Journal of

FOOD LEGUMES
An Official Journal of Indian Society of Pulses Research and Development (Registration No. 877)
ISSN: 0970-6380; Online ISSN: 0976-2434

The Indian Society of Pulses Research and Development (ISPRD) was founded in April 1987 with the following
objectives:
• To promote research, development and extension activities in pulses
• To facilitate close association amongst pulse workers nationally and internationally
• To publish “Journal of Food Legumes”, a quality research journal of the Society
Membership: any person interested in pulses research and development is eligible for membership of the Society
by becoming ordinary, life or corporate member by paying respective membership fee as detailed below:
Membership Fee Indian (Rs.) Foreign (US$)
Ordinary (Annual) 500 40
Life member 5000 400
Admission Fee 50 10
Libarary/Institute 5000 400
Corporate Member 7500 –
Contribution to the Journal, except in case of invited articles, is open to the members of the society only. Any
non-member submitting a manuscript will be required to become at least an annual member. Members will be
entitled to receive the Journal and other communications issued by the Society. Renewal of the subscription is due
in January each year. If the subscription is not received by February 15, the membership will stand cancelled and
can be revived by paying readmission fee of Rs. 50/-. The membership fee will be paid through online bank
transfer as per given details:
Account Holder’s name: INDIAN SOCIETY OF PULSES RESEARCH AND DEVELOPMENT
Name of the Bank: Union Bank of India
Address: Kalyanpur-Kanpur 208024
Account No.: 349502010003620
IFSC Code: UBIN0534951
Communication regarding transfer of membership fee alongwith the transfer receipt should be communicated
to Secretary, ISPRD, ICAR-Indian Institute of Pulses Research, Kanpur-208024, India at secretary.isprd@gmail.com.

EXECUTIVE COUNCIL 2020-2023

Chief Patron
Dr Trilochan Mohapatra
Patron Co-Patron
Dr TR Sharma Dr NP Singh
President: IP Singh, ICAR-IIPR, Kanpur
Vice-President: Rajeev Varshney, ICRISAT, Hyderabad
Secretary: Aditya Pratap, ICAR-IIPR, Kanpur
Joint Secretary: CS Praharaj, ICAR-IIPR, Kanpur
Treasurer: DR Mishra, ICAR-IIPR, Kanpur
Councilors
AK Srivastava, ICAR-IIPR, Kanpur; Ravinder Singh, PAU, Ludhiana; C. Bharadwaj, ICAR-IARI, New Delhi;
Mudalgiriyappa, GKVK UAS, Bengaluru; S.S. Punia, CoA, Bharatpur, Rajasthan; RP Singh, RAK College, Sehore
Editor-in-Chief
Meenal Rathore
ICAR-Indian Institute of Pulses Research, Kanpur, India
Editorial Board
SK Sharma, Palampur, India; Pooran Gaur, ICRISAT, Hyderabad, India; Nguyen, Henry T, Columbia, USA; Suk-Ha
Lee, Seoul, Korea; Kadambot Siddique, Perth, Australia; Shiv Kumar, ICARDA, Morocco; Ramakrishnan Madhavan
Nair, WorldVeg, Hyderabad, India; Liao Boshou, China; Sushil Chaturvedi, Jhansi, India; AR Sharma, Jhansi, India;
Jayamani P, Coimbatore, India; PS Basu, Kanpur, India; Jitendra Kumar, Kanpur, India; Dinesh Yadav, Gorakhpur,
India; Harsh Nayyar, Chandigarh, India; Harsh K Dikshit, New Delhi, India; A Amarender Reddy, Hyderabad, India;
Uma Sah, Kanpur, India; Mohd. Akram, Kanpur, India; Gaurav K Taggar, Ludhiana, India; ; Sanjeev Kumar, Patna,
India; Sanjay Singh Rathore, New Delhi, India; Narendra Kumar, Kanpur, India; Prasoon Verma, Kanpur, India;
Senthil Kumar, Kanpur, India
 Journal of
FOOD LEGUMES
An Official Journal of Indian Society of Pulses Research and Development
ISSN: 0970-6380; Online ISSN: 0976-2434

Vol. 33 (4) October-December, 2020

Contents
CURRENT AFFAIRS
1. Development of hybrids: Approach for breaking the yield plateau in pigeonpea
(Cajanus Cajan (L.) Millsp.) 213
IP Singh

RESEARCH PAPERS
2. Effect of foliar spray of micronutrients on growth and yield of late sown lentil
(Lens culinaris) in new alluvial zone of West Bengal 215
V Visha Kumari, Roshni Vijayan, Rajib Nath and Kajal Sengupta
3. Diversity of chickpea germplasm against wilt disease caused by
Fusarium oxysporum f. sp. ciceris, Race 2 218
PR Saabale, Manjunatha L, RK Mishra, Naimuddin and DN Gawande
4. Yield and quality of mungbean genotypes under different foliar application of
nutrients and growth regulators 223
Prerna Sundriyal, DK Shukla, Chandra Bhushan and VK Singh
5. Host preference and development of Callosobruchus analis (F.) on different
legumes 227
Rajnish Dwivedi, Sanjay M. Bandi, Prastuti Mishra, Revanasidda and Bansa Singh
6. Molecular characterization of begomoviruses causing yellow mosaic disease in
Vigna stipulacea and evidence of recombination 232
Mohammad Akram, Naimuddin Kamaal, Aditya Pratap, Abdul Muin, Shameem Ahmad,
Aniruddha Kumar Agnihotri, Pawan Shinde, PR Saable and NP Singh
7. Management of pigeonpea wilt using host resistance, chemicals,
soil amendments and bioagents 245
M Hareesh, HC Lal, Savita Ekka, Niraj Kumar, Binay Kumar, Sunna Deepti
and MK Barnwal
8. Crop, water productivity and economics in chickpea as influenced by
application of hydrogel and foliar nutrition 252
KC Gupta, CS Praharaj, SK Jain, Vipin Kumar and MR Yadav
9. Effect of frontline demonstrations on summer moong in Amritsar district of
Punjab 257
Astha, Raminder Kaur Hundal and Bhupinder Singh Dhillon

SHORT COMMUNICATION
10. A systematic methodology to assess bruchid field infestation and the impact of
field-carry-over infestation in stored pulses 262
Revanasidda, Sanjay M Bandi, Prasoon Verma, Kiran Gandhi Bapatla and Bansa Singh
11. Variability and correlation studies for yield and yield contributing traits in
kabuli chickpea 265
Gazal Saini, G Katna, Kamal Dev Sharma and Archana Joshi Saha
12. Assessment of genetic divergence among blackgram (Vigna mungo (L.) Hepper)
genotypes under organic fertilizer management 270
A Kavitha Reddy, M Shanthi Priya, D Mohan Reddy and B Ravindra Reddy
13. Response of mungbean (Vigna radiata L.) cultivars to integrated nutrient
management in Bundelkhand region of Uttar Pradesh 274
Ankit Tiwari, AK Tripathi and Jagannath Pathak
14. Identification of a unique accession in cowpea with dense pubescence 278
Kuldeep Tripathi, AK Parihar, Niranjana Murthy, Revanasidda, DP Wankhede,
Neeta Singh, Sanjeev K Deshpande and Ashok Kumar

COMMENTARY 280
15. Insight into virus disease challenges in food legumes in Genomic era 280
VG Malathi
16. Obituary 283
17. List of Referees for Vol. 33(4) 284
 Journal of Food Legumes 33(4): 213-214, 2020

Current Affairs
Development of hybrids: Approach for breaking the yield plateau in
pigeonpea (Cajanus Cajan (L.) Millsp.)
IP SINGH

Project Coordinator-AICRP- With more than 28 years’ experience in pulses

Pigeonpea ICAR-Indian Institute of research, Dr I P Singh is a pioneer in pigeonpea
Pulses Research, Kanpur, India research, development and research coordination
in the country. He started his research career as a
E-mail: ipsingh1963@yahoo.com plant breeder in ICAR-IIPR in 1992 and joined as
Project Coordinator, AICRP-Pigeonpea in 2013 and
is presently leading the All India Coordinated
research Project on Pigeonpea. Dr Singh has to his
credit four varieties and two hybrids of pigeonpea.
He has carried out a lot of work in the area of
resistance breeding and heterosis breeding in pigeonpea and registered
several donors for resistance to Fusarium wilt, sterility mosaic disease
and Phytophthora stem blight. He has developed and registered six
CGMS lines of pigeonpea which are being utilized in the development
of hybrids. He has led the hybrid pigeonpea project funded by DAC
under ISOPOM and NFSM. As a project coordinator he has launched
the idea of development of extra short duration and mid early duration
varieties of pigeonpea. Now the multi location trials are being conducted
for both maturity groups under AICRP on pigeonpea which has resulted
in development of first extra short duration pigeonpea variety Pusa Arhar
16 which matures in 120 days. Development of mid early breeding
materials and their evaluation has resulted in the development of high
yielding mid early varieties like BDN 716, GRG 81, BRG 3 GRG 152,
WRGE 93, KRG 33 and WRGE 121. At present his main focus is on
development of extra short and short duration varieties and hybrids of
pigeonpea.

India is the largest producer (3.59 Million
Tones) and consumer of pigeonpea (Source:
http://agricoop.gov.in) and shares world’s
76.69% acreage and 71.54% production
(FAOSTAT 2017). Production of pigeonpea
increased gradually from 1970s to till date
mainly due to increase in area, particularly in
the less fertile, a non-traditional coverage in
southern and central zone at the cost of
traditionally fertile alluvial soil of north Indian
states. Despite dedicated sincere research
efforts to improve the productivity of
pigeonpea, that eventually led to the
development and release of nearly 155 high
yielding varieties in different maturity groups,
a considerable gap still exists between the
potential and realized yield coupled with
increasingly soaring prices of the pulse.
The constantly increasing gap in demand
and supply for pigeonpea has been a matter of
concern to pigeonpea researchers in India and
they aim to increase its productivity and
production. The entomophilly abet cross
pollination behavior of pigeonpea is desirable
to develop and establish the hybrid system to
exploit the commercial heterosis. Keeping this
in view, pigeonpea research was directed
towards a new initiative on hybrid pigeonpea
breeding at ICRISAT, Hyderabad immediately
after the identification of male sterile line in
1974. which in turn led to the development of
first GMS based hybrid called ICPH 8 in 1991
for cultivation in central zone which followed
the development of five GMS hybrids (PPH 4,
CoPH 1, CoPH 2, AKPH 4101 and AKPH 2022)
in the early maturing group which were
214 Journal of Food Legumes 33(4), 2020
released by the State and central varietal release
committee. Nevertheless, the GMS based
hybrids did not yield much success due to
difficulty in the production of commercial F1
seed. The advertent GMS system led to the
development of a stable and economically
viable CGMS system in pigeonpea after 26 years
of its first GMS initiative. The first CGMS line
GT 288A and its maintainer B line was
registered by Pulse Research Station of SDAU,
SK Nagar, Gujarat in 2000. Consequently, in
2006, the first CMS hybrid GTH 1 was
developed by SDAU, S K Nagar Gujarat and
released by CVRC for cultivation in central
zone. There are 39 CGMS lines which have been
registered with ICAR-NBPGR and two CMS
based hybrids namely ICPH 2671 and ICPH
2740 were developed and released by ICRISAT
for cultivation in Madhya Pradesh and
Telangana, respectively. Since both the hybrids
take 180-185 days to mature, therefore, crop
suffers a lot due to water stress at the pod
development stage. Keeping this in view in mid
late duration hybrids of pigeonpea, now a day’s
maximum effort is being given to develop early
(120-150 days) and mid early (151-165 days)
hybrids at different centers of AICRP on
Pigeonpea. These efforts have resulted in the
development and recent release of two early
maturing pigeonpea hybrids viz. IPH 15-3 and
IPH 09-5 developed at ICAR-Indian Institute
of Pulses Research Kanpur. Both the hybrids
are suitable for cultivation in NWPZ of the
country and suitable for Pigeonpea-Wheat
cropping system.
Pigeonpea hybrid IPH 15-03 based on CMS
technology (C. scarabaeoides cytoplasm) is
developed from the cross, PA 163A × AK
250189R. The hybrid has been notified for
cultivation in the North western plain zone
(NWPZ). The hybrid was evaluated for four
years under Initial hybrid trial (IHT) 2015, IHT
in 2016, Advanced hybrid trial 1 (AHT 1) in
2017 and the Advanced hybrid trial 2 (AHT 2)
in 2018 in NWPZ under AICRP-Pigeonpea.
Averaged over four years of evaluation, the
hybrid with 1595.6 kg/ha yield has shown
28.3%, 55.2% and 31.91% superiority over the
checks Pusa 992 (1243.6 kg/ha), PAU 881
(1028.07 kg/ha) and ICPL 88039 (1225.03 kg/
ha), respectively. The hybrid matures in 150
days and has a 100 seed weight of 8.54 g. This
hybrid has shown 94.31 percent plant fertility
and resistance to Fusarium wilt and sterility
mosaic diseases. Another hybrid IPH 09-5
Pigeonpea based on CMS technology (C.
scarabaeoides cytoplasm) has got developed from
the cross, PA 163A × AK 261322R. The hybrid
has been notified for cultivation in the North
western plain zone (NWPZ). The hybrid was
evaluated for four years Initial hybrid trial (IHT)
in 2009, Advanced hybrid trial 1 (AHT 1) in
2010, Advanced hybrid trial 2 (AHT 2) 2011
IN NWPZ as well as NEPZ and Advanced
hybrid trial 2 (AHT 2) 2019 in NWPZ under
AICRP-Pigeonpea. Averaged over four years
of evaluation, the hybrid with 1822 kg/ha yield
has shown 30.4 %, 40.77%, 64.7%, 67.6% and
40.2% superiority over the checks UPAS 120
(1396 kg/ha), Pusa 992 (1294.20 kg/ha), AL
201 (1105.60 kg/ha), PAU 881 (1086.30 kg/
ha) and ICPL 88039 (1298.80 kg/ha),
respectively. It matures in about 150 days and
has a 100 seed weight of 9.60 g. This hybrid
has shown 90.25 percent plant fertility and
moderate resistance to Fusarium wilt and
sterility mosaic and Phytophthora stem blight
diseases.
Seed production experiments have already
been conducted and it was concluded that
planting of CMS lines (‘A’ line) and maintainer
lines (‘B’ line) in 4:1 row ratio and planting of
CMS lines (‘A’ line) and restorer lines (R line)
in 4:1 row ratio with isolation distance of
minimum 500 m results the best quality seed
production of ‘A’ line and hybrid. Maintainer
and restore lines should be grown in isolation
for selfing and multiplication of their seeds.
The major task now is seed production of
these hybrids which is best possible in PPP
model. Thus, the seeds of parental lines (‘A’ and
‘R’ lines) should be multiplied and supplied by
concerned institute (where the hybrid has been
developed) to a private partner who will be
responsible for hybrid seed production. Once
commercial seed production of pigeonpea
hybrids takes place and it gets popularized
among the farmers, it is sure to result in
enhanced productivity and production of
pigeonpea in the country.
 Journal of Food Legumes 33(4): 215-217, 2020

Effect of foliar spray of micronutrients on growth and yield of late sown

lentil (Lens culinaris) in new alluvial zone of West Bengal
V VISHA KUMARI1, ROSHNI VIJAYAN2, RAJIB NATH1 and KAJAL SENGUPTA1

1
Department of Agronomy, Bidhan
Chandra Krishi Vishwavidyalaya,
Mohanpur, West Bengal-741252,
2
AINP, Arid Legumes, Kerala
Agricultural University-679306
*Email: visha.venugopal@gmail.com
Received: September 28, 2020
Accepted: February 19, 2021
Handling Editor:
Dr Meenal Rathore, ICAR-Indian Institute
of Pulses Research, Kanpur
ABSTRACT
A field experiment was conducted during 2018-19 and 2019-20 at Bidhan Chandra
KrishiViswavidyalaya, West Bengal, India to study the effect micronutrients
foliar spray on growth and yield in lentil (Lens culinaris Medik). Pooled results
of two years revealed that foliar spray of B @ 0.2% +Fe @ 0.5% increased the dry
matter (113.4 g m2), no of nodules (30.6) and no of branches (3.5). The no of pods
were also found higher in this treatment when compared to control (89.4 Vs121.4).
The treatment of B@0.2% +Fe@0.5% foliar spray significantly increased 38.6%,
21.4%, 3.4%, 35.4 % higher grain yield (1130 kg ha-1), stover yield (3713 kg ha-1),
test weight (20.4 g) and harvest index (0.31) compared to control (no spray).
Under late sown situation, foliar spraying of B @ 0.2% +Fe @ 0.5% helps in
improving the growth and yield of the crop to a larger extend.
Key words: Growth, Harvest index Lentil, Nodules, Yield

INTRODUCTION In view of this, the present study was carried out to

Lentil is a highly nutritious legume with
adequate quantity of carbohydrates, right amount of
proteins and good amount of micronutrients. As lentil
is grown after the harvest of rainy season (kharif)crop,
often the sowing of the crop gets delayed either due to
delayed harvest of long duration kharifcrop or delay
in the preparation of the field due to higher moisture
in the field (Singh et al., 2011; Visha et al., 2019). Delay
in sowing may encounter severe cold in the earlier or
heat and moisture stress in the later stage, hampering
its development and thus yield (Ramakrishna et al.,
2000). Foliar application of micronutrients helps in
the rapid translocation when compared to soil
application which is very pertinent in mitigating stress
in plants especially during late sown condition.
Micronutrients including Zn, Fe and B have diverse
role on plant reproductive development. Zn is known
for its metabolic and regulatory functions along with
its role in reproductive phase of the crop (Broadly et
al., 2007). Iron (Fe) is important for various biochemical
pathways of the plants (Rout and Sahoo, 2015; Briat et
al., 2007). Boron plays an important role in
reproductive growth and of plants, pistil development
and pollination to fertilization (Dear and Lipsett, 1987;
Dell and Huang, 1997). As lentil sowing often gets
delayed in alluvial zone, it is very important to know
if the foliar spray of these micronutrients either
individually or in combination will help in improving
the growth and yield of lentil in late sowing condition.
investigate the effect of micronutrient foliar spray of
zinc, boron and iron on nodule no, dry matter, other
growth and yield of lentil.
MATERIALS AND METHOD
The field experiment was conducted during rabi
season of 2018-19 and 2019-20 at the District Seed
Farm, AB block, Kalyani, Bidhan Chandra Krishi
Viswavidyalaya (Latitude 22º58´ N and Longitude
88º32´ E), West Bengal, India. The study site is located
at an altitude of 9.75 m above mean sea level. The crop
received precipitation of 149.5 mm and 105.8 mm in
the year 2018-19 and 2019-20. The maximum
temperature varied from 22.2 o C to 35.5o C and
minimum temperature varied between 7.8o C and 25.5o
C during rabi season of 2018-19 and 2019-20,
respectively. The soil is well-drained gangetic alluvial
soil (order: Inceptisol), clayey loam with medium
fertility and neutral in reaction (pH: 7.4). The soil was
low in available nitrogen (alkaline permanganate-
oxidizable) with a value of 138 kg ha-1. Organic carbon
(wet-digestion method), available nitrogen zinc
(DTPA-extractable), boron (Azomethine H) and iron
(DTPA extractable) (0.52 %, 138 kg/ha, 0.40 ppm, 0.49
ppm and 0.45 ppm, respectively) were found to be
medium. However, available P2O5 (Brays’P), and K2O
(NH4OAc-extractable) (30 kg/ha and 160 kg/ha
respectively were high.
216 Journal of Food Legumes 33(4), 2020

