
37
Venkidasamy B, Selvaraj D, Nile AS, Ramalingam SK, Kai
G and Nile SH. 2019. Indian pulses: a review on
nutritional, functional and biochemical properties with
future perspectives. Trends in Food Science &
Technology 88: 228-242
Verma LK and Singh RP. 2008. Effect of phosphorus on
nitrogen fixing potential of Rhizobium and their
response on yield of mungbean. An Asian Journal of
Soil Science 3: 310-312
Vikrant Singh H, Malik CVS and Singh BP. 2005. Grain
yield and protein content of cowpea as influenced by
farm yard manure and phosphorus application. Indian
Journal of Pulses Research 18: 250-251
Yadav RP and Shrivastava UK. 1997. Response of chickpea
(Cicer arietinum) to phosphorus and biofertilizers.
Legume Research 20: 137-140
 Journal of Food Legumes 34(1): 38-43, 2021

Profitability of legume-maize cropping systems under

legume residue management practices
MONIKA SHUKLA1*, AC SADHU2, KD MEVADA and PRATIK PATEL

1 Maize (Zea mays L.) is very important crop in the world. To study
ICAR-Central Soil Salinity Research Institute,
RRS, Bharuch, Gujarat; 2RRS, AAU, Anand,
Gujarat; Dept. of Agronomy, B. A. College of
Agriculture, AAU, Anand, Gujarat
*Email: agri.monika@gmail.com
Received: February 25, 2021
Accepted: May 308, 2021
Handling Editor: Dr. S S Rathore,
ICAR-IARI, New Delhi
ABSTRACT
profitability of various legume-maize cropping systems with residue
management, a field experiment was conducted at College of
Agronomy Farm, B. A. College of Agriculture, Anand Agricultural
University, Anand, Gujarat during summer-kharif seasons of two
consecutive years, 2017 and 2018.Three legume crops viz., green gram,
groundnut and cluster bean has been grown in summer season and
two residue management treatments after legume harvest viz., residue
removal and residue incorporation; was followed before sowing of
kharif maize. Three treatment viz., 100%, 75% and 50% recommended
dose of nitrogen levels were also given to kharif maize. Results of 2
year experiment revealed that cluster bean-maize sequence provided
the highest grain and straw yield of maize. Highest net realization and
benefit cost ratio for maize crop was achieved with cluster bean-maize
sequence with legume residue incorporation and 100% RDN followed
by groundnut-maize sequence with similar nutrient management
practices. For summer legume-kharif maize cropping system, the
highest net realization and benefit cost ratio was obtained with the
cluster bean-maize system with residue incorporation and 100% RDN.
System productivity in terms of the highest total maize equivalent
yields was observed under groundnut-maize cropping system with
residue incorporation and 100% RDN. Positive response of inclusion
of legumes on the profitability of the system find out under this study.

Key words: Cropping system, Legume, Maize, Profitability, Residue

management

INTRODUCTION Crop productivity is directly related to the soil

Maize (Zea mays L.) crop gained significance just
after wheat and rice in the world and is considered as
“Queen of cereals”. Globally, maize is cultivated in
179 m ha with the production of 967 m tonnes having
5402 kg ha-1 average productivity (Anon., 2017a). Due
to its multiple uses this crop has high demand for raw
material as well as packaged food. With 9.86 m ha
area under maize, India produced 26.26 m tonnes with
2663 kg ha-1 productivity (Anon., 2017b). In Gujarat, it
is cultivated on 0.40 m ha area with production of 0.72
m tonnesand much lower productivity (1800 kg ha-1)
(Anon., 2017c) than the national average.High cost of
inputs as seed, fertilizer, pesticides and declining
productivity of crops making agriculture non
profitable. Improving crop productivity for making
agriculture profitable, gaining attention of today’s
researchers. Due to intensive uses and exploitation,
agricultural lands also going toward degradation.
Lands productivity can be enhanced by growing
diverse crops on the farm. Diversification of the crops
not only help the soils to rejuvenate but also increase
the remuneration by harvest of multiple produce.
fertility which is again greatly related with soil
organicmatter. Modern agricultural practices resulted
in significant decrease in organic matter in soil.
Legumes are well known contributor of significant
amount of organic carbon as well as atmospheric N
fixation in to the soil. Inclusion of legumes with cereals
in cropping systems is the simplest way of improving
soil fertility. Therefore, there is need to assess suitable
legume crops for rotation as a measure of improving
soil fertility. Also the leguminous crop residues have
higher nitrogen content that could be an alternative
for nitrogen management whilemaintaining soil
health (Zoumane et al., 2000). It is well known fact that
crop residues supplies various nutrients, improves the
physical, chemical and biological properties as well
asacts as a soil conditioner (Mandal et al., 2004).Under
middle Gujarat conditions, diversification of maize
based cropping systems with short duration legume
crops could add N to soil for succeeding maize that
ultimately will result in gain in production of maize
and total systems profitability. This paper elaborate
the effect of inclusion of legumes in maize based
system onproductivity and profitability of the systems.
 Shukla et al.: Profitability of legume-maize cropping systems
MATERIALS AND METHODS
The field experiment was conducted at College
Agronomy Farm, B. A. College of Agriculture, Anand
Agricultural University, Anand, Gujarat, India during
summer-kharif seasons of years 2017 and 2018. Anand
is situated at 220 35’ N latitude, 720 55’ E longitude
with an elevation of 45.1 m above the mean sea level.
This region is having semi-arid and sub-tropical
climate with an average annual rainfall of 864.5 mm,
which is realized entirely from the South-West
monsoon currents. The soil of the experimental field
was loamy sand in texture and at 0-15 cm depth low
in organic carbon (0.34%) and available N (141.1 kg
ha-1), medium in available P2O5(36.2 kg ha-1) and K2O
(226.8 kg ha-1) and slightly alkaline in reaction (pH-
8.24, EC-0.18).
Experiment details
The experiment was laid in strip-split plot design
with four replications.Three legume crops viz., green
gram (C1), groundnut (C2) and cluster bean (C3) was
grown in summer season and designated as vertical
strips. Each legume crop strip was sub-divided into
two horizontal strips, for residue management
treatments viz., residue removal (R0) and residue
incorporation (R1); which further split into three
intersectional sub plots designated with three nitrogen
levels in succeeding kharif maize viz., 100% RDN (N1),
75% RDN (N2) and 50% RDN (N3). Green gram var.
GAM 5, groundnut var. GJG 31 and cluster bean var.
GG 2 were grown in summer season of both the years.
All legumes in summer season received equal nutrients
i. e., 20 kg N and 40 kg P2O5 per ha as basal dose.
Sowing of legumes were done in summer season on
22nd February in 2017 and 14th February in 2018 with
row spacing of 30 cm. Harvesting of green gram
wasdone in first fortnight of May and cluster bean
and groundnut were harvested in first week of
June.Maize var. GAWMH 2 was sown as main kharif
crop with spacing of 60 cm and all the treatments were
conferred upon it during both the years. The
recommended dose of fertilizer for maize crop was
150:65:00 NPK, kg ha-1 which given as per treatment
as basal and two N top dressing. Source of application
of nutrient was urea and DAP during both seasons.
Residue management
Residue yield was obtained by subtracting the
grain yield of legumes ofeach net plot from their
respective total dry biomass (above ground) and
computed in terms of kg per net plot and then on
hectare basis. The weight of pod residue after threshing
(pods) was also recorded and converted on hectare
basis. After harvesting, the entire biomass was
39
removed from the plots by uprooting the plants or
incorporated after finely chopping into pieces as per
treatments during both the years. After incorporation
one irrigation was given for proper decomposition of
the residue. The biomass was allowed to decompose
for about 20 days in the field.
Data recording and calculations
The pods of each legume from the net plot area
were threshed separately, cleaned and the seed yield
was recorded in kg per net plot and then computed on
hectare basis. Haulm yield was obtained by subtracting
the grain yield of each net plot from their respective
total dry biomass (above ground) and computed in
terms of kg per net plot and then on hectare basis for
all the three crops. Grain and straw yield of maize
recorded from the net plot. The statistical analysis of
the data of the kharif maize were performed in Strip-
Split Plot Design as per the procedure described by
Cochran and Cox (1957). Cropping systems, residue
management and nitrogen management data were
subjected to an ANOVA and means were compared
using t-test, with  = 0.05 level.
Cost of cultivation of the maize crop for individual
treatment was worked out taking into consideration
the cost of all the cultural operations starting from
preparatory tillage to harvesting of the crop including
the cost of all the inputs. The gross realization (Rs. ha-
1
) was worked out on the basis of grain and straw
yields of maize for each treatment combination,
considering the minimum support price prevailing in
the market during the year 2018.The net realization
was worked out by deducting the total expenditure
from gross realization from each of the treatments
combination and recorded accordingly. The benefit:
cost ratio (BCR) was worked out by dividing net
realization from the cost of cultivaion. Same
calculation was followed for calculation of gross, net
realization and BC ratio of the whole legume-maize
system. The benefit: cost ratio was calculated on the
basis of formula given below.
N et real i zati on (Rs. ha-1)
BCR =
Cost of cul ti vati on (Rs. ha-1)
System Productivity
System productivity in terms of total maize
equivalent yield (TMEY) was calculated by adding the
treatment wise maize yield in the maize equivalent
yields of seed and haulm yield of different legumes
and stover yield of maize crop. Maize equivalent yield
(MEY) was calculated for each legume by making use
of the following formula as stated by Munda et al.
(2008).
40 Journal of Food Legumes 34(1), 2021

System productivity (Kg/ha) = [(Seed and haulm yield Table 2. Grain and straw yield (kg ha -1) of maize as
of green gram/groundnut/cluster bean/ stovar yield influenced by different treatments (Pooled over
of maize (kg/ha) x Price/kg)/Price of maize/kg)] 2 years)

Minimum support price was considered for Treatment Grain yield Straw yield
(kg/ha) (kg/ha)
seeds, grains and local market price was considered Cropping systems
for legume haulm and maize stover. C1 : Green gram - Maize 2934 5051
C2 : Groundnut- Maize 3114 5294
RESULTS AND DISCUSSION C3 : Cluster bean - Maize 3253 5525
SEm+ 38.83 63.99
CD at 5 % 120 197
Seed and Residue Yield of Summer Legumes
CV % 8.68 8.38
During summer,cluster bean produced the Residue management (R)
R0: Residue removal 2899 5018
highest seed yield and total residue (haulm + pod
R1 : Residue incorporation 3301 5562
residue) followed by groundnut and green gram (Table. SEm+ 27 47
1). It was due to short growing period of green gram as CD at 5 % 94 161
compared to groundnut and cluster bean, which CV % 7.41 7.46
restrict dry matter accumulation in the plant, which Nitrogen management in
Maize (N)
resulted into lower production of seed and residues. N1: 100% RDN 3693 6138
Table 1. Seed, haulmand pod residueyield (kg ha-1) of N2: 75% RDN 3038 5265
summer legumes (Average data of two years) N3: 50% RDN 2570 4467
SEm+ 27 50
Green gram Groundnut Cluster bean CD at 5 % 77 141
Seed Yield 1102 1675 1753 CV % 5.54 6.15
Haulm 2424 3297 3619
Pod residue 234 536 803 with pulse systems might be due to, the N-rich leaf
Total Residue 2658 3833 4422 litter fall and roots decomposition over the post-harvest
period, which provides N benefits to the succeeding
Grain and Straw Yield of Maize crop. Decomposition and mineralization of applied
During kharif season, highest grain yield of maize residues might have coincided with the nutrient
(3253 kg ha-1) observed with cluster bean-maize (C3) demanding growth stages of succeeding maize which
followed by groundnut-maize (C2) cropsequence. resulted in better growth of crop and yield gains. The
Cluster bean-maize (C3) sequence increased 10.87 per present findings are in corroboration with the results
cent grain yield of maize over green gram-maize (C1) reported by Shah et al. (2014) and Ali et al. (2015).
sequence. Similar as positive effect of preceding Study of interaction effect on grain yield revealed
legume crops their residue incorporation also proved that the interaction of all three factors (cropping
beneficial in increasing maize yield. Significantly systems, residue management and nitrogen
higher grain yield was achieved with residue management in maize) came significant in the last year
incorporation (R1) (3301 kg ha-1) as compare to removal (2018). Cluster bean-maize with residue incorporation
(R0) and the magnitude of yield increase was 13.86 per and 100% RDN (C3R1N1) recorded significantly higher
cent over residue removal (R0). With every rise in grain yield of maize (4492kg ha -1), followed by
nitrogen doses from 50% RDN-00% RDN, there combination of groundnut-maize system with similar
seemed a linear and significant response for grain yield residue and nitrogen treatments (C2R1N1) (Table 3).
of maize.Application of 100% RDN (N1) appreciably Higher benefit by taking cluster bean and groundnut
increased the grain yield of maize(3693 kg ha -1),
followed by 75% RDN(N2) and 50% RDN(N3). Full
dose of nitrogen provided 50.72 per cent increased
yield over 50% RDN (N3)(Table 2).
Results were similar for straw yield and highest
straw yield of maize (5525 kg ha-1) was recorded with
cluster bean-maize (C3) followed by groundnut-maize
(C2) cropping sequence. Residue incorporation (R1) of
the summer legumes gave significantly higherstraw
yield (5562 kg ha-1) over removal (R0). The highest straw
yield was recorded underapplication of 100% RDN
(N1) (6138 kg ha-1), followed by 75% RDN(N2) (Table Fig 1. Grain yield (kg ha -1) of maize as influenced by
2). Improvement in the grain and straw yield of maize interaction of various factors (2018)
 Shukla et al.: Profitability of legume-maize cropping systems 41

as preceding crops could be attributed in to higher of other treatments (Table 4). This indicated the yield
biomass production, more carryover effect and high benefit of maize crop when legume residue application
N, P and K content of their residues as compare to was done. Similar findings reported by Ammaji (2014)
green gram. Similar findings reported by Ammaji and Rekha (2014).
(2014), and Ali et al. (2015)
Economics of Summer lugume-kharif maize
Economics of kharif maize
Gross and Net realization
Gross and Net realization
Effect of different treatments on gross and net
Average annual gross income from the maize realization was also notably visible in different
crop was higher (Rs. 79625 ha-1) in cluster bean-maize summer legume-kharif maize cropping systems (Table
cropping system with residue incorporation and 100% 5). The highest net realization of the system (average
RDN (C3R1N1) followed by groundnut-maize with of two years, Rs. 99506 ha-1)was obtained with cluster
residue incorporation and 100% RDN (Rs. 75305 ha- bean-maize cropping system with residue
1
). Similar combinations also gave higher net incorporation and 100% RDN (C3R1N1); followed by
realization C3R1N1; Rs. 46673ha-1 followed by C2R1N1; groundnut-maize cropping system with similar
Rs. 42353 ha-1(Table 4). It indicated that inclusion of treatments (C2R1N1;Rs. 97220 ha-1). Higher yield of both
preceding legumes as cluster bean and groundnut gave summer and kharif crop with better remuneration from
more profit from the maize crop as compare to green the legumes resulted into more profit from the above
gram crop. It was due to more yield benefit in the maize mentioned systems.
crop by residual nitrogen as well as residue Benefit:Cost Ratio
incorporation of these crops.
Treatment wise calculation of cost and income of
Benefit:Cost Ratio
both summer and kharif crops was also done for the
Among various treatment combinations the whole system. Results revealed that cluster bean-maize
highest BCR,1.42 for maize crop was obtained with cropping system + residue incorporation +100%
cluster bean-maize cropping system with residue RDN(C3R1N1) gavethe highest BCR of 1.95 followed
incorporation and 100% RDN followed by groundnut- by BCR of 1.88 under similar cropping system and N
maize with similar treatments (1.29). Study of management but with residue removal C3R0N1 (Table
economics of maize crop with different residue 5). Although the groundnut maize cropping system
management treatments revealed that residue with similar combinations gave good net returns from
incorporation treatments gave higher benefit cost ratio the system but due to higher cost of cultivation of
as compare to residue removal treatments irrespective groundnut as compare to cluster bean, the system
Table 3. Economics of kharif maize influenced by comprising groundnut gave lower benefit cost ratio.
different treatment (Average of two years) Similar results were reported by Mulik et al. (1989)
Gross realization Cost of
Ghosh and Singh (1996) and Franke et al. (2004)
Net
(Rs. ha-1) cultivation realization BCR
Treatment Grain Straw Total (Rs. ha )
-1
(Rs. ha-1) System productivity
C1R0N1 55934 5617 61551 31118 30433 0.98
C1R0N2 46313 4760 51073 30604 20469 0.67
System productivity in terms of highest total
C1R0N3 39631 4137 43768 30091 13677 0.45 maize equivalent yields was 9,249 kg ha-1, which was
C1R1N1 64235 6247 70482 32952 37530 1.14 obtained with treatment combination groundnut-
C1R1N2 50476 5155 55631 32438 23193 0.71 maize cropping system with residue incorporation and
C1R1N3 42663 4394 47056 31925 15132 0.47 100% RDN (N1) (Table 6). This was due to higher price
C2R0N1 57072 5770 62841 31118 31724 1.02
of groundnut produce as compare to others. These
C2R0N2 49004 5031 54034 30604 23430 0.77
C2R0N3 41647 4253 45900 30091 15810 0.53
results are in corroboration with Ammaji (2014).
C2R1N1 68762 6543 75305 32952 42353 1.29
C2R1N2 54642 5487 60130 32438 27691 0.85 CONCLUSION
C2R1N3 46476 4681 51157 31925 19232 0.60
C3R0N1 57851 5816 63667 31118 32549 1.05
From the present study, it was that under middle
C3R0N2 50984 5209 56193 30604 25589 0.84 Gujarat, during summer season cluster bean gave
C3R0N3 45140 4570 49710 30091 19620 0.65 highest seed and residue yield. The crop was also
C3R1N1 72787 6837 79625 32952 46673 1.42 found beneficial for improving maize grain and stovar
C3R1N2 58509 5947 64456 32438 32018 0.99 yield with its residue incorporation and full dose of
C3R1N3 46537 4770 51307 31925 19382 0.61
nitrogen in maize which further resulted into higher
C1 :Greengram, C 2 :Groundnut,C 3 :Cluster bean; R 0 :Residue gross and net realization and B:C ratio of maize crop.
removal R1:Residue incorporation; N1:100% RDN, N2:75% RDN,
N3 :50% RDN
Among the cropping systems cluster bean-maize
 42
Table 4. Economics of summer legumes-kharif maize systems influenced by different treatment (Average of two years)