The experiment was laid out in randomized block Table 1: Growth parameters at maturity of lentil as
design with nine foliar spray treatments (no spray, influenced by micronutrient foliar spray
spray of tap water, Zn @ 0.5% (ZnSO4.7H2O), Fe @ (pooled data of 2 years)
0.5% (FeSO4.7H2O), B @ 0.2% (borax 10.5%), Zn @ 0.5% Treatment Plant Total dry No. of
+ B @ 0.2%, Zn @ 0.5% + Fe @ 0.5%, B @ 0.2% + Fe @ height matter nodules/plant
(cm) (g m-2) (60DAS)
0.5% and Zn @ 0.5% + Fe @ 0.5% + B @ 0.2%) with
No spray 43.6 104.1 24.6
three replication. The foliar sprays were given at flower
Tap water 45.7 104.9 24.4
initiation (45 DAS) and pod initiation stage (60 DAS).
Zn @ 0.5% 46.7 107.8 24.0
The seeds of popular variety “Moitree”(WBL 77) were Fe @ 0.5% 47.8 110.6 26.3
sown at 30 cm row spacing in experimental plot of (5 B @ 0.2% 49.8 109.9 28.0
m x 4 m) at first night of December. The standard crop Zn @ 0.5% +B @ 0.2% 49.9 111.8 28.4
management practices like uniform fertilizer dose of Zn+Fe @ 0.5% 47.2 111.8 28.0
20:40:40 kg ha-1 of N: P2O5 and K2O, one hand weeding B @ 0.2% + Fe @ 0.5% 47.3 113.3 30.6
at 25-30 days after sowing (DAS) were given. No Zn @ 0.5% + Fe @ 49.0 109.5 32.4
irrigation was provided as lentil was grown on 0.5% +B @ 0.2%
residual soil moisture with little precipitation during CD (P=0.05) 1.62 2.93 2.96
rabi season. Ten random plants were selected from each
approximately 9% increase in dry matter accumulation
plot, excluding border row, for taking observations on
when compared with control (no spray). The results
growth and yield attributes of lentil. The analysis of
are in accordance with the findings of Gill et al. (2012)
variance (ANOVA) was done in RBD. The significance
in Punjab. Though the growth of the plants is its
of treatment differences was compared by critical
varietal character, the difference in dry matter
difference (CD) at 5% level of significance (P=0.05) and
accumulation among different treatments may be due
statistical interpretation of treatments was done as per
to the role each micronutrient played in crop growth
Gomez and Gomez (1984). As data were similar during
and development. Foliar spray of Zn @ 0.5% + Fe @
both the years, pooled analysis of data was carried
0.5% +B @ 0.2% recorded significantly highest no of
out and presented.
nodules/plant (32.4) followed by foliar spray of B @
RESULT AND DISCUSSION 0.2% + Fe @ 0.5% (30.6) when compared with control
(24.6). We recorded very less number of nodules in our
Growth parameters experiment as compared to already reported works.
This may be because of the delayed sowing. Singh
The pooled data of 2 years indicated that foliar (2005) reported a decreasing trend in number of
spray treatments, Zn @ 0.5% +B @ 0.2% and B @ 0.5% nodules with delay in sowing from November to
were on par and resulted in significantly highest plant December in West Bengal. Foliar spray of micronutrient
height (49.9 and 49.8 cm) at harvest. Dry matter (DM) had no significant effect on no. of branches/plant
accumulation showed an upward trend with the (Table 1).
advancement of crop stage. We are presenting here
only the data recorded at harvest as the influence Yield attributes
during the later stage of the crop was more evident.
Foliar spray of micronutrients had significant
Lentil crop sprayed with B @ 0.2% + Fe @ 0.5%
influence on number of pods per plant, grain yield
produced significantly highest dry matter (115.3 g
stover yield and test weight of lentil (Table 2). Foliar
m-2) compared to control (104.1 g m-2). It recorded
Table 2: Yield attributes of lentil as influenced by micronutrient foliar spray (pooled data
Treatment No. of pods Seed yield Stover yield Test weight HI
(kg ha-1) (kg ha-1) (g)
No spray 81.4 700 2917 19.7 0.20
Tap water 89.1 715 3118 19.8 0.21
Zn @ 0.5 % 100.6 729 3395 20.2 0.21
Fe@ 0.5 % 105.4 813 3058 20.3 0.27
B @ 0.2 % 107.5 831 3440 20.3 0.24
Zn@0.5% +B@0.2% 113.2 904 3644 20.3 0.26
Zn+Fe@0.5%, 115.6 845 3493 20.4 0.24
B@0.2% +Fe@0.5% 121.4 1130 3713 20.4 0.31
Zn@0.5% +Fe@0.5% +B@0.2% 112.6 1034 3639 20.3 0.29
CD (P=0.05) 5.05 87.52 43.31 0.15 NS
 Kumari et al. : Effect of foliar spray of micronutrients on growth and yield of late sown lentil
(Lens culinaris) in new alluvial zone of West Bengal
spray of B @ 0.2% +Fe @ 0.5% resulted in highest yield
(1130 kg ha-1) significantly followed by Zn @ 0.5% +
Fe @ 0.5% +B @ 0.2% (1034 kg ha-1) (Table 2). Stover
yield also followed the same trend as that of seed yield.
Foliar spray with B @ 0.2% +Fe @ 0.5% resulted in
significant highest stover yield (3713 kg ha-1) when
compared to 2917 kg ha-1 in control. The increase in
grain and stover yield may be attributed to foliar spray
of micronutrients, which regulate their supply to the
crop through mineralization and prevents them from
leaching and other losses as they are directly applied
to the leaves. The availability of nutrients might have
helped in increasing the translocation of
photosynthates to sink leading to improvement in yield
as reported by Choudhary et al. (2015). The pooled
result of harvest index was not significant.
CONCLUSION
Based on the above results, it can be concluded
that foliar spray of B @ 0.2% +Fe @0.5% can be
recommended for getting better crop growth,
establishment and yield. We found that under late
sowing condition, foliar spray of B @ 0.2% +Fe @ 0.5%
had beneficial effect in reducing the negative effect of
heat and moisture stress the crop experiences due to
increase in air temperature. Foliar spray of
micronutrients helps in improving the growth and
yield of the crop to a larger extend.
REFERENCES
Briat, J. F., Curie, C. and Gaymard, F. 2007. Iron utilization
and metabolism in plants. Current Opinion on Plant
Biology 10: 276-282.
Broadly, M.R., White, P.J., Hamnod, J.P., Zelko, I. and Lux,
A. 2007. Zinc in plants. New Phytology 173: 677-702
Choudhary, S.K., Mathur, A.K. and Singh, P. 2015. Effect
of micronutrient fertilization and methods of
217
application on yield and quality of sorghum (Sorghum
bicolor) in sub-humid southern plains zone. Research
on Crops 16(1): 59–63.
Dear, B. S. and Lipsett, J. 1987. The effect of boron supply
on the growth and seed production of sub-terranean
clover (Trifolium subterraneum L.). Australian Journal
of Agricultural  Research 38(3): 537–546.
Dell, B. and Huang, L.1997. Physiological response of plants
to low boron.Plant and Soil 193 (1–2), 103–120.
Gill, J.S. 2012. Response of lentil (Lens culinaris Medikus)
to different sowing times and tillage systems.
Environmental Ecology 30: 1118-21.
Gomez, K.A. and Gomez, A. A. 1984. Statistical Procedures
for Agricultural Research, Edn 2. John Wiley & Sons,
NewYork.
Ramakrishna, A., Gowda C.L.L. and Johansen, C. 2000.
Management factors affecting legumes production in
the Indo-Gangetic Plain. (In) Legumes in rice and wheat
cropping systems of the Indo Gangetic Plain-
constraints and opportunities. ICRISAT, Patancheru,
Andhra Pradesh, pp 156–65.
Rout, G. R. and Sahoo, S. 2015. Role of iron in plant growth
and metabolism. Journal of Agricultural Science 3, 1–
24.
Singh, A. K., Meena, M. K. and Bharati, R .C. 2011.Sulphur
and zinc nutrient management in rice lentil cropping
system. International Conference on Life Science
Research for Rural and Agricultural Development, 27-
29 December 2011, CPRS Patna (Bihar), pp 66–7.
Singh, I., Sardana, V. and Sekhon, H.S. 2005. Influence of
row spacing and seed rate on seed yield of lentil under
different sowing dates. Indian Journal of Agronomy
50: 308-10.
Visha Kumari, V., Banerjee, P., Nath, R., Sengupta K.,
SarathChandran, M.A. and Kumar, R. 2019. Effect of
foliar spray on phenology and yield of Lentil sown on
different dates. Journal of Crop and Weed, 15(3): 54-
58.
 Journal of Food Legumes 33(4): 218-222, 2020

Diversity of chickpea germplasm against wilt disease caused by

Fusarium oxysporum f. sp. ciceris, Race 2
PR SAABALE*1, MANJUNATHA L2, RK MISHRA2, NAIMUDDIN2 and DN GAWANDE

1
Indian Institute of Pulses Research,
Regional Centre, Dharwad-580005,
Karnataka; 2Indian Institute of Pulses
Research, Kanpur-208024, Uttar
Pradesh;
*E-mail: sparashu@gmail.com
Received: September 26, 2020
Accepted: February 20, 2021
Handling Editor:
Dr. P. Jayamani, Tamil Nadu Agricultural
University, Coimbatore
ABSTRACT
A total of 123 ‘desi’ chickpea germplasm were evaluated against Fusarium wilt
caused by Fusarium oxysporum f. sp. ciceris (Padwick) Matuo & K. Sato (race 2)
under artificial epiphytotic conditions during 2015-16 and 2016-17. During 2015-
16, 22 genotypes were found resistant, 11 moderately resistant, 17 susceptible
and 73 highly susceptible. The percent incidence in susceptible check was
recorded 100 percent and in resistant check it was less than 10 percent. The local
severity index (LSI) was 55.2 percent at physiological maturity stage of the
crop. In a total, 17.8 percent germplasm accessions revealed resistance reaction
(<10% disease incidence) and 8.9 percent revealed moderately resistant reaction
(10.1 to 20%). Based on previous year observations, 22 resistant and 11 moderately
resistant lines were further evaluated in 2016-17. Based on pooled data of two
years, 12 lines viz., EC-267154, EC-267308, EC-489845, EC-489882, EC-489919,
EC-489991, EC-498818, IC-83523, IC-83538, IC-83539, IC-83748 and IC-83757
were found resistant to the disease. These identified resistant lines can be
exploited for breeding programs to develop resistant varieties.

Key words: Diversity, Fusarium, Germplasm, Race 2, Resistance, Wilt

Chickpea (Cicer arietinum L.) is the world’s third
most important pulse crop known for its nutritive value
in all tropical and subtropical countries. It plays vital
role in human and animal nutrition (20-26% dietary
proteins) and increases soil fertility by fixing
atmospheric nitrogen. India share is approximately
70% of world chickpea production with an area of
9.63 million ha with 9.38 million tons production and
an average productivity 974 kg/ha (Anonymous,
2018). The production of chickpea is largely affected
by many biotic and abiotic factors. Amongst biotic
stresses, Fusarium wilt caused by Fusarium oxysporum
f. sp. ciceris (Padwick) Matuo & K. Sato, is one of the
major causes for low productivity in chickpea (Haware
and Nene, 1982a). The disease occurs in all chickpea
growing states and is estimated to cause an annual
yield loss of 10-15% (Singh and Dahiya, 1973), but
under favorable conditions, yield loss up to 100 per
cent has been recorded (Halila and Strange, 1996).
Moreover, losses caused by Fusarium wilt depend
upon the stage of the crop infected; early wilting causes
77-94% losses while late wilting causes 24-65%
(Haware and Nene, 1980). The disease can occur at all
stages of plant growth but high incidence occurs at
flowering and podding stages. The pathogenicity test
indicates that Fusarium wilt of chickpea exhibits two
pathotypes viz., yellowing and wilting pathotype
(Trapero-Casas and Jimenez-Diaz, 1985). Based on a
set of differential chickpea cultivars eight races (races
0, 1A, 1B/C, 2, 3, 4, 5, and 6) of pathogen have been
reported worldwide. Among them, 0 and 1B/C cause
yellowing syndrome and 1A, 2, 3, 4, 5, and 6 cause
wilting syndrome (Jimenez – Diaz et al., 1993).
Races 1A, 2, 3 and 4 have been reported from India
(Haware and Nene, 1982b). Recently, a change in race
scenario in Indian populations of Foc has been reported
by Dubey et al. (2012) on a new set of chickpea
differentials wherein he reported existence of all 8
races. Currently, though chickpea wilt can be managed
to some extent by cultural practices and chemical seed
treatment methods, host resistance can offer complete
protection and is an economical and eco-friendly
strategy for management of chickpea wilt (Govil and
Rana, 1994). Consequently, considerable efforts have
been made across the globe to identify resistance
sources against wilt (Pande et al. 2006, Sharma et al.
2012, Saabale et al. 2017 and Saabale et al. 2019) and
several are being utilized in breeding programs. But,
periodical change in the virulence of pathogen
seriously curtailed host plant resistance longevity due
to genetic breakdown thus making it imperative to
continuously search for resistant sources. In present
study, evaluation of germplasm lines of chickpea was
undertaken to identify stable wilt resistant sources
against Fusarium wilt (race 2) in an artificially
developed sick plot.
 Saabale et al. : Diversity of chickpea germplasm against wilt disease caused by
Fusarium oxysporum f. sp. ciceris, Race 2
MATERIAL AND METHODS
Seed Source: A total of 123 ‘desi’ chickpea germplasm
lines collected from NBPGR, New Delhi, India were
evaluated against wilt disease caused by F. oxysporum
f. sp. ciceris (race 2) in sick plot under artificially
inoculated conditions during 2015-16 and 2016-17.
JG 62 (Susceptible check) and JG 315 (Resistant check)
were obtained from Division of Crop Protection, ICAR-
IIPR, Kanpur, India.
Wilt sick plot: The Sick plot is located at 26.490 north
latitude and 80.270 east longitude. The soil type is
alluvial with a pH 8.0 and area receives an annual
average rainfall of 880 mm. The Fusarium wilt sick
plot of size 3000 m2 is located in North East Plane
Zone (NEPZ) of India against F. oxysporum f. sp. ciceris
race 2. It contains threshold inoculum level (~7000
CFU/g of soil) and is designated to evaluate entries of
All India Coordinated Research Project (AICRP) for
NEPZ region. Threshold of inoculum was maintained
by adding inoculum prepared in laboratory on
sorghum grains using dynamic culture of Foc race 2.
Sickplot evaluation of chickpea germplasm for wilt
resistance: A total of 123 chickpea germplasm lines
were evaluated under artificial epiphytotic conditions
during 2015-16. The promising lines identified were
revalidated during 2016-17 for confirmation. The
experiment was laid in a randomized complete block
design (RCBD) with two replications. Each genotype
was planted in 2 rows of 4 m length with row to row
spacing of 30 cm and plant to plant distance of 10 cm.
The chickpea genotype JG 62 and JG 315 were used as
susceptible and resistant check respectively at every
10 test rows as indicators.
The observations were recorded on wilt starting
from seedling to maturity of the crop. Cumulative
percent wilt incidence of each test genotype was
calculated using the formula as: Disease incidence (%)
= (Number of infected plants/ Total number of plants)
x 100.
The test genotypes were grouped as resistant (0–
10% incidence), moderately resistant (10.1–20%
incidence), susceptible (20.1-50%) and highly
susceptible (>50.0 % mortality) based on disease rating
scale given by Sharma et al.(2012). Local Severity Index
(LSI) indicates severity of a disease at a location and
was calculated by using formula LSI (%) = (Total wilt
incidence in a given location/total number of test
entries) x 100.
RESULTS AND DISCUSSION
Fusarium wilt is an important disease in all
chickpea growing agro-climatic zones of India.
219
Cultivation of resistant varieties is an only effective
and economically viable option for management of
wilt disease (Jimenez-Diaz et al. 1993). In the present
study, phenotyping of 123 germplasm lines against
Fusarium wilt was undertaken in a sick plot having
the threshold inoculum level of ~7000 Colony Forming
Units (CFU) per gram of soil. In previous study, Foc
population 1795±253 CFU/g of soil was reported to
be adequate for efficient screening (Halila and Strange,
1997). As a result, many international and national
institutes developed sick plots (Nene et al. 1981;
Jimenez-Diaz et al. 1991) for large scale screening of
chickpea germplasm lines.
In the present study, 123 lines exhibited wide
variation for Fusarium resistance and disease incidence
varied from 0 to 100 percent. Among 123 lines, 22
genotypes showed resistant, 11 were moderately
resistant, 17 were susceptible and 73 were showed
highly susceptible reaction. These genotypes may be
divided into early wilting and late wilting genotypes.
Percentage of early wilting ranged between 1.1 to 90.4
percent and late wilting ranged between 1.4 to 100
percent (Table 1). At seedling stage, 30 genotypes were
sensitive, however, at flowering and podding stage 56
genotypes appeared to be sensitive. Similarly, previous
workers also reported variation in wilt resistance at
seedling and reproductive stage (Haware et al. 1996).
High temperature coupled with moisture stress might
play an important role in the development of the
disease during reproductive stage. Consequently, most
of the genotypes were resistant during seedling stage.
The susceptible check exhibited 100 percent wilt
incidence within 40 days after sowing and a local
severity index (LSI) of 55.2 percent indicating that
screening was reliable. In the current study, 17.8 per
cent germplasm accessions revealed a resistance
reaction (<10% disease incidence) at physiological
maturity stage against race 2. Similarly, in earlier
studies, a small fraction of land race (ILCs) accessions
(5.0 %) collected across the globe were found resistant
to Fusarium wilt race II (Saable et al. 2017). Pande et
al.(2006) and Haware et al. (1992) had reported that
only 12 percent of minicore collections and 1.1 percent
global collections were resistant to Fusarium wilt race
I another race.
Based on previous year observations, 22 resistant
and 11 moderately resistant lines were selected and
were subjected to revalidation for confirmation of
resistance. Similar results were obtained during
revalidation except for a few lines, which, signifies
the differences in response due to genotype. In pooled
data, wilt incidence of chickpea varied from 0.7 to
37.6%. Based on data of two years, 12 lines viz.,
220 Journal of Food Legumes 33(4), 2020

Table 1. List of germplasm lines evaluated against Fusarium wilt during 2015-16
Genotype Early Late Total Genotype Early Late Total Genotype Early Late Total
wilt wilt wilt wilt wilt wilt wilt wilt wilt
(%) (%) (%) (%) (%) (%) (%) (%) (%)
EC-223519 0.0 8.2 8.2 EC-489913 26.5 57.8 84.3 IC-83529 5.9 11.7 17.7
EC-261136 0.0 72.3 72.3 EC-489919 0.0 5.2 5.2 IC-83530 0.0 8.9 8.9
EC-267154 0.0 4.9 4.9 EC-489928 5.2 46.5 51.8 IC-83534 2.6 14.9 17.5
EC-267240 0.0 47.6 47.6 EC-489930 31.2 48.5 79.7 IC-83535 0.0 18.3 18.3
EC-267261 17.1 50.1 67.2 EC-489950 54.9 45.1 100.0 IC-83536 2.1 97.9 100
EC-267265 9.5 48.4 58.0 EC-489974 0.0 21.5 21.5 IC-83537 2.8 21.6 24.4
EC-267272 16.4 47.7 64.1 EC-489975 0.0 22.7 22.7 IC-83538 0.0 6.5 6.5
EC-267293 1.7 12.9 14.6 EC-489989 19.0 79.6 98.6 IC-83539 1.1 8.8 9.9
EC-267308 0.0 1.5 1.5 EC-489991 0.0 3.1 3.1 IC-83541 0.0 13.2 13.2
EC-267316 1.3 79.2 80.5 EC-489992 45.3 54.7 100.0 IC-83542 0.0 5.1 5.1
EC-267437 0.0 3.0 3.0 EC-490005 30.1 20.0 50.2 IC-83543 10.7 52.5 63.2
EC-267484 47.6 52.4 100 EC-490010 52.7 47.3 100.0 IC-83545 8.7 42.1 50.9
EC-267504 1.8 35.7 37.5 EC-490013 63.6 36.4 100.0 IC-83546 13.3 68.4 81.8
EC-267511 0.0 15.5 15.5 EC-490014 58.1 41.9 100.0 IC-83549 9.7 48.2 57.9
EC-440552 3.8 4.9 8.7 EC-490024 73.5 26.5 100.0 IC-83551 0.0 12.8 12.8
EC-441725 3.2 13.1 16.3 EC-490027 4.1 32.1 36.2 IC-83554 0.0 67.8 67.8
EC-441805 48.6 51.4 100 EC-490028 50.0 45.1 95.1 IC-83555 0.0 71.7 71.7
EC-442202 73.4 26.6 100 EC-490030 5.2 28.8 34.0 IC-83556 0.0 5.4 5.4
EC-442226 74.5 25.5 100 EC-490034 52.6 41.8 94.4 IC-83558 0.0 6.6 6.6
EC-442228 0.0 32.6 32.6 EC-490038 42.1 57.9 100.0 IC-83568 84.5 15.5 100
EC-44229 19.4 77.2 96.6 EC-490039 24.5 75.5 100.0 IC-83569 7.6 12.4 20.0
EC-442300 5.4 34.9 40.4 EC-490040 23.4 76.6 100.0 IC-83570 0.0 4.0 4.0
EC-442348 56.2 43.8 100 EC-490042 17.8 82.2 100.0 IC-83571 6.7 68.1 74.8
EC-442380 90.4 9.6 100 EC-490045 25.2 69.5 94.7 IC-83572 32.1 67.9 100
EC-442407 43.8 56.2 100 EC-498765 33.9 59.5 93.5 IC-83573 17.1 82.9 100
EC-442409 50.0 50.0 100 EC-498767 11.9 73.4 85.3 IC-83747 16.1 83.9 100
EC-442519 2.9 74.4 77.3 EC-498773 12.4 67.8 80.2 IC-83748 0.0 3.8 3.8
EC-449853 3.1 54.4 57.5 EC-498779 4.5 57.7 62.2 IC-83750 0.0 8.7 8.7
EC-489845 0.0 10.0 10.0 EC-498780 0.0 71.1 71.1 IC-83751 3.8 3.1 6.9
EC-489861 8.1 66.0 74.2 EC-498812 0.0 21.6 21.6 IC-83753 18.6 70.1 88.7
EC-489865 9.2 41.0 50.2 EC-498818 0.0 1.4 1.4 IC-83757 0.0 7.6 7.6
EC-489867 0.0 75.4 75.4 EC-498823 0.0 53.4 53.4 IC-83758 63.4 36.6 100
EC-489869 5.2 62.6 67.8 EC-498827 10.2 64.7 75.0 IC-83760 4.6 46.2 50.8
EC-489870 1.7 50.4 52.1 EC-267308 0.0 27.8 27.8 IC-83761 3.1 56.7 59.8
EC-489881 7.2 59.3 66.5 IC-83518 0.0 50.2 50.2 IC-83763 54.0 46.0 100
EC-489882 0.0 8.7 8.7 IC-83519 0.0 14.8 14.8 IC-83764 3.0 97.0 100
EC-489883 15.8 62.1 77.9 IC-83522 1.9 24.7 26.6 IC-83765 0.0 100 100
EC-489886 12.6 37.4 50.0 IC-83523 0.0 4.6 4.6 IC-83765 2.0 98.0 100
EC-489887 0.0 35.0 35.0 IC-83524 13.7 57.4 71.1 IC-83766 0.0 100 100
EC-489905 0.0 19.0 19.0 IC-83525 0.0 23.3 23.3 JG62 (S) 66.6 33.4 100
EC-489907 0.0 28.7 28.7 IC-83526 2.5 14.7 17.2 JG315 (R) 0 4.0 4.0
EC-489910 23.3 28.1 51.4 IC-83527 0.0 11.5 11.5
LSI 55.2

EC-267154, EC-267308, EC-489845, EC-489882, EC-
489919, EC-489991, EC-498818, IC-83523, IC-83538,
IC-83539, IC-83748 and IC-83757 were found resistant
and 15 accessions moderately resistant (Table 2) to
Fusarium wilt. The variations observed in per cent
wilt incidence and time of wilt development may be
due to genotype (Upadhyaya et al. 1983) and variations
in genotype sensitivity to toxins of pathogen
(Sutherland and Pegg, 1992). Variations in genotypes
may also be due to ability of chickpea genotypes to
compensate damage caused by pathogen with
production of new roots (Huisman, 1982).
The study concludes that immunity in chickpea
against Fusarium wilt is rather scarce. Though many
resistance sources are being identified across the globe,
a continuous change in the genetic makeup of the
pathogen warrants search for new resistant sources.
The identified resistant germplasm in the present study
 Saabale et al. : Diversity of chickpea germplasm against wilt disease caused by 221
Fusarium oxysporum f. sp. ciceris, Race 2

Table 2. Percent incidence in chickpea genotypes during 2015-16 and 2016-17

Genotype name 2015-16 2016-17 Pooled data Reaction
EC-223519 8.2 43.8 26.0 S
EC-267154 4.9 15.2 10.0 R
EC-267293 14.6 60.6 37.6 S
EC-267308 1.5 9.5 5.5 R
EC-267437 3 17.9 10.4 MR
EC-440552 8.7 12.2 10.5 MR
EC-441725 16.3 12.3 14.3 MR
EC-489845 9.9 2.1 6.0 R
EC-489882 8.7 6.0 7.4 R
EC-489905 18.9 11.4 15.1 MR
EC-489919 5.2 8.7 6.9 R
EC-489991 3.1 11.7 7.4 R
EC-498818 1.4 0.0 0.7 R
IC-83519 14.7 32.4 23.5 S
IC-83523 4.6 4.3 4.5 R
IC-83526 17.2 15.0 16.1 MR
IC-83527 11.4 19.7 15.5 MR
IC-83529 17.6 16.0 16.8 MR
IC-83534 17.5 25.6 21.5 S
IC-83535 18.3 12.3 15.3 MR
IC-83538 6.4 9.8 8.1 R
IC-83539 9.8 4.4 7.1 R
IC-83541 13.1 19.5 16.3 MR
IC-83542 5.1 52.0 28.6 S
IC-83551 12.8 11.2 12.0 MR
IC-83556 5.4 22.1 13.8 MR
IC-83558 6.5 26.8 16.6 MR
IC-83569 20 13.6 16.8 MR
IC-83570 3.9 45.8 24.9 S
IC-83748 3.7 16.2 10.0 R
IC-83750 8.6 18.7 13.7 MR
IC-83751 6.9 27.3 17.1 MR
IC-83757 7.6 8.8 8.2 R
Resistant check 4.0 5.2 4.6 R
Susceptible check 100 100 100 S

can be of great value to plant breeders in their efforts
to develop race specific (Race II) resistant chickpea
cultivars.
ACKNOWLEDGEMENTS
The authors are grateful to The Director, Indian
Council of Agricultural Research-Indian Institute of
Pulses Research for providing facilities to carry out
the investigation.
REFERENCES
Anonymous 2018. Directorate of Economics and Statistics,
Department of Agriculture, Cooperation and Farmer’s
Welfare, Agriculture Statistics at a Glance p. 110.
Halila MH and Strange RN. 1996. Identification of the
causal agent of wilt of chickpea in Tunisia as Fusarium
oxysporum f.sp. ciceri race 0. Phytopathologia
Mediterranea 35: 67-74.
Haware MP and Nene YL. 1980. Influence of wilt at
different stages on the yield loss in chickpea. Tropical
Grain Legume Bulletin 19: 38-40.
Haware MP and Nene YL. 1982a. Symptomless carriers of
the chickpea wilt Fusarium. Plant Disease 66: 250–251.
Haware MP and Nene YL. 1982b. Races of Fusarium
oxysporum f. sp. ciceri. Plant Disease 66: 809-810.
Dubey SC, Priyanka K, Singh V and Singh B. 2012. Race
profiling and molecular diversity analysis of
Fusariumoxysporum f. sp. ciceris causing wilt in chickpea.
Journal of phytopathology 160: 576-587.
Govil JN and Rana BS. 1994. Stability of host plant resistance
to wilt (Fusarium oxysporum f. sp. ciceri) in chickpea.
International Journal of Tropical Plant Disease 2: 55-
60.
Haware MP, Nene YL, Pundir RPS and Narayana Rao J.
1992. Screening of world chickpea germplasm for
resistance to Fusarium wilt. Field Crops Science 30:
147–154.
222 Journal of Food Legumes 33(4), 2020
Haware MP, Nene YL and Natarajan M. 1996. Survival of
Fusarium oxysporum f.sp. ciceri. Plant Disease 66: 809-
810.
Huisman OC. 1982. Inter-relations of root growth
dynamics to epidemiology of root-invading fungi.
Annual Review of Phytopathology 20: 303–327.
Jimenez-Diaz RM, Singh KB, Trapero-Casas A and
Trapero-Casas JL. 1991. Resistance in ‘kabuli’ chickpea
to Fusarium wilt. Plant Disease 75: 914–918.
Jimenez-Diaz RM, Alcala-Jimenez AR, Hervar A and
Trapero- Casas JL. 1993. Pathogenic variability and
host resistance in the Fusarium oxysporum f. sp. ciceri/
Cicer arietinum pathosystem. In Arseniuk Eand Goral T
(ed). Third Proceedings of European Seminar:
Fusarium-mycotoxins taxonomy, pathogenicity and
host resistance, Rodzikov, Poland: Plant Breeding and
Acclimatization Institute pp. 87–94.
NeneYL, Haware MP, Reddy MV. 1981. Chickpea diseases:
resistance screening techniques. ICRISAT Information
Bulletin 10: p. 10.
Pande S, Kishore GK, UpadhyayaHD, Rao JN. 2006.
Identification of multiple disease resistance in mini
core collection of chickpea. Plant Disease 90: 1214-1218.
Saabale PR, Mishra RK, Naimuddin and Chaturvedi. SK.
2017. New sources of resistance in land races and
advance germplasm against Fusarium oxysporum f. sp.
ciceris race 2 causal agent of chickpea wilt. Legume
Research 40: 364-368.
Saabale PR, Manjunath L, Shripad Bhat, Revanappa SB,
Mishra RK, Naimuddin, Chaudhary RG, Srivastava AK,
Chaturvedi SK and Singh NP. 2019. Elucidation of host
resistance for chickpea wilt (Fusariunoxysporum f. sp.
ciceris). Journal of Food Legumes 32: 174-177.
Sharma M, Kiran Babu T, Gaur PM, Ghosha R, Rameshwar
T, Chaudhary RG, Upadhyay JP, Gupta O, Saxena DR,
Kaur L, Dubey SC, Anandani VP, Harer PN, Rathore
A and Pande S. 2012. Identification and multi-
environment validation of resistance to
Fusariumoxysporum f. sp. ciceris in chickpea. Field Crops
Research 135: 82–88.
Singh KB and Dahiya BS. 1973. Breeding for wilt resistance
in chickpea. In Symposium on Problem and Breeding
for Wilt Resistance in Bengal Gram, IARI, New Delhi
pp: 13–14.
Sutherland ML and Pegg GF. 1992. The basis of host
recognition in Fusariumoxysporum f. sp. lycopersici.
Physiological and Molecular Plant Pathology 40: 423–
436.
Trapero-Casas A and Jimenez-Diaz RM. 1985. Fungal wilt
and root rot diseases of chickpea in southern Spain.
Phytopathology 75: 1146-1151.
Upadhyaya HD, Smithson JB, Haware MP and Kumar
J.1983. Resistance to wilt in chickpea. II: further
evidence for two genes for resistance to race1.
Euphytica. 32: 749–755.
 Journal of Food Legumes 33(4): 223-226, 2020

Yield and quality of mungbean genotypes under different foliar

application of nutrients and growth regulators
PRERNA SUNDRIYAL*, DK SHUKLA, CHANDRA BHUSHAN and VK SINGH

Department of Agronomy, G. B. Pant
University of Agriculture and
Technology, Pantnagar (UK), India
*Email: sundriyalprerna@gmail.com
Received: November 18, 2020
Accepted: February 03, 2021
Handling Editor:
Dr. Sanjay S Rathore, ICAR-IARI, New
Delhi
ABSTRACT
A field experiment was conducted during kharif season (2017) with the aim to
study effect of foliar nutrition on growth and development, yield attributes,
yield and economics of mungbean genotypes. The treatments comprised of
two mungbean genotypes and six foliar nutrient applications. The performance
of ‘Pant mung-5’ was found superior to ‘Pant mung-7’ in terms of number of
pods/plant (53.57), test weight (36.91 g), grain yield (1222 kg/ha), protein yield
(263.01 kg/ha) and B:C ratio (2.70). Pant mung-5 produced 14.2 per cent higher
grain yield than Pant mung-7. Among the foliar treatments, RDF + 0.25% borax
being at par with RDF +2% DAP in terms of maximum number of pods/plant
(64.00) and seed yield (1421 kg/ha) recorded significantly higher test weight
(38.71 g), protein yield (338.33 kg/ha) and B:C ratio (3.17) than other foliar
treatments. Thus, foliar nutrition through 0.25% borax or di-ammonium
phosphate (DAP) solution at pre-flowering stage over and above the
recommended dose of fertilizers was found beneficial for higher mungbean
yield in Uttarakhand tarai region.

Key words: Foliar nutrition, Genotype, Grain yield, Mungbean, Protein

Mungbean [Vigna radiata (L.) Wilczek], the third
most important pulse crop in India contains high
amount of quality protein (25%), dietary fibre,
carbohydrates, vitamins (particularly vitamin C) &
minerals. It needs special attention in the era of
nutritional security. India, despite of being the largest
producer of pulses in the world struggled to achieve
self-sufficiency in pulses as the cultivation is primarily
restricted to rainfed and marginal lands, which are
not only thirsty but hungry too. Development of
suitable variety along with matching agro-technique
may advance the steps to achieve potential yield of the
crop. Varietal development being a continuous process
exhibits distinct physiological characters, the response
of which to any treatment may differ significantly with
the different genotypes of the same crop (Pegu et al.
2013, Singh et al. 2017). Hence, it becomes inevitable to
check these responses in order to obtain the best
possible package of practices for a specific region.
Proper nutrition is a prerequisite for desirable
harvest of any crop. In case of mungbean, nutrient
management is limited to basal application only, owing
to its N- fixing ability. However, it has been reported
by various workers that nodule degeneration at
flowering decreases the overall N supply to the plants
which ultimately affects the plant physiological and
metabolic activities (De and Singh 2010). Physiological
factors such as inefficient partitioning of assimilates,
excessive flower abscission and poor pod setting are
some of the proven yield barriers for mungbean crop,
which may be improved by foliar application of
nutrients and growth regulators (Ganapathy et al.
2008). Foliar nutrition makes nutrients readily
available to plants without any loss and thus not only
boosts the crop growth but also ensures quality
production by efficient assimilation of photosynthates
in the seed specifically at pod filling stage, when sink
competition occurs for photosynthates among the
plant parts (Thakur et al. 2017).
Not only nitrogen, foliar application of
phosphorus too has been reported to increase the yield
and yield attributes in mungbean (Chandrashekhar
and Bangarusamy, 2003). Among the micronutrients,
boron plays a key role in achieving higher yield as it
enhances nitrogen assimilation through increased root
growth and nodule formation. Since boron is immobile
in soil sprayed to foliage at the time of flowering
encourages flower and seed setting and quality as well.
In addition to essential nutrients, application of plant
growth regulators like salicylic acid (at non-toxic
concentration) to plants has been proved to be effective
in increasing translocation of photosynthates.
Keeping these points in view, an experiment was
conducted to study the effects of foliar application of
nutrients and growth regulators on two genotypes of
224 Journal of Food Legumes 33(4), 2020

mungbean regarding their growth and yield responses standard agronomic practices were followed as per
under tarai condition of Uttarakhand. the recommendation of crop. To work out protein
content in grains, nitrogen content of grain was
MATERIALS AND METHODS multiplied by 6.25 (A.O.A.C. 1960). All the statistical
The experiment was conducted at N. E. Borlaug analyses was done using STPR-3 software package
Crop Research Centre of G.B.P.U & T, Pantnagar developed by department of mathematics and
(Uttarakhand) during the kharif season of the 2017. statistics GBPUA&T, Pantnagar.
The soil of experimental site was sandy loam in texture
RESULTS AND DISCUSSION
having high organic carbon (0.84%), low available
nitrogen (268.9 kg N /ha), high available phosphorus Growth parameters: Plant height, plant dry matter
(25.1 kg P /ha) and medium available potassium (228.0 accumulation and nodulation at 60 DAS were
kg K /ha) with a slightly alkaline soil reaction (Soil significantly affected by genotypes as well as foliar
pH 7.3). The experimental site experienced a total of treatments (Table 1). ‘Pant mung-7’ accumulated
805.7 mm rainfall during the crop growth period from significantly more dry matter than ‘Pant mung-5’
June to October, 2017, which was lower than the owing to varietal characteristics. On the contrary,
normal rainfall (1285 mm) of the region during this number and dry weight of root nodules were
period. The field experiment was laid out in significantly more in ‘Pant mung-5’ than that of ‘Pant
Randomized Block Design with two factors, mung-7’. These variations in different parameters may
comprising of two genotype viz.; ‘Pant mung-5’ and be because of genotypic variation poses by the varieties.
‘Pant mung-7’ and six foliar nutrition viz.; RDF This finding was in agreement with Reddy and
(Control), RDF + 1000 litres water / ha, RDF + 2 % Majumder 2004, Maheshwari and Karthik 2017.
urea, RDF + 2 % DAP, RDF + 0.25% borax spray at Among the foliar treatments, maximum plant height
pre-flowering stage and RDF + 75 ppm salicylic acid and dry matter accumulation was recorded under RDF
spray at pre-flowering and 7 days after first spray. + 0.25% borax which was statistically at par with RDF
The treatments were replicated thrice. The crop was + 2% urea and RDF + 2% DAP and significantly
sown at 30cm ×10 cm spacing by kera method on July superior to other treatments. The increase in plant
19, 2017. A uniform application of N: P2O5: K2O at the height may be due to the well described role of boron
rate of 18 kg , 48 kg & 24 kg per hectare (RDF) in triggering the meristematic cell division and polar
respectively was applied as basal through N:P:K transport of IAA in leguminous crops as reported by
mixture (12:32:16). At later stage (Pre-flowering), foliar Jiao et al. 2007.
applications were done as per the treatments. To ‘Pant mung-5’ produced more number of active
dissolve DAP warm water was used. The foliar nodules with higher dry weight at 60 DAS than ‘Pant
treatments were applied using 1000 litre water per mung-7’. On the other hand RDF + 0.25% borax
hectare through battery operated knapsack sprayer recorded significantly more number of root nodules
with a flat fan nozzle. To obtain optimum plant per plant at 60 DAS (Table 1). Similar results were also
population, thinning and weeding was done reported by Balachander et al. 2003.Whereas dry
simultaneously at 30 DAS. The harvesting of the crop weight of root nodules per plant was highest in RDF +
was done in one go manually by using sickles. Other
Table 1: Effect of different treatments on growth parameters of mungbean at 60 DAS
Treatments Dry matter accumulation No. of root nodules Dry weight of root
(g/plant) nodules (mg/plant)
Genotypes
‘Pant mung-5’ 13.57 19.9 26.9
‘Pant mung-7’ 15.21 18.0 24.6
LSD at p=0.05 1.00 0.6 1.70
Foliar Nutrition
RDF (Control) 12.99 16.1 22.2
RDF + 1000 litres water/ha spray at pre-flowering stage 13.40 17.1 23.4
RDF + 2 % urea spray at pre-flowering stage 14.62 19.4 26.3
RDF + 2 % DAP spray at pre-flowering stage 15.26 20.4 27.6
RDF + 0.25% borax spray at pre-flowering stage 16.09 22.5 30.2
RDF + 75 ppm salicylic acid spray at pre-flowering & 7 13.98 18.3 24.9
days after first spray
LSD at p=0.05 1.74 1.0 2.86
 Sundriyal et al. : Yield and quality of mungbean genotypes under different foliar application of 225
nutrients and growth regulators

0.25% borax which was statistically at par with RDF
+2% DAP at 60 DAS. Foliar application of nutrients
particularly boron have synergistic effect on
phosphorus and potassium uptake, which in turn
enhanced the root growth in legumes. Sujatha (2001)
and Padma et al. (1989) also reported increased root
length (16.9 cm) in greengram and French bean (20.4
cm) due to foliar application of micronutrients which
proliferated roots and increased sites for rhizobia
infection and ultimately resulted in increased number
of effective nodules and their dry weight. This may be
attributed to profound role of boron in nodulation and
nitrogenase activity. Similar results were reported by
Kumar et al., 2018.
Yield attributes and yield: Performance of ‘Pant mung-
5’ and RDF + 0.25% borax was found significantly
superior in terms of the yield attributing characters
viz. number of pods per plant (54 & 64, respectively),
number of seeds per pod (12.16 and 14.07) and test
weight (36.91 g and 38.71 g), thus resulted in higher
grain yield (1222 & 1421 kg/ha) (Table 2). Though the
number of pods per plant remained at par with RDF +
2% DAP(58.26). This may be because of more number
of root nodules and their dry weight in Pant mung -5
and boron effect responsible for proper nutrition for
plant. The results also confirm the findings of Pandey
& Gupta 2012.
‘Pant mung-5’ recorded 14.2 per cent and 17.4
per cent higher grain yield and harvest index
respectively than ‘Pant mung-7’ (Table 2) due to better
initial growth and higher yield attributing characters.
‘Pant mung-7’ had higher biological yield due to taller
plants and long duration. Among foliar treatments,
grain yield under RDF + 0.25 % borax was significantly
superior to remaining treatments except RDF + 2%
DAP (Table 2). This might be due to reduced seed
abortion and improved pollen-stigma interaction
leading to increased fertilization and seed set, which
ultimately increased the seed yield as reported by
Pandey and Gupta 2012. Higher grain yield under
Pant mung-5 may be attributed to the yield attributing
characters, which were found to be significantly higher
than Pant mung-7. ‘Pant mung-5’ have less
indeterminate growth habit which may have resulted
into more conversion of photosynthates from source
to sink under lesser intra plant competition for
partitioning of photosynthates. Similar findings were
also reported by Maheshwari and Karthik 2017,
Muthal et al. 2016.
On the other hand, no significant difference was
observed on the harvest index of crop due to foliar
treatments (Table 2). Higher seed yield & biological
yield under RDF + 0.25% borax contributed to higher
harvest index as compared to other treatments.
Quality parameters: Protein content, being the genetic
character of mungbean crop was not significantly
influenced by the foliar treatments whereas, protein
yield was significantly influenced by the genotypes
and foliar treatments (Graph 1). Pant mung-5 and
application of RDF + 0.25 % borax recorded higher
protein content and yield than rest of the treatments. It
may be due to higher grain yield under respective
treatment, as protein yield was calculated using
protein content per cent and grain yield. Higher grain
yield and protein content per cent results higher
protein yield and vice-versa.
Economics: Net returns and benefit : cost ratio were
significantly influenced by genotypes and foliar
nutrition. ‘Pant mung-5’ was found profitable over
‘Pant mung-7’ produced significantly higher net

Table 2: Effect of different treatments on yield attributing characters, grain yield and economics of mungbean
Treatment Number of Number of 1000 grains Grain yield Net return B: C
pods/plant seeds/pod .weight (g) (kg/ha) (₹ /ha) Ratio
Genotype
‘Pant mung-5’ 54.6 12.2 36.9 1222 50709 2.70
‘Pant mung-7’ 47.6 10.9 33.9 1070 43489 2.45
LSD at p=0.05 1.91 0.7 0.9 71 4688 0.16
Foliar nutrition
RDF (Control) 40.6 9.9 33.0 926 33310 2.14
RDF + 1000 litres water/ha spray at pre-
42.0 10.3 33.5 990 37162 2.25
flowering stage
RDF + 2 % urea spray at pre-flowering stage 52.1 11.4 35.3 1188 49795 2.67
RDF + 2 % DAP spray at pre-flowering stage 58.3 12.4 36.8 1308 57205 2.89
RDF + 0.25% borax spray at pre-flowering
64.0 14.1 38.7 1421 64896 3.17
stage
RDF + 75 ppm salicylic acid spray at pre-
46.7 11.1 35.0 1044 40226 2.34
flowering & 7 days after first spray
LSD at p=0.05 3.3 1.2 1.7 123 8119 0.27
226 Journal of Food Legumes 33(4), 2020
Graph 1: Effect of different treatments on protein
content per cent and protein yield of mungbean
return (Rs/ha. 50709) and B : C ratio (2.70), this may
be because of higher grain yield (1222 kg/ha) and gross
return (Rs/ha. 80561) while cost of cultivation was
equal for both the genotypes. Among the foliar
nutrition, RDF + 0.25% borax spray at pre-flowering
stage recorded significantly higher net return (Rs/ha
64896) and B:C ratio of 3.17 over other treatments
except RDF+ 2% DAP (Table 2) may be due to higher
grain yield (1421 kg/ha) under respective treatments.
These results were in agreement with Chandrashekhar
& Bangarusamy 2003, Kumar et al. 2013 and
Choudhary et al. 2017.
On the basis of present study, it can be concluded
that ‘Pant mung-5’ was found superior to ‘Pant mung-
7’ with respect to grain quality, yield attributing
characters, yield and economics. Among the foliar
nutrition, 0.25% borax or 2 % DAP at pre-flowering
stage over and above of RDF ( 18 N: 48 P2O5: 24K2O kg/
ha) gave higher seed yield and net return in tarai
condition.
REFERENCES
Balachander D, Nagarajan P and Gangasekharan S. 2003.
Effect of micronutrient on nodulation and yield of
blackgram (Vigna mungo L. Hepper) in acid soil
condition. Legume Research. 26(2): 153-154.
Chandrashekhar CN and Bangaruswamy U. 2003.
Maximizing the yield of mungbean by foliar
application of growth regulating chemicals and
nutrients. Madras Agriculture Journal. 90(3): 142-145.
Choudhary P, Ghosh G, Neha and Kumari N. 2017. Effect
on Yield and Benefit Cost Ratio of Green gram at
Different Phosphorus Levels and Frequency of Boron
Levels. International Journal of Current Microbiology
and Applied Sciences. 6(6): 1095-1103.
De N and Singh R. 2010. Effect of bioferilizer on nodulation
of pea in an alluvial soil. Journal of food legumes.
23: 50-53.
Ganapathy M, Baradhan G and Ramesh N. 2008. Effect of
foliar nutrition on reproductive efficiency and grain
yield of rice fallow pulses. Legume Res. 31(2): 142-144.
Jiao XY, Yang ZP, Zhao RF and Wang LZ. 2007. Effects of
boron on indole-3-acetic acid transportation in intact
phaseolus aureus plant. Ying Yong Sheng Tai Xue. Bao.
18(2): 366-370.
Kumar CV, Vaiyapuri K, Amanullah MM and
Gopalaswamy G. 2013. Influence of foliar spray of
nutrients on yield economics of soybean (Glycine max
L. Merill). Journal of biological sciences. 13(6): 563-
565.
Kumar S, Mamta P and Lal M. 2018. Response of pulse and
oilseed crops to boron application. International
Journal of Current Microbiology and Applied Sciences.
7(3): 669-675.
Maheshwari U and Karthik A. 2017. Effect of foliar nutrition
on growth, yield attributes and seed yield of pulse
crops. Adv Crop Sci Tech. 5(3): 2329-8863.
Muthal YC, Deshmukh SL, Sagevekar VV and Shinde JB.
2016. Effect of foliar application of macronutrient and
micronutrients on yield attributes, yield and
economics of Kharif greengram (Vigna radiata L.).
International Journal of Tropical Agriculture. 34(7):
2143-2148.
Padma M, Reddy SA, Babu RS. 1989. Effect of foliar sprays
of molybdenum (Mo) and boron (B) on vegetative
growth and dry matter production of French bean
(Phaseolus vulgaris L.). The Journal of. Research. Andhra
Pradesh Agricultural University. 17: 87-89.
Pandey N and Gupta B. 2012. The impact of boron sprays
on reproductive quality and seed biology of
blackgram. Journal of Trace Elements in Medicine and
Biology. 27: 58-64.
Pegu L. 2013. Performance of some blackgram genotypes
in relation to physiochemical, root parameters and as
influence by foliar feeding with boron. Legume Res.
36(6): 505-510.
Reddy CCS and Majumder TK 2004. Effect of foliar spray
of boron and IAA on vegetative growth and yield of
blackgram. Environment and Ecology. 22(2): 445-446.
Singh RB and Rajput RL 2017. Effect of genotypes and
phosphorus levels on growth analysis parameters of
greengram (Vigna radiata L.) Legume Research. 40(2):
331-334.
Sujatha KB. 2001. Effect of foliar spray of chemicals and
bioregulators on growth and yield of greengram
(Vigna radiata L.). M.Sc. Thesis, Tamil Nadu Agric. Univ.,
Coimbatore.
Thakur V, Teggell RG and Meena MK. 2017. Influence of
foliar nutrition on growth and yield of pulses grown
under North Eastern Dry Zone of Karnataka.
International Journal of Pure and Applied Bioscience.
5(5): 787-795.
 Journal of Food Legumes 33(4): 227-231, 2020