Maize Yield Legume yield Total cost of Income from Income from Gross Net
(kg ha-1) (kg ha-1) Cultivation (' ha-1) Maize(' ha-1) Legumes (' ha-1) realization realization
of System of System BCR
Trea tment Grain Straw Seed Hanlm Maize Legumes Tota l Grain Straw Total Seed Hanlm Tota l
(~ ha-1) (~ ha-1)

C1RoN1 3290 5617 1102 2424 31118 21276 52394 55934 5617 61551 76881 4848 81729 143279 90886 1.73
C1RoN2 2724 4760 1102 2424 30604 21276 51880 46313 4760 51073 76881 4848 81729 132802 80922 1.56
C1RoN, 2331 4137 1102 2424 30091 21276 51367 39631 4137 43768 76881 4848 81729 125497 74130 1.44
C1R1N1 3779 6247 1102 2424 32952 21276 54228 64235 6247 70482 76881 0 7688 1 147363 93135 1.72
C1R1N2 2969 5155 1102 2424 32438 21276 53714 50476 5155 55631 76881 0 7688 1 132512 78798 1.47
C1R1N, 2510 4394 1102 2424 31925 21276 53201 42663 4394 47056 76881 0 7688 1 123937 70737 1.33
CiRoN1 3357 5770 1675 3298 3111 8 27057 58175 57072 5770 62841 81924 6595 88519 151360 93185 1.60
C,RoN, 2883 5031 1675 3298 30604 27057 57661 49004 5031 54034 81924 6595 88519 142553 84892 1.47

Journal of Food Legumes 34(1), 2021

C,RoN, 2450 4253 1675 3298 30091 27057 57148 41647 4253 45900 81924 6595 88519 134419 77271 1.35
C,R1N1 4045 6543 1675 3298 32952 27057 60009 68762 6543 75305 81924 0 81924 157229 97220 1.62
C,R1N2 3214 5487 1675 3298 32438 27057 59495 54642 5487 60130 81924 0 81924 142053 82558 1.39
C,R1N, 2734 4681 1675 3298 31 925 27057 58982 46476 4681 51157 81924 0 81924 133081 74099 1.26
C.RoN1 3403 5816 1753 3619 31118 18158 49276 57851 5816 63667 70991 7238 78229 141896 92620 1.88
C,RoN, 2999 5209 1753 3619 30604 18158 48762 50984 5209 56193 70991 7238 78229 134421 85659 1.76
C,RoN, 2655 4570 1753 3619 30091 18158 48249 45140 4570 49710 70991 7238 78229 127939 79691 1.65
CaR1N1 4282 6837 1753 3619 32952 18158 51 110 72787 6837 79625 70991 0 7099 1 150615 99506 1.95
CaR1N2 3442 5947 1753 3619 32438 18158 50596 58509 5947 64456 70991 0 7099 1 135447 84851 1.68
CaR1N, 2737 4770 1753 3619 31925 18158 50083 46537 4770 51307 70991 0 7099 1 122297 72215 1.44
 Shukla et al.: Profitability of legume-maize cropping systems 43

Table 5. System productivity in terms of total maize Ammaji P 2014. Productivity of maize as affected by crop
equivalent yield (kg ha-1) of the legume-maize residue incorporation and nitrogen levels in legume–
sequence cereal sequence. (Doctoral Thesis, Acharya N.G. Ranga
MEY* for legume MEY for Maize Total Maize Agricultural University, Hyderabad, India).
(kg ha-1) Stover (kg ha-1) equivalent
Anonymous 2017a. Food and agriculture organization
yield
Treatment Seed Haulm (FAOSTAT). Website: http.//www.fao.org/faostat/
(kg ha-1)
C1R0N1 4523 285 331 8428 data.
C1R0N2 4523 285 280 7812
Anonymous 2017b. Ministry of Agriculture, Directorate
C1R0N3 4523 285 244 7383
of economics and statistics. Website: http.//
C1R1N1 4523 0 368 8669
C1R1N2 4523 0 303 7795
www.agricoop.nic.in &https://www.statista.com
C1R1N3 4523 0 259 7291 Anonymous 2017c. Directorate of Agriculture
C2R0N1 4819 388 340 8904
(Department of Agriculture, farmers welfare and
C2R0N2 4819 388 296 8386
corporation) Gujarat. Website: https://
C2R0N3 4819 388 250 7907
C2R1N1 4819 0 385 9249
dag.gujarat.gov.in/
C2R1N2 4819 0 323 8356 Cochran WG & Cox, GM 1957. Experimental designs.
C2R1N3 4819 0 275 7828 Wiley New York, USA.
C3R0N1 4176 426 342 8347
C3R0N2 4176 426 307 7907 Franke AC, Schulz S, Oyewole BD and Bako S 2004.
C3R0N3 4176 426 269 7526 Incorporating short season legumes and green manure
C3R1N1 4176 0 402 8860 crops into maize-based systems in the moist Guinea
C3R1N2 4176 0 350 7968 of the Savannah of West Africa. Experimental
C3R1N3 4176 0 281 7194
Agriculture, 40, 463-479.
*MEY- Maize equivalent yield
Ghosh PK and Singh NP 1996. Production potential of
cropping system with residue and full N to maize was summer legumes-maize (Zea mays) sequence under
found more remunerative followed by groundnut- varying levels of nitrogen. Indian Journal of
maize cropping system. However highest system Agronomy, 41(4), 525-528.
productivity in terms oftotal maize equivalent
Mandal KG, Misra AK, Hati KM, Bandyopadhyay KK,
yieldswas found groundnut-maize cropping system Ghosh PK and Mohanty M 2004. Rice residue
with residue incorporation and 100% RDN. On the management options and effects on soil properties and
basis of these findings it can be concluded that crop productivity. Food Agriculture & Environment,
profitability of maize based cropping system can be 2 (1), 224-231.
improved with inclusion of legumes in summer season
Mulik SP, More SM, Deshpande, SS and Patel, JD 1989.
and incorporation of their residues further add in the Studies onnitrogen, yield, nutrient uptake and
profitability and productivity of the system. moisture utilization by winter sorghum. Journal of
Indian Society of Soil Science. 35: 417-420.
ACKNOWLEDGEMENT
Rekha MS 2014. Nitrogen management of summer maize
We acknowledge the support from Anand (Zea mays L.) as influenced by rabi legumes (Doctoral
Agricultural University, Anand, Gujarat and Indian thesis, Acharya N. G. Ranga Agricultural University,
council of agricultural research (ICAR)-Central Soil Hyderabad, India)
Salinity Research Institute, Karnal during the period Shah F, Jan MT, Shah T, Wu W, Khan ZH, Iqbal A, Islam B,
of experimentations. Ahmad, A and Jamal Y 2014. Impact of crop residue,
fertilizer and their placement technique on yield and
REFERENCES related traits of maize (Zea mays L.). Journal of
Agricultural and Biological Science, 9(7): 233-239.
Ali W, Jan A, Hassan A, Abbas A, Hussain A, Ali M, Zuhair,
SA and Hussain A 2015. Residual effect of preceding Zoumane K, Franzluebbers K, Juo ASR and Hossner LR
legumes and nitrogen levels on subsequent maize. 2000. Tillage, crop residue, legume rotation and green
International Journal of Agronomy and Agricultural manure effects on sorghum and millet in the semi arid
Research, 7 (1), 78-85. tropics of Mali. Plant and Soil, 225: 141-151.
 Journal of Food Legumes 34(1): 44-47, 2021

Effect of Frontline demonstrations of gram in Sirohi district of

South-Western Rajasthan
DILEEP KUMAR1 and LOKESH KUMAR JAIN2*

ABSTRACT
1 Front line demonstrations on gram were carried out at farmers’ field in
Krishi Vigyan Kendra, Keshwana, Jalore;
2 Sirohi district of Rajasthan to evaluate the performance of recent
College of Agriculture, Sumerpur (Pali)
Rajasthan-306 902 varieties recommended for the zone from Rabi 2011-12 to Rabi 2014-15.
The increase in grain yield with the adoption of improved technology
was in the range of 9.7per cent in Rabi 2011-12 to 35.7 percent in Rabi
*Email: jailokesh74@gmail.com
2013-14 in different years. Similarly, technology index ranged from 7.5
per cent in Rabi 2011-12 to 46.5 percent in Rabi 2013-14 as influenced by
Received: January 05, 2021 locality variations in different years. Economics revealed a seven times
Accepted: June 03, 2021 higher benefit with the adoption of improved packages over traditional
cultivation. Demonstration of proven technologies in gram, their
scientific management and monitoring helped Include in before income
Handling Editor: Dr. Uma Sah, ICAR-Indian level of the farming community.
Institute of Pulses Research, Kanpur
Key words: Demonstration, Economics, Grain yields, Gram, Yield gap
analysis.

INTRODUCTION Appropriate crop management practices increase

Pulse, the food legume is being grown since
millennium and has been a vital ingredient of human
diet in India. Pulses are major source of protein to
people who avoid eating meat. Chickpea
(Cicerarietinum L.) is grown in many tropical, sub-
tropical and temperate regions of the world. India is
the largest chickpea producer as well as consumer in
the world.Chickpea is one of the most important pulse
crops of India due to its multiple functions in
traditional farming system and multiple uses in human
diet in the form of green leaves, green seed for
vegetables, sattu, flour, roasted grain as well as for
making local beverage known as Chhang (Mir and
Mir 2000). Chickpea is annual plant with
indeterminate growth habit which grows up to 30-70
cm. In India it is cultivated on 9.44 million ha with a
production of 10.13 million tons during 2018-19 (GoI,
2019). Not with standing its distribution throughout
the country, six states viz., Madhya Pradesh,
Rajasthan, Maharashtra, Uttar Pradesh, Karnataka
and Andhra Pradesh together contribute 91% of the
production and 90% of the area of the country. Arid
region is considered to be the pulse bowls of Rajasthan
as it to share about 55% area and 40% of total pulse
production of state. The average pulses productivity
in the arid region was low (520 kg/ha) against 725
kg/ha as the state average. Total area under chickpea
in Sirohi district is 2731hectare and2659 tons in rabi
season 2017-18 (GoR, 2017).
production potential, ensures stable yields and higher
water use efficiency. Main strategies for achieving
sustainable production of these crop is the use of
improved short duration and high yielding varieties,
integrated nutrient management, pest and disease
control and suitable agronomic practices (Jain et al.
2019). The Front Line Demonstration is an important
method of transferring the latest package of practices
in totalityto farmers. By which, farmers learn latest
technologies under real farming situationat his own
field.
To demonstrate the proven technology of
scientific cultivation of gram, front line demonstrations
were laid out at farmer’s field during rabi 2011-12 to
rabi 2014-15 with objectives to assess the performance
of technologies demonstrated in frontline
demonstrations, their economics and the related yield
gaps.
METHODOLOGY
Present study was conducted on FLD in gram
in rainfed condition in Sirohi district of Rajasthan
state. Sirohi district is situated in the south-west part
of Rajasthan between the parallel of 24°20' and 25°17'
North Latitude and 72°16' and 73°10' East Longitude.
In total 331 frontline demonstrations were conducted
on farmers’ field in various villages of Sirohidistrict
of Rajasthan. Out of these 331 demonstrations 50
demonstrations of GNG 469 variety were conducted
 Kumar & Jain : Effect of Frontline demonstrations of gram in Sirohi district of South-Western Rajasthan
in 2011-12, 156 demonstrations of RSG 888 variety in
2012-13, 63 demonstrations of RSG 888 variety in 2013-
14 and 62 demonstration of GNG 1581 variety were
conducted in 2014-15 during rabi season in arid region
of south western Rajasthan.The package of improved
technologies like line sowing, nutrient management,
seed treatment and whole package were used in the
demonstrations. In general, soils of the area under
study were sandy loam and medium to low in fertility
status. During this period extension activity like field
day, farmers training, literature, short message services,
diagnostic visits etc. were undertaken to benefit the
farmers. Critical inputs supplied by KVK for the present
study with respect to FLD and farmers practices have
been given in Table 1. The farmers were selected from
active participation in group meeting regarding
different aspects of cultivation practices. Whole
package approach demonstrated to the farmers
through FLD trials included critical inputs such as
variety, recommended seed rate, seed treatment
practices, weed management, fertilizers and plant
protection measures.
The thinning and weeding was done invariably
35-40 days after sowing. Seed sowing was done in
the first week of November with a seed rate of 80
kg/ha. Under strict supervision of KVK scientists
study was conducted from sowing to harvesting. Data
with respect to grain yield from FLD plots and
from fieldscultivated following local practices
adopted by thefarmers of the area were collected
and evaluated. Different parameters as suggested by
Yadav et al. (2004) and Verma et al. (2014) were used
for calculating gap analysis, costs and returns. The
analytical tool used for assessing the performance of
the FLD on gram is as follows:
 Technology gap (kg/ha): Potential yield –
Demonstration yield
 Extension gap (kg/ha): Demonstration yield –
Farmers yield
 Technology index (%): (Technology gap/
Potential yield) X 100
 Additional return (Rs/ha) = Demonstration
return - Farmers’ practice return
 Effective gain (Rs) = Additional return -
Additional cost
 Incremental B: C ratio = Additional return /
Additional cost
RESULT AND DISCUSSION
India has led to replacement of chickpea with
wheat and mustard in larger areas as the irrigation
facility was improved. Results of 331 demonstrations
45
conducted from rabi 2011-12 to 2014-15 in 103.86 ha
at farmer’s field in Sirohi district presented in Table 2
and 3. Results indicated that use of high yielding
variety, balanced application of fertilizers and
micronutrients and control of insect and disease at
economic threshold level gave average significant
higher yield of gram as compared to farmer practices.
Grain yield
The increase in grain yield under demonstration
over the farmer’s local practices was in the range of
9.7 to 35.7 per cent. On the average basis 23.3 per cent
yield advantage was recorded under FLD
demonstrations as compared to farmers practices (FP)
of gram cultivation.
The productivity of gram under improved
production technology ranged between 963-1480 kg/
ha with mean yields of 1265 kg/ha as against a yield
range between 782 to 1189 kg/ha under farmers’
practice during study period.In comparison to farmer’s
practice, there were 24.5, 35.7, 23.2and 9.7% increase
in production of gram under improved technologies
in 2011-12, 2012-13, 2013-14 and 2014-2015,
respectively. The increased grain yield with improved
technologies was mainly because of adoption of
recommended package of practices in the zone (Jain
2016). Joshi et al. (2004) have also observed that
improved package of practices along with water
management have shown positive effect on yield
potentials of different crops. Similar findings have also
been supported by Narolia et al. (2013) and Naroliaet
al. (2015). Overall, the yield of demonstration plots
exceeds that of farmer’s plots in all FLD.
Gap analysis
Extension gap is a parameter to know the yield
differences between the demonstrated technology and
farmers’ practice while technology gap is the difference
between potential yield and yield obtained under
improved technology demonstration. Technology gap
is of greater significance than other parameters as it
indicates the constraints in implementation and
drawbacks in our package of practices, these could be
environmental or varietal.An extension gap ranging
from 105-375kg per ha was found between FLD and
farmers practices during the different time line and on
average basis the extension gap was observed to be
238 kg per hectare (Table 2). The extension gap was
lowest (105 kg/ha) in rabi 2014-15 and was highest
(375 kg/ ha) in year 2012-14. Such gap might be
attributed to adoption of improved technology in
demonstrations which resulted in higher grain yield
than that in the farmers’ practices. Wide technology
gap were observed during these years and this was
lowest (120 kg/ha) during 2011-12 and was highest
46 Journal of Food Legumes 34(1), 2021

Table 1. Comparison between demonstration package (IP) and existing farmers practice (FP) under gram FLDs
Sl. No. Items Farmers practice Recommended practice
1 Use of seed variety Local seed (Dahod yellow) Seed of improved variety
GNG 469
RSG 888
GNG 1581
2 Seed rate Higher seed rate (100 kg) 80 kg/ha
3 Seed treatment - Seed treatment with Bavistin followed by Rhizobium and
PSB
4 Fertilizer No or Lower doses N- 20 kg/ha
(10 kg N and 25 kg P2O5) P2O5- 40 kg/ha
5 Sowing Broadcasting Mix cropping Line sowing
6 Plant protection measures Rarely used Spray of Aciphate 75 SP @ 700 g/ha
disease insect

Table 2. Performance of gram in crop technology demonstrations (Rabi 2011-12 to Rabi 2014-15)
Year Variety No. of Area Yield (Kg/ha) % increase Potential Technology Technology Extension
demonstration Improved Farmers over (FP) yield Index Gap (q/ha) Gap (q/ha)
package of practice (kg/ha)
practice (IP) (FP)
2011-12 GNG-469 50 20 1480 1189 24.47 1600 7.5 120 291
2012-13 RSG-888 156 40 1425 1050 35.71 1800 20.8 375 375
2013-14 RSG-888 63 19.06 963 782 23.15 1800 46.5 837 181
2014-15 GNG- 1581 62 24.8 1190 1085 9.68 1800 33.9 610 105
Average - - 1264.5 1026.5 23.2525 1750 27.175 485.5 238