Host preference and development of Callosobruchus analis (F.) on

different legumes
RAJNISH DWIVEDI1, SANJAY M. BANDI2*, PRASTUTI MISHRA2, REVANASIDDA2 and BANSA SINGH2

1
Bundelkhand University, Jhansi
(India); 2ICAR-Indian Institute of Pulses
Research, Kanpur (India).
*E-mail: sanjaysmb@gmail.com
Received: December 26, 2020
Accepted: February 18, 2021
Handling Editor:
Dr. Gaurav K Taggar, PAU, Ludhiana
ABSTRACT
Bruchids cause qualitative and quantitative deterioration of legumes, especially
during post-harvest storage. The study was conducted to determine the
preference and development of Callosobruchus analis (F.) on six common
legume hosts, viz. mungbean, urdbean, desi chickpea, kabuli chickpea, pigeonpea
and cowpea using no-choice and free-choice assay. The C. analis adult beetles
preferred to lay more eggs on pigeonpea (59.00 eggs) and cowpea seeds (76.67
eggs) in no-choice and free-choice assay, respectively indicating the most
preferred oviposition substrates. Higher egg density was evident on cowpea
(1.14 eggs per seed), desi chickpea (1.07) and kabuli chickpea (1.01) in free-
choice assay. The rate of adult emergence in free-choice assay was found to be
higher in pigeonpea (88.53 %) signifying the suitability of host. The egg-to-
adult developmental period was 1.4 to 1.5 times longer on urdbean seeds (43-44
days) and delayed development was apparent in comparison to other legumes.
Nevertheless, C. analis was found to breed and survive on all six legumes but
host seeds had significant effect on oviposition, survival and developmental
time. The seed characters, nutritional composition and presence of deterrent
factors could have attributed to differential preference and development of C.
analis on six different legumes studied.

Key words: Bruchids, Callosobruchus analis (F.), Damage, Developmental time,

Host preference, Legumes.

INTRODUCTION
Grain legumes or pulses, members of the
Fabaceae (Leguminosae) family, are important
components of farming system and a principle source
of affordable dietary protein and minerals in human
nutrition across the globe. Legumes constitute about
27 per cent of the global crop production (Graham and
Vance 2003) contributing to nearly 33 per cent of the
dietary needs in human nutrition (Vance et al. 2000).
India is the largest producer (22.08 m tonnes) and
consumer of pulses in the world contributing around
25-28 per cent of the total global pulse production
(DAC & FW 2020).
Pulses in the tropical and subtropical countries
are prone to infestation by bruchids or pulse beetles of
the sub-family Bruchinae in the field as well as storage.
About 20 species of bruchids belonging to six genera
are recognized as cosmopolitan pests of economic and
edible stored legumes (Borowiec 1987; Southgate 1979)
of the genera Vigna, Phaseolus, Glycine, Lablab, Vicia,
Pisum, Cicer, Lens, Cajanus and Arachis (Credland 1987;
Erler et al. 2009; Gbaye et al. 2011). Immature stages of
the beetle from egg to pupae are found in/on the single
seed (Howe and Currie 1964; Credland et al. 1986).
The adult female glues the eggs to the testa of the seeds
and the young larvae chew through the seed coat
beneath the eggs into the seeds (Eker et al. 2018). The
larval stages are internal feeders and more than one
larvae are reported to develop within a single seed.
The reproductively mature adults emerge from the
seeds which are well adapted to the storage
environments and do not require either food or water
resources to reproduce (Credland 1987). The presence
of life stages of the bruchids and completely hollowed
seeds render the stored pulses unfit for human
consumption. Heavy infestations often lead to
mouldiness and poor germination, reduced weight and
loss of commercial value of the pulses (Olubayo and
Port 1997). Some bruchid species can infest the crop in
field, but initial or pre-harvest infestation seldom
reaches 1-2 per cent (Southgate 1979) and this
population multiplies dramatically, reaching to a level
of 80 per cent, in six to eight months of storage, and
causing up to 100 per cent loss of stored seeds (Singh
et al. 1978; Caswell 1961).
Bruchids are co-evolved to survive on dried seeds
of leguminous plants in storage environment
(Rodriguez 2018) and are reported to breed
228 Journal of Food Legumes 33(4), 2020
successfully on a wide range of legume seeds. The
beans of the family Fabaceae are principle hosts of
bruchids (Johnson 1981). Most of the bruchid species
infesting legume sub-family Faboideae are
oligophagous and their host range is limited to certain
plant taxa, mainly tribes and subtribes (Jermy and
Szentesi 2003; Tuda et al. 2005). Hosts of the
Callosobruchus sp. mainly belong to the subtribe
Phaseolinae followed by Cajaninae and Glycininae of the
leguminous tribe, Phaseoleae (Johnson 1981). The
ovipositing female bruchid discriminates among
legume hosts based on seed characters (Messina et al.
1987, Credland and Wright 1988). The survival of
offspring is influenced by host seed selection by
ovipositing females because once the egg is laid on
seed, the larvae are unable to migrate to other host
seeds (Smith 1986). The egg distribution depends on
host seed size in order to maximize the survival of
offsprings (Cope and Fox 2003) although, growth and
development depends on nutritional value of seeds
(Howe and Currie 1964).
The degree of host seed selection, oviposition and
development of bruchids considerably varies among
different kinds of legumes. However, the post-harvest
storage of susceptible legumes at one place are often
prone to cross-infestation by bruchids. Hence, the
study was carried out to assess the host preference
and development of Callosobruchus analis (F.) on six
common legumes.
MATERIALS AND METHODS
Insect culture: The culture of C. analis was initiated
from the stock culture maintained at Storage
Entomology Laboratory at Division of Crop Protection,
ICAR - IIPR, Kanpur. Pulse beetles were reared on
healthy and sterilized seeds of mungbean following
the procedure of Strong et al. (1968). About 100 g of
mungbean seeds were infested with 25 pairs of adult
beetles (0-3 days old). After three days, all adults were
removed and seeds containing eggs were incubated
for adult emergence at 27±1C and 65±5 per cent relative
humidity in laboratory. Adults emerging from this
culture were utilized for experiments. The male and
female beetles were separated on the basis of
distinctive abdominal characters following Bandara
and Saxena (1995).
Host preference assay: The preference of C. analis to
different pulses, viz. mungbean, urdbean, desi chickpea,
kabuli chickpea, pigeonpea and cowpea was
ascertained following free-choice and no-choice assay
as described by Raina (1971) and Duraimurugan et al.
(2014) with necessary modifications.
No-choice test: The adult beetles in no-choice test were
supplied with a single kind of legume seeds thereby
not giving a choice to select the preferred host seed(s).
Two pairs of 0-3 day old beetles were introduced in a
Petri dish containing 100 seeds of each legumes,
separately for 48 hours. Each Petri dish was considered
as a replication for each legume and the experiment
consisted of three replications.
Free-choice test: In free-choice test, all the legume seeds
were subjected to infestation of bruchids, thereby the
bruchids were allowed to select the preferred host
seed(s) placed in the same arena (6.5 cm diameter) at
an equidistance from the insect release point (9 cm
diameter) in an olfactory chamber (60×60 cm; L×W).
Adult beetles of about 0-3 days old were placed in the
centre of test area at the rate of two pairs for each
replication. Petri dish containing 100 seeds of each
legume was considered as a replication. The
experiment was replicated thrice. The adult beetles
were discarded after 48 hours.
Data collection and statistical analysis: The
observations on oviposition, F1 adult emergence and
hollowed seeds were recorded to calculate the egg
density and seed damage (Khattak et al. 1995). Adult
emergence was recorded from first day of F1 emergence
up to a period of 15 days continuously, from different
pulse seeds to compute adult emergence (%) and mean
developmental period (MDP) (Howe 1971). The data
were analysed using one way ANOVA followed by
Tukey’s HSD post hoc tests (P = 0.05) using SPSS 16.0
(SPSS Inc., Chicago, IL).
RESULTS AND DISCUSSION
Oviposition: Female bruchids deposited variable
number of eggs on all legumes tested (Fig. 1).
Oviposition differed significantly among the different
legumes in no-choice (F=4.26, df= (5,12), P<0.05) as
well as free-choice assay (F=3.60, df= (5,12), P<0.05)
[Fig.2(a) and 2(b)]. Number of eggs laid on pigeonpea
seeds were significantly higher (59.00 eggs) in no-
choice assay. This was followed by cowpea (55.0 eggs),
however total eggs deposited on cowpea was
comparable with rest of the legumes. In free-choice
assay, maximum number of eggs were deposited on
cowpea seeds (76.6 eggs) followed by desi chickpea
(51.6 eggs), pigeonpea (49.3 eggs) and kabuli chickpea
seeds (39.6 eggs). Thus, cowpea and pigeonpea seeds
had greater eggs deposited by C. analis. These findings
are in conformity with previous studies which reported
highest oviposition preference of C. maculatus to
cowpea, pigeonpea and chickpea (Giga and Smith
1987; Swella and Mushobozy 2009). Mainali et al.
 Dwivedi et al. : Host preference and development of Callosobruchus analis (F.) on different legumes
(2015) reported higher preference of C. chinensis to
cowpea seeds as oviposition substrate due to higher
surface area of the cowpea seed. The oviposition
behaviour of female beetles could have been affected
by seed surface characters and kind of legume hosts.
The present findings are in agreement with the reports
of Raina (1971); Srivastava and Bhatia (1959); Teotia
and Singh (1966) and Singh et al. (1980). Egg density
among the different legumes seeds did not differ
significantly in no-choice (F=1.12, df= (5,12), P=0.39)
as well as free-choice assay (F=2.91, df= (5,12), P=0.06)
[Fig.2(a) and 2(b)]. Cowpea (1.14 eggs per seed), desi
chickpea (1.07 eggs per seed) and kabuli chickpea (1.01
eggs per seed) had higher eggs per seed in free choice
test. The seed size and seed coat characters could have
been responsible for differential oviposition across the
legumes as stated by Howe and Currie (1964).
Fig. 1. Different legume seeds bearing the eggs laid by
C. analis
Adult emergence and seed damage: Adult emergence
was found significantly higher on desi chickpea
(92.94%) which was comparable to pigeonpea
(91.74%), urdbean (83.08%) and cowpea (67.07) in no-
choice assay (F=3.59, df= (5,12), P<0.05) (Fig. 3(a). In
free-choice assay, the significantly higher adult
emergence was recorded on pigeonpea (88.53%)
followed by desi chickpea and kabuli chickpea (Fig. 3
(b). Seeds with circular exit holes and a ‘flap’ of seed
Fig.2. Number of eggs (Mean ±SE) and egg density
(Mean ±SE) of C. analis on different legumes seeds in
no-choice (a) and free-choice assay (b). Means
followed by same letters are not significantly different
according to Tukey’s test (P < 0.05).
229
coat were considered as damaged seeds (Fig. 4). The
seed damage differed significantly amongst the
legumes in both no-choice (F=2.99, df= (5,12), P<0.05)
and free-choice test (F=5.82, df= (5,12), P<0.05).
Pigeonpea seeds in no-choice assay suffered higher
damage (54.33%), while in free-choice test,
significantly more damage was registered on cowpea
(52.67 %). Swella and Mushobozy (2009) reported
higher C. maculatus adult emergence in cowpea (88.10
%), garden pea (76.30 %) and pigeonpea (60.80 %).
Fig. 3. Rate of C. analis adult emergence (Mean ±SE)
and damage (Mean ±SE) to different legumes seeds in
no-choice (a) and free-choice assay (b). Means followed
by same letters are not significantly different according
to Tukey’s test (P < 0.05).
Fig. 4. The damaged seeds of different legumes
showing circular exit holes of adult bruchids
Developmental time: The mean developmental period
of C. analis from egg-to-adult ranged from 29.09 to 43.66
days and 29.36 to 44.29 days in no-choice and free-
choice assay (Fig. 5). The developmental time of C.
analis was found to be longer on urdbean seeds (43.66
and 44.29 days) as compared to remaining legume
seeds in both the assay, respectively. This indicated
slower development of C. analis in urdbean which
could be attributed to chemical composition of urdbean
seeds influencing the metabolic rate of larvae. Sulehrie
et al. (1998) found delayed development of C. maculatus
on urdbean varieties and opined that the non-
230 Journal of Food Legumes 33(4), 2020
adaptability of larvae to utilize the urdbean seed
proteins or presence of deterrent effects in host seeds
limiting the metabolic activities and normal
development of larvae. Southgate (1979) reported that
the absence of nutritional factors and presence of toxic
substances in legume seeds may affect the bruchids.
Fig. 5. Egg-to-adult developmental time (days ±SE) of
C. analis on different legume hosts in no-choice and
free-choice assay
CONCLUSION
Results clearly indicate that C. analis can breed
on all common legumes tested (viz., mungbean,
urdbean, desi chickpea, kabuli chickpea, pigeonpea and
cowpea) and none was completely rejected for either
oviposition or for feeding. However, the degree of
oviposition, damage and developmental rate varied
considerably amongst the different legume seeds.
Higher total oviposition, adult emergence and seed
damage by C. analis in cowpea and pigeonpea revealed
suitability of cowpea as a host. The developmental
time of C. analis from egg-to-adult was 1.4 to 1.5 times
longer on urdbean seeds in comparison to other
legumes. Although the extent of preference and
performance of C. analis varied across the legume hosts,
the post-harvest storage of these legumes without
proper packaging at a common place could lead to
cross-infestation. The seed size, texture, hardness,
presence of nutritional factors, deterrent factors could
have affected the bruchid behaviour and development
across the host seeds. Further studies are essential to
determine the effect of these parameters on
oviposition, development and damage by C. analis in
different legumes.
ACKNOWLEDGEMENT
The authors are thankful to Director, ICAR-IIPR,
Kanpur for providing necessary facilities for carrying
out the study at Storage Entomology Laboratory, IIPR
Kanpur.
REFERENCES
Bandara KAN and Saxena RC. 1995. A technique for
handling and sexing Callosobruchus maculatus (F.) adults
(Coleoptera, Bruchidae). J. Stored Prod. Res., 31: 97-
100.
Borowiec L. 1987. The genera of seed-beetles (Coleoptera,
Bruchidae). Polskie Pismo Entomologiczne, 57: 3-207.
Caswell GH. 1961.The infestation of cowpeas in western
Region of Nigeria. Tropical Sci., 3: 154-158.
Cope JM and Fox CW. 2003. Oviposition decisions in the
seed beetle, Callosobruchus maculatus (Coleoptera:
Bruchidae): effects of seed size on superparasitism, J.
Stored Prod. Res., 39: 355-365.
Credland PF, Dick KM and Wright AW. 1986. Relationships
between larval density, adult size and egg production
in the cowpea seed beetle, Callosobruchus maculatus.
Ecol. Entomol., 11: 41-50.
Credland PF. 1987. Effects of host change on the fecundity
and development of an unusual strains of
Callosobruchusmaculatus (F.) (Coleoptera: Bruchudae).
J. Stored Prod. Res., 23(2): 91-98.
Credland PF and Wright AW. 1988. The effect of artificial
substrates and host extracts on oviposition by
Callosobruchus maculatus (F.) (Coleoptera: Bruchidae).
J. Stored Prod. Res., 24: 157–164.
DAC & FW. 2020. First advance estimates of production of
food-grains for 2020-21. Directorate of Economics and
Statistics. Ministry of Agriculture and Farmers
Welfare, Government of India. p. 02. http://
agricoop.gov.in. Accessed on 19.11.2020.
Duraimurugan P, Pratap A, Singh SK and Gupta S. 2014.
Evaluation of screening methods for bruchid beetle
(Callosobruchus chinensis) resistance in greengram
(Vigna radiata) and Blackgram (Vigna mungo) genotypes
and influence of seed physical characteristics on its
infestation. Vegetos, 27(1): 60-67.
Eker T, Felai E and Alper A. 2018. Screening of chickpea
accessions far resistance against the pulses beetle
Callasobruchus chinesis L. (Coleoptera bruchidae), J.
Stored Prod. Res.,76: 51-57.
Erler F, Ceylan F, Erdemir T and Toker C. 2009.
Preliminary results on evaluation of chickpea, Cicer
arietinum, genotypes for resistance to the pulse beetle,
Callosobruchus maculatus. J. Insect Sci., 9: 1-7.
Giga DP and Smith RH. 1987. Egg production and
development of Callosobruchus rhodesianus and
Callosobruchus maculatus (F.) (Coleoptera: Bruchidae)
on several commodities at two differed temperatures,
J. stored Prod. Res., 23(1): 9-15.
Graham PH and Vance CP. 2003. Legumes: Importance
and constraints to greater use. Plant Physiol., 131: 872-
877.
Gbaye OA, Millard JC and Holloway GJ. 2011. Legume
type and temperature effects on the toxicity of
 Dwivedi et al. : Host preference and development of Callosobruchus analis (F.) on different legumes
insecticide to the genus Callosobruchus (Coleoptera:
Bruchidae). J. Stored Prod. Res., 47(1): 8-12.
Howe RW. 1971. A parameter for expressing the suitability
of an environment for insect development. J. Stored
Prod. Res., 7(1): 63-65.
Howe RW and Currie JE. 1964. Some laboratory
observations on the rates of development, mortality
and oviposition of several species of Bruchidae
breeding in stored pulses. Bull. Entomol. Res., 55: 437-
477.
Jermy T and Szentesi A. 2003. Evolutionary aspects of host
plant specialization - a study on bruchids (Coleoptera:
Bruchidae). Oikos, 101: 196–204.
Johnson CD. 1981. Seed beetle host specificity and the
systematics of the Leguminosae. In: RM Polhill and
Raven PH (Eds). Advances in Legume Systematics, Part
2, Royal Botanic Gardens, Kew. pp. 995-1027.
Khattak SU, Jan KY, Hussain N and Khalil K. 1995.
Resistance of chickpea cultivars to pulse beetle,
Callosobruchus maculatus. Sci. Khyber. 8: 1-8
Mainali BP, Kim HJ, Park CG, Yoon YN, Lee YH, Park IH,
Kang HW and Bae SD. 2015. Interactive effects of
temperature and relative humidity on oviposition and
development of Callosobruchus chinensis (L.) on azuki
bean. J. Stored Prod. Res., 63: 47–50.
Messina FJ. 1987. Genetic contribution to the dispersal
polymorphism of the cowpea weevil (Coleoptera:
Bruchidae). Ann. Entomol. Soc. Am., 80: 12-16.
Olubayo FM and Port GR. 1997. The efficacy of harvest
time modification and intercropping as methods of
reducing the field infestation of cowpeas by storage
bruchid in Kenya. J. Stored Prod. Res., 33(4): 271-276.
Raina AK. 1971. Comparative resistance in a strain of
chickpea (Cicer aritenum L.) J. Stored Product Res., 7:
213-216.
Rodriguez SA. 2018. Semio-chemistry of the Bruchidae
species. J. Stored Prod. Res., 77: 148-155.
Singh RR, Luse RA, Leuschuner K and Nangju D. 1978.
Groundnut oil treatment for the control of
Callosobruchus maculatus (F.) during cowpea storage. J.
Stored Prod. Res., 14: 77-80.
231
Singh Y, Saxena HP and Singh KM. 1980. Exploration of
resistance to pulse beetle. III. Growth, development of
C. maculatus F. Indian J. Entomol., 42: 622-626.
Smith RH. 1986. Oviposition, competition and population
dynamics in storage insects. In: Proc. 4 th Int. Work.
Conf. Stored-Product Protection. E Donahaye and S.
Navarro (Eds). pp. 426-433.
Southgate BJ. 1979. Biology of Bruchidae. Ann. Rev.
Entomol., 24: 449-473.
Srivastava BK and Bhatia SK. 1959. The effect of host species
on the oviposition of Callosobruchus chinensis (F.)
(Coleoptera: Bruchidae). Ann. Zool. Agra., 3: 37-42.
Strong RG, Partida GJ and Warner DN. 1968. Rearing stored
product insects for laboratory studies, bean and cowpea
weevil. J. Econ. Entomol., 61: 747-751.
Sulehrie MAQ, Golob P, Moss C and Tran BMD. 1998. The
oviposition and development of a Pakistani biotype
of Callosobruchus maculatus (F.) (Coleoptera: Bruchidae)
on different host legumes. In: Proc. 7th Int. Work. Conf.
Stored Products Protection, Beijing. Vol. I. pp 43-50.
Swella GB and Mushobozy DMK. 2009. Comparative
susceptibility of different legume seeds to infestation
by cowpea Bruchid Callosobruchus maculatus (F.)
(Coleoptera: Chrysomelidae). Plant Protect. Sci., 45(1):
19-24.
Teotia TPS and Singh VS. 1966. The effect of host species
on the oviposition, fecundity and development of
Callosobruchus chinensis Linn. (Bruchidae: Coleoptera).
Bull. Grain Technol., 4: 3-10.
Tuda M, Chou LY, Niyomdham C, Buranapanichpan S
and Tateishi Y. 2005. Ecological factors associated with
pest status in Callosobruchus (Coleoptera: Bruchidae):
high host specificity of non-pests to Cajaninae
(Fabaceae). J. Stored Prod. Res., 41: 31-45.
Vance CP, Graham PH and Allan DL. 2000. Biological
nitrogen fixation. Phosphorus: a critical future need.
In: FO Pedrosa, M Hungria, MG Yates and WE Newton
(Eds), Nitrogen Fixation: From Molecules to Crop
Productivity. Kluwer Academic Publishers, Dordrecht,
The Netherlands. pp. 506–514.
 Journal of Food Legumes 33(4): 232-244, 2020