Table 3. Economic analysis in front line demonstrations of gram on farmers field gram (Rabi 2011-12 to Rabi 2014-15)
Year Cost of cash input (₹/ha) Additional cost of Sale price of Total Return Additional return in Effective Incrementa
IP FP demonstration (₹/ha) grain (₹/q) IP FP demonstration (₹/ha) grain l B:C ratio
(₹/ha)
2011-12 14250 13210 1040 2800 41440 33292 8148 7108 6.83
2012-13 14950 13550 1400 3000 42750 31500 11250 9850 7.04
2013-14 15150 13890 1260 3100 29853 24242 5611 4351 3.45
2014-15 16200 14800 1400 3175 37783 34449 3334 1934 1.38
Average 15137.5 13862.5 1275 3019 37957 30871 7086 5811 4.68

(837 kg/ha) during 2013-14. The difference in
technology gap during different years could be due to
differential feasibility of recommended technologies
during different years. Similarly, the technology index
for all the demonstrations during different years were
in accordance with technology gap. Higher technology
index emphasized the need to educate (insufficient
extension services in transfer of technology) the
farmer’s through various means for the adoption of
improved / recommended production technology to
decrease the gaps (Jain 2018).
Economic analysis
Different variables like seed, fertilizers, bio-
fertilizers and pesticides were considered as cash input
for the demonstrations as well as farmers’ practice and
additional investment was given in Table 3 under
demonstrations. Economic returns as a function of
grain yield and minimum support price (MSP) sale
price varied during different years. The higher
additional returns and effective gain obtained under
demonstrations could be due to improved technology,
non-monetary factors, timely operations of crop
cultivation and scientific monitoring. The lowest and
highest incremental benefit cost ratio (IBCR) were 1.38
and 7.04 in 2014-15 and 2012-13, respectively (Table
3) depends on produced grain yield and MSP sale rates.
It is observed that an additional investment of ¹
1275/- per ha was made under 331 demonstrations.
Economic returns was observed to be a function of
grain yield and Minimum Support Price (MSP) or sale
price which varied along different years. Maximum
additional returns of ¹11250/-per hectare
wereobtained due to higher grain yield during the year
2012-13.It was attributed due to improved technology,
nonmonetary factors, and timely operations of crop
cultivation, location specify and scientific monitoring.
The lowest and highest incremental benefit: cost ratio
(IBCR) were 1.38&7.04 in 2014-15 and 2012-13,
respectively (Table 3) which depends on grain yield
and MSP. The front line demonstration on gram
revealed 23.25 per cent increase in yield over local
check. This increase was with an extra expenditure of
1275/- per ha which is very less and even small and
marginal farmers could also afford. Thus it is ‘not the
cost that deters the farmers from adoption of latest
 Kumar & Jain : Effect of Frontline demonstrations of gram in Sirohi district of South-Western Rajasthan
technology but ignorance is the primary reason. The
IBCR during different years is sufficiently high to
motivate the farmers under aberrant and rainfed
conditions to adopt the technology. Therefore, FLD
program was effective in changing attitude, skill and
knowledge of farmers towards improved/
recommended practices of wheat cultivation. This also
led to improvement in the relationship between
farmers and scientists and built confidence between
them. The FLD demonstration farmers acted as primary
source of information about the improved practices of
gram cultivation. They also acted as source of good
quality pure seeds in their locality and surrounding
area for the next crop as it is self-pollinated crop. The
concept of FLD’s may be applied to all farmer
categories including progressive farmers for horizontal
dissemination of the recommended practices to other
members of the farming community. This will help in
the removal of the cross-sectional barriers among
farming community. The results are in conformity with
the findings of Jain (2017) and Meena et al. (2012).
Reactions and constraints: During crop growing
period since field preparation to maturity and after
harvest, the reaction of farmers about critical input
supplied under demonstration was asked and they
replied good seed germination, early maturity, high
yield and high net benefit with resistance so some
diseases. In-spite of best efforts and feedback from
respondents, there was some constraints suggested
by farmers’ for higher adoption and are listed below:
 Pod borer resistance along with shattering
tolerance varieties should be developed.
 Timely availability of seeds of HYVs’.
 Unavailability of plant protection chemicals on time.
 Lack of proper post harvest management and
value addition
 Lack of centralized facilities for cleaning, grading,
processing, packing and storage in the state is
prior requirement.
 More number of training programmes should be
arranged with demonstration and frequent field
visit by the concerned extension experts to
enhance the level of adoption.
CONCLUSION
By conducting crop technology demonstration
of recommended technologies, yield of gram can be
increased to its potential yield. This will substantially
increase the income as well as livelihood status of the
farming community. There is need to further conduct
such demonstration of recommended technology in
Sirohi district of Rajasthan.
47
REFERENCES
Government of India. 2019. Agriculture Statistics at a
Glance, Ministry of Agriculture and Farmers Welfare
Department of Agriculture, Cooperation and Farmers
Welfare, Directorate of Economics and Statistics.
Government of Rajasthan. 2017. Vital Agriculture Statistics,
Commissionerate of Agriculture, Pant Krishi Bhawan,
Jaipur (Rajasthan).
Jain LK. 2016. Impact assessment of frontline
demonstrations on greengram in Barmer district of
western Rajasthan. Journal of Food Legume 29: 249-252
Jain LK. 2018. Technology and Extension Gaps in
Pearlmillet Productivity in Barmer District, Rajasthan.
Indian Journal of Dryland Agricultural Research &
Development 33: 39-42
Jain LK,ParewaHP and Ratnoo SD. 2019. Impact of
frontline demonstration on productivity and
profitability analysis of clusterbean in Barmer district
of Rajasthan. Forage Research. 44 (4): 282-285.
Jain LK. 2017. Crop Technology Demonstration: An
effective communication approach for dissemination
of technology for isabgol production. Journal of
Medicinal and Aromatic Plant Sciences 39(2-4): 76-82
Joshi OP, Billore SD and Vyas AK. 2004. Productivity and
economic sustainability of improved soybean
production technology under real farm conditions.
Paper presented in VII-WSRC held at Fojdop Iguassu,
PR, Brazil on 29 Feb-5 March 04.
Meena OP, Sharma KC,Meena RH and Mitharwal BS. 2012.
Technology transfer through FLD’s on mung bean in
semi-arid region of Rajasthan. Rajasthan Journal of
Extension Education 20: 182-186.
Mir MS and Mir AA. 2000. Ethnic foods of Ladhakh. In
dynamics of cold arid agriculture (Sharma, JP, Mir AA,
Eds).Kalyani Publishers, Ludhiana, India Pp 297-306.
NaroliaRS, Meena H and Singh P. 2015. Impact of water
management practices on productivity of soybean +
maize intercropping system in Chambal command.
Annals of Agricultural Research New Series 36(4): 364-
369
NaroliaRS, SinghP, MathurIN and Panwar LL. 2013.Impact
of improved water management technology on
productivity and sustainability of soybean grown in
Chambal command of S.E.Rajasthan.Soybean Research
11(1): 36-42.
Verma RK, Dayanand, Rathore RS, Mehta SM and Singh
M. 2014.Yield and gap analysis of wheat productivity
through frontline demonstrations in Jhunjhunu district
of Rajasthan.Annals of Agricultural Research New
Series 35(1): 79-82.
Yadav DB, Kamboj BK and Garg RB. 2004. Increasing the
productivity and profitability of sunflower through
front line demonstrations in irrigated agro ecosystem
of eastern Haryana. Haryana Journal of Agronomy
20: 33-35.
 Journal of Food Legumes 34(1): 48-50, 2021

Enhancement of productivity in chickpea through frontline

demonstrations on farmers’ field
SHALU ABRAHAM*, ISHWAR SINGH, ESHU SAHU,
PRAVEEN JAMREY and MANISH ARYA

Krishi Vigyan Kendra,
Gariyaband 493889,
Chhattisgarh, India
*Email: shaluabraham5@gmail.com
Received: March 05, 2021
Accepted: June 08, 2021
Handling Editor: Dr. Meenal Rathore,
ICAR-Indian Institute of Pulses Research,
Kanpur
ABSTRACT
The frontline demonstrations of chickpea were conducted during the rabi
season of 2016-17 to 2019-20 in 48 farmers field to determine the production
potential and economic benefit under improved package and practices. The
improved practices consisted of improved variety JAKI 9218, Integrated
Nutrient Management (20:60:20 NPK kg/ha + Soil application of Trichoderma
enriched FYM + Seed treatment with Rhizobium + PSB 5g/kg seed) at
Gariyaband district of Chhattisgarh State. The improved technologies
recorded mean yield of 9.62 q/ha which was 69.05 percent higher than that
obtained with farmers practice of 5.68 q/ha. Improved technologies gave
higher net return of 26718 Rs/ha with a benefit cost ratio of 2.85 as compared
to farmers practice (Rs 14485.25 /ha, benefit cost ratio 2.48). The extension
gap ranged between 3.18 to 4.25 q/ha. Data on technology index reduced
from 57.2% to 49.25% exhibiting the feasibility of technology demonstration
in this region.

Key words: Chickpea, Extension gap, Frontline demonstration, Improved

practices, Technology gap, Yield

INTRODUCTION Chhattisgarh is delayed sowing of chickpea due to

Chickpea (Cicer arietinum Linn), a major pulse
crop in India, is an important source of protein and is
an essential component of the vegetarian diet. Other
than this, chickpea cultivation also improves soil
fertility by fixing atmospheric nitrogen N upto 140 kg/
ha. Chickpea covers about 9.44 Mha with production
of 10.13 million tonnes and productivity of 1073 kg/
ha (Directorate of Economics and Statistics, GOI, 2019).
Chickpea is a predominant crop among Rabi pulse
crops of Chhattisgarh occupying 0.32 Mha of land,
producing 0.33million tonnes with average
productivity of 1031 kg/ha (Directorate of Economics
and Statistics,GOI 2019). As far as the chickpea
cultivation in Gariyaband district of Chhattisgarh is
concerned, it is grown on 0.01 Mha of land producing
0.00923 million tonnes with the average productivity
of 914 kg /ha (Agriculture Department, Gariyaband)
In Gariyaband district the average productivity
of chickpea is very low (9.14 q/ha) as compared to
genetic potential (20.00 q/ha). The reason of low
productivity in chickpea may be due to low adoption
of recommended production technologies like
adoption of local cultivars, imbalanced use of
fertilizers, lack of irrigation facilities, poor agronomic
management (broadcasting method of sowing, higher
seed rate and delayed sowing) and poor plant
protection measures. One major constraint in
late harvesting of preceding kharif crop of rice resulting
in poor seed yield.Less soil moisture, low organic
matter content and soil type are also some of the major
abiotic stresses responsible for low yield. Among the
biotic stresses pod borer is a major pest resulting in
pod damage in the crop causing a wide reduction in
yield(Krishan Kant et al 2007). Seed yield of chickpea
can be enhanced in farmers’ field with adoption of
improved technologies. To combat the causes of yield
reduction and technology gap, dissemination of
recommended technologies of chickpea through front
line demonstration were conducted on farmer’s field
from 2016-17 to 2019-20.
MATERIALS AND METHODS
The frontline demonstrations were carried out in
48 farmer’s field at different villages of Gariyaband
district during the rabi season of 2016-17 to 2019-20
under the paddy -chickpea cropping system. Each
demonstration was carried out in 0.4 ha area adjacent
to the plot of farmers practice. Before conducting the
Frontline demonstrations a list of farmers was
prepared after conducting group meetings and
thereafter the selected farmers were imparted off
campus trainings regarding the different aspects of
cultivation as suggested by Choudhary, 1999 and
Venkattakumar et al., 2010. In the local checks, existing
 Abraham et al.: Enhancement of productivity in chickpea through frontline demonstrations 49

farmers practice like use of local seeds delayed sowing
upto 3rd week of December, with higher seed rate 100
kg/ha, no seed treatment, no bio fertilizer and
imbalance use of fertilizer were adopted. In
demonstration plots, use of quality seeds of improved
variety JAKI-9218, seed treatment with bio fertilizers
(Rhizobium & PSB), soil application of Trichoderma,
use of balanced fertilizers (20:60:20 kg NPK/ha) line
sowing and timely weeding, and applied irrigations
(2 no) on critical growth stages of irrigation as
suggested by Chattopadhyay et al. (2003) were used
as technical interventions.The yield data was collected
from the selected FLD farmers by random crop cutting
method.The data output were collected from both FLD
plots as well as farmer’s practice plot and finally the
extension gap, technology gap, technology index along
with the benefit cost ratio were worked out (Samui et
al., 2000) as given below:
Technology gap = Potential yield-Demonstration yield
Technology (Potential Yield - Demonstration Yield)
x 100
index = Potential Yield
Extension gap= Demonstration yield-Farmer’s
practice yield
RESULTS AND DISCUSSION
The difference between the technological
interventions and existing farmer practices under
chickpea FLD is depicted in Table 1. A complete gap
was observed in adoption of recommended over
Table 1. Differences between recommended practices and existing farmer practices under FLD on chickpea
farmers practice with regard to variety, sowing
method, seed inoculation, fertilizer and weed control
whereas partial gap was noted for irrigation.
Seed Yield
Yields obtained under improved technology as
well as local check are presented in Table 2. Results of
the frontline demonstrations indicated that adoption
of recommended production technologies produced
on an average 69.05% more yield of chickpea as
compared to farmers practice. The productivity of
chickpea ranged from 8.56 to 10.15 q/ha with mean
yield of 9.62 q/haunder improved technology on
farmers field as against a yield ranging from 5.38 to
5.90 q/ha with a mean of 5.68 q/ha recorded under
farmers practice.The higher yield of chickpea under
recommended practices was due to the use of
improved high yielding variety, integrated nutrients
management. Similar results have also been reported
by Tomar et al. (1999).
Economics
The input and output prices of different
commodities which prevailed during each year were
taken into consideration for calculating cost of
cultivation, gross returns, net returns and benefit cost
ratio. The net returns obtained from the recommended
practices ranged between 16010 to 31943 Rs/ha while
from the farmers practice net returns of 9355 to 17358
Rs/ha were obtained.The average benefit cost ratio of
improved technologies was 2.85 ranging from 2.15 to
3.14 and that of local check was 2.48 varying from

Crop operations Recommended practices Farmers practice

Variety JAKI 9218 Local
Sowing Method Line Sowing Broadcasting
Seed inoculation Seed inoculation Rhizobium (5g/kg seed) and PSB culture (5 g/kg seed) No use of cultures
Fertilizer dose Fertilizer dose 20:40:20 kg N:P:K /ha + Soil application of Trichoderma Imbalanced Use
enriched FYM at the time of final ploughing
Weed management Pre-emergence application of Pendimethalin (0-3 DAS) fb 2 hand No weeding
weedings at 25 DAS and 55 DAS
Irrigation One at pre flowering and one at pod development stage One irrigation
Plant Protection Need based plant protection measure Need based plant protection
measure

Table 2. Productivity, extension gap, technology gap and technology index of chickpea as grown under FLD and
existing package of practices
Year Area No.of Potential Yield Yield (q/ha) % increase Extension gap Technology gap Technology
(ha) demo (q/ha) over FP (q/ha) (q/ha) Index (%)
RP FP
2016-17 4 10 20 8.56 5.38 59.11 3.18 11.44 57.2
2017-18 4.8 12 20 9.80 5.80 68.97 4.00 10.20 51.0
2018-19 4 10 20 9.95 5.65 76.11 4.30 10.05 50.25
2019-20 4 10 20 10.15 5.90 72.03 4.25 9.85 49.25
Mean - - - 9.62 5.68 69.05 3.93 10.39 51.93
50 Journal of Food Legumes 34(1), 2021

Table 3. Economic Analysis of Demonstration and Farmers Practices

Year Cost of Gross Returns Net Returns B: C ratio Additional Cost Additional Net
Cultivation (Rs/ha) (Rs/ha) (Rs/ha) Returns (Rs/ha)
(Rs/ha)
RP FP RP FP RP FP RP FP
2016-17 13950 9475 29960 18830 16010 9355 2.15 1.99 4475 6655
2017-18 14200 9650 41650 24650 27450 15000 2.93 2.55 4550 12450
2018-19 14500 9875 45969 26103 31469 16228 3.17 2.64 4625 15241
2019-20 14950 9900 46893 27258 31943 17358 3.14 2.75 5050 14585
Mean 14400 9725 41118 24210.25 26718 14485.25 2.85 2.48 4675 12232.75

1.99 to 2.48. This may be due to higher yield obtained
under improved technologies compared to local check
(Farmer’s practice). Thus it was clearly evident that
demonstration of chickpea with full package was
better than farmers practice. Similar findings have also
been reported by Tomar 2010 and Dubey et al 2017.
Extension Gap
The extension gap showed an increasing trend.
The extension gap ranging between 3.18 to 4.25 q/ha
during the period of trial emphasizes the need to
educate the farmers through various means for the
adoption of improved agriculture production to
reverse the trend of wide extension gap.
Chattopadhyay C, Meena PD, Sastri RKand Meena RL.
2003. Relationship among photological and agronomic
attributes for soil borne diseases of three oilseed crops.
Indian J. Plant Protection 31: 127-128.
Choudhary BN. 1999. Krishivigyan Kendra-A guide for
KVK mangers. Publication, Division of Agricultural
Extension, ICAR; 73-78.
Dubey S, Raghav RS and Singh P. 2017. Enhancement of
productivity for chickpea (Cicer arietinum L.) through
front line demonstration in farmer’s fields. Legume
Research 40(2): 335-337.
GOI Agriculture, Statistics. 2019. Directorate of Economics
and Statistics, Ministry of Agriculture, Government of
India. 2020