Molecular characterization of begomoviruses causing yellow mosaic

disease in Vigna stipulacea and evidence of recombination
MOHAMMAD AKRAM1, NAIMUDDIN KAMAAL1*, ADITYA PRATAP2, ABDUL MUIN1,
SHAMEEM AHMAD1, ANIRUDDHA KUMAR AGNIHOTRI1, PAWAN SHINDE3, PR SAABLE3 and
NP SINGH2

1
Division of Crop Protection, 2Division
of Crop Improvement, ICAR-Indian
Institute of Pulses Research, , Kanpur
208024, India, 3IIPR-Regional Research
Station, Dharward, India
*Email: naimk@rediffmail.com
Received: October 27, 2020
Accepted: January 12, 2021
Handling Editor:
Dr. Gaurav Kumar Taggar, PAU,
Ludhiana
ABSTRACT
In April 2019 symptoms similar to yellow mosaic of many pulse crops were
observed on Vigna stipulacea grown in a field near the village Vijayanagar,
Karnataka, India.  Samples of YMD affected leaves were collected for
identification and characterization of virus/es associated with the disease.
Fourteen primer pairs were used to amplify the genomic DNA of Mungbean
yellow mosaic India virus (MYMIV), Mungbean yellow mosaic virus (MYMV)
and Horsegram yellow mosaic virus (HgYMV). Blast analysis of the full length
molecules of the viral genomes revealed association of three viruses (MYMIV,
MYMV and HgYMV) with the YMD in V. stipulacea. Comparison of intergenic
region of DNA-A and DNA-B of corresponding virus species revealed presence
of a common region with highest level of sequence identity, confirming that
the DNA-B molecules are in fact cognate of DNA-A molecule of corresponding
virus species. The recombination detection analysis indicated presence of a
putative event in DNA-A of HgYMV-Vs (MN698282) and MYMIV-Vs
(MN698280) by seven detection methods. Mixed infection by these viruses in V.
stipulacea is likely to have caused exchange of genetic material among DNA as
leading to the formation of recombinant DNA-A of HgYMV-Vs isolate. Multiple
infections by three begomovirus species in V. stipulacea may have a bearing
not only on the epidemiology of the YMD in pulse crops but also on the
emergence of the new virus species or recombinant strains.

Key words: Begomoviruses, Cognate, Geminiviruses, Pulse crops, Yellow mosaic

disease

The genus Vigna is large and immensely variable
comprising more than 200 species and holds
tremendous agronomic importance (Pratap et al. 2014).
All these species are distributed in 7 subgenera
accommodating 18 cultivated species as well. Asia
represents a centre of diversity for the subgenus
Ceratotropis, popularly known as the Asiatic Vigna and
includes 24 species, distributed in three sections viz.,
Ceratotropis, Aconitifoliae and Angulare (Tateishi, 1996;
Yadav et al. 2014). The constituent subgenus,
Ceratotropis, also known as the Asiatic Vigna, is an
important taxonomic group from which six species
viz., Vigna aconitifolia (Jacq.) Maréchal, V. aridicola N.
Tomooka et Maxted, V. indica T.M. Dixit, K.V. Bhat &
S.R. Yadav, V. khandalensis (Santapau) Raghvan et
Wadhwa, V. trilobata (L.) Verdc. and V. stipulacea (Lam.)
Kuntze are prominent (Gore et al. 2019). Among these,
V. trilobata and V. stipulacea are considered as semi-
domesticated and find their use in food, fodder, short-
term pasturage and green manuring. Morphologically,
V. trilobata and V. stipulacea have very close resemblance
and therefore are often misidentiûed in the field.
Recently, Gore et al. (2019) suggested a key for
delineation of V. stipulacea from V. trilobata which
described that V. stipulacea has intermediate
germination, angular stem, large stipule, raceme above
canopy, compact inflorescence, purple keel pocket,
slightly developed aril, and seed with slightly
protruding and oblong hilum. Its pods are generally
long and seeds have rough seed surface.
V. stipulacea is a creeping plant, cultivated by the
ethnic groups in parts of India for food and fodder
uses. It is also reported to possess many useful traits
including resistance to diseases and insect-pests
(Nagaraj et al. 1981; Chandel et al.1984; Tomooka et al.
2006; Pandiyan et al. 2008) and adaptation to hot, dry,
and tropical lowland habitats. This makes it an
important candidate for neo-domestication as well as
inclusion in hybridization programmes for
transferring desirable traits in cultivated vignas. V.
stipulacea has quite a wide distribution and grows well
in open or lightly shaded and partially disturbed
habitats. It is common to see V. stipulacea growing in
humid subtropical tropical wet and dry forests of India
 Akram et al. : Molecular characterization of begomoviruses causing yellow mosaic disease in
Vigna stipulacea and evidence of recombination
on the bunds of paddy fields or in abandoned paddy
fields in Western Ghats (Maharashtra, Karnataka,
Kerala), Eastern Ghats (Odisha) and Tamil Nadu;
Indo-Gangetic plains (Uttarakhand, Uttar Pradesh,
Chhattisgarh and West Bengal), and Rajasthan.
Yellow mosaic disease (YMD) was first reported
in cowpea (Vigna unguiculata) in 1942, since then it
has been reported on lima bean (Phaseolus lunatus),
dolichos (Dolichos lablab), mungbean (Vigna radiata),
urdbean (Vigna mungo), pigeonpea (Cajanus cajan),
horsegram (Macrotyloma uniflorum), French bean
(Phaseolus vulgaris), mothbean (Vigna aconitifolia),
soybean (Glycine max) and many wild Vigna species
(Singh et al. 2019; Naimuddin et al. 2016).
Symptoms of viral diseases are broadly similar
in all the host plants and hence it is quite often taken
as caused by the same virus. However, in the last
decade rapid advancement has been made towards
understanding of viruses involved in YMD of new
hosts particularly pulse crops. Eleven distinct viruses
(Mungbean yellow mosaic India virus, Mungbean yellow
mosaic virus, Horsegram yellow mosaic virus, Dolichos
yellow mosaic virus, Rhynchosia yellow mosaic virus,
Rhynchosia yellow mosaic India virus, Velvet bean severe
mosaic virus, Kudzu mosaic virus, Soybean mild mottle
virus, Soybean chlorotic blotch virus, Desmodium mottle
virus) are known to cause YMD in different leguminous
species (Qazi et al. 2007; Ilyas et al. 2009; Briddon et al.
2010; Alabi et al. 2010; Akram et al. 2015; Mollel et al.
2017). All these begomoviruses are restricted to infect
legume hosts only with the exception of MYMIV which
has recently been reported to infect tomato (Agnihotri
et al. 2019; Shahid et al. 2019). Besides this, MYMIV
and MYMV have also been found associated with
some weed plants which might be playing a role to
provide primary source of inoculum (Naimuddin et
al. 2014; Marabi et al. 2017).
All these above mentioned begomoviruses except
Soybean mild mottle virus possess bipartite genome
consisting of two circular ssDNA molecules (DNA-A
and DNA-B) with similar genome organization. Mixed
infection by two or more viruses are not uncommon.
But the application of next generation sequencing has
revealed many more cases of mixed infection by plants
viruses (Prabha et al. 2013; Maliogka et al. 2018; Mutuku
et al. 2018). Due to the transmission by the similar
vector and the preference of the same host plants the
chances of mixed infection are high almost in all the
YMD affected plants of these begomoviruses. The
exchange of genetic materials takes place in case of
mixed infection and lead to the development of
recombinant virus strains/species (Padidam et al.
233
1999; Garcia et al. 2007; Davino et al. 2009; Tugume et
al. 2016; Fiallo et al. 2019; Diaz et al. 2019). A relatively
high number of recombination events have been
reported in the population of MYMIV and MYMV
(Morya et al. 2014) among the Begomovirus studied and
in DoYMV (Akram et al. 2015). Search of the literature
from different sources indicated that there is no record
of a virus disease including YMD in V. stipulacea. It
was therefore decided to characterize the virus/es
associated with YMD of V. stipulacea.
MATERIALS AND METHODS
Disease symptoms and sample collection: During a
survey for the collection of YMD affected samples of
minor pulses in the month of April 2019, three samples
of yellow mosaic disease affected leaves of Vigna
stipulacea were collected from Vijayanagar
(Coordinates: 12° 58' 18.9840'’ N and 77° 31' 57.8820'’
E.), Raichur, Karnataka, India. Field observation also
showed presence of whiteflies in the crop. Three
samples designated as Vs1 (29-19-DBT), Vs2 and Vs3
of the leaves showing yellow mosaic symptoms were
collected for the identification of the viruses causing
the disease.
Designing of primers: Using available full genome
sequences (data not shown) of three Begomovirus
species viz., Mungbean yellow mosaic India virus
(MYMIV), Mungbean yellow mosaic virus (MYMV) and
Horsegram yellow mosaic virus (HgYMV) in the
database, 14 primer pairs were designed (Table 1) to
amplify approximately 1.5kb of the DNA-A or DNA-B
molecules of MYMIV, MYMV and HgYMV known to
cause yellow mosaic disease (YMD) in many
leguminous hosts (Naimuddin et al. 2016). These
primers were designed in such a way that the complete
genome is obtained through direct sequencing of the
PCR products (Fig. 2A,B & C) without cloning into a
vector.
DNA extraction, rolling circle amplification and PCR:
The total DNA extracted using DNeasy Plant Mini Kit
(Qiagen Inc., USA), following the manufacturer’s
instructions was used as template in PCR as well as
in rolling circle amplification (RCA) to enrich the viral
DNA present in the sample. The RCA reaction was
performed using REPLI-g Mini Kit (QIAGEN GmbH,
Hilton) following the manufacturer’s instructions. The
RCA product was diluted in 1:20 ratio and used for
the amplification of target DNA fragments. The
amplification was performed in an automated
Mastercycler ProS (Eppendorf AG, Germany)
programmed for one cycle for 3 min as initial
denaturation at 94 0C and 35 cycles for 30 sec of
234 Journal of Food Legumes 33(4), 2020
denaturation at 940C, 1.5 min annealing temperature
at 560C, 1 min for extension at 720C, followed by one
cycle of final extension for 10 min at 720C. The total
volume of the PCR mix was 40 µl for each reaction.
PCR mix was prepared using Dream Taq Green Master
Mix 2x (Fermentas) according to the manufacturer’s
instructions. The PCR products were resolved in 1%
agarose gel and photographed. The PCR products were
cleaned using the PCR Cleanup Kit (Nucleo-pore) and
the concentration of the DNA was measured using
Nanodrop 2000 spectrophotometer (Thermo
Scientific). The PCR products were sequenced through
Maptech Intruments, Lucknow, India.
Sequence analysis: The sequence data received from
the service provider were assembled and analyzed
using the software Bioedit (v-7.2). The full length
sequence of DNA-A and DNA-B molecules were
subjected to BLAST (https://blast.ncbi.nlm.nih.gov).
These sequences were also subjected to ORF finder
and all ORFs that could encode proteins of Geminividae
family were used to identify potential homologues. The
pair wise per cent nucleotide identity of DNA-A and
DNA-B of MYMIV-Vs (MN698280 and MN698281),
MYMV-Vs (MN814423 and MN698283) and HgYMV-
Vs (MN698282 and MN814424) and different ORFs
with selected isolates (Table 2) of the corresponding
virus species were obtained by SDTv1.2 software
(http://web.cbio.uct.ac.za/SDT). For comparison
three isolates of respective virus species were selected
based on the full length genome blast results which
showed highest and lowest nucleotide similarity at
100% query coverage and type member of that species.
Beside the 3 virus species as presented in Table 2, nine
more virus species viz., Rhyncosia yellow mosaic virus
(HM777509, NC_014902), Dolichos yellow mosaic virus
(AY309241, AJ969370), Velvet bean severe mosaic virus
(FN543425, KU569581), Rhynchosia yellow mosaic India
virus (NC_038995, FM208847), Kudzu mosaic virus
(HQ162271, DQ641690), Soybean mild mottle virus
(NC_014141), Soybean chlorotic blotch virus (NC_039001)
and Tomato leaf curl New Delhi virus (AY428769,
NC_004611) which are close to the viruses under study
were also selected and used to find out the potential
recombinants, major and minor parents and possible
recombination breakpoint positions with the aid of
Recombination Detection Program ( RDP 4 Martin et
al. 2015).
RESULTS
Disease symptoms and incidence: Affected plants
showed typical yellow mosaic symptoms on the leaves
(Fig. 1a). There were no apparent symptoms on the
pods. Further, complete yellowing of the leaves as seen
in YMD affected plants of other Vigna species like V.
radiata (mungbean), V. mungo (urdbean) and V.
unguiculata (cowpea) was not seen in YMD affected V.
stipulacea. Disease incidence, based on the
observations from randomly selected different sites in
the field did not appear to be more than 5%.
PCR amplification of target viruses: When the total
DNA extract was used as a template in PCR to amplify
the target viruses, only six pairs of primers (MIA-F1/
MIA-R1, MIA-F2/MIA-R3, MB-F1/MB-R1, MBs1-F2/
MB1-R3, HgA-F1/HgA-R1, HgA-F3/HgA-R3) gave
the expected results (Fig. 1b), whereas rest of the
primers did not amplify or gave faint band in gel
electrophoresis of PCR products. These results,
however, indicated the presence of three begomovirus
species in the samples. It was therefore decided to
subject the total DNA to rolling circle amplification
and use the RCA product as template to amplify the
DNA components of these viruses. The gel
electrophoresis of RCA products revealed the presence
of high molecular (10kb) weight DNA band, indicating
that the reaction was positive. When the RCA product
was used as template in PCR, all the pairs of primers
except MB2-F1/MB2-R1 and MB2-F2/MB2-R3
successfully amplified the targeted fragment of
expected size ~1400-1500 bases of the virus genome
(Fig. 1b). The RCA of the total DNA extracted from the
diseased plant samples improved the detection/
amplification of viruses. PCR amplification results
indicated the presence of three begomovirus species
in all the three samples. However, only the PCR
products of one sample (Vs1:29-19-DBT) were
sequenced.
Characterization of viruses involved in YMD of V.
stipulacea: Sequence data obtained was used to
assemble full length genomes of the target viruses.
Complete genome (DNA-A and DNA-B) of MYMIV-
Vs, MYMV-Vs and HgYMV-Vs were 2746 nt and
2656 nt, 2729 nt and 2677 nt and 2735 and 2670 nt
long, respectively and submitted to the NCBI data base
under the accession numbers MN698280 and
MN698281, MN814423 and MN698283, and
MN698282 and MN814424, respectively. DNA-A and
DNA-B of all the viruses (MYMIV, MYMV and
HgYMV) from V. stipulacea had their genome
organization typical of begomoviruses; DNA-A having
2 ORFs (AV1 and AV2) in virion sense and 5 ORFs
(AC1, AC2, AC3, AC4 and AC5) in complementary
sense and DNA-B having two ORFs, BV1 in virion
sense and BC1 in complimentary sense. DNA-A of
MYMIV-Vs (MN698280) was 2746 nucleotides long
having highest identity (96.5%) with DNA-A of
MYMIV (HF922628) both at nucleotides as well amino
 Akram et al. : Molecular characterization of begomoviruses causing yellow mosaic disease in
Vigna stipulacea and evidence of recombination
Fig. 1. (A) Yellow mosaic symptoms on Vigna stipulacea
grown in a farmer’s field at Vijayanagar, Raichur,
India. (B) Amplification of target DNA fragments (total
DNA extract used as template) from yellow mosaic
affected sample of Vigna stipulacea. Lane M=Marker
(1kb), Lane 1=MIA-F1/MIA-R1, Lane 2=MIA-F2/MIA-
R3, Lane 7= MB-F1/MB-R1, Lane 8=MBs1-F2/MB1-R3,
Lane 11=HgA-F1/HgA-R1, Lane 12= HgA-F3/HgA-R3.
(C) Amplification of target DNA fragments (RCA
products used as template) from the YMD affected
sample of Vigna stipulacea. Lane M=Marker (1kb), Lane
1= MIA-F2/R3, Lane 2=MIB-F2/R3, lane 3=HgA-F3/R3,
Lane 4=HgB-F1/R1, Lane5=HgB-F2/R3, Lane6=MA-F1/
Mas-R1, Lane7=MA-F2/R3, Lane8=MB1-F1/R1,
Lane9=MIA-F1/R1, Lane10=MB1-F2/R3, lane 11=MIB-
F1/R1, Lane12=HgA-F1/R1, Lane13=MB2-F1/R1 and
Lane14=MB2-F2/R3.
acids level and all the ORFs were similar in size and
had highest identities at both nucleotides and amino
acids level with corresponding ORFs. DNA-B of
MYMIV-Vs (MN698281) was 2656 nucleotides long
and had 96.5% nucleotide identities with DNA-B of
MYMIV (MF683073) and also both ORFs (BV1 and
BC1) were similar in size and had maximum identity
with corresponding ORFs (Fig. 4). DNA-A and DNA-
B of MYMV-Vs (MN814423 and MN698283) were
respectively 2729 and 2677 nucleotides long and had
highest identity similarity (98.5% and 98.4%).) with
DNA-A (DQ400848) and DNA-B of MYMV
(MN602420), respectively. DNA-A and DNA-B of
HgYMV-Vs (MN698282 and MN814424) were 2735
nucleotides and 2670 nucleotides long and had highest
identity (92.1% and 97.2%) with DNA-A (AM932430)
235
and DNA-B (AM932430) of HgYMV, respectively (Fig.
3).
ORFs AV1, AC1 and AC3 located on DNA-A and
BV1 and BC1 on DNA-B have similar size in all the
three viruses characterized (MYMIV-Vs, MYMV-Vs
and HgYMV-Vs) in the present study and resembled
in size with the corresponding ORF in most of the
isolates of these viruses; however, size of AV2 ORF
varied among all the isolates of these viruses. ORF
AC5 of HgYMV-Vs (MN698282) differed in size and
was smaller (252 bases) than the corresponding ORF
in other isolates of HgYMV (441 bases) available in
data base. In fact its size resembled with the size of
corresponding ORF in isolates of MYMIV and MYMV
and has highest nt identity with AC5 ORF of MYMIV
(MN698280, MN698277 and KC243784). ORFs AV1,
AC4, AC3 and AC2 of HgYMV-Vs had highest
nucleotide identity with MYMIV isolates (Fig. 4).
We tried to ascertain the cognate nature of DNA-
B molecules of the three begomoviruses (MYMIV-Vs,
MYMV-Vs and HgYMV-Vs). Comparison of intergenic
region (IR) of DNA-A and DNA-B of corresponding
virus species revealed presence of features like CAAA
motif, rep binding site (iterons), TATA box and
common region sequences confirming that the DNA-
B molecules are in fact cognate of DNA-A molecule of
corresponding virus species. Thus, all the three viruses
(MYMIV-Vs, MYMV-Vs and HgYMV-Vs) are complete
genome sequences (Fig. 2).
Detection of recombination: Size of various ORFs
located in the DNA-A and DNA-B of the isolates of
three viruses (MYMIV-Vs, MYMV-Vs and HgYMV-Vs)
identified in the present study was broadly similar to
their size reported in their genome sequences available
in data base. However, the size of AC5 ORF of HgYMV-
Vs (MN698282), 252 nucleotide long encoding for a
protein consisting of 83 amino acids smaller than its
size (441 nucleotide and 146 amino acids) in other
sequences of HgYMV (AM932425, GU323321 and
NC_005635). This ORF (AC5) of the present HgYMV-
Vs isolate resembled in size and also had highest
nucleotides and amino acids similarity with
corresponding ORF in DNA-A of MYMIV-Vs
(MN698280). This may possibly be due to a
recombination between HgYMV-Vs (MN698282) and
MYMIV-Vs (MN698280). Interestingly, out of 7 ORFs
in HgYMV-Vs only two had maximum nucleotides
and amino acids similarity with corresponding ORFs
in DNA-A of HgYMV (AM932425, GU323321 and
NC_005635) isolates, whereas five ORFs had
maximum similarity with corresponding ORFs in
DNA-A of MYMIV-Vs (MN698280).
236 Journal of Food Legumes 33(4), 2020