The trends of technology gap (ranging from 11.44
to 9.85 q/ha) reflects the cooperation from farmers side
in carrying out these demonstrations achieving
positive results in subsequent years. The technology
gap observed may be attributed to dissimilarity in soil
fertility conditions and variable weather conditions.
The technology index shows the feasibility of the
evolved technology at the farmer’s field. The lower the
value of technology index more is the feasibility of the
technology demonstrated. (Sagar and Chandra, 2004)
As such reduction in technology index from 57.2 %
during 2016-17 to 49.25 % during 2019-20 exhibited
the feasibility of the demonstrated technology in this
region. These results confirm the findings of crop
technology demonstration on oilseed and pulses crops
by Yadav et al (2004) and Lathwal (2010).
From the above findings it can be concluded that
use of scientific method of chickpea cultivation can
reduce the technology gap to a considerable extent this
leading to increase productivity of chickpea in the
district. Moreover extension agencies in the district
need to provide proper technical support to the farmers
through different educational and extension methods
to reduce the extension gap for betterpulse production
in the district.
REFERENCES
Agriculture Department. 2020. Office of Deputy Director
Agriculture, District Gariyab and. 2020
Krishna Kant, Kanaujia KR and Kanaujia S. 2007. Role of
plant density and abiotic factors on population
dynamic of Helicoverpa armigera (Hubner) in chickpea.
Annual Plant Protection Sciences. 15: 303-306.
Lathwal OP. 2010. Evaluation of crop demonstration on
black gram in irrigated agro ecosystem. Annals of
Agriculture Research 31: 24-27.
Sagar RL and Ganesh Chandra 2004. Frontline
demonstration on sesame in West Begal. Agricultural
Extension Review 16: 7-10.
Samui SK, Mitra S, Roy DK, Mandal AK and Saha D.
2000.Evaluation of front line demonstration on
groundnut. J. Indian Soc. Coastal Agriculture Research
18(2): 180-183.
Tomar RKS, Sharma P and Yadav LN. 1999. Comparison
of Yield and economic of integrated chickpea under
improved and local management practices. Int.
Chickpea Pigeonpea News Letter 6: 22-23.
Tomar RKS. 2010. Maximization of productivity for
chickpea (Cicer arietinum L.) through improved
technologies in farmer’s field. Indian Journal of Natural
Products and Resources 1: 515-517.
Venkattakumar R, Ramana Rao SV, Padmaiah M and
Madhuri, P. 2010. Production constraints and
information needs of growers in Andhra Pradesh.
Agric. Extn. Review (April-June): 21-24.
Yadav D B, Kamboj B K and Garg R B.2004.Increasing the
productivity and profitability of Sunflower through
front line demonstration in irrigated agro ecosystem
Haryana Haryana Journal of Agronomy 20: 33-35.
 Journal of Food Legumes 34(1): 51-56, 2021

IPA 15-2 (Sharada): A high yielding, wilt and sterility mosaic disease
resistant pigeonpea cultivar for North East Plain Zone
SATHEESH NAIK SJ*, ABHISHEK BOHRA, FARINDRA SINGH, DIBENDU DATTA,
IP SINGH, RAJ KUMAR MISHRA, HRIDAY NARAYAN MAURYA and NP SINGH

ICAR-Indian Institute of Pulses Research (IIPR),
Kanpur 208024, UP, India
*Email: satheeshnaikagri@gmail.com
Received: March 02,2021
Accepted: June 06, 2021
Handling Editor: Dr. Meenal Rathore,
ICAR-Indian Institute of Pulses Research
Kanpur
ABSTRACT
Development of improved cultivars with enhanced resistance/tolerance
is an indispensable process to improve the productivity in pigeonpea.
Newly released long duration pigeonpea variety IPA 15-2 (Sharada)
was developed by crossing diverse parents’ viz., NDA 1 and MAL 13.
The generation advancement was monitored through pedigree breeding
method. The female parent NDA 1 is compact in growth habit with
resistant reaction to sterility mosaic disease (SMD). While, the male
parent MAL 13 is spreading and resistant to wilt disease. The variety
IPA 15-2 (Sharada) was subjected to three years rigorous testing for
yield stability and disease resistance under All India Coordinated
Research Project on pigeonpea during 2017-18 to 2019-20. The results
revealed that the weighted mean of three years grain yield over six test
location was 2266 kg/ha. However, the centre Varanasi recorded highest
yield of 2998 kg/ha. The variety IPA 15-2 (Sharada) offers 23.47% higher
yield superiority over the national check variety Bahar and 24.38%
over zonal check IPA 203 (Prakash). It is resistant to wilt (15.11%) and
sterility mosaic disease (15.62%). Keeping this in view the committee
on Release of Crop Variety to Central Sub-Committee on Crop
Standards Notification and Release of Varieties has recommended IPA
15-2 (Sharada) for cultivation in North East Plain Zone comprising the
states of Uttar Pradesh, Bihar, Jharkhand and West Bengal.

Key words: High yield, North East Plain Zone, Sterility mosaic disease
resistance, Pigeonpea, Variety

INTRODUCTION Project (AICPIP) in 1967. The current elastic

Pigeonpea [Cajanus cajan (L.) Millsp], an
important multi–purpose grain legume crop of rainfed
agriculture, is globally cultivated in about 82 countries
in an area of 5.61mha with a production of 4.42mt and
an average productivity of 788kgha–1 (FAOSTAT,
2019). India is the global leader in terms of total acreage
under cultivation (4.3 mha), production (3.83 mt), yield
(890 kg/ha), processing and consumption of
pigeonpea in 2019-20 (http://agricoop.gov.in).
Pigeonpea is an integral part of human diet as a
source of plant protein among majority of the Indian
households. It is grown as sole crop or inter crop in
varying agro-eco systems as a means to supply food
for humans, fodder and feed for animals, fuel wood
for rural households, soil binder to protect soil erosion
and as border crop to protect the main crop.
Development of pigeonpea varieties with improved
seed yield and resistance to different biotic and abiotic
stresses stood at the highest priority to the breeder ever
since the organized pigeonpea breeding initiated
under All India Coordinated Pulses Improvement
population growth of 1.2%
(www.thehindubusinessline.com, 2019) in India had
created increased demand on limited available
resources that are depleting progressively. The prime
production factors like land, water and climate is
under gradual degradation and posing threat to loss
of biodiversity (FAO, Land and water resource
planning, 2018). Such alarming situation requires
rational approaches to conserve and efficiently use
available resources that sustain and enhance
productivity and maintain ecosystem resilience.
Pigeonpea is the favorite crop of rainfed semi-
arid farming system of India. It is being cultivated in
five different zones namely (i) North East Plain Zone
(Uttar Pradesh, Bihar, West Bengal, Jharkhand);
(ii)North West Plain Zone (Punjab, Haryana,
Uttarakhand, Delhi); (iii)Central Zone (Madhya
Pradesh, Maharashtra, Rajasthan, Chhattisgarh); (iv)
South Zone (Karnataka, Telangana, Andra Pradesh,
Tamil Nadu) (v) North Hilly Zone (Tripura, Manipur,
Nagaland).
52 Journal of Food Legumes 34(1), 2021
The rich fertile soil of Indo gangetic plains and
hot-humid climatic conditions of North East Plain
Zone (Uttar Pradesh, Bihar, West Bengal, and
Jharkhand) are favorable for the cultivation of long
duration pigeonpea varieties. The sowing season
begins in July first fortnight and the crop gets
prolonged vegetative phase for acquiring sufficient
biomass. The extreme cold spell months of December
and January freezes the crop reproduction. As the
day/night temperature raises from the second fortnight
of February the crop switch to its full bloom and
complete podding by the first fortnight of April. North
East Plain Zone contributes about 12.2% of total
pigeonpea area and 15.26% of production in the
country. Owing to its long duration, pigeonpea
cultivation NEPZ is also considered as the high
yielding zone (18-25 q/ha) (AICRP on pigeonpea
annual report, 2019-20).
Genetic enhancement is a ray of hope for
manipulating pigeonpea crop to perform better under
limited resources and stressful environment. Positive
genetic improvement increases the productivity per
unit resources consumed and decreases the gap of
demand and supply. Keeping this in view the present
varietal development programme was initiated to
develop high yielding, wilt and sterility mosaic disease
resistance variety in pigeonpea for cultivation in NEPZ.
MATERIAL AND METHODS
The pigeonpea variety ‘IPA 15-2’ was developed
at ICAR-Indian Institute of Pulses Research, Kanpur
by crossing NDA 1/MAL 13 parents. The female parent
NDA 1 was the selection of Faizabad local landrace.
NDA 1is compact with indeterminate growth habit,
Fig 1. Morphological features of male (NDA 1) and
female (MAL 13) parents of IPA 15-2 (Sharada) variety
semi spreading branches suitable for sole cropping; it
produces yellow flowers with sparse red streaks on
the dorsal side of the standard petal, green pod and
tolerant to wilt and SMD. Whereas, the female parent
MAL 13 [Pedigree: MA 2/MA 166 // Bahar] is
spreading, indeterminate in growth habit, yellow
flowers with sparse red streak and green purple
streaked pods. MAL 13 is tolerant to wilt, pod borer
and sterility mosaic disease (Fig 1).
The new variety IPA 15-2 (Sharada) was
developed through pedigree breeding method to track
the historical data on line development as given in the
Figure 2. From F2 to F6 generations the line was
maintained through single seed descent method and
after F6 plant to progeny row was adopted for
generation advancement. The variety IPA 15-2 was
subjected to preliminary yield trial, station trial and
disease resistance screening at ICAR-IIPR, Kanpur.
Identified for release in NEPZ by Central Variety
Release Committee (CVRC) on 1st October, 2020 and
Pigeonpea Variety ‘IPA 15-2 (Sharada)’

Parent 1(NDA 1) × Parent 2(MAL 13)

F1

2 and 6 in foot materials handled through
pedigree methods

Preliminary yield trials (PYT)

Tested in Station trial

Nominated in IVT (Late), AICRP on pigeonpea
(2017-18)

Tested for three year under ICAR-AICRP on
pigeonpea (2017-18 to 2019-20)

Based on three years AICRP performance showed
23.47% and 24.38% superiority in grain yield over
the national check (Bahar) and zonal check (IPA
203) respectively

Identification proposal invited after concluding
AICRP on pigeonpea annual group meet (2020)
Fig 2. Flow chart details of development of variety
IPA 15-2 (Sharada)
 Naik et al.: IPA 15-2 (Sharada): A high yielding pigeonpea cultivar
subsequently notified in 85th meeting of the Central
Sub-Committee on Crop Standards, Notification and
Release of Varieties for Agricultural Crops held on 9th
November, 2020
The progressive performance of the entry at
station level led to further nomination for testing under
ICAR-All India Coordinated Research Project (AICRP)
on pigeonpea varietal adoptive trials. IPA 15-2 was
rigorously screened for yield stability, wilt and Sterility
Mosaic Disease (SMD) resistance, pod borer, pod bugs
and pod fly tolerance under ICAR-AICRP on
pigeonpea varietal adoptive testing trials from 2017-
18 to 2019-20. The IPA 15-2 variety has recorded
distinct genetic gain over its both the parents (NDA 1
and MAL 13) and National (Bahar) and zonal, IPA
203 (Prakash) check varieties.
Based on its unbeatable performance in AICRP
on pigeonpea testing trials, Sharada was identified
for release by Central Variety Release Committee
(CVRC), on 1st October, 2020 and subsequently notified
in 85th meeting of the Central Sub-Committee on Crop
Standards, Notification and Release of Varieties for
Agricultural Crops held on 9th November, 2020 for
commercial cultivation under rainfed/irrigated, timely
sown conditions of NEPZ comprising Uttar Pradesh,
Bihar, Jharkhand and West Bengal states.
DNA profiling of the variety IPA 15-2 (Sharada)
was performed using six pigeonpea specific SSR
markers (Table 1). Modified Kjeldhal, (1883) technique
was used for the estimation of whole grain crude
protein content, dry seed samples of IPA 15-2 was
taken for protein analysis (Satheesh et al., 2016).
RESULTS AND DISCUSSION
Yield superiority and adaptability
The variety IPA 15-2 (Sharada) was initially tested
in preliminary yield trial (PYT)and simultaneously for
wilt and sterility mosaic (SMD) disease resistance at
sick fields of ICAR-IIPR during 2015-16. Based on the
yield superiority over checks and stable resistance
reaction to wilt and SMD it was evaluated in 2016-17
station trial (ST) at ICAR-IIPR, Kanpur. The superior
Table 1. Details of the primers used in DNA profiling of IPA 15-2 (Sharada)
S. No. Marker Genomic Forward primer
Name Location (5'-3')
1. CcGM 17845 scaffold_LG01 CAATGAATATTGTCTTGAACAAATGA
2. CcGM 23176 scaffold_LG11 CACGTGGCATCATCCTTATG
3. CcGM17946 scaffold_LG10 AAAAATGATTTGTGTACGAGTTTT
4. CcGM19653 scaffold_LG10 GTGATGCTGAGATATTCTTGTCC
5. CcGM08701 scaffold_LG06 GCATTATTGATTCATCATTTTCG
6. CcGM12371 scaffold_LG06 AAGGTTAAAGGTGAATGGGGA
53
performance of IPA 15-2 in PYT and ST led to
nomination for Initial Varietal Trial (IVT) under All
India Coordinated Research Project (AICRP) on
Pigeonpea in 2017-18. The variety IPA 15-2 (Sharada)
was tested for three years (2017 to 2019) across seven
locations of North East Plain Zone (NEPZ) namely
Varanasi, Dholi, IARI Pusa (Bihar), CSAUA & T,
Kanpur, Ranchi, Chianki and Arual for yield stability
to reveal that the weighted mean grain yield of IPA
15-2 was 2266 kg/ha for the maturity duration of 250-
255 days. IPA 15-2 recorded 23.47% yield superiority
over the national check Bahar and 24.38% over the
recently released zonal check variety IPA 203
(Prakash). Of the total sixteen test locations, IPA 15-2
was superior in performance at ten locations (Table 1).
As inferred from the Table 3, the location wise
yield data analysis for the new variety IPA 15-2
(Sharada) showed that the testing centre Varanasi
(Uttar Pradesh) recorded the highest grain yield of 2998
kg/ha followed by Chianki (Jharkhand), CSAUA & T,
Kanpur (Uttar Pradesh) and Sabour (Bihar) with mean
grain yield of 2667, 2577 and 2558 kg/ha, respectively.
Stability in yield performance of IPA 15-2 at diverse
locations, situated in three different states, namely,
Uttar Pradesh, Bihar and Jharkhand indicated the
wider adaptability of the variety IPA 15-2 (Sharada).
Examination of the detail pedigree lineageof the new
variety IPA 15-2 (Sharada) unveiled that it
accumulated the alleles from five different genotypes
viz., Faizabad landrace, NDA 1, MA 2, MA 166 and
Bahar at different levels during the course of its
development. Presence of the landrace and most
popular variety Bahar as one of the parents may
possibly be a reason for wider resilience of the new
variety IPA 15-2 over temporal and spatial screenings
(Satheesh et al., 2020)
Morphological characteristics
The new variety has compact growth habit with
green stem and no pubescence on leaves. Its higher
yield is manifested due to high number of primary
branches (20-24 numbers) and number of pods per
plant (295-354). It grows up to 240-270 cm in height
and bears 50% flowering in the range of 150-158 days
Reverse primer Tm Product size Reference
(5'-3') (°C) (bp)
CCCAACCCGATCAAAATCTA 59.8 210 Bohra et al. 2017
ATGTGTGCATGGTTGCATCT 60.0 267 Bohra et al. 2017
AAATTCGACTTGCTGAAATCAA 58.9 156 Bohra et al. 2017
CATTTGAGCTATTCACTTCTTTC 59.0 235 Bohra et al. 2017
AA
AAACTATGAGGTGTGATGTGAT 58.5 227 Bohra et al. 2017
GA
TGGCTTGACATGCAAAGAAT 59.3 298 Bohra et al. 2017
54 Journal of Food Legumes 34(1), 2021

Table 2. Weighted mean grain yield, percent superiority and frequency data of IPA 15-2 (Sharada) in Coordinated
Varietal Trials (2017-2019)
Particulars Year of No. of IPA 15-2 Bahar NDA-1 MA 6 IPA 203
testing locations (New variety) (National (Zonal (Local check) (Zonal
Check) Check) Check)
Mean yield (kg/ha) 2017 (IVT) 4 2153 2012 1968 1945 0
a) Zonal: NWPZ 2018 (AVT 1) 5 2322 1804 1919 1674 1888
2019 (AVT 2) 7 2324 1726 1825 2027 1848
Weighted mean yield (kg/ha) 16 2266 1847 1904 1882 1868
Percentage increase or 2017 (IVT) 4 - (+)7.03 (+)9.40 (+)10.72 -
decrease over the checks 2018 (AVT 1) 5 - (+)28.73 (+)20.99 (+)38.71 (+)23.00
& qualifying varieties 2019 (AVT 2) 7 - (+)34.65 (+)27.34 (+)14.65 (+)25.76
Weighted mean percent superiority 16 - (+)23.47 (+)19.24 (+)21.36 (+)24.38
Frequency in the top 2017 (IVT) 4 2/4 0/4 0/4 0/4 -
three group over the 2018 (AVT 1) 5 3/5 0/5 0/5 0/5 1/5
years 2019 (AVT 2) 7 5/7 1/7 0/7 3/7 2/7
Weighted mean for frequency 16 10/16 1/16 0/16 3/16 3/12

Table 3. Centre and year wise grain yield (kg/ha) of pigeonpea variety IPA 15-2 and checks
Year Name of the No. of locations New variety Check varieties General CV (%)
trial IPA 15-2 Bahar NDA-1 MA 6 IPA 203 mean of
location
2017 IVT Dholi 1923 2135 1619 1737 - 1854 12.17
(Late) IARI Pusa (Bihar) 2255 1768 2124 1887 - 2009 11.01
CSAUA&T, Kanpur 1877 2451 2398 2009 - 2184 13.00
Sabour 2558 1693 1732 2146 - 2032 19.98
Zonal mean 2153 2012 1968 1945 - 2020 4.62
% increase or decrease - (+)7.03 (+)9.40 (+)10.72 - (+)6.62
2018 AVT 1 Banda 2313 2096 2231 1840 1948 2086 8.37
(Late) Varanasi 2998 2132 2754 2621 2472 2595 11.14
IARI Pusa (Bihar) 2260 1758 1642 1761 1858 1856 11.50
Chianki 2054 1996 1796 1337 1546 1746 15.52
Ranchi 1984 1036 1172 810 1614 1323 31.88
Zonal mean 2322 1804 1919 1674 1888 1921 11.32
% increase or decrease - (+)28.73 (+)20.99 (+)38.71 (+)23.00 (+)20.85
2019 AVT 2 Varanasi 2077 1458 1673 2102 1501 1762 15.71
(Late) Dholi 2358 1948 1734 2010 1911 1992 10.27
IARI Pusa (Bihar) 2296 1315 1256 1817 2099 1757 23.57
CSAUA&T, Kanpur 2577 2259 2535 2344 1964 2336 9.42
Ranchi 1852 1505 1447 1551 1655 1602 8.89
Chianki 2667 1460 1863 2198 1899 2017 19.87
Arual 2442 2135 2265 2167 1910 2184 7.95
Zonal mean 2324 1726 1825 2027 1848 1950 10.81
% increase or decrease (+)34.65 (+)27.34 (+)14.65 (+)25.76 (+)19.18

and requires 240-255 days to attain the maturity. The
base flower colour of ‘IPA 15-2’ is yellow however the
outer layer of the standard petal is red (Fig 3). The 100
seed weight is about 10-12 grams and possesses yellow
coty led on and creamy brown colored seed coat with
smooth surface (Fig 4). Presences of distinct
morphological traits serve as markers for easy
identification of the variety in context. Thus, it will
help in maintaining its genetic purity and admixture
from other varieties during large scale seed production.
Resistance to major diseases and insect pests
Fusarium wilt and sterility mosaic disease are
important yield reducing biotic stresses in pigeonpea
across the country. Fusarium wilt is an important soil
borne killer disease, which causes up to 100 percent
yield loss at favorable disease development condition.
Being soil borne, wilt disease is difficult to manage
through agro-chemicals. In this context, the variety
‘IPA 15-2’ has enhanced level of resistance to wilt
(15.11%) compared to the susceptible check variety ICP
2376 wherein 77.24% population died due to wilt
(Table 4). The high level of wilt resistance offers more
durability and ensure optimum crop stand in field.
Thus in turn manifests in higher yield per unit area
(Satheesh et al., 2012).
As inferred from the Table 5, the sterility mosaic
disease caused by Emaravirus, which is transmitted
 Naik et al.: IPA 15-2 (Sharada): A high yielding pigeonpea cultivar 55

Table 4. Reaction to Fusarium wilt diseases (Percent wilt

incidence recorded during 2018-19)
Disease Location New Resistant Susceptible
name Variety check check
IPA 15-2 (ICP 8863) (ICP 2376)
Fusarium Bangalore 9.00 8.50 97.00
wilt Gulbarga 13.23 8.05 77.50
Akola 7.69 7.14 22.34
Khargone 26.00 - 92.00
Sehore 21.36 9.95 73.47
IIPR 9.15 - 96.94
Kanpur
Ranchi 19.31 - 81.43
Average wilt incidence 15.11 8.41 77.24
Table 5. Reaction to sterility mosaic diseases (Percent
SMD incidence recorded during 2018-19)
Disease Location New Susceptible Susceptible
name Variety check-1 check-2
IPA 15-2 (ICP 2376) (ICP 8863)
Sterility Badnapur 7.69 0.00 100.00
Mosaic Rahuri 28.59 74.18 100.00
Fig 3. Field view and varietal description of IPA 15-2 Disease Dholi 9.20 74.00 62.00
Ludhiana 16.98 - 2.00
Average SMD incidence 15.62 49.39 66.00

Fig 5. Gel images illustrating DNA profiling of IPA 15-2

L: Ladder 100 bp standard DNA, 1: Pusa151, 2: IPA203,
Fig 4. Grain and dal of IPA 15-2 3: Bahar, 4: NA1, 5: BRG2, 6: IPA206, 7: MA6, 8: IPA15-2

Table 6. Reaction of pigeonpea variety IPA 15-2 (Sharada) to Insect Pests incidence
Parameters New variety Check entries SEm± CD 5%
IPA 15-2 Bahar IPA 203 NDA 1 MA 6 MAL 45
(NC) (ZC) (PC-1) (PC-2) (PC-3)
Flowering 143 147 141 144 143 150 -- --
Pod damageby H. 6 6.73 7.25 4.44 6.25 8.97 0.92 2.76
armigera
Pod damageby M. obtusa 28.31 43.56 36.44 18.25 22.38 38.25 1.76 5.28
Total pod damage (%) 34.31 50.29 43.69 22.69 28.63 47.22 -- --
Pod damage by Pod fly 51.00 36.00 31.67 47.33 33.67 37.00 1.954 5.85
(%) (45.55) (36.84) (34.19) (43.44) (35.44) (37.44)
Grain damage by Pod fly 29.21 13.92 15.33 23.46 21.31 21.30 1.349 4.04
(%) (32.65) (21.86) (22.94) (28.90) (27.48) (27.45)
PRR 4 6 6 3 4 -- -- --

through Eriophyid mite (Aceria cajani
Channabasavanna) is another major reproductive
constraint in pigeonpea. The new variety IPA 15-2 has
only 15.62% mortality as compared to susceptible
check ICP 8863, which recorded 66.00% mortality.
The long duration pigeonpea varieties need to
with stand in the field for about 240-260 days.
Therefore, they get exposed to various kinds’ of insect
pests. In this regard the new variety has recorded 6%
pod damage by H. armigera and 28.31% damage by
Maruca obtuse whereas, the Bahar (National check)
recorded 6.73% and 43.56% pod borer damage, IPA
203 (Zonal check) reported 7.25% and 36.44% pod
borer damage and MA 6 (Local check) reported 6.25%
and 22.38% pod damage by H. armigera and M. obtuse,
respectively (Table 6).
56 Journal of Food Legumes 34(1), 2021
DNA fingerprinting
Six pigeonpea specific polymorphic SSR markers
(Table 7) were used for DNA fingerprinting of the new
variety IPA 15-2 (Sharada) to distinguish it from other
varieties and parents. An amplicons of 280bp for the
SSR marker CcGM 23176 was specific to the variety
IPA 15-2 as given in the figure 5. Along with the distinct
morphological features, the SSR marker based
differentiation would certainly be additional
advantage to distinguish IPA 15-2 from other varieties
during the course of seed production and maintenance
of genetic purity.
CONCLUSION
Pigeonpea variety ‘IPA 15-2 (Sharada)’ is widely
adopted in North East Plain Zone comprising the
states of Uttar Pradesh, Bihar, Jharkhand and West
Bengal. Under rainfed condition, it has recorded 2998
kg/ha grain yield. Cultivation of ‘IPA 15-2’ pigeonpea
variety would provide enhanced level of resistance
against wilt and sterility mosaic diseases and thereby
assured optimum crop stand and economic yield under
well managed field. IPA 15-2 has 19% crude grain
protein content. Therefore, being superior in several
aspects, the new variety IPA 15-2 would be popular
among the farmers, millers and consumers.
REFERENCES
FAOSTAT. 2019. Food and agriculture organization of the
united nations, Rome.
Food and Agricultural Organization. 2018. Land and water
resource planning. http://www.fao.org/land-water/
overview/en/
Ministry of Agriculture and Farmers Welfare, Department
of Agriculture, Cooperation and Farmers Welfare,
Directorate of Economics and Statistics, First Advance
Estimates of Production of Foodgrains for 2020-21.
http://agricoop.gov.in
Ministry of Agriculture and Farmers Welfare. Department
of Agriculture, Cooperation and Farmers Welfare,
Crops Division. Krishi Bhavan. Pulses Revolution from
Food to Nutritional Security. https://farmer.gov.in/
Sucess Report 2018-19.pdf
Kjeldahl J. 1883. New method for the determination of
nitrogen in organic substances. Fresenius’ Zeitschrift
für Analytische Chemie. 22 (1): 366-383.
Satheesh Naik SJ, Singh IP, Abhishek Bohra, F. Singh, D
Datta, RK. Mishra, Shefali Tyagi, Alok Kumar Maurya
and NP Singh. 2020. Analyzing the genetic relatedness
of pigeonpea varieties released over last 58 years in
India. Indian J. Genet., 80(1) 70-76 DOI: 10.31742/
IJGPB.80.1.9
Satheesh Naik SJ, Farindra Singh, Raj Kumar Mishra,
Abhishek Bohra, IP Singh, SK Chaturvedi, Jagdish
Singh and NP Singh. 2016. Characterization of
genotypes for wilt, quality and agronomic traits in
vegetable pigeonpea [Cajanus cajan (L.) Millsp.]. J. Food
Legume, 29(3&4): 216-219.
Satheesh Naik SJ, M Byregowda and SC Venkatesh. 2012.
Molecular diversity among pigeonpea genotypes in
response to SMD. J. Food Legume. 25(3): 194-200.
 Journal of Food Legumes 34(1): 57-59, 2021

Short Communication

Yellow mosaic disease status of mungbean genotypes grown in

South-Eastern Rajasthan
DL YADAV*, SL YADAV, KHAJAN SINGH, PRATAP SINGH and MANJU MEENA

Agriculture University,
Kota-324001(Rajasthan)
*Email: dlaau21@gmail.com
Received: January 14, 2021
Accepted: June 06, 2021
Handing Editor: Dr. Mohd. Akram,
ICAR-Indian Institute of Pulses Research,
Kanpur
ABSTRACT
Mungbean yellow mosaic virus is one of the begomoviruses causing yellow
mosaic diseasein mungbean and limiting the production and productivity
in India. Fifty three mungbean genotypes were screened for identifying
resistance against Mungbean yellow mosaic virus in natural conditionduring
summer 2020. Out of fifty three genotypes, forty genotypesviz., HUM 16,
IPM 101-102, IPM 139, IPM 1604-1, IPM 205-7, IPM 2-14, IPM 2-3, IPM 410-
3, IPM 604-16, IPM 610-2, IPM 99-125, IPMD 604-1-7, LGG 460, LGG 600,
MH 1762, MH 1703, MH 1871, MH 421, MML 2560, MML 2575, OBGG 107,
OBGG 108, PANT M-5, PM 1520, PM 1601, PUSA 19111, PUSA 1971, PUSA
9531, PUSA BM 3, PUSA VISHAL, SML 1932, SML 1933, SML 668, SML 832,
TCADM 19-1, VGG 15-013, VGG 17-002, VGG 17-019, VGG 17-043 and
VGG 18-002 were found resistant. However, HUM 1, PANT M-2, PM 1602,
PUSA BM 9, VGG 16-047, VGG 17-049 and VGG 17-40 were identified as
moderately resistant. ADT 3, COGG 8, SKNM 1801 and HUM 12 were
identified as susceptible and DGGV 91 and SML 1082 as highlysusceptible.

Key words: Genotypes, Mungbean, MYMV

Mungbean (Vigna radiata L. Wilczek) is an the AICRP on MULLaRP, Agricultural Research

important pulse crop cultivated across the country
during Kharif, Rabi and Spring/Summer season.
Mungbean yellow mosaic virus (MYMV), transmitted
through the whitefly (Bemisia tabaci) in the persistent
manner is one of the most pernicious diseases of Vigna
species. The early symptoms of the virus become
evident with the development of yellow specks along
the veinswhich progressively spreads and turns the
entire leaf yellow.Upon severe infection, leaves become
completely yellow and produce lesser flowers and
pods.Most of these genotypes studied in the paper
have been released as resistant. The disease is also
serious in Punjab and sometimes causing complete
losses (up to 100%) depending on the genotypes and
age of the plant (Yadav and Brar, 2005). The yield loss
from the viral diseases in pulses accounts upto 80
percent, while the MYMV alone causes losses upto 80
to 100 percent in mungbean (Naimuddin, 2001). Yadav
and Brar, (2010) revealed that per plant reduction in
seed yield varied from 22.3 to 61.7 per cent under
resistant (grade 1) to highly susceptible (grade 9) in
comparison to healthy control. On an average 43.6%
reduction in seed yield were assessed on moderate
level of susceptibility (grade 5) over healthy control.The
latest investigation on the sources of resistance is
present need of the day. Therefore, it is necessary to
develop resistant varieties is an ideal way of managing
the disease and the production cost as well as to protect
the environment.The investigation was carried out at
Station, Kota, Agriculture University, Kota. A total of
53 diverse genotypes of mungbean were screened
against yellow mosaic virus disease under disease
epiphytotic conditions. The field screening trials were
laid in randomized block design with two replications
during the summer season of 2020. Each plot consisted
of a single row of three-meter length with 30cm and
10cm row to row and plant to plant spacing,
Scale Description
0 No visible symptoms on leaves
1 Very minute yellow specks on leaves
2 Small yellow specks with restricted spread covering
0.1-5% leaf area of plant
3 Yellow mottling of leaves covering 5.1-10% leaf area of
plant
4 Yellow mottling of leaves covering 10.1-15% leaf area
of plant
5 Yellow mottling and discolouration of 15.1-30% leaf
area of plant
6 Yellow discolouration of 30.1-50% leaf area of plant
7 Pronounced yellow mottling and discolouration of
leaves and pods, reduction in leaf size and stunting of
plants covering 50.1-75% foliage of plant
8 Severe yellow discolouration of leaves covering 75.1-
90% of foliage, stunting of plants and reduction in pod
size
9 Severe yellow discolouration of leaves covering above
90.1% of foliage of plants, stunting of plants and no pod
formation
58 Journal of Food Legumes 34(1), 2021

respectively. Disease scoring was done on the basis of Table 1. Disease reaction, incidence of Mungbean yellow
the visual symptoms. Plants were randomly selected mosaic virus on genotypes of mungbean under
and their leaves showing clear symptoms (veinal natural epiphytotic condition of South-Eastern
yellowing and scattered bright yellow spots) and total Rajasthan during summer 2020
leaves were counted and percent disease indexwas Sr. No. Genotypes Disease % disease Reaction
grade severity
calculated by using the formula given by Modified
1 ADT 3 7 42.5 S
MULLaRP scale (0-9). Scoring was done after 80% of 2 COGG 8 7 53.5 S
the plant showed incidence based on 1-9 modified 3 DGGV 91 9 96.5 HS
scale All India Coordinated Research Project on 4 HUM 1 3 6.5 MR
MULLaRP by Alice and Nadarajan, (2007). 5 HUM 16 1 2.8 R
6 IPM 101-102 1 2.9 R
Percent Disease Severity Rating Reaction 7 PDM 139 1 1.5 R
0.1-5 1 to 2 Resistant 8 IPM 1604-1 1 1.6 R
5.1-15 2.1 to 4 Moderately Resistant 9 IPM 205-7 1 1.2 R
15.1-30 4.1 to 5 Moderately Susceptible 10 IPM 2-14 1 1.4 R
30.1-75 5.1 to 7 Susceptible 11 IPM 2-3 1 0.4 R
75.1- 100 7.1 to 9 Highly Susceptible 12 IPM 410-3 1 1.7 R
Percentage disease index was calculated by using the 13 IPM 604-16 1 1.4 R
14 IPM 610-2 1 1.6 R
formula given by Wheeler (1969)
15 IPM 99-125 1 1.5 R
Sum of all the numerical ratings 16 IPMD 604-1-7 1 1.6 R
17 LGG 460 1 0.5 R
Percent Disease Index = [(Sum of plants in each rating
18 LGG 600 1 2.5 R
x 100)/ (Total number of observations × Maximum 19 MH 1762 1 2.5 R
disease rating)] 20 MH 1703 1 1.5 R
21 MH 1871 1 0.9 R
The results (Table 1 & 2) showed significant 22 MH 421 1 0.8 R
difference among the genotypes for the level of 23 MML 2560 1 0.3 R
resistance against the disease. Out of fifty three 24 MML 2575 1 0.4 R
genotypes, forty genotype viz., HUM 16, IPM 101-102, 25 OBGG 107 1 1.5 R
26 OBGG 108 1 1.5 R
IPM 139, IPM 1604-1, IPM 205-7, IPM 2-14, IPM 2-3, 27 PANT M-2 3 5.5 MR
IPM 410-3, IPM 604-16, IPM 610-2, IPM 99-125, IPMD 28 PANT M-5 1 1.6 R
604-1-7, LGG 460, LGG 600, MH 1762, MH 1703, MH 29 PM 1520 1 1.5 R
1871, MH 421, MML 2560, MML 2575, OBGG 107, 30 PM 1601 1 1.9 R
OBGG 108, PANT M-5, PM 1520, PM 1601, PUSA 31 PM 1602 3 5.5 MR
32 PUSA 19111 1 1.8 R
19111, PUSA 1971, PUSA 9531, PUSA BM 3, PUSA 33 PUSA 1971 1 1.9 R
VISHAL, SML 1932, SML 1933, SML 668, SML 832, 34 PUSA 9531 1 1.6 R
TCADM 19-1, VGG 15-013, VGG 17-002, VGG 17-019, 35 PUSA BM 9 3 5.5 MR
VGG 17-043 and VGG 18-002 were found resistant. 36 PUSA BM 3 1 0.2 R
37 PUSA VISHAL 1 1.5 R
However, HUM 1, PANT M-2, PM 1602, PUSA BM 9,
38 SKNM 1801 7 33.5 S
VGG 16-047, VGG 17-049 and VGG 17-40 exhibited 39 SML 1082 9 94.5 HS
moderately resistant, Whereas, ADT 3, COGG 8, SKNM 40 SML 1932 1 2.5 R
1801 and HUM 12 as susceptible and DGGV 91 & 41 SML 1933 1 1.5 R
SML 1082 were found highly susceptible. Resistant 42 SML 668 1 2.1 R
43 SML 832 1 2.5 R
44 TCADM 19-1 1 3.5 R
45 VGG 15-013 1 2.5 R
46 VGG 16-047 3 6.5 MR
47 VGG 17-002 1 2.5 R
48 VGG 17-019 1 2.5 R
49 VGG 17-043 1 0.4 R
50 VGG 17-049 3 6.5 MR
51 VGG 17-40 3 6.8 MR
52 VGG 18-002 1 1.7 R
53 HUM 12 7 42.5 S