Fig. 2. Genome organization of MYMIV-Vs (A), MYMV-Vs (B) and HgYMV-Vs (C), hair loop and cognate sequence
comparison. All the three viruses have 7 ORFs in DNA-A and 2 ORFs in DNA-B. The open reading frames (ORFs)
orientations are indicated by arrows; the number indicates start and end of the ORFs, common region of cognate of
each virus DNA-A and DNA-B showing “CAAA-motif”, “Rep- binding site”, “TATA Box”, and “stem-loop
structure”.
 Akram et al. : Molecular characterization of begomoviruses causing yellow mosaic disease in 237
Vigna stipulacea and evidence of recombination

Fig. 3. Pair wise identities of full length DNA-A and DNA-B sequences of MYMIV-Vs, MYMV-Vs and HgYMV-Vs
with selected isolates of the corresponding virus species as determined by SDT v1.2 (Muhire et al. 2014)

Fig. 4. Pair wise identities of ORFs of DNA-A and DNA-B sequences of MYMIV-Vs, MYMV-Vs and HgYMV-Vs with
selected isolates of the corresponding virus species as determined by SDT v1.2 (Muhire et al. 2014)
238 Journal of Food Legumes 33(4), 2020

The entire DNA-A and DNA-B sequences of three
virus species (MYMIV-Vs, MYMV-Vs and HgYMV-Vs)
under study along with selected species of
begomoviruses (type species and 1 to 3 sequences of
other isolates) were subjected to recombination
detection. The results indicated the presence of a
putative event in DNA-A of HgYMV-Vs (MN698282)
by seven detection methods. MYMIV-Vs (MN698280)
along with MYMIV (HF922628 and MF818047) was
identified as major parent and HgYMV (HgYMV-
KC019306 and AM932425) as minor parent with the
recombination breakpoints at residue 399-1590 of
HgYMV-MN698282-Vs (Fig. 5). Two recombinant
events were identified in each of MYMIV-Vs and
HgYMV-Vs. Only one recombination event was
identified in MYMV-Vs by two detection methods (Fig.
5). There was no significant recombination event in
DNA-B of any of the virus species characterized in the
present study.
DISCUSSION
Whitefly transmitted begomoviruses infecting
legumes have two genomic componenets- DNA A and
DNA B and are known to cause substantial production
losses (Varma and Malathi 2003; Malathi and Johns
2008). Begomoviruses infecting legumes are known to
be generally confined to the leguminous hosts and are
collectively referred to as legumoviruses (Qazi et al.
2007). However, recently instances of legumoviruses
infecting non-leguminous host have emerged.
Infection of tomato by MYMIV, an important
legumovirus known to infect various legume crops
like Vigna mungo, V. radiata, Cajanus cajan, Glycine max,
Vigna aconitifolia, Macrotyloma uniflorum and Phaseolus
vulgaris has been reported recently from India
(Agnihotri et al. 2019) and Oman (Shahid et al. 2019).
Instances of mixed infection by different
begomoviruses in many weeds and cultivated hosts
are not uncommon and have been reported from many
parts of the globe, mostly from tropical and sub-tropical
regions (Harrison et al. 1997; Fondong et al. 2000a; Sanz
et al. 2000; Torres-Pacheco et al. 1996; Méndez-Lozano
et al. 2001; Ala-Poikela et al. 2005; Sidik et al. 2017;
Koeda et al. 2016; Naimuddin and Akram 2009; Alabi
et al. 2008; Monde et al. 2010).
Recombination is an important evolutionary
mechanism in begomoviruses (Lefeuvre et al. 2007b,
2009; Lima et al. 2013; Martin et al. 2005, 2011) and
mixed infections by two or more begomovirus species
in a host offers conditions favourable for the exchange
of genetic material between genomic components of
different Begomovirus species leading to recombination
events. In the present study we found association of
three Begomovirus species with YMD in V. stipulacea.
Analysis of sequences of the virus species in YMD
affected V. stipulacea reveals an interesting point, i.e. a
smaller AC5 ORF in HgYMV-Vs than the

Fig. 5. Recombination events detected in DNA-A of HgYMV-Vs, MYMIV-Vs and MYMV-Vs isolates. Each line
represents one genome linearized at the virion strand origin of replication and are depicted with different colour.
The virus name and the accession number are written to the left of each line.
 Akram et al. : Molecular characterization of begomoviruses causing yellow mosaic disease in 239
Vigna stipulacea and evidence of recombination

corresponding ORF of other isolates of HgYMV
available in data base. Further, it resembled in size
and nucleotides and amino acids similarity with the
corresponding ORF of MYMIV isolates. Recombination
analysis of these sequences revealed MYMIV-Vs to be
a minor parent of HgYMV-Vs and the exchange
between MYMIV-Vs DNA-A and HgYMV-Vs DNA-A
would have been the reason for the resemblance
between AC5 ORF of the latter with that of minor
parent i.e. MYMIV-Vs. Mixed infection by two
Begomovirus species –African cassava mosaic virus and
East African casaava mosaic virus led to the emergence
of a distinct virus designated as Uganda variant (UgV),
that is created by the inter-specific recombination (Zhou
et al. 1997;). Recombination between two virus species
involved in mixed infection may also occur within both
(DNA-A and DNA-B) genomic components of these
viruses (Fondong et al. 2000). However, in the present
study, no significant recombination event was detected
in DNA-B of three begomoviruses associated with
YMD of V. stipulacea.
It may therefore be concluded that the mixed
infection by begomoviruses in a leguminous host may
lead to the emergence of recombinant strains or new
virus species. Infection by two or more begomoviruses
may also exacerbate the disease symptoms as has been
reported in case of cassava mosaic disease (Zhou et al.
1997; Fondong et al. 2000) and in common bean
infected by 2-4 viruses (Sidik et al. 2017). However,
presence of three virus species in V. stipulacea does not
appear to exacerbate disease phenotype as the
symptoms were normal yellow mosaic. However, effect
of multiple infections in a host plant by begomoviruses
on the symptoms manifestation needs to be
investigated in Vigna stipulacea and other leguminous
hosts. The present study is the first report of a virus
disease in Vigna stipulacea and presence of three
begomoviruses in YMD affected samples highlights
its epidemiological role as it may possibly acting as
reservoir of these viruses and their spread through
whitefly vector to cultivated hosts like mungbean,
urdbean, cowpea and others.

Table 1. Details of the primers used for the full length amplification of DNA-A and DNA-B target viruses
Primers ID Sequence (5’-3’) Expected size of Virus to be detected/ DNA
amplicon fragment
MIA-F1 ATGCCAAAGCGGACCTTCGA 1.4kb MYMIV/DNA-A
MIA-R1 ACGAGGCATGGTACAACGTC
MIA-F2 GCATTCTTTGAAGCCCACTG 1.5kb
MIA-R3 ACATGGTCCCTCACAACCACGA
MIB-F1 ATGTTTAACCGGAATTATCGCACC 1.4kb MYMIV/DNA-B
MIB-R1 GATCATGCTGTGATCGAATACAG
MIB-F2 GACTATCTCCCATGGTGTTTCATC 1.5kb
MIB-R3 CCATGTTGAACCTCAACAATGGA
MA-F1 ATGTCGAATGTGCGGAGGAGG 1.4kb MYMV/DNA-A
MAs-R1 TCATTGATGACGTCGATCCCCA
MA-F2 TGCTGTATTATCAGCCTCGTCC 1.7kb
MA-R3 TGTAACCCAGATAGACTTAACAC
MB1-F1 ATGTTTAACCGCAATTATCGAAC 1.4kb MYMV/DNA-B1
MB1-R1 GGTAGACCATGCTGTGATTGAAT
MBs1-F2 CTGTTGAGTGTTTTGCGGAAGAC 1.6kb
MB1-R3 CTCAAGGGACATATGGCTTCC
MB2-F1 ATGTACAACCGTAACATACGAACC 1.4kb MYMV/DNA-B2
MB2-R1 CAAGGGGACAGTAGTAGTCACT
MB2-F2 GTTGTCCCGTCGATCACATTGG 1.6kb
MB2-R3 CCATCACCATTAATACCACGAGT
HgA-F1 ATGCCAAAGCGGAACTACGATA 1.4kb HgYMV/DNA-A
HgA-R1 TAAAGGTGGAATCCCCACCATC
HgA-F3 GTAATAGCTACACCCACAGG 1.6kb
HgA-R3 GAGATGTCATGTCTCGCCT
HgB-F1 ATGTTTAACCGTAATTATCGTACTCC 1.4kb HgYMV/DNA-B
HgB-R1 GAAGGTTGATCACGCCGTGATA
HgB-F2 GTCTGTTGAGTGTTTCGCTGAAG 1.6kb
HgB-R3 CATTAATGACACCGGAGACATCAAG
MYMIV=Mungbean yellow mosaic India virus, MYMV=Mungbean yellow mosaic virus, HgYMV=Horsegram yellow mosaic virus
Table 2. Comparison of sequences of MYMIV-Vs, MYMV-Vs and HgYMV-Vs with selected sequences of respective isolates of the viruses 240
Journal of Food Legumes 33(4), 2020

MYMIV=Mungbean yellow mosaic India virus, MYMV= Mungbean yellow mosaic virus, HgYMV=Horsegram yellow mosaic virus; nt% si.= nucleotide per cent similarity;
aa=amino acids; Acc. No.=Accession number , Vs=Vigna stipulacea
 Akram et al. : Molecular characterization of begomoviruses causing yellow mosaic disease in 241
Vigna stipulacea and evidence of recombination
Recombination detection in DNA-A of HgYMV-Vs ((MN698282), MYMIV-Vs (MN698280) and MYMV-Vs (MN814423)

Recombination events in DNA-A

Table 3.

*
242 Journal of Food Legumes 33(4), 2020
ACKNOWLEDGEMENTS
This work was supported by a grant from
Department of Biotechnology, Ministry of Science &
Technology, Government of India, New Delhi under
the network project on Genetic Enhancement of Minor
Pulses (No. BT/Ag/Network/Pulses-I/2017-18)
REFERENCES
Agnihotri AK, Mishra SP, Ansar M, Tripathi RC, Singh R,
Akram M. 2019. Molecular characterization of
Mungbean yellow mosaic India virus infecting tomato
(Solanum lycopersicum L.). Australasian Plant Pathology
48: 159-165. https://doi.org/10.1007/s13313-018-0611-
7 Aconitifoliae: V. trilobata (L.) Verdc. and V. stipulacea
Akram M, Naimuddin, Agnihotri AK, Gupta S, Singh NP.
2015. Characterization of full genome of Dolichos yellow
mosaic virus based on sequence comparison, genetic
recombination and phylogenetic relationship. Annals
of Applied Biology 167: 354-363.https://doi.org/
10.1111/aab.12231
Alabi OJ, Kumar LP, Mgbechi-Ezeri JU, Naidu RA. 2010.
Two new ‘Legumoviruses’ (genus Begomovirus)
naturally infecting soybean in Nigeria. Archives of
Virology 155: 643–656. https://doi.org/10.1007/
s00705-010-0630-3
Ala-Poikela M, Svensson E, Rojas A, Horko T, Paulin L,
Valkonen JPT, Kvarnheden A. 2005 Genetic diversity
and mixed infections of begomoviruses infecting
tomato, pepper and cucurbit crops in Nicaragua. Plant
Pathology 54: 448–459.
Briddon RW, Patil BL, Basavaraj B, Nawaz-ul-Rehman MS,
Fauquet CM. 2010. Distinct evolutionary histories of
the DNA-A and DNA-B components of bipartite
begomoviruses. BMC Evolutionary Biology 10:97.
https://doi.org/10.1186/1471-2148-10-97
Chandel KPS, Lester RN, Starling RJ. 1984. The wild
ancestors of urd and mungbeans [(Vigna mungo (L.)
Hepper and V. radiata (L.) Wilczek]. Bot J Linn Soc 89:
85–96
Davino S, Napoli C, Dellacroce C, Miozzi L, Noris E,
Davino M, Accotto GP. 2009. Two new natural
begomovirus recombinants associated with the tomato
yellow leaf curl disease co-exist with parental viruses
in tomato epidemics in Italy. Virus Research 143(1):
15-23. doi: 10.1016/j.virusres.2009.03.001
Díaz-Pendón JA, Sánchez-Campos S, Fortes IM, Moriones
E. 2019. Tomato Yellow Leaf Curl Sardinia Virus,
a Begomovirus Species Evolving by Mutation and
Recombination: A Challenge for Virus Control.
Viruses 11(1): 45. doi: 10.3390/v11010045
Fiallo-Olivé E, Trenado HP, Louro D, Navas-Castillo J.
2019. Recurrent speciation of a tomato yellow leaf curl
geminivirus in Portugal by recombination. Scientific
Reports 9(1): 1332. doi: 10.1038/s41598-018-37971-
z.PMID: 30718735  CS, Silva SJC, Xavier CAD, Silva FN, Duffy S, Zerbini
Fondong VN, Pita JS, Rey MEC, de Kochko A, Beachy RN,
Fauquet CM. (2000. Evidence of synergism between
African cassava mosaic virus and a new double-
recombinant geminivirus infecting cassava in
Cameroon. Journal of General Virology 81: 287–297.
doi:10.1099/0022-1317-81-1-287
García-Andrés S, Tomás DM, Sánchez-Campos S, Navas-
Castillo J, Moriones E. 2007. Frequent occurrence of
recombinants in mixed infections of tomato yellow
leaf curl disease-associated begomoviruses. Virology
365(1): 210 219. doi:10.1016/j.virol.2007.03.045
Gore PG, Tripathi K, Pratap A, Bhat KV, Umdale SD, Gupta
V, Pandey A. 2019. Delineating taxonomic identity of
two closely related Vigna species of section
(Lam.) Kuntz in India. Genetic Resources and Crop
Evolution. https://doi.org/10.1007/s10722-019-00767-
9.
Gore, PG, Tripathi, K, Pratap, A, Bhat, KV, Umdale, SD,
Gupta, V, Pandey A. 2019. Delineating taxonomic
identity of two closely related Vigna species of section
Aconitifoliae: V. trilobata (L.) Verdc. and V. stipulacea
(Lam.) Kuntz in India. Genetic Resources and Crop
Evolution. https://doi.org/10.1007/s10722-019-00767-
9.
Harrison BD, Zhou X, Otim-Nape GW, Liu Y, Robinson
DJ. 1997. Role of a novel type of double infection in
the geminivirus-induced epidemic of severe cassava
mosaic in Uganda. Ann Appl Biol 131: 437-448. https:/
/doi.org/10.1111/j.1744-7348.1997.tb05171.x
Hong YG, Robinson DJ, Harrison BD. 1993. Nucleotide
sequence evidence for the occurrence of three distinct
whitefly-transmitted geminiviruses in cassava. Journal
of General Virology 74: 2437-2443.
Ilyas M, Qazi J, Mansoor S, Briddon RW. 2009. Molecular
characterization and infectivity of a “Legumovirus”
(genus Begomovirus: family Geminiviridae) infecting the
leguminous weed Rhynchosia minima in Pakistan. Virus
Research 145: 279–284. DOI: 10.1016/j.virusres.
2009.07.018
Koeda S, Kesumawati E, Tanaka Y, Hosokawa M, Doi M,
Kitajima A. 2016. Mixed Infection of Begomoviruses
on Pepper Plants at Northern Sumatra, Indonesia. Trop
Agr Develop 60(2): 59-64.
Lefeuvre P, Lett JM, Varsani A, Martin DP. 2009. Widely
conserved recombination patterns among single-
stranded DNA viruses. Journal of Virology 83: 2697–
2707.
Lefeuvre P, Martin DP, Hoareau M, Naze F,  Delatte H,
Thierry M, Varsani A, Becker N, Reynaud B, Lett JM.
2007. Begomovirus ‘melting pot’ in the south-west
Indian Ocean islands: molecular diversity and
evolution through recombination. J Gen Virol 88:
3458–3468.
Lima ATM, Sobrinho RR, Gonza´ lez-Aguilera J, Rocha
 Akram et al. : Molecular characterization of begomoviruses causing yellow mosaic disease in
Vigna stipulacea and evidence of recombination
FM. 2013. Synonymous site variation due to
recombination explains higher genetic variability in
begomovirus populations infecting noncultivated
hosts. J Gen Virol 94: 418–431.
Malathi VG, John P. 2008. Geminiviruses infecting
legumes. In: Rao GP, Kumar PL, Holguin-Pena RJ (ed)
Characterization, Diagnosis & Management of Plant
Viruses, Volume 3: Vegetables and Pulse Crops,
Stadium Press LLC, Texas, pp 97-123.
Maliogka VI, Angelantonio M , Pasquale S , Ana B. Ruiz-
García, Miroslav G, Nikolaos K, Antonio O. 2018.
Recent Advances on Detection and Characterization
of Fruit Tree Viruses Using High-Throughput
Sequencing Technologies. Viruses 10: 436; doi:10.3390/
v10080436
Marabi RS, Sagare DB, Das SB, Tripathi N, Noda H. 2017.
Molecular identification of Mungbean Yellow Mosaic
India Virus (MYMIV) from alternate Weed and Crop
hosts. Ann Plant Protection Sciences 25 (1): 152-155.
Martin DP, Murrell B, Golden M, Khoosal A, Muhire B.
2015. RDP4: Detection and analysis of recombination
patterns in virus genomes, Virus Evolution 1
(1):vev003, https://doi.org/10.1093/ve/vev003
Martin DP, Lefeuvre P, Varsani A,  Hoareau M,
Semegni JY, Dijoux B, Vincent C,  Reynaud B, Lett JM.
2011. Complex recombination patterns arising during
geminivirus coinfections preserve and demarcate
biologically important intra-genome interaction
networks. PLoS Pathog 7:e1002203. https://doi.org/
10.1371/journal.ppat.1002203
Martin DP, van der Walt E, Posada D, Rybicki EP. 2005.
The evolutionary value of recombination is
constrained by genome modularity. PLoS Genet 1:e51.
doi:10.1371/journal.pgen.0010051
Méndez-Lozano J, Rivera-Bustamante RF. 2001. Pepper
huasteco virus and Pepper golden mosaic virus are
Geminiviruses Affecting Tomatillo (Physalis ixocarpa)
Crops in Mexico. Plant Disease 85: 1291. doi:10.1094/
PDIS.2001.85.12.1291A
Mollel HG, Sseruwagi P, Ndunguru J et al.
2017. Desmodium mottle virus, the first legumovirus
(genus Begomovirus) from East Africa. Archives of
Virology 162: 1799–1803. https://doi.org/10.1007/
s00705-017-3289-1
Monde G, Walangululu J, Winter S, Bragard C. 2010. Dual
infection by cassava begomoviruses in two
leguminous species (Fabaceae) in Yangambi,
Northeastern Democratic Republic of Congo. Arch
Virol 155: 1865–1869.
Morya VK, Singh Y,  Singh BK, Thomas G. 2014.
Ecogenomics of Geminivirus from India and Neighbor
Countries: An In Silico Analysis of Recombination
Phenomenon. Interdiscip Sci Comput Life Sci 6: 1–9
DOI: 10.1007/s12539-014-0209-x
Muhire BM, Varsani A, Martin DP. 2014. SDT: A Virus
243
Classification Tool Based on Pairwise Sequence
Alignment and Identity Calculation. PLoS ONE 9(9):
e108277. doi:10.1371/journal.pone.0108277
Mutuku J Musembi, Wamonje Francis O, Mukeshimana
Gerardine et al. 2018. Metagenomic Analysis of Plant
Virus Occurrence in Common Bean (Phaseolus vulgaris)
in Central Kenya. Frontiers in Microbiology 9: 2939.
doi.org/10.3389/fmicb.2018.02939
Nagaraj NC, Muniyappa V, Satyan BA, Shanmugam N,
Jayarajan R, Vidhyasekaran P. 1981. Resistance source
for mungbean yellow mosaic virus. In: Proceedings of
the national seminar on disease resistance in crop
plants, pp 69–72.
Naimuddin K, Akram M, Singh NP. 2016. Yellow mosaic
of mungbean and urdbean: current status and future
strategies. Journal of Food Legumes 29(2): 77-93.
Naimuddin, Akram M, Gupta S, Agnihotri AK. 2014.
Ageratum conyzoides harbours Mungbean yellow mosaic
India virus. Plant Pathology Journal 13: 59-64.
DOI: 10.3923/ppj.2014.59.64
Naimuddin, Akram M. 2010. Detection of mixed infection
of begomoviruses in cowpea and theirmolecular
characterization based on CP gene sequences. Journal
of Food Legumes 23: 191–195
Padidam M, Sawyer S, Fauquet CM. 1999. Possible
emergence of new geminivirus by frequent
recombination. Virology 265: 218-225. doi:10.1006/
viro.1999.0056.
Pandiyan M, Ramamoorthi N, Ganesh SK, Jebraj S,
Pagarajan P, Balasubramanian P. 2008. Broadening the
genetic base and introgression of MYMY resistance
and yield improvement through unexplored genes
from wild relatives in mungbean. Plant Mut Rep 2:
33–38
Prabha K, Baranwal VK, Jain RK. 2013. Applications of
next generation high throughput sequencing
technologies in characterization, discovery and
molecular interaction of plant viruses. Indian Journal
of Virology 24(2): 157-165. doi:10.1007/s13337-013-
0133-4
Pratap A, Malviya N, Tomar R, Gupta DS, Kumar J. 2014.
Vigna. In: Pratap, A. And Kumar, J. (eds.) Alien Gene
Transfer in Crop Plants, Volume 2: Achievements and
Impacts, Springer Business+ Science Media, New York,
USA. Pp. 163-190.
Qazi J, Ilyas M, Mansoor S, Briddon RW. 2007. Legume
yellow mosaic viruses: genetically isolated
begomoviruses. Molecular Plant Pathology 8: 343–348.
https://doi.org/10.1111/j.1364-3703.2007.00402.x
Sanz AI, Fraile A, Garcia-Arenal F, Zhou X, Robinson J,
Khalid S, Butt T and Harrison BD. 2000. Multiple
infection recombination and genome relationships
among begomovirus isolates found in cotton and other
plants in Pakistan. Journal of General Virology 81:
1839–1849. doi:10.1099/0022-1317-81-7-1839
244 Journal of Food Legumes 33(4), 2020
Shahid MS, Shafiq M, Ilyas M et al. 2019. Frequent
occurrence of Mungbean yellow mosaic India virus in
tomato leaf curl disease affected tomato in
Oman. Scientific Reports 9: 16634. https://doi.org/
10.1038/s41598-019-53106-4
Sidik EA, Hartono S, Sulandari S, Lukman R, Affifudin A,
Wahyudin D, Santoso HB. 2017. Molecular Evidence
for Mixed Infections of Four Begomoviruses in
Common Bean and Yard Long Bean Showing Severe
Yellow Symptoms in East Java, Indonesia. In:
Isnansetyo A, Nuringtyas T (ed) Proceeding of the 1st
International Conference on Tropical Agriculture.
Springer, Cham. DOI 10.1007/978-3-319-60363_7
Singh CM, Singh P, Pratap A, Pandey A, Purwar S, Vibha,
Douglas C, Baek K-H and Mishra AK. 2019. Breeding
for enhancing legumovirus resistance in mungbean:
Current understanding and future directions,
Agronomy, 9: 622; doi 10.3390/agronomy9100622
Takahashi Yu, Sakai Hiroaki, Yoshitsu Yuki, Muto Chiaki,
Anai Toyoaki, Pandiyan Muthaiyan, Senthil Natesan,
Tomooka Norihiko, Naito Ken 2019. Domesticating
Vigna stipulacea: A potential legume crop with broad
resistance to biotic stresses. Frontiers in Plant Science
10: 1607 DOI=10.3389/fpls.2019.01607
Tateishi Y. 1996. Systematics of the species of Vigna
Subgenus Ceratotropis. In: Srinivas P, Kitbamroong C,
Miyazaki S, (Eds.). Mungbean germplasm: Collection,
evaluation and utilization for breeding program.
Tsukuba, Japan: JIRCAS, pp. 9-24
Tomooka N, Kaga A, Vaughan DA. 2006. The Asian Vigna
(Vigna subgenus Ceratotropis) biodiversity and
evolution. In: Sharma AK, Sharma A (eds) Plant
genome: biodiversity and evolution. Part C
phanerogams (angiosperms- dicotyledons), vol 1.
Science Publishers, Enfi eld, New Jersey, pp 87–126
Tomooka N, Naito K, Kaga A, Sakai H, Isemura T, Ogiso-
Tanaka E, Iseki K, Takahashi Y. 2014. Evolution,
domestication and neo-domestication of the genus
Vigna. Plant Genet. Resour. 12:S168–S171. doi: 10.1017/
S1479262114000483
Torres-Pacheco I, Garzón-Tiznado JA, Brown JK, Becerra-
Flora A, Rivera-Bustamante RF. 1996. Detection and
distribution of geminiviruses in Mexico and the
southern United States. Phytopathology 86: 1186-1192.
Tugume AK, Mukasa SB, Valkonen JPT. 2016. Mixed
Infections of Four Viruses, the Incidence and
Phylogenetic Relationships of Sweet Potato Chlorotic
Fleck Virus (Betaflexiviridae) Isolates in Wild Species
and Sweet potatoes in Uganda and Evidence of Distinct
Isolates in East Africa. PLoS ONE 11(12): e0167769.
doi:10.1371/journal.pone.0167769
Varma A, Malathi VG. 2003. Emerging geminivirus
problems: a serious threat to crop production. Annals
of Applied Biology 142: 145–164. https://doi.org/
10.1111/j.1744-7348.2003.tb00240.x
Yadav SR, Bhat KV, Latha M, John JK, Malik SK, Aitwade
M, Rao SR, Scariah S, Nissar M, S Umdale, P Patil,
Krishnan G, Khedsana R. 2014. Genus Vigna in India,
National Bureau of Plant Genetic Resources, New Delhi
and Shivaji University, Kolhapur, 70p
Zhou X, Liu Y, Calvert L, Munoz C, Otim-Nape GW,
Robinson DJ, Harrison BD. 1997. Evidence that DNA-
A of a geminivirus associated with severe cassava
mosaic disease in Uganda has arisen by interspecific
recombination. Journal of General Virology 78(8):
2101-2111
 Journal of Food Legumes 33(4): 245-251, 2020

Management of pigeonpea wilt using host resistance, chemicals, soil

amendments and bioagents
M HAREESH1, HC LAL2*, SAVITA EKKA3, NIRAJ KUMAR4, BINAY KUMAR5, SUNNA DEEPTI6 and
MK BARNWAL7

1,2,3,7
Department of Plant Pathology,
B.A.U., Kanke, Ranchi-834006,
4
Department of Genetics & Plant
Breeding, Birsa Agricultural University,
Kanke, Ranchi-834006; 5Department of
Agril. Entomology, Birsa Agricultural
University, Kanke, Ranchi-834006;
6
Department of Plant Pathology,IGKV,
Raipur
*Email: hclal_bau@rediffmail.com
Received: September 28, 2020
Accepted: February 20, 2021
Handling Editor:
Dr. Mohd. Akram, ICAR-IIPR, Kanpur
ABSTRACT
The present investigation was carried out in the laboratory and research farm
of Birsa Agricultural University Ranchi on management of pigeonpea wilt.
Wilt disease in Pigeonpea was found at all ten locations surveyed during Kharif,
2015-16 and 2016-17. Maximum wilt percent was found at Bukru (32.14%)
followed by Kanadu (29.40%) and Ranchi BAU (28.63 %). Out of 19 medium
entries evaluated, 13 entries showed moderately resistant reaction to wilt,
Among 43 late entries, 5 entries viz., MA-6, PT0012(C), WRGE 102, CRG9701,
WRGE 248 showed resistance against wilt. In host differential reaction, ICP8868,
BDN-2, BAHAR genotypes showed same reaction to the three different effective
isolates (Isolate – 1, 14, 35) of Fusarium udum, and these are grouped under
variant 3 Seed treatment with Saaf @ 2.5 g/kg seed proved to be the most
effective treatment in which least wilt severity per cent (15.03 %, 18.75 % ) and
highest yield (1491.22 Kg/ha, 1369.32 Kg/ha) were recorded during 2015-16 and
2016-17, respectively. Soil application of Neem + Musturd cake @ 5+5 q/ha
proved to be the most effective treatment in which least wilt severity percent
(15.97%, 13.57% ) and highest yield (1510.28 Kg/ha, 1410 Kg/ha ) were recorded
during 2015-16 and 2016-17, respectively. Seed treatment with biocontrol agent
Trichoderma viride (Commercial strain) proved to be the most effective
treatment in which least wilt severity (23.33%, 20.89%) and highest yield (1429.65
Kg/ha and 1349.25 Kg/ha) were recorded during 2015-16 1nd 2016-17, respectively.

Key words: Biocontrol, Fungicides, Fusarium oxysporum f.sp. udum, Pigeonpea,

Wilt

Pigeonpea wilt is widely prevalent throughout MATERIAL AND METHODS

the world and more important in India (Kannaiyan et
al. 1984).The annual loss in pigeonpea due to wilt alone
in India has been estimated to US $ 71 million (Pande
et al. 2012). The crop suffers heavily due to Fusarium
wilt in the major growing areas resulting in huge
production losses (Reddy et al. 1993). The pathogen is
mainly soil and seed borne. The genus Fusarium has a
wide host range and survives for long time in field
and in absence of host plant and attacks the plants at
any stage. It can cause compete crop loss, especially in
warm spring and dry hot summer.As such, soil borne
pathogens are very difficult to control by chemicals.
Keeping this in mind, there is need to explore the
possibility of improving genetic base for disease
resistance in addition to integration of chemical,
organic amendments and biological control, which can
be successfully adopted in modern agriculture.
Therefore, the present study was carried out for the
management of pigeonpea wilt using chemical
fungicides, soil amendments, biocontrol agents and
host resistance as a parameter for study.
Field trials were conducted for two consecutive
Kharif seasons of 2015-16 and 2016-17 using
Pigeonpea variety Bahar with 4.0 m × 3.0 m plot size
with spacing of 60 cm × 20 cm in Research Farm of
Birsa Agricultural University, Ranchi which is situated
at 23 17' North latitude and 85 19' East longitude with
an altitude of 625 m above mean sea level.
Survey: Field survey was carried out in ten villages of
Kanke block of Ranchi district during Kharif seasons,
2015-16 and 2016-17. Three to five farmers field were
selected in each village. Wilt incidence was recorded
during the period. The disease incidence was
categorized into low (0-10%), moderate (10.1-25.0%)
and high (more than 25.0%).
Host plant Resistance: A total of 19 medium and 43
late duration germplasm of pigeonpea were evaluated
for resistance against F. oxysporumf.sp. udum, causing
wilt under artificial epiphytotic condition in sick plot
of Birsa Agricultural University, Kanke, Ranchi during
Kharif seasons of 2015-2016 and 2016-17. A standard
246 Journal of Food Legumes 33(4), 2020

procedure for sowing with 5.0 m row length and RESULTS AND DISCUSSION
spacing of 60 cm x 20 cm in two replications was
Wilt disease was prevalent in all the ten locations
followed for evaluation of genotypes with
surveyed with moderate to high disease pressure
recommended package of practices. Susceptible check
during both the years.The mean wilt incidence was
Bahar was sown after every two rows of test genotypes.
highest (32.14%) at Bukru followed by Kanadu
Data on disease incidence and yield was recorded.
(29.40%) and Ranchi BAU (28.63%). The least wilt
Chemical Management: Field experiments were incidence was recorded (16.69%) at Kokdoro in Ranchi
conducted with the aim to study the effect of seed district (Table 1). Incidence of the disease was most
treatment with fungicides for control of pigeonpea wilt serious and wide spread in Maharashtra (22.6%),
in wilt sick plot. Seed treatment was carried out using Bihar (21.4%) and Uttar Pradesh (8.2%) (Kannaiyan et
six fungicides viz. Mancozeb (Indofil M-45), al. 1984).
Carbendazim (Bavistin), Mancozeb + Carbendazim
In varietal screening trial against wilt, Out of 19
(SAAF), Copper oxychloride (Blitox-50), Propineb
medium entries,12 entries showed moderately
(Antracol), Chlorothalonil (Kavach) and. Control was
resistant to wilt disease whereas , only five of 43 late
maintained with untreated seeds. Dose of fungicides
entries namely MA-6, PT0012(C), WRGE 102,
applied is mentioned in Table 4. The experiments were
CRG9701 and WRGE 248 showed resistance. Also,
conducted in randomized block design (RBD) with
23 entries showed moderately resistant reaction
three replications. Fertilizer dose of N:P:K:S @
against wilt disease (Table 2.1 and 2.2). These resistant
20:40:20:20 kg/ha was applied at the time of sowing.
sources can serve as a good source of resistant genes
The crop was sown with recommended package of
for breeders to incorporate in the good agronomic
practices using moderately susceptible variety i.e.
susceptible cultivars to obtain resistant as well as good
Bahar. Data on disease incidence and yield was
commercial varieties for the localities. Chaudhary
recorded.
(2010) released long duration wilt resistant variety IPA
Management with biocontrol agents: Field trials were 204 in 2009 after testing in 24 Pigeonpea growing areas
carried out with biocontrol agents viz Trichoderma across India.
viride (108 spores/g), T. harzianum (108 spores/g and T.
To study the host differential reaction pattern of
viride (RAU Strain) (109 spores/g, Pseudomonas spp as
pigeonpea genotypes, experiment with three effective
seed treatment. Laboratory formulations of biocontrol
isolates of F. udum on eight pigeonpea differentials
agents were used @ 0.5 g/kg seed each. The
was conducted and Variant III was recognized to be
experiments were conducted in randomized block
prevailing in Jharkhand in present investigation (Table
design (RBD) in four replications. Treated seeds were
3). Similar observations from Bihar and Jharkhand
sown in field having plot size of 3.0 m x 4.0 m with
were also reported earlier (Raj and Singh,1996).
spacing of 60 cm x 20 cm, Fertilizer dose of N:P:K:S @
Sources of resistance identified in one region do not
20:40:20:20 kg/ha was applied at the time of sowing.
perform with the same degree of resistance in other
Control was maintained with untreated seeds. The crop
regions thereby indicating pathogenic variability in
was sown with recommended package of practices
the fungus (Kumar and Upadhyay, 2014).
using moderately susceptible variety i.e. Bahar. Data
on disease incidence and yield was recorded.
Table 1. Survey for wilt disease incidence in different
Soil amendments: Field trials were conducted for two places of Ranchi district
consecutive Kharif seasons of 2015-16 and 2016-17. Sl. No Place Area Wilt incidence (%)
The plot size was 3.0 mx 4.0 m with 60 cm x 20 cm (acre) 2015-16 2016-17 Average
spacing. Fertilizer dose of N:P:K:S @ 20:40:20:20 kg/ 1 Ranchi (BAU) 5 29.16 28.11 28.63
ha was applied at the time of sowing. Four organic 2 Pithoria 15 17.97 17 17.48
amendments Neem cake @ 10 q/ha, Mustard cake @ 3 Nagri 16 24.99 23.56 24.27
10 q/ha, Karanj cake @ 10 q/ha, Neem+ karanj @ 5q + 4 Hochar 9 24.84 23.77 24.3
5q/ha and Trichoderma pre-colonized FYM @ 2 t/ha 5 Boreya 16 26.94 27.89 27.41
were tested either alone or in combination as treatments 6 Kanadu 13 29.45 29.35 29.40
in three replications. These powdered cakes were 7 Badhu 12 23.15 25.14 24.14
8 Kokdoro 14 17.16 16.22 16.69
applied in finally prepared land three weeks before
9 Bukru 9 32.15 32.14 32.14
sowing. Plots without amendment served as check.
10 Sukurhuttu 4 21.52 20.95 21.23
The crop was sown with recommended package of Average = 24.57
practices.
 Hareesh et al. : Management of pigeonpea wilt using host resistance, chemicals, soil amendments and bioagents 247

Table 2.1. Sources of host resistance against wilt pathogen in medium duration pigeonpea entries
Sl. No. Entries Wilt incidence %* Average Reaction
2015-16 2016-17
1 GJP 1401 15.25 (22.84)** 18.23 (25.35) 16.74 MR
2 LRG 117 18.99 (25.74) 15.29 (22.91) 17.14 MR
3 AKTE 12-02 18.17 (25.22) 20.56 (26.66) 19.365 MR
4 BRG15-2 10.25 (18.66) 13.11 (21.13) 11.68 MR
5 CRG 2012-25 13.14 (21.14) 11.36 (19.45) 12.25 MR
6 LRG 170 21.1 (27.32) 23.12 (28.80) 22.11 S
7 BRG 15-1 19.43 (26.08) 19.36 (26.01) 19.39 MR
8 BSMR 243 20.52 (26.92) 21.36 (27.50) 20.94 S
9 TRG 59 18.17 (25.22) 20.12 (26.63) 19.145 MR
10 WRGE 252 12.5 (20.69) 16.12 (23.61) 14.31 MR
11 CRG 2012-30 20 (26.55) 24.21 (29.69) 22.105 S
12 RPS 2007-10 25.63 (30.38) 29.23 (33.03) 27.43 S
13 WRGE 242 25.63 (30.38) 28.12 (32.04) 26.875 S
14 BDN 2008-7 17.89 (24.97) 14.28 (22.55) 16.085 MR
15 GJP 1406 14.68 (22.42) 18.32 (25.31) 16.5 MR
16 GRG 2013 15.78 (23.39) 18.21 (24.98) 16.995 MR
17 TDRG 107 19.37 (26.10) 15.16 (23.25) 17.265 MR
18 RKPV 451-01 23.02 (28.64) 26.23 (30.80) 24.625 S
19 BAHAR(Ch) 52.5 (46.43) 60.26 (51.20) 56.38 HS
SEm( ±) 1.76 1.40
C.D.(P=0.05) 5.23 4.20
C.V. (%) 9.51 7.24
*Average of two replications **Figures in the parentheses areangular transformed value.

In-vivo trials on evaluation of chemicals revealed
that Seed treatment with carbendazim+ Mancozeb @
2.5 g/kg seed recorded lowest wilt severity of 15.03
and 18.75 per cent and disease reduction over control
of 78.5 and 71.14 per cent with highest yield of 1491.22
and 1369.32 kg/ha during 2015-16 and 2016-17,
respectively.This treatment was followed by Mancozeb
@ 2.5 g/kg seed which recorded wilt severity of 21.25
and 22.98 per cent with grain yield of 1462.3 and
1336.36 kg/ha during above noted years (Table 4).
Similar results were also reported by Gupta et al(2014)
and Koushik and Parthadeb (2016).
In-vivo studies on the management of wilt disease
of Pigeonpea through soil amendments, soil
application of Neem + Musturd cake @ 5+5 q/ha
proved to be the most effective treatment in which least
wilt severity percent (15.97 and 13.57) and highest
yield (1510.28 kg/ha and 1410 kg/ha) and B:C ratio
of 1:200 and 1:2.27 were recorded during 2015-16 and
2016-17. It was followed by soil application of Neem
cake @ 10 q/ha, which recorded wilt severity (17.75 %
and 18.25 %) and yield of 1473.21 and 1369.65 kg/ha
with B:C ratio of 1:1.79 and 1:2.03 during the above
noted years (Table 5). Raj and Singh (1996) had also
observed that Neem, mustard and mahua oil cakes
were most effective in reducing fungal growth of
Fusarium udum. Padmodaya and Reddy (1999) also
found similar results.
In field studies on management of pigeonpea wilt
disease with four bio agents viz., Trichoderma viride,
Trichoderma harzianum, Trichoderma viride (RAU) and
Pseudomonas spp., the seed treatment Trichoderma viride
(Laboratory strain) @ 0.5 g/kg seed proved to be most
effective in which least wilt severity ( 23.33% in 2015-
16 and 20.89% in 2016-17) and highest yield (1429.65
kg/ha in 2015-16 and 1349.25 kg/ha in 2016-17) was
recorded. It was followed by Trichoderma viride
(RAU,strain) @ 0.5 g/kg seed that recorded 24.12%
and 25.98 % wilt severity and grain yield of 1449.58
and 1291.12 kg/ha during 2015-16 and 2016-17,
respectively (Table 6). Chaudhary and Prajapati (2004)
evaluated six biological control agentsagainst F. udum
and reported that maximum colony growth inhibition
in dual culture was obtained with Gliocladium
virens(Pantnagar) and Trichoderma viride (Coimbatore).
They also noticed that cultural filtrate of all the six
biological control agents inhibited colony growth of F.
udum by 18.1-53.6 % at different concentration. Seeds
treated with dry powder of Trichoderma viride at 4 g/
kg before sowing significantly reduced wilt disease in
all the cultivars of pigeonpea compared to untreated
control (Mahalinga et al., 2004).
248 Journal of Food Legumes 33(4), 2020

Table 2.2: Sources of host resistance against wilt pathogen in late duration pigeonpea entries
Sl. No. Entries Wilt incidence %* Average Reaction
2015-16 2016-17
1 ASHA 16.6 (24.03)** 15.23 (22.81) 15.915 MR
2 BAHAR 21.3 (27.39) 23.65 (29.18) 22.475 S
3 BAU 9-27 15.39 (23.08) 14.26 (22.19) 14.825 MR
4 BAU 13-2 13.14 (21.14) 15.32 (23.39) 14.23 MR
5 BDN 2 14.93 (22.55) 16.25 (24.09) 15.59 MR
6 BRG-1 27.2 (31.40) 26.32 (30.89) 26.76 S
7 BRG-2 32.43 (34.70) 38.62 (38.61) 35.525 S
8 BRG-3 20 (26.55) 22.32 (28.42) 21.16 S
9 BRG-4 20.47 (26.87) 19.26 (25.84) 19.865 MR
10 BRG-5 13.77 (21.72) 11.2 (19.76) 12.485 MR
11 BSMR 736 15.78 (23.39) 14.32 (22.44) 15.05 MR
12 BSMR 853 19.37 (26.10) 22.36 (28.36) 20.865 S
13 CO-6 (c) 15.62 (23.17) 17.68 (24.85) 16.65 MR
14 CRG 9701 6.06 (14.25) 8.32 (16.87) 7.19 R
15 DA 15-1 11.11 (19.46) 9.32 (18.02) 10.215 MR
16 DA 15-2 15.25 (22.84) 14.38 (22.56) 14.815 MR
17 ICP 2376 25.23 (30.06) 29.63 (32.89) 27.43 S
18 ICP 7119 22.5 (28.27) 24.52 (29.83) 23.51 S
19 ICP 8863 19.9 (26.47) 17.39 (24.34) 18.645 MR
20 IPA 8 F 20 (26.55) 21.32 (27.85) 20.66 S
21 IPA 15F 18.6 (25.43) 17.32 (24.28) 17.96 MR
22 JKM 189 (C) 20.39 (26.69) 25.32 (30.46) 22.855 S
23 KA 13-5 11.76 (20.04) 10.1 (18.67) 10.93 MR
24 KPL 43 14.55 (22.36) 11.39 (19.18) 12.97 MR
25 KPL 44 11.5 (19.79) 9.6 (17.87) 10.55 MR
26 MA -6 7.75 (15.90) 6.32 (15.10) 7.035 R
27 MAL 13(C) 15.78 (23.39) 18.54 (24.97) 17.16 MR
28 MAL 43 13.4 (21.42) 16.32 (24.13) 14.86 MR
29 MAL 44 24.2 (29.48) 28.96 (32.45) 26.58 S
30 RVSA 07-10 19.9 (26.44) 18.63 (25.37) 19.265 MR
31 RVSA 07-22 21.12 (27.31) 24.36 (29.64) 22.74 S
32 RVSA 07-29 22.2 (28.09) 26.52 (31.14) 24.36 S
33 RVSA 07-31 18.85 (25.68) 14.65 (22.43) 16.75 MR
34 PT 0012 (C) 10.5 (18.90) 8.23 (16.22) 9.365 R
35 WRP -1 (C) 13.58 (21.49) 16.51 (23.62) 15.045 MR
36 WRGE 65 16.66 (24.08) 17.02 (24.48) 16.84 MR
37 WRGE 102 6.06 (14.25) 9.32 (17.80) 7.69 R
38 WRGE 140 12.5 (20.69) 16.32 (23.76) 14.41 MR
39 WRGE 248 10.52 (18.32) 9.52 (18.19) 10.02 R
40 WRGE 256 13.33 (21.25) 16.49 (23.72) 14.91 MR
41 VBN -3 25.8 (30.46) 26.32 (30.92) 26.06 S
42 BA-1 19.9 (26.47) 21.69 (27.44) 20.795 S
43 BAHAR(Ch) 57.5 (49.29) 60.32 (51.21) 58.91 HS
SEm(±) 1.81 2.03
C.D. (P=0.05) 5.18 5.82
C.V. (%) 10.40 11.39
*Average of two replications **Figures in the parentheses are angular transformed values.
Table 3. Reaction of different effective F. udum isolates on pigeonpea wilt differentials