genotypes possessing better phenotypic characters

and yield attributes identified in these studies could
be utilized in mungbean improvement programme.
Yadav and Brar (2010) evaluated 40 genotypes against
Fig 1. Experiment view at AICRP on MULLaRP, ARS, MYMV, two genotypes namely NM 57 and NM 94
AU, Kota were found resistant and four genotypes (PBM 118,
 Yadav et al.: Yellow mosaic disease status of mungbean genotypes grown in South-Eastern Rajasthan
Table 2. Grouping of mungbean genotypes based on their response to MYMV during summer 2020
S.No. Disease % infection Categories
severity
1 0 No infection Immune
2 1 1% or less plant Resistant
3 3 1-10% Moderately
resistant
4 5 11-20% Moderately
susceptible
5 7 21-50% Susceptible
6 9 More than 51% Highly susceptible
PBM 121, PBM 123 and A 3) were found moderately
resistant. The results of the present screening were in
close agreement with the previous findings. The
resistance nature of the genotypes IPM-02-03 and HUM
16 have also been reported by several scientists
(Asthana, 1998 and Subedi et al., 2016). Awasthi and
Singh (2008) also screened the mungbean germplasm
for field resistance to mungbean yellow mosaic India
virus and observed that germplasm evaluated at
different locations exhibited different level of
resistance. Twenty eight genotypes including five
commercial varieties (PBM 1, PBM 2, ML 267, ML 613,
and ML 818) showed 7.0–20.0% viral severity and
considered as moderately resistant from Bathinda.
Kooner and Cheema (2007) reported high severity of
MYMIV in ML 267 and ML 613 and SML 668 from
Ludhiana. It proves that germplasm evaluated at
different locations exhibited different level of
resistance. Among all these genotypes, four genotypes
viz., ADT 3, COGG 8, SKNM 1801 and HUM 12 were
found susceptible with severity of 33.5-53.5% whereas
two viz., DGGV 91 andSML1082were highly
susceptible with 94.5-96.5% severity (Table 1). In severe
cases of infection, the leaves and other plant parts
become completely yellow. It can be well concluded
that integration of resistant sources of cultivars
cheapest way of disease management with no
environmental concern of pesticide residues.
ACKNOWLEDGEMENT
The authors are grateful to The Project
Coordinator, AICRP on MULLaRP, ICAR-IIPR, Kanpur
for providing genotypes.
59
Reaction group Total No. of Genotypes
genotypes
I 0 None
R 40 HUM 16, IPM 101-102, IPM 139, IPM 1604-
1, IPM 205-7, IPM 2-14, IPM 2-3, IPM 410-
3, IPM 604-16, IPM 610-2, IPM 99-125,
IPMD 604-1-7, LGG 460, LGG 600, MH
1762, MH 1703, MH 1871, MH 421, MML
2560, MML 2575, OBGG 107, OBGG 108,
PANT M-5, PM 1520, PM 1601, PUSA
19111, PUSA 1971, PUSA 9531, PUSA BM
3, PUSA VISHAL, SML 1932, SML 1933,
SML 668, SML 832, TCADM 19-1, VGG 15-
013, VGG 17-002, VGG 17-019, VGG 17-
043 and VGG 18-002
MR 7 HUM 1, PANT M-2, PM 1602, PUSA BM 9,
VGG 16-047, VGG 17-049 and VGG 17-40
MS 0 None
S 4 ADT 3, COGG 8, SKNM 1801 and HUM 12
HS 6 DGGV 91 and SML 1082
REFERENCES
Alice D and Nadarajan N. 2007. Screening techniques and
assessment methods for disease resistance, Department
of Pulses, TNAU. All India Coordinated Research
Project on MULLaRP-Tamil Nadu Agricultural
University Kasturi Graphics and Printers, Coimbatore-24.
Asthana AN. 1998. Pulse crops research in India. Indian
Journal of Agricultural Sciences.; 68(8): 448–452.
Awasthi, LP and Singh, S. 2008. Screening of mungbean
germplasm for field resistance to mungbean yellow
mosaic virus. New Botanist 35: 65-70.
Kooner, BS and Cheema, HS. 2007. Screening of mungbean
germplasm against whitefly (Bemasia tabaci Genn.) and
mungbean yellow mosaic virus. Acta Hort. 752: 307-310.
Naimuddin 2001. Major viral diseases of pulses and their
management. India: Indian Institute of Pulses Res
Kanpur; 2001. p. 1–22.
Subedi S, Neupane S and Ghimire TN 2016. Screening of
mungbean and black gram genotypes as sources of
genetic resistance against Mungbean Yellow Mosaic
Disease. Nep J Agril Sci.; 14: 148–155.
Wheeler BEJ. 1969. An Introduction to plant disease. John
Wiley and Sons Ltd, London, 9-364.
Yadav, MS and Brar, KS.2005. Screening of Vigna radiata
genotypes against mungbean yellow mosaic virus and
estimation of yield losses. Plant Disease Research 20: 90.
Yadav, MS and Brar, KS. 2010. Assessment of yield losses
due to Mungbean yellow mosaic India virus and
evaluation of mungbean genotypes for resistance in
South-West Punjab. Indian Phytopath. 63(3): 318-320.
 Journal of Food Legumes 34(1): 60-63, 2021

Short communication

Effect of pre-storage infestation levels of Callosobruchus analis (F.)

on mungbean
RAJNISH DWIVEDI1 , SANJAY M BANDI2*, REVANASIDDA2 ,
PRASTUTI MISHRA2 and BANSA SINGH2

1
Bundelkhand University, Jhansi, UP.;
2
ICAR-Indian Institute of Pulses Research,
Kanpur
*E-mail: sanjaysmb@gmail.com
Received: March 11, 2021
Accepted: May 178, 2021
Handling Editor: Dr. Gaurav Kumar
Taggar, PAU, Ludhiana
ABSTRACT
The bruchids are major post-harvest pests of several legumes throughout
the tropical and sub-tropical regions of the world. Bruchid infestation
commences from mature pods and seeds in the field which persists and
increases rapidly during storage causing nearly total loss of stored pulses
depending on the duration of storage. A study was conducted to determine
the population build-up and seed damage following 48 h exposure of
mungbean to varied initial infestation levels, viz. one, two, three, four and
five pairs of Callosobruchus analis (F.). A significant positive correlation
was observed for infestation levels (r =0.98) and F1 population (r= 0.97)
with seed damage. The regression studies indicated 99% variability in the
seed damage due to initial infestation, egg density and population build
up after F1 generation. Although the population build-up (F= 20.57,
df= (4,15), P < 0.05) and associated seed damage (F= 22.56, df= (4,15),
P < 0.05) were considerably higher when mungbean seeds carried initial
infestation of five pairs of beetles. The egg-to-adult developmental period
of F1 generation based on Howe’s parameter was found to be 29 days in
mungbean. The results indicated that a small initial infestation of C. Analis
could multiply rapidly and cause considerable damage to mungbean during
storage.

Key words: Bruchids, Callosobruchus analis (F.), Mungbean, Seed damage

Grain legumes or pulse crops are the mainstay of
Indian agriculture and principle source of dietary
protein especially among the vegetarian population
of the country. India is the leading producer (22.08
MT) and consumer of pulses in the world contributing
around 25-28% of the global pulse production (DAC
& FW 2020). Pulses in the tropical and subtropical
countries are prone to infestation by bruchids in the
field as well as during post-harvest storage. However,
the major losses are inflicted during storage where the
pest multiplies rapidly and spreads to the uninfested
seed lots. Bruchids are reported to breed successfully
on a number of legume seeds in store-houses. The
mature adult emerging from the seeds neither need
water nor food resources to reproduce (Credland 1987).
The larval stages are internal feeders on the seeds, thus
rendering them unfit for human consumption,
reducing seed viability, seed weight and commercial
value of the seeds (Olubayo and Port 1997). Bruchids
are cosmopolitan pests infesting pods and seeds of
legume crops. The pre-harvest infestation by some
bruchid species seldom reaches 1-2% at field level
(Southgate 1979) however, this population multiplies
dramatically reaching to a level of 80% in about 6-8
months of storage and causing up to 100% loss of
stored seeds (Singh et al. 1978; Caswell 1961).Post-
harvest losses caused by bruchids vary according to
crop species, type of cultivar and bruchid species. The
losses due to C. maculatus were up to 90% in blackgram
(Soundararajan et al. 2012), 10–78% in pigeonpea
(Jadhav et al. 2012) and 4–90% in cowpea (Maina et al.
2012; Amusa et al. 2013). Both C. maculatus and
C. chinensis caused 7–73% losses in mungbean (Somta
et al. 2008) during storage (as reviewed by Mishra et al.
2018). The C. maculatus is capable of causing up to
100% seeddamage and 60% weight loss within
4 months of cowpea storage (Tanzubil, 1987). Singal
et al. (1989) reported complete damage of chickpea
grains when the initial infestation was between 2 to 5
pairs of C. maculatus after the second generation.
Studies on varied levels of pre-storage infestation levels
of C. Analis on mungbean storage are lacking hence,
the effect of initial infestation levels of C. analis was
assessed for one generationin mungbean.
The pulse beetles were reared on sterilized
healthy seeds of mungbean following the procedure
of Strong et al. (1968). About 100 g seeds of mungbean
 Dwivedi et al.: Effect of pre-storage infestation levels of Callosobruchus analis (F.) on mungbean 61

was infested with 25 pairs of adult beetles (0-3 days

old). After 3 days, all the adults were removed and
seeds containing eggs were incubated for adult
emergence at 27 ± 1oC and 65 ± 5% relative humidity.
The male and female beetles were separated based on
the distinctive pygidium characters following
Halstead (1963).The healthy and disinfested
mungbean seeds (20 g) were exposed to five levels of
initial infestation, viz. one, two, three, four and five
pairs of C. analis adults (0-3 days old) separately in a
Petri dish and each infestation level was replicatedfour
times in CRD. The adult beetles were discarded at 48 h
Fig 1. The egg density, F1 population build-up and
post-release and seeds were incubated for bruchid
seed damage in mungbean at different levels of
development. To study the mean developmental time
C. analis infestation
of C. analis on mungbean, a separate set of 100 pre-
sterilized seeds was infested with two pairs of 0 to 3
days old beetles and incubated for F1 development.
The observations on oviposition and F1 emergence
were recorded for one generation from different levels
of infestation. The percent seed damage was calculated
following Khattak et al. (1995) using observations on
number of hallowed seeds. The F1 population was
recorded from the first day of emergence to a period of
15 days continuously to compute Mean Developmental
Period (MDP) as described by Howe (1971). The F1
emergence and seed damage was correlated with
infestation levels. Multiple regressions were fitted with Fig 2. The F1 adult emergence pattern of C. Analis in
seed damage as dependent variable (Y) and other mungbean
factors (infestation levels, eggs laid, F1 population) as beetles which differed significantly from rest of the
independent variables (X). The data on eggs laid, seed infestation levels (F = 22.57, df = (4, 15), P < 0.05). The
damage and F1 population was analyzed using one- infestation levels (r (3) = 0.98; P < 0.01), egg load (r (3)
way ANOVA followed by Tukey’s HSD post hoc tests = 0.99; P < 0.01) and population build-up (r (3) = 0.97;
(P = 0.05) in SPSS 16.0 (SPSS Inc., Chicago, IL). P < 0.01) was positively correlated with seed
The F1 population build-upand associated seed damagefor one generation (Table 1).
damage at different levels of bruchid infestation in The relationship between egg density, population
mungbean are depicted in Fig. 1. The mean egg build-up for F1 generation with seed damage after
deposition on mungbean at 48 h post-infestation infestation with varied beetle population is depicted
differed significantly (F = 14.46, df = (4, 15), P < 0.05) in Fig. 3 along with regression equation and coefficient
and was highest (154.75 eggs) on seeds exposed to 5 of determination (R2). It was evident that an increase
pairsof beetles. The C. analis F1 emergence in in initial infestation level by one pair, the seed damage
mungbean commenced on 27th days post-oviposition. was increased by 4.86 %. While for every unit increase
The peak emergence (7.33 adults) was attained on of F1 population, the seed damage was increased by
second day and gradually declined thereafter but 0.20 %. Among the three models, the coefficient of
continued up to 11 days (Fig. 2). The mean determination was highest (R 2=0.99) when the
developmental period of C. analis from egg-to-adult independent variable was F1 population build-up. The
wasfound to be 29 daysin mungbean. The F1 emergence multiple regression model for seed damage after F1
gradually increased from 25 to 125 with infestation generation determined by three factors, viz. eggs
level from 1 to 5 pairs. Significantly higher adults density, F1 population and infestation levels was;
(125.50) emerged at an infestation level of 5 pairs (F = Percentage of seed damage = – 0.328 + 0.563 (levels of
20.57, df = (4,15), P < 0.05), while in the rest of the infestation) + 0.016 (egg density) + 0.156 (F1 population
infestation levels, it was comparable. build-up). The model describes magnitude of seed
The seed damage was varied significantly damage by pulse beetles where initial infestation
between 5 to 25% in different bruchid infestation levels, egg density and F1 population build-up are
levelspost F1 emergence. The highest seed damage specified. The R2 value (0.99) in multiple regression
(25%) was noticed in the seeds infested with 5 pairs of analysis indicated 99% of variability in seed damage
62 Journal of Food Legumes 34(1), 2021
Fig 3. Relationship between (a) seed damage(Y) and infestation levels (X) of C. analis (P<0.05); (b) Seed damage (Y)
and egg density (X) (P<0.05); (c) Seed damage (Y) and F1 population (X) (P<0.05)
by bruchids which was accounted by three factors,
viz. infestation level, eggs load and F1 adult
population. In the present study, the egg density was
considerably higher at infestation level of 5 pairs
whereas egg density in rest of the infestation levels (1
to 4 pairs) was comparable. Adesina and Idoko (2014)
found no significant difference in egg load between
infestation levels of 1 and 3 pairs or 5, 8 and 10 pairs
of C. maculatus in cowpea. The F1 population and
associated seed damage was higher when seeds were
infested by 5 pairs of beetles however effect of other
infestation levels, viz. 1, 2, 3 and 4 pairs, were
statistically comparable. The seed damage was
proportional to the population build-up in F1
generation. Present results are in line with those of
Patro et al. (2007) on C. chinensis infestation in
mungbean and urdbean. Adesina and Idoko (2014)
reported that F1 progeny and concomitant seed
damage in cowpea did not vary considerably when
seeds carried initial infestation of 3, 5, 8 and 10 pairs
of C. maculatus however seed damage was significantly
lesser when infested with 1 pair of beetles.The
coefficient of determination in the present study
revealed 99 % variability in seed damage was caused
by independent variables. Singal et al. (1989) reported
the correlation between grain damage and C. chinensis
adult emergence in chickpea, and 97% variability in
grain weight loss after F1 generation was due to initial
infestation, beetle emergence and seed damage. The
egg-to-adult developmental period of C. analis based
on Howe’s (1971) parameter was found to be 29 days
in mungbean. Swella and Mushobozy (2009) found
mean developmental period of 31 days for
C. maculatus in mungbean.
Table 1. Pearson’s correlation betweeninfestation
levels, egg density, F1 population build-up and
seed damage by bruchids for one generation
Levels of Eggs laid F1 % DAC & FW. 2020. First advance estimates of production of
infestation emergence damage
Levels of 1 0.974** 0.976** 0.981**
infestation
Eggs laid 0.974** 1 0.999** 0.999**
F1 emergence 0.976** 0.999** 1 1.000**
% damage 0.981** 0.999** 1.000** 1 of an environment for insectdevelopment. J. Stored
**Correlation is significant at 0.01 level
The seed damage and population build-up of
C. analis in mungbean was found to be proportional
with increase in initial level of infestation from 1 to 5
pairs of beetles. However, seed damage and F1
population noticeably higher at 5 pair infestation after
the end of one generation. Thus it is evident that the
drastic population build up and associated seed
damage could happen at a meagre initial infestation
level of 5 sexual pairs of beetles for a short period (48
h) of time in mungbean. The further studies are needed
to quantify the losses for every generation of bruchids
at varied levels of initial infestation.
ACKNOWLEDGEMENT
The authors are thankful to the Director, ICAR-
IIPR, Kanpur (India) for providing necessary facilities
for carrying out the study at Storage Entomology
Laboratory, ICAR - IIPR Kanpur.
REFERENCES
Adesina JM and Idoko J. 2014. Effects of initial infestation
levels on damage to resistant and susceptible cowpea
by Callosobruchus maculatus (Fabr.). Archives of
Phytopathology and Plant Protection, 47(14): 1726–
1736.
Amusa OD, Adebayo L, Ogunkanmi AL, Bolarinwa K and
Ojobo O. 2013. Evaluation of four cowpea lines for
bruchid (Callosobruchus maculatus) tolerance. Journal
of Natural Science Research, 3: 46–52.
Caswell GH. 1961. The infestation of cowpeas in western
Region of Nigeria. Tropical Sci., 3: 154-158.
Credland PF. 1987. Effects of host change on the fecundity
and development of an unusual strains of
Callosobruchus maculatus (F.) (Coleoptera: Bruchidae).
J. Stored Prod. Res., 23(2): 91-98.
food-grains for 2020-21. Directorate of Economics and
Statistics. Ministry of Agriculture & Farmers Welfare,
Government of India.p. 02.http://agricoop.gov.in.
Accessed on 19.11.2020.
Howe RW. 1971. A parameter for expressing the suitability
Prod. Res., 7(1): 63–65.
 Dwivedi et al.: Effect of pre-storage infestation levels of Callosobruchus analis (F.) on mungbean
Jadhav DR, Mallikarjuna N and Rao GVR. 2012.
Callosobruchus maculatus resistance in some wild
relatives and interspecific derivatives of pigeonpea.
Indian J. Plant Prot., 40: 40–44.
Halstead DGH. 1963. External sex differences in stored-
products Coleoptera. Bull. Entomol. Res., 54(1): 119-
133.
Khattak SU, Jan KY, Hussain N and Khalil K. 1995.
Resistance of chickpea cultivars to pulse beetle,
Callosobruchus maculatus. Scientific Khyber 8: 1-8.
Maina YT, Mbaya AM and Mailafiya DM. 2012.
Susceptibility of six local and four improved cowpea
cultivars to Callosobruchus maculatus (F.) (Coleoptera:
Bruchidae) infestation in north eastern Nigeria. Journal
of Environmental Issues and Agriculture in
Developing Countries, 4: 31-37.
Mishra SK, Macedo MLR, Panda SK and Panigrahi J. 2018.
Bruchid pest management in pulses: past practices,
present status and use of modern breeding tools for
development of resistant varieties. Annals of Applied
Biology, 172(1): 4-17.
Olubayo FM and Port GR. 1997. The efficacy of harvest
time modification and intercropping as methods of
reducing the field infestation of cowpeas by storage
bruchid in Kenya. J. Stored Prod. Res., 33(4): 271-276.
Patro B, Sahu KC and Sahoo P. 2007. Effect of different
levels of Callosobruchus chinensis (Linn.) infestation on
deterioration of some pulse seeds. Legume Res., 30(4):
301-304.
63
Singal SK, Singh Z and Jaglan RS. 1989. Effect of different
levels of bruchids, Callosobruchus chinensis (L.)
infestation on chickpea, Cicer arietinum L. in India.
Tropical Pest Management, 35(2): 187-189.
Singh RR, Luse RA, Leuschuner K and Nangju D. 1978.
Groundnut oil treatment for the control of
Callosobruchus maculatus (F.) during cowpea storage. J.
Stored Prod. Res., 14: 77-80.
Somta C, Somta P, Tomooka N, Ooi PAC, Vaughan DA
and Srinivas P. 2008. Characterization of new sources of
mungbean (Vigna radiata (L.)Wilczek) resistance to
bruchids, Callosobruchus spp. (Coleoptera: Bruchidae).
J. Stored Prod. Res., 44:316–321.
Soundararajan RP, Chitra N, Geetha S and Poorani J. 2012.
Biological control of bruchid Callosobruchus maculatus
(F.) in blackgram. Journal of Biopesticides, 5: 192–195.
Southgate BJ. 1979. Biology of Bruchidae. Ann. Rev.
Entomol., 24: 449-473.
Strong RG. Partida GJ and Warner DN. 1968. Rearing stored
product insects forlaboratory studies, bean and cowpea
weevil. J. Econ. Entomol., 61: 747-751.
Swella GB and Mushobozy DMK.2009. Comparative
susceptibility of different legume seeds to infestation
by cowpea bruchid Callosobruchus maculatus (F.)
(Coleoptera: Chrysomelidae). Plant Prot. Sci., 45(1):
19-24.
Tanzubil PB. 1987. The use of neem products in controlling
the cowpea bruchid Callosobruchus maculatus. In:
Proceedings of the 3rd International Neem Conference
(Schmutterer H. and Ascher K. R. S., Eds.), pp. 517-523.
 Journal of Food Legumes 34(1): 64-67, 2021

Short communication

An improved screening method for identification of resistance to

bruchids in pulses
REVANASIDDA*1, ADITYA PRATAP2, DEBJYOTI SEN GUPTA2, AK PARIHAR2 ,
SANJAY M BANDI1, MOHD. AKRAM1, BANSA SINGH1 and NP SINGH3

1
Division of crop protection,
ICAR-Indian Institute of Pulses Research,
Kanpur, 2Division of crop improvement,
ICAR-Indian Institute of Pulses Research,
Kanpur, 3Division of Biotechnology,
ICAR-Indian Institute of Pulses Research,
Kanpur
*Email: Revanasidda@icar.gov.in;
rshlb1114@gmail.com
Received: January 24, 2021
Accepted: April 07, 2021
Handling Editor: Dr. Gaurav Kumar Taggar,
PAU, Ludhiana
ABSTRACT
The screening method involving key modifications in the existing ‘Free-
choice’ and ‘No-choice’ tests was developed at ICAR-IIPR, Kanpur for
the identification of sources of resistance in three pulse crops to bruchids.
The methodology challenged the genotypes to intense oviposition by
the bruchids in both the tests and incubated infested seeds for F1 adult
emergence after providing a sufficient time for insect development under
controlled conditions. The genotypes exhibiting resistant reactions in
the free-choice test were further validated by challenging them to bruchid
infestation in a single chamber. In no-choice test, the genotypes were
challenged in individual plastic vials. The infestation parameters were
recorded and the seed parameters were correlated to the bruchid
preference for different germplasm. Modifications in square shaped
free-choice chamber used for free-choice, exposing seeds to intense
oviposition for 3–7 days, and F1 emergence/seed damage count on daily
basis from the first day of emergence till 20th-day post-emergence were
the key modifications adopted in the methodology. Using this
methodology, 104 mungbean, 50 urdbean and 25 cowpea germplasm
were screened against three bruchid species. This methodology may
serve as an essential tool to identify potential resistance sources in legume
crops against bruchids and can provide a way to further elucidate the
physical, biochemical, and molecular basis of resistance.

Key words: Bruchid, Callosobruchus, Free-choice, No-choice, Resistance,

Screening

Host Plant Resistance (HPR), one of the
traditional yet most effective methods, is being adopted
for decades to identify the traits in the host plants that
offer resistance against the insect-pests. Bruchids
(Callosobruchus spp.) are known to be one of the most
devastating pests attacking pulses, both at field and
storage level. The considerable damage and economic
losses by bruchids are realized mostlyduring storage
of pulses where bruchids complete a major part of their
life cycle. To date, nearly 1700 species of bruchid
species have been described worldwide (Romero and
Johnson 2004), and among them, 20 species were
identified to be severe pests of pulses (Southgate 1979).
Several traditional, conventional and biotechnological
approaches have been employed to manage the
bruchids, but they could not completely eradicate the
bruchid menace across space and time (Mishra et al.
2017). Perhaps, numerous methods adopted
worldwide were found cost-ineffective, impractical
and proven non-sustainable making bruchid controla
difficult matter over the years (Credland 1994).
However, identifying bruchid resistance in traditional
cultivars or landraces was one of the age-old practices
and still, it is considered to be worthwhile, inexpensive
and compatible in the longer term since the resistant
sources are reliable, if identified through proper
screening or bioassay methods.
Screening of primary legumes for bruchid
resistance isa reliable method to identify the resistance
sources.The results would be unambiguous since this
method identifies the effect of host seeds on the
biological fitness of the insect which supports the fact
that ‘the essence of any control measure of insects is to
reduce its biological fitness (Began et al. 1990)’as it
takes into account the performance of bruchid
(fecundity, mortality and survival)or suitability of host
legume (preference, oviposition and damage). Hence,
a systematic screening of genotypes for bruchid
resistance was one of the long term requirements to
explore the potential resistant sources available in the
large germplasm bank with ICAR-IIPR, Kanpur
against the three bruchid species,viz. Callosobruchus
maculatus (L.), C. chinensis (F.) and C. analis (F.) which
 Revanasidda et al.: Improved screening method for identification of resistance to bruchids
are commonly distributed and reported to cause
enormous damage to the stored pulses across India
(Pruthi and Singh 1950; Raina 1970; Sengupta et al.
1984; Tuda et al. 2006).
An improved screening method involving major
modifications in existing ‘Free-choice’ and ‘No-choice’
tests (Howe 1971; Tomooka et al. 2000; Kashiwaba et
al. 2003; Sulehrie et al. 2003; Erler et al. 2009;
Duraimurugan et al. 2014; Soumia et al. 2015; Eker et
al. 2018) was developed at ICAR-IIPR, Kanpur (Fig. 1).
The methodology challenged the genotypes to severe
bruchid infestation and damage and the genotype
which suffered the least or no damage after thorough
screening would serve as a potential source for
bruchid resistance.
Fig 1. ‘Free choice’ and ‘No choice’ tests for screening
of pulses germplasm
The ‘free-choice’ tests were conducted in
artificially designed ‘square shaped screening
chambers’ (Fig. 2a) developed following modifications
overe arlier descriptions (Duraimurugan et al. 2014;
Soumia et al. 2015). The square-shaped chambers were
made up ofa wooden box covered with a removable
lid (60 x 60 x 18 cm L x W x H). The inner flat bottom of
the chamber included 21 disc-like craters (6.5 cm dia,
1 cm H, Fig. 2b) where seeds of the genotypes were
placed. In the center of the flat bottom, a single disc-
like crater (9 cm dia, 1 cm H) was made for insect release
(Fig. 2c). The upper lid of the chamber was made of
transparent glass with a wooden frame surrounding
(Fig. 2d) to observe the behavior of released insects for
their host preference (Fig. 2e).‘Free-choice’ test included
exposing a minimum of three replicative sets of seeds
(n= minimum 30 or more seeds per set) of each genotype
to bruchid infestation at the rate of one pair of adults
(male and female) per 10 seeds. In each chamber, seven
genotypes with three replications each were randomly
accommodated across 21 craters. Like this for each
experiment, more screening chambers were used to
screen the available set of germplasm at a time. The
insects were, then, released in the central crater and
allowed to choose the germplasm of their preference.
The genotypes which fell under the highly resistant or
65
Fig 2. Olfactory chambers to conduct ‘free choice’
screening test for pulses germplasm
resistant category which were screened along with
susceptible ones under multiple screening chambers
during the first experiment were validated by
challenging them collectively under one or more
chamber during the second/validating experiments.
The ‘No-choice’ tests were conducted in plastic
vials covered with caps. Small micro-pin holes were
made on the caps for aeration and also small enough
(< 0.05 mm) to prevent the entry of egg/grub/pupal
parasitoids which often affect the mortality of released
insect stages and ultimately, the interpretation of
screening bioassay results. In this test, in both first
and validating experiments, a replicative seed set (n =
minimum 30 or more per set) of each genotype was
exposed to the bruchid infestation in separate plastic
vials (each vial represented a replication). The insects
were released at the rate of one pair per 10 seeds and
unlike free-choice, were not given any choice for the
preference of germplasm. Hence, this test proves to be
the ultimate screening method to identify and validate
resistance genotypes since the released insects were
put under extreme selection for their survival.
In both the tests, preferably three to six day old
adults were used for screening studies. The male and
females were separated based on antennal and
pygidium characters. The released insects were
allowed to infest the seeds for a minimum of three days
to a maximum of one week. After infestation, the adults
were removed and the initial observations, viz.
oviposition, egg density, hatching success (Giga and
Smith 1987; Giga et al. 1993), and seed weight were
recorded, and the infested seeds were then incubated
till the F1 adult emergence. Once the F1 adults emerged,
the observations on seed damage (Boxall 1986), and
the number of adults that emerged (adult density%
survivability) were recorded on daily basis for the next
20 days. This was done to record the adults which are
taking longer time to emerge in few genotypes (may be
66 Journal of Food Legumes 34(1), 2021

due to some biochemical hindrance present in those

genotypes affecting for normal development of insect).

The daily adult observations were used to work

out the Mean Developmental Period (MDP) of bruchids
which was a pre-requisite to work out Howe’s (1971)
Susceptibility Index, a reliable method to categorize
the germplasm based on their resistance reaction
because this index considers the suitability of
environment (seeds of germplasms) for insect
development instead of considering only percent seed
damage (Weigand and Tahhan 1990; Singh et al. 1998).
Apart from this, the final observations on seed weight
were recorded to work the seed weight loss (Adams,
1976) due to bruchid damage. Seed morphological
parameters can affect the choice/preference of
germplasm by the bruchids, especially under free-
choice tests, and also the suitability of the germplasm
to bruchids under both the tests. Hence, important
morphological seed attributes like seed size, shape,
color, luster andhardiness were recorded for
correlation studies which provided broader insight to
understand the factors responsible for germplasm
resistance to bruchids.

Using this improved methodology, a total of 59

wild Vigna accessions (against C. chinensis and C.
maculatus), 45 advance breeding lines of mungbean
developed at ICAR-IIPR, 50 urdbean and 24 cowpea
lines (against C. chinensis, C. analis and C. maculatus)
were screened. The resistant reactions were
categorized based on Howe’s (1971) Susceptibility
Index (Soumia et al., 2015). Among the 59 wild Vigna
genotypes, 4 were found highly resistant or immune
(Howe’s SI values <0.00), 14 were resistant (<0.05), 10
were moderately resistant (0.051-0.059), 19 were
Fig 3. Reaction of different pulse germplasms under
moderately susceptible (0.061-0.070), 7 were
‘free-choice’ and ‘no-choice’ test against three bruchid
susceptible (0.071-0.080) and 3 were highly
species.
susceptible (>0.081). Among the 45 IIPR mungbean
advanced breeding lines, none were found to be highly This high throughput methodology involving
resistant, 2 were found resistant (SI <0.05), 6 moderately improved ‘free-choice’ and ‘no-choice’ screening
resistant (0.052–0.060), 17 moderately susceptible methods would serve as an essential tool to identify
(0.063–0.070),12 susceptible (0.071–0.079) and 8 were potential resistant sources in traditional landraces or
highly susceptible (0.082–0.098). Among the 50 advanced breeding materials against bruchid species
urdbean lines, all were immune to C. chinensis as this causing economic losses to stored pulses.The
species did not complete its life cycle in any of the germplasm found resistant can be validated further
genotypes. However, against C. analis and C. maculatus, by elucidating the physical, biochemical and molecular
none of the lines were found to be highly resistant, 7 basis of resistance. This would contribute significantly
were found resistant (<0.05), 21 moderately resistant in developing the bruchid resistant germplasm
(0.052–0.060), 7 moderately susceptible (0.061–0.070), through advanced breeding programs.
10 usceptible (0.073-0.079) and 5 were highly
susceptible (>0.081). Among the 25 cowpea genotypes, Acknowledgments
none were found to be highly resistant or resistant, The authors thank DBT, Government of India for
whereas, 1 was found moderately resistant (0.059), 6 providing financial assistance (Grant No. BT/Ag/
moderately susceptible, 7 susceptible and 11 were Network/Pulses-I/2017-18) to carry out the above
highly susceptible (Fig. 3). research activities.
 Revanasidda et al.: Improved screening method for identification of resistance to bruchids
References
Adams JM. 1976. Weight loss caused by development of
Sitophilus zeamais Motsch. in Maize. Journal of Stored
Products Research 12: 269-272.
Begon M, Harper JL and Townsend CR. 1990. Ecology
(Second edition). Oxford, Blackwell. 945 pp.
Boxall R. 1986. A critical review of the methodology for
assessing farm-level grain losses after harvest. Report
of the Tropical Development and Research Institute
G19. ISBN: 085954-208-4. http://gala.gre.ac.uk/id/
eprint/10793.
Credland PF. 1994. Bioassays with bruchid beetles:
problems and (some) solutions. Proceedings of the 6th
International Working Conference on Stored-Product
Protection,17-23 April 1994, Canberra, Australia. CAB
International, Wallingford, United Kingdom.ISBN:
0851989322. http://spiru.cgahr.ksu.edu/proj/iwcspp/
pdf2/6/509.pdf.
Duraimurugan P, Pratap A, Singh SK and Gupta S. 2014.
Evaluation of screening methods for bruchid beetle
(Callosobruchus chinensis) resistance in green gram
(Vigna radiata) and blackgram (Vigna mungo) genotypes
and influence of seed physical characteristics on its
infestation. Vegetos 27(1): 60–67.
Eker T, Erler F, Adak A, Imrek B, Guven G, Tosun HS, Sari
D, Sari H, Upadhyaya HD, Toker C and Ikten C. 2018.
Screening of chickpea accessions for resistance against
the pulse beetle, Callosobruchus chinensis L. (Coleoptera:
Bruchidae). Journal of Stored Products Research 76:
51-57.
Erler F, Ceylan FO, Erdemir T. and Toker C. 2009.
Preliminary results on evaluation of chickpea (Cicer
arietinum L.) accessions for resistance to Callosobruchus
maculatus F. Journal of Insect Science 9: 58.
Giga DP, Kadzere I and Canhao J. 1993. Bionomics of four
strains of Callosobruchus rhodesianus (Pic) (Coleoptera:
Bruchidae) infesting different food legumes. Journal
of Stored Products Research 29(1): 19–26.
Howe RW. 1971. A parameter for expressing the suitability
of environment for insect development. Journal of
Stored Products Research 7: 63–65.
67
Kashiwaba K, Tomooka N, Kaga A, Han OK and Vaughan
DA. 2003. Characterization of resistance to three
bruchid species (Callosobruchus spp. Coleoptera:
bruchidae) in cultivated rice bean (Vignaumbellata).
Journal of Economic Entomology 96: 207-213.
Mishra SK, Macedo MLR, Panda, SK. and Panigrahi J. 2017.
Bruchid pest management in pulses: past practices,
present status and use of modern breeding tools for
development of resistant varieties. Annals of Applied
Biology 172(1): 4-19.
Pruthi HS and Singh M. 1950. Pests of stored grain and
their control. Special number. Indian Journal of
Agricultural Sciences 18(4): 36-38.
Romero NJ and Johnson CD. 2004. Checklist of the
Bruchidae (Coleoptera) of Mexico. The Coleopterists
Bulletin 58: 613–635.
Singh KB, Ocampo B and Robertson LD. 1998. Diversity
for abiotic and biotic stress resistance in the wild
annual Cicer species. Genetic Resources and Crop
Evolution 45: 9-17.
Soumia PS, Chitra S, Dikshit HK and Pirasanna PG. 2015.
Screening for resistance against pulse beetle,
Callosobruchusa nalis (F.) in greengram (Vigna radiata
(L.) Wilczek) accessions. In: Proceedings of the National
Academy of Sciences, India-Section B: Biological
Sciences. 87: 551–558
Southgate BJ. 1979. Biology of the Bruchidae. Annual
Review of Entomology 24: 449–473. https://doi.org/
10.1146/annurev.en.24.010179.002313.
Sulehrie MAQ, Golob P, Tran BMD and Farrell G. 2003.
The effect of attributes of Vigna spp. on the bionomics
of Callosobruchus maculatus. Entomologia
Experimentalis et Applicata 106: 159-168.
Tomooka N, Kashiwaba K, Vaughan DA, Ishimoto M and
Egawa, Y. 2000. The effectiveness of evaluating wild
species: searching for sources of resistance to bruchid
beetles in the genus Vigna subgenus. Ceratotropis.
Euphytica 115: 27-41.
Weigand S. and Tahhan O. 1990. Chickpea insect pest in
the Mediterranean zones and new approaches to their
management. In: Chickpea in Nineties: Proceedings
of the Second International Workshop on Chickpea
Improvement, Hyderabad, India169-175 pp.
 Journal of Food Legumes 34(1): 68-69, 2021

Commentary

A hidden threat of deteriorating nutritional quality of

pulses under climate change
PS Basu

Principal Scientist With more than 25 years of research experience in abiotic

ICAR-Indian Institute of Pulses stress physiology in thermal microorganisms such
Research, Kanpur cyanobacteria and higher plants including legumes and
vegetables, Dr PS Basu has made significant contributions
in evolving varieties and donors tolerant to heat and
Email: psbsu59@gmail.com
drought in legumes and vegetables and deciphered the
mechanisms of adaptation of pulses to diverse climatic
conditions. He is member of International Society of
Drought Mitigation and Climate Change and has established international
collaboration with CSIRO, Australia and JIRCAS Japan in the field of stress
physiology and evaluated diverse legume germplasm through advanced
molecular and Physiological tools. His current research interest is long term
projections of climate change on agricultural productivity, developing
varieties resilient to adverse climates and crop modeling. He is recipient of
several national and International awards including ATSE Crawford
Fellowship, Australia; Gold Medal by Indian Potato Association, Shimla;
Fellow of IPA and ISPRD to name a few.

Pulses, an inevitable part of our daily diet, are
the nutrient-dense food items on which a large section
of people in the world depends upon heavily for plant-
based proteins. Pulses play a major role towards
eradicating malnutrition of world’s poorer section.
Though animal proteins are considered superior over
vegetable proteins, yet, consumption of pulse proteins
has many added advantages of supplementing iron,
zinc, antioxidants, dietary fibers, vitamins, and
phenols and some prebiotic RFOs that lack in animal-
derived protein diet. In fact, pulses provide a unique
blend of complete nutrition that cannot be substituted
by any other single crop, and therefore there is a
growing global awareness of pulses as an essential
diet supplement that not only provides important
nutrients to support human health but also acts as a
strong immunity booster to fight against diseases. The
demand and promotion of pulses has therefore
increased gradually in the present century.
Needless to describe the various constraints
limiting pulse productivity, various biotic and abiotic
stresses and confined cultivation areas (in rainfed agro
ecosystems) have remained major hurdles in their
vertical and horizontal expansion. Incessant efforts
over the past several decades to increase the stagnating
pulse productivity gave results beyond 2014 to reach
a new height of production to 23-25 mt. The strong
technological back-up, seed availability and expansion
of pulse cultivation to new niches and policy support
have been the most influential factors responsible for
this quantum jump. The next target is to sustain the
enhanced pulse production and reach a target of 32
million ton by the end of this decade.
What are the new unforeseen challenges ahead
which we cannot predict at the present time? Could
we have any innovative ideas or make any tangible
breakthrough to address those issues. The major
challenges which have been projected are increasing
CO2 and a concomitant increase in temperature and
associated changes in water scarcity.
Whether high CO2 is beneficial for increasing
pulse productivity? Ambient CO2 concentration has
already reached to about 425 ppm from 280 ppm (from
last century) and is expected to increase further to be
>500 ppm by the end of present century. Experimental
evidences indicate towards increasing productivity in
pulses with CO2 enrichment provided there is no
limitation of water and nitrogen fertilizers. Legume
and vegetable yields increased with elevated CO2
concentration of 250 ppm above ambient by 22%. CO2
fertilization apparently seems to be beneficial for
enhancing productivity, but will it be affordable for
pulses to apply additional amount of nitrogen
fertilizer, perhaps we do not have the mind set yet to
comprise fertilizer application in pulses.
Large changes in physiological and biochemical
processes due to high CO2 have been observed in grain
legumes and perhaps dealing with all those altered
responses may not be the real scope to elaborate in the
present context. The main focus of present discussion
 Basu : A hidden threat of deteriorating nutritional quality of pulses under climate change
is the nutritive value of pulses for human health?
Whether the unique nutritional values of pulses will
remain intact with rising atmospheric CO2? Because
elevated eCO2 increases biomass, more N is required
by the crop. Thus, to take advantage of eCO2, more
fertilizer inputs may be required. This demand for N
may be tempered, however, by rising temperatures that
will tend to depress yields. Eventually, temperature
variations can also affect seed N concentration, one of
the main criteria determining quality of grain legume.
Legume plants have the ability to fix atmospheric
N2 through symbiosis with soil bacteria (Rhizobia)
hosted in specific root organs called “nodules”.
Indeed, symbiotic N2 fixation is highly sensitive to
environmental stresses. As such, climate change may
affect symbiotic fixation either directly by impairing
Rhizobia survival, its competitiveness, nodule
formation, growth, or activity, or indirectly by
modifying carbon supply to nodules.
With regard to nutrient quality, a meta-analysis
indicated that pulse grains had 10% lower zinc, 5%
lower iron and 6% lower protein. It was observed that
protein declines by an average of 10% under elevated
CO 2, and iron and zinc decline by 8% and 5%
respectively. Furthermore, a range of vitamins show
large declines. As pulses underpin the diets of many
of the world’s poorest people in low-income countries,
especially in Asia, these changes under high CO2 may
affect the nutrient status of about 600 million people.
Decrease in protein concentration with elevated CO2
69
are related to reduced nitrogen concentration possibly
caused by nitrogen uptake not keeping up with
biomass growth, an effect called ‘carbohydrate
dilution’ or ‘growth dilution’, and by inhibition of
photorespiration which can provide much of the
energy used for assimilating nitrate into proteins.
Together, the impact on protein availability may take
as many as 150 million people into protein deficiency
by 2050. Increasing concentrations of atmospheric CO2
lowers the content of zinc and other nutrients in
important food crops. Dietary deficiencies of zinc and
iron are major public health concerns globally. An
estimated two billion people suffer from their
deficiencies, causing a loss of 63 million life-years
annually. Most of these people depend on C3 grain
legumes as their primary dietary source of zinc and
iron. Zinc deficiency is currently responsible for large
burdens of diseases globally, and the populations who
are at highest risk of zinc deficiency receive most of
their dietary zinc from crops. The people likely to be
most affected live in Africa and South Asia, with nearly
48 million residing in India alone. Differences between
cultivars of a single crop suggest that breeding for
decreased sensitivity to atmospheric CO2 concentration
could partly address these new challenges to global
health. In summary, while increased CO2 is projected
to be beneficial for crop productivity but, it is also
projected to lower nutritional quality. Therefore, while
we aim to enhance productivity of pulses, it is equally
important to target at least sustaining, if not increasing,
the nutritional quality of pulses.
70 Journal of Food Legumes 34(1), 2021

List of Referees for Vol. 34(1)

List of Referees for Vol. 34(1)

1. Dr Gaurav Kumar Taggar, PAU, Ludhiana

2. Dr. Shantanu Dubey, ICAR-ATARI, Kanpur

3. Dr. Mohd. Akram, ICAR-IIPR, Kanpur

4. Dr. Meenal Rathore, ICAR-IIPR, Kanpur

5. Dr. S.S. Rathore, ICAR-IARI, New Delhi

6. Dr Jameel Akhtar, ICAR-NBPGR, New Delhi

7. Dr Jyoti Kumari, ICAR-IARI, New Delhi

8. Dr Gayacharan, ICAR-IARI, New Delhi

9. Dr. Krishnasis Das, ICAR-IIPR, Kanpur

Proofreaders for Vol. 34 (1)

1. Mr. Sudhir Kumar, ICAR-IIPR, Kanpur

2. Dr. C.P. Nath, ICAR-IIPR, Kanpur

3. Mr. Revanasidda, ICAR-IIPR, Kanpur

4. Dr. Neetu S Kushwah, ICAR-IIPR, Kanpur

5. Dr Avinash Srivastava, ICAR-IIPR, Kanpur

 Janardan Singh : Site-specific nutrient management in soybean
Instructions to Authors
Journal of Food Legumes (formerly Indian Journal of Pulses
Research) publishes original papers, short communications
and review articles by renowned scientists, covering all
areas of food legumes research. The paper should not have
been published or communicated elsewhere. Authors will
be solely responsible for the factual accuracy of their
contribution. Language of publication is English (British).
Please send your manuscript to following address:
Secretary ISPRD, Indian Institute of Pulses Research
Kalyanpur, Kanpur 208 024, India
Email: secretary.isprd@gmail.com
Manuscript must be submitted through e-mail. You should
also submit a hard copy of your manuscript for our official
record. Besides author(s) is required to submit a certificate
that the paper is exclusive for Journal of Food Legumes.
Manuscripts must conform to the Journal style (see the
latest issue). Correct language is the responsibility of the
author. After having received your contribution (date of
submission), there will be a review process before the
editorial board takes decision regarding acceptance for
publication. One copy of the revision together with the
original manuscript must be returned to the subject editor
or Secretary. The submitted paper must be one complete
word document file comprising a title page, abstract, text,
references, tables, figure legends and figures. When
preparing your text file, please use only Times New
Roman for text (12 point, double spacing) and Symbol
font for Greek letters to avoid inadvertent character
substitutions.
Format
Every original paper should be divided into the following
five sections: ABSTRACT, Key words, INTRODUCTION,
MATERIALS AND METHODS, RESULTS AND
DISCUSSION, and REFERENCES. The manuscript should
be typed on one side of the paper only, double spaced,
and with 4-cm margins with page and line numbers. The
main title must be capital bold. Subheading must be bold
italic and Sub-sub heading normal italic.
At the head of the manuscript, the following information
should be given: the title of the paper, the name(s) of the
author(s), the institute where the research was carried out,
the present addresses of the authors (foot note) and of the
corresponding author (if different from above Institute).
Authors are required to provide running title of the paper.
You must supply an E-mail address for the corresponding
author.
The abstract should contain at least one sentence on each
of the following: objective of investigation (hypothesis,
purpose, aim), experimental material, method of
investigation, data collection, result and conclusions.
Maximum length of abstract is 175 words. Up to 10 key
words should be added at the end of the abstract and
separated by comma. Key words must be arranged
alphabatically (e.g., EMS, Gamma ray, Mungbean,
Mutations, Path coefficient, ......).
Each figure, table, and bibliographic entry must have a
reference in the text. Any correction requested by the
reviewer should also be integrated into the file.
Manuscript file including tables must be in MS Word and
Windows-compatible and must not contain any files other
71
than those for the current manuscript. Please do not import
the figures into the text file. The text should be prepared
using standard software (Microsoft Word); do not use
automated or manual hyphenation.
Length
Manuscripts should not exceed a final length of 15 printed
pages, i.e., 5,000 words, including spaces required for
figures, tables and list of references. Manuscripts for short
communications should not exceed 3000 words (3 printed
pages, with not more than a total of 2 figures or tables).
Units, abbreviations and nomenclature
For physical units, unit names and symbols, the SI-system
should be employed. Biological names should be given
according to the latest international nomenclature.
Botanical and zoological names, gene designations and
gene symbols are italicised. Yield data should be reported
in kg/ha.
Tables and Figures
Tables and figures should be limited to the necessary
minimum. Please submit reproducible artwork. For
printing of coloured photograph, authors will be charged ` 4000/
- per photograph. It is essential that figures are submitted as
high-resolution scans.
References
The list of references should only include publications
cited in the text. They should be cited in alphabetical order
under the first author’s name, listing all authors, the year
of publication and the title, according to the following
examples:
Becker HC, Lin SC and Leon J. 1988. Stability analysis in
plant breeding. Plant Breeding 101: 1-23.
Sokal RR and Rholf FJ. 1981. Biometry, 2nd Ed. Freeman,
San Francisco.
Tandon HLS. 1993. Methods of Analysis of Soils, Plants,
Water and Fertilizers (ed). Fertilizer Development and
Consultation Organization, New Delhi, India. 143 pp.
Singh DP. 1989. Mutation breeding in blackgram. In: SA
Farook and IA Khan (Eds), Breeding Food Legumes.
Premier Publishing House, Hyderabad, India. Pp 103-109.
Takkar PN and Randhawa NS. 1980. Zinc deficiency in
Indian soils and plants. In: Proceedings of Seminar on
Zinc Wastes and their Utilization, 15-16 October 1980,
Indian Lead-Zinc Information Centre, Fertilizer
Association of India, New Delhi, India. Pp 13-15.
Satyanarayan Y. 1953. Photosociological studies on
calcarious plants of Bombay. Ph.D. Thesis, Bombay
University, Mumbai, India.
In the text, the bibliographical reference is made by giving
the name of the author(s) with the year of publication. If
there are two references, then it should be separated by
placing ‘comma’ (e.g., Becker et al. 1988, Tandon 1993). If
references are of the same year, arrange them in alphabatic
order, otherwise arrange them in ascending order of the
years.
While preparing manuscripts, authors are requested to
go through the latest issue of the journal. Authors are also
required to send the names & E-mail address of at least
3-4 reviewers appropriate to their articles.
8.
Effect of frontline demonstrations of gram in Sirohi district of
South-Western Rajasthan
44

Dileep Kumar and Lokesh Kumar Jain
9.
Enhancement of productivity in chickpea through frontline demonstrations on
farmers’ field
48

Shalu Abraham, Ishwar Singh, Eshu Sahu, Praveen Jamrey and Manish Arya
10.
IPA 15-2 (Sharada): A high yielding, wilt and sterility mosaic disease resistant
pigeonpea cultivar for North East Plain Zone 51

Satheesh Naik SJ, Abhishek Bohra, Farindra Singh, Dibendu Datta, IP Singh,
Raj Kumar Mishra, Hriday Narayan Maurya and NP Singh

SHORT COMMUNICATION
11.
Yellow mosaic disease status of mungbean genotypes grown in
South-Eastern Rajasthan
57

DL Yadav, SL Yadav, Khajan Singh, Pratap Singh and Manju Meena
12.
Effect of pre-storage infestation levels of Callosobruchus analis (F.) on mungbean
60

Rajnish Dwivedi, Sanjay M Bandi, Revanasidda, Prastuti Mishra and Bansa Singh
13.
An improved screening method for identification of resistance to bruchids in pulses 64

Revanasidda, Aditya Pratap, Debjyoti Sen Gupta, AK Parihar,
Sanjay M Bandi, Mohd. Akram, Bansa Singh and NP Singh

COMMENTARY

15.
A hidden threat of deteriorating nutritional quality of pulses under climate change
68

PS Basu

16.
List of Referees 70

17. Instructions to Authors 71

 ISSN 0970-6380
Journal of
Online ISSN 0976-2434
I SPR D
FOOD LEGUMES
1987

Volume 34 Number 1 January-March, 2021

Contents
CURRENT AFFAIRS
1.
Can India sustain high growth of pulses production?
1

Pooran Gaur

RESEARCH PAPERS
2.
Genetic diversity and phylogeography of mungbean yellow mosaic India virus in
Central India
4

Rakesh Kumar Singh, Parveen Ghazi Ansari, Shruti Kaushik, Gaurav Raghuwanshi,
Ashok Krishna, Takashi Wada and Hiroaki Noda
3.
Potential resistant donors for yellow mosaic disease identified from endemic
wild Vigna species
10
Gita Kumari, Aditya Pratap, Roopa Lavanya, G Mohd. Akram, Revanasidda,
Meenal Rathore, Latha Madhavan, Yogendra Singh and NP Singh
4.
Genetic studies for biofortification traits in chickpea 17

Satvinder Singh, Karthick S Babu, Anju Arora, RK Panwar and SK Verma
5.
Use of novel chitin amended formulation of Trichoderma asperellum and
Pseudomonas fluorescens to induce systemic induced resistance in chickpea
[Cicer arietinum L.] against biotic tresses 21
P Jaisani and NM Gohel
6.
Effect of PSB, FYM with variable levels of P on the yield attributes and
productivity of black gram in Shiwalik hills of Himachal Pradesh 31
Ashish Sharma, Pawan Pathania and Munish Sharma
7.
Profitability of legume-maize cropping systems under legume residue
management practices
38

Monika Shukla, AC Sadhu, KD Mevada and Pratik Patel

Published by The Secretary on behalf of

Indian Society of Pulses Research and Development (www.isprd.in)
ICAR-Indian Institute of Pulses Research, Kanpur-208 024
Phone : 9452060055
E-mail: secretary.isprd@gmail.com
at Army Printing Press, 33, Nehru Road, Sadar Cantt. Lucknow-2 Ph.: 0522-2481164
For free download of JFL articles, please also visit: www.indianjournals.com