Table 4. In Vivo evaluation of fungicides against wilt pathogen and yield in pigeonpea
Hareesh et al. : Management of pigeonpea wilt using host resistance, chemicals, soil amendments and bioagents 249
Table 5. Effect of organic amendments - against wilt pathogen and yield in pigeonpea under field condition 250

Table 6. In vivo evaluation of bio agents against wilt pathogen and yield in pigeonpea
Journal of Food Legumes 33(4), 2020
 Hareesh et al. : Management of pigeonpea wilt using host resistance, chemicals, soil amendments and bioagents 251
Similar results were also reported by Vishwadhar
et al.(2006) and Pande et al.(2012).Integrated Disease
Management (IDM) approach was carried out to
combat pigeonpea wilt with a combination of
fungicides, bio agents, organic amendments and
different cropping systems in kharif seasons of four
years viz ., 2006, 2007, 2008 and 2009. Based on the
performance, four treatments were identified as best
practices for the management of pigeonpea wilt viz
.,carbendazim seed treatment @ 2 g/kg of seeds +
Trichoderma viride @ 2.5 kg/ha in FYM @ 50 kg / ha
recorded lowest mean wilt incidence of 11.38 per cent
with highest mean yield of 969.18 kg/ha (Prasad et
al.,2012)
Pigeopea wilt was prevalent in all surveyed areas
of Ranchi district of Jharkhand. In varietal screening
trials, Five entries viz., MA-6, PT0012, WRGE102, CRG
9701 and WRGE 248 were recorded as resistant
reaction against wilt. In host differential studies,
variant 3 was recognized to be prevalent in the area.
Seed treatment with carbendazim 12% + mancozeb
64% @ 2.5 g/kg seed recorded lowest wilt severity and
highest grain yield og pigeonpea. Soil application of
Neem + Mustard cake @ 5+5 Q/ha was most effective
for wilt management and gave highest yield of
pigeonpea. In biological management pigeonpea wilt
trials, seed treatment with T. viride (laboratory strain)
@ 0.5 g/kg seed recorded least wilt severity and highest
yield of pigeonpea. Hence, these can be included as
integrated disease management in the mangagement
og wilt of pigeonpea.
REFERENCES
Chaudhary AK 2010. A wilt-resistant line ‘IPA 204’ of long-
duration Pigeonpea (Cajanus cajan). Indian Journal of
Agricultural Sciences 80: 907–9.
Chaudhary RG and Prajapati RK. 2004. Comparative
efficacy of fungal bio-agents against Fusarium udum.
Ann. Pl. Protec. Sci. 12: 75-79.
Gupta S Singh R Kumar R Kumar V. and Biswas SK 2014.
Evaluation of fungicides for management of Fusarium
wilt of pigeonpea caused by Fusarium udum Butler.
Agriways 2(1): 19-23.
Kannaiyan J, Nene YL, Reddy MV, Ryan TN. and Raju TN.
1984. Prevalence of pigeonpea diseases and associated
crop losses in Asia, Africa, and the Americas. Tropical
Pest Management 30: 62-712.
Koushik B. and Parthadeb G. 2016. Recent advancements
and biological management of Fusarium udum: a
causative agent of pigeonpea wilt. International
Journal of Applied and Natural Sciences. 5(3): 57-72.
Kumar S and Upadhyay J 2014. Studies on cultural
morphological and pathogenic variability in isolates
of Fusarium udum causing wilt of pigeonpea. Indian
Phytopath, 67(1): 55-58.
Mahalinga DM, Jayalaksmi SK and Gangadhara GC 2004.
Management of pigeonpea wilt through integration
of bio-agent and resistant source. Plant Dis. Res. 19:
181-182.
Padmodaya B. and Reddy HR 1999. Effect of organic
amendment on seedling disease of tomato caused by
Fusarium oxysporum f. sp. lycoperscici. J. Mycol. Pl. Pathol.
29(1): 38-41.
Pande S Sharma M Gopika G and Rameshwar T. 2012.
High Throughput Phenotyping of Pigeonpea Diseases:
Stepwise identification of host plant resistance.
Information Bulletin No. 93 Patancheru 502 324, Andhra
Pradesh, India: International Crops Research Institute
for Semi-Arid Tropics. 40 pp.
Prasad PS Saifulla M Mahesh M and Kumar GN V 2012.
Management of pigeonpea wilt caused by Fusarium
udum Butler through integrated approaches. J. Biol.
Control 26(4): 361–367,
Raj PK. and Singh KP 1996. Efficacy of certain oil cake
amendments on Heterodera cajani, Fusarium udum and
associated wilt of Pigeonpea. International J. Tropical
Pl. Dis. 14(1): 51-58.
Reddy MV Raju TN Sharma SB Nene YL and Mc Donald D.
1993. Handbook of Pigeonpea diseases (In
En.Summaries in En. Fr.). Information Bulletin
International Crops Research Institute for Semi-Arid
Tropics, Andhra Pradesh, India. Pp14.
Vishwadhar Mishra S. and Chaudhary RG 2006.
Differential efficacy of bioagents against Fusarium
udum isolates. Indian Phytopath. 59(3): 290-293.
 Journal of Food Legumes 33(4): 252-256, 2020

Crop, water productivity and economics in chickpea as influenced by

application of hydrogel and foliar nutrition
KC GUPTA1*, CS PRAHARAJ2, SK JAIN1, VIPIN KUMAR1 and MR YADAV3*

1
Rajasthan Agricultural Research
Institute (SKN Agriculture University,
Jobner, Durgapura, Jaipur, Rajasthan;
2
ICAR-Indian Institute of Pulse
Research, Kanpur (Uttar Pradesh)
*E-mail: kcguptahindaun@rediffmail.com
Received: November 21, 2020
Accepted:
Handling Editor:
Dr. Sanjay S Rathore, ICAR-IARI, New
Delhi
ABSTRACT
A field experiment was carried out during two consecutive winter seasons of
2018-19 and 2019-20 to enhance crop and water productivity in chickpea RSG
973 through hydrogel and foliar nutrition under deficit soil moisture conditions.
Ten treatments combinations consisting of two hydrogel levels (control versus
hydrogel at 5 kg/ha applied at last plough or sowing in rows) in main plots and
five foliar nutrition levels (water spray i.e., control, urea 2%, thiourea 500 ppm,
salicyclic acid 100 ppm and NPK at 0.5% (with complex fertilizer having
N:P:K 19:19:19 kg/ha) applied at flowering and pod development stages) in sub
plots were carried out in trice replicated split plot. Results revealed that
application of hydrogel @5 kg/ha significantly increased growth , yield
attributes and yield of chickpea during both the year. The mean increases in
grain yield and water productivity due to application of hydrogel were 17.54
per cent and 0.24 kg/m3 respectively over control. Similarly, foliar nutrition
significantly influence pods/per plant, 100-seed weight, grain, straw, biological
yield , harvest index and water productivity during both year of experimentation.
Further, foliar application of salicylic acid @ 100 ppm recorded significantly
higher pods/plants (63.87, 67.40), 100-seed weight (15.67, 15.85 g), grain yield
(15.48, 16.27 qha-1) and water productivity being at par with NPK 19:19:19 @0.5
per cent, thiourea @ 500ppm but significantly superior over water spray and
urea@ 2 per cent.

Key words: Chickpea, Foliar Nutrition, Hydrogel, water productivity, Yield

INTRODUCTION abiotic stress (moisture) conditions, the heat and

temperature extremities especially during flowering
Chickpea (Cicer arietinum L.), an important
and pod development are also major impediment
constituent of Indian vegetarian diet, is considered as
affecting development of the crop and its productivity
one of the most important pulses in India. In Rajasthan,
resulting in flower drop and improper seed filling.
it is grown in an acreage of 2.46 million hectares (mha)
Therefore, we needed a substance which could be used
producing about 2.66 million tonnes (mt) with the
in the field to retain (excess) moisture in the time of its
productivity of 1080 kg/ha (Anonymous 2020). This
availability and released the same in case crop needed
crop is also an integral part of diverse and intensive
it (removal/uptake by the crop in case of water stress).
cropping systems for sustainable agricultural
Thus, hydrogel used in the experiment were granular
production. In spite of its multifarious advantages, its
insoluble materials with hydrophilic in nature which
productivity is low due to several biotic and abiotic
could absorb large quantities of water. In areas where
factors. Insufficient soil moisture is the major
opportunity for irrigation is very limited, hydrogels
environmental stress in dryland areas of several
have great potential and can increase the water
countries of the world (Kalhapure et al. 2016) and often
availability during crop growth period. This can also
affects the crop along with heat stress and perplexing
absorb and retain water as much as 80–180 times of
effects on crop productivity (Erskine et al. 2011; Singh
its original volume (Singh et al. 2016) while on weight
et al. 2016). In Rajasthan, chickpea is mostly grown as
basis it can absorb as high as 400 times its original
rainfed crop on conserved soil moisture as there is
weight (Subbarao et al. 1995). Application of hydrogel
little scope for supplementary irrigation as this Indian
delays the permanent wilting point, thereby
state falls under semiarid region. Thus, water scarcity
minimizing the irrigation requirement of the crop
is one of the major constraints in increasing/
(Shooshtarian et al. 2012). The various physical
sustaining chickpea productivity under this agro-
properties of soil like infiltration rates, density, soil
ecosystem (Praharaj et al. 2018. Under these sorts of
 Gupta et al. : Crop, water productivity and economics in chickpea as influenced by application of
hydrogel and foliar nutrition
structure and compaction etc. can also be modified by
application of hydrogel. Agriculture productionmay
be stabilized by soil application of polymer (Khadem
et al. 2010), through mitigating the effect of drought
stress (Ali et al. 2014; Praharaj et al. 2018). For an
improved production in dryland/rainfed ecosystems,
a larger percentage of the precipitation must be stored
in soil and the stored water must be used more
efficiently to exploit its full potential (Singh et al. 2016,
Praharaj et al. 2018). The abnormal weather conditions
have also posed new generation problems like nutrient
management in rainfed areas. Under dry conditions,
supply of nutrients through soil application may
involve higher costs besides lower absorption capacity
by roots (Baldeo Ram et al. 2018). Foliar application of
nutrients in a lower concentration through bio-
regulators enhances physiological and reproductive
efficiencies of plants and helps in nutrient absorption
by acting as chemical catalyst in plant (Davies et al.
2000). Thus efficient nutrient management (macro and
micronutrients) through foliar application not only
helps in amending the nutrient deficiency, but also
helps in reducing the heat stress. Yield of lentil has
been reported to increase by drilling hydrogel (2.5 kg/
ha) along with foliar application of either NPK (0.5%)
or salicylic acid (75 ppm) (Baldeo Ram et al. 2018).
Keeping this in view, a field experiment was conducted
for consecutive two winter seasons during 2018-20 to
assess the effect of hydrogel with suitable foliar
nutrition at critical stages for enhancing productivity
and profitability of chickpea under limited irrigation
situation.
MATERIALS AND METHODS
A field experiment was conducted during two
consecutive winterseasons of 2018-19 and 2019-20 at
research farm of Rajasthan Agricultural Research
Institute, Durgapura, Jaipur (260 51´ N, 750 47´ E and
390 m altitude) to enhance the chickpea productivity
with higher water productivity through hydrogel and
foliar nutrition under limited water conditions.
Durgapura, Jaipur falls in the Semi-Arid Eastern Plain
Zone of Rajasthan (III-A) having extreme cold winters
and hot summers. During winter season, occurrence
of frost (below 0C) is quite common. The average annual
rainfall of zone is 529 mm of which about 90 % is
received from South-west monsoon during latter half
of June to September with erratic distribution over time
and space. The soil of the experimental site was sandy
loam with sand (86.8%), silt (5.6%), clay (7.6%), pH
7.9, 0.17 % organic carbon and 139.2, 36.6 and 238.0
kg/ha available N, P, K, respectively. The experiment
was laid out in thrice replicated split plot with two
253
levels of hydrogel (no hydrogel and hydrogel @ 5 kg/
ha) and five treatments of foliar nutrition (Control ,urea
@ 2% ,Thiourea @ 500 ppm , salicyclic acid @ 500 ppm
and NPK 19:19:19 @ 2%). Field preparation included
one deep ploughing followed by 2 cross harrowing
followed by planking. The chickpea var. RSG 973 were
sown during first fortnight of November during both
the years of experimentation using crop geometry of
30x10 cm. The experimental crops were fertilized with
uniform basal dose of 20 kg N + 40 kg P2O5 /ha and
whole amount of N and P2O5 was drilled at the time of
sowing. Crop was raised under limited irrigated
condition and a total of two including pre-sowing
irrigation were applied. A total of 10 cm water was
applied in irrigation. Crop protection measures were
followed as and when required. Chickpea crop was
harvested in first week of april during both the years,
manually at about 10 cm above the ground level and
were kept for sun drying for some days in field and
after threshing the bundles from each plot, the seeds
were cleaned, dried and weighed. The grain and straw
yield was expressed in kg ha-1. The water productivity
was estimated as per the formula given by Pereira et
al. (2002). The net returns of each treatment were
calculated by deducting the total cost of cultivation
from gross returns of respective treatments and the
benefit: cost ratio was calculated by dividing the net
returns with total cost of cultivation. All data recorded
were analyzed with the help of analysis of variance
(ANOVA) technique (Gomez and Gomez, 1984) SPD.
The least significant test was used to decipher the
effects of treatments at 5% level of significance (P<0.05).
RESULTS AND DISCUSSION
Effect of hydrogel:
Results (Table 1 and 2) revealed that drilling of
hydrogel @ 5 kg/ha had significant effect on growth,
yield attributes and yield of chickpea. Application of
hydrogel @ 5 kg/ha resulted in significantly increase
in plant height, pods/plant,100-seed weight, grain
and straw yield of chickpea during both the years of
experimentation. The mean increase in plant height,
pods/plant and 100-seed weight due to hydrogel were
11.65, 12.32 and 5.73 percent respectively over no
hydrogel application. Similarly, higher mean chickpea
seed, straw and biologicalyield (15,95,33.83 and 49.76
q/ha) was recorded under application of hydrogel @
5 kg/ha compared to no hydrogel . The mean increases
in chickpea grain, straw and biological yield due to
hydrogel were 17.54, 12.32 and 13.89 percent
respectively over no hydrogel application. The
significant increases in growth, yield attributes and
254 Journal of Food Legumes 33(4), 2020

Table 1. Effect of hydrogel and foliar nutrition on growth, seedyield and yield attributes of chickpea
Treatments Plant height Pods /plant 100-seed weight Grain yield Straw yield
(cm) (g) (q/ha) (q/ha)
Years 18-19 19-20 Mean 18-19 19-20 Mean 18-19 19-20 Mean 18-19 19-20 Mean 18-19 19-20 Mean
No hydrogel 52.27 53.49 52.88 55.56 60.65 58.11 14.90 15.13 15.02 13.21 13.93 13.57 29.40 30.83 30.12
Hydrogel @ 5 kg/ha 58.59 59.49 59.04 63.87 66.67 65.27 15.86 15.90 15.88 15.71 16.19 15.95 33.02 34.64 33.83
SEm± 1.00 0.85 - 1.26 0.79 - 0.14 0.13 - 0.21 0.27 - 0.44 0.56 -
CD 5% 6.11 5.18 - 7.65 4.80 - 0.89 0.56 - 1.29 1.65 - 2.65 3.41 -
Water spray (control 53.63 54.83 54.23 52.50 55.37 53.94 14.81 14.94 14.88 12.80 12.90 12.85 29.56 29.66 29.61
Urea 2% 55.40 56.73 56.07 56.53 61.23 58.88 15.16 15.23 15.20 13.79 14.29 14.04 30.85 31.35 31.10
Thiourea 500 ppm 55.42 56.40 55.91 62.50 65.63 64.07 15.61 15.81 15.71 14.88 15.77 15.33 31.65 33.63 32.64
Salicyclic acid 100 55.80 56.70 56.25 63.87 67.40 65.64 15.67 15.85 15.76 15.48 16.27 15.88 31.65 34.13 32.89
ppm
NPK (19:19:19) @ 56.90 57.80 57.35 63.17 68.67 65.92 15.68 15.75 15.72 15.38 16.07 15.73 32.34 34.92 33.63
0.5%
SEm(±) 1.98 1.91 - 2.20 3.49 - 0.21 0.25 - 0.24 0.38 - 0.66 0.75 -
CD (0.05) NS NS - 6.61 7.39 - 0.63 0.54 - 0.72 1.14 - NS 2.23 -

Table 1. Cont….
Treatments Biological yield Harvest index WP
(q/ha) (%) (Kg/M3)
Years 18-19 19-20 Mean 18-19 19-20 Mean 18-19 19-20 Mean
No hydrogel 42.62 44.76 43.69 30.98 31.07 31.03 1.32 1.39 1.36
Hydrogel @ 5 kg/ha 48.73 50.79 49.76 32.23 31.79 32.01 1.57 1.62 1.60
SEm± 0.65 0.91 0.01 0.10 - 0.02 0.03 -
CD 5% 3.94 5.54 0.06 0.61 0.13 0.16 -
Water spray (control 42.36 42.56 42.46 30.15 30.28 30.22 1.28 1.29 1.29
Urea 2% 44.64 45.63 45.14 30.84 31.24 31.04 1.38 1.43 1.41
Thiourea 500 ppm 46.53 49.40 47.97 31.95 31.90 31.93 1.49 1.58 1.54
Salicyclic acid 100 ppm 47.12 50.30 48.71 32.83 32.24 32.54 1.55 1.63 1.59
NPK (19:19:19) @ 0.5% 47.72 50.99 49.36 32.24 31.48 31.86 1.54 1.61 1.58
SEm(±) 0.86 1.09 - 0.31 0.33 - 0.02 0.04
CD (0.05) 2.58 3.28 - 0.92 0.98 - 0.07 0.11

yield of chickpea under application of hydrogel might
be due to better availability of moisture during the
entire crop growth stages which may enhance better
uptake of macro and micro nutrients and thus reduced
moisture stress and better availability of nutrients
plays an important role in improving crop
productivity. 8-55% increase in chickpea yield was
also observed by Dingre et al., 2017. Similar findings
were also reported by Baldeo Ram et al., 2018 who also
recorded significantly higher values of plant height
pods/plant and grain yield of lentil under application
of hydrgel compared to control. Significantly higher
values of harvest index and water use efficiencies were
also recorded under application of hydrogel during
both the years. However, on pooled basisonly the WP
could prove significantly superior over no hydrogel.
The mean increases in WP due to hydrogel were 0.24
kg/m3 compared to no hydrogel. The increase in water
use efficiency might be higher grain yield under
hydrogel application. Higher water use efficiency
under application of hydrogel was also reported by
Kumar and Rajkumara (2016). Similarly, higher gross
and net returns were also recorded under application
of hydrogel compared to no hydrogel during both years
of experimentation. The mean increases in gross and
net returns under hydrogel were Rs. 13144 and Rs.
5326/- respectively, over no hydrogel. Halagalimath
and Rajkumara (2017) also observed higher gross and
net returns were obtained from the irrigation at 0.4
IW/CPE + 2.5 kg ha-1 of hydrogel application.
Effect of foliar nutrition
The yield and yield attributes of chickpea crop
was significantly influenced by foliar nutrition during
both the years of study except straw yield during 2018-
19 compared to control (water spray) presented in
Table 1 and 2. Application of urea @ 2% though
improved the yield attributing characters like pods/
plant and 100-seed weight but failed to attain
statistical significance during both the years.However,
application of thiourea@ 500 ppm, salicylic acid @
100 ppm and NPK 19:19:19 @ 2 % significantly
improved the studied yield attributing characters
during both the years. The mean increases in pod/
 Gupta et al. : Crop, water productivity and economics in chickpea as influenced by application of 255
hydrogel and foliar nutrition

Table 2. Effect of hydrogel and foliar nutrition on economics of chickpea

Treatments Gross returns (Rs/ha) Net returns (Rs/ha) B:C Ratio
Years 18-19 19-20 Mean 18-19 19-20 Mean 18-19 19-20 Mean
No hydrogel 75752 83318 79535 42256 49822 46039 1.26 1.49 1.38
Hydrogel @5 kg/ha 89108 96250 92679 47794 54936 51365 1.16 1.33 1.25
SEm± -- -- -- -- -- -- -- -- --
CD 5% -- -- -- -- -- -- -- -- --
Water spray (control 73907 77703 75805 37090 40886 38988 1.01 1.12 1.07
Urea 2% 79135 85317 82226 41738 47920 44829 1.12 1.29 1.21
Thiourea 500 ppm 84573 93713 89143 46901 56041 51471 1.25 1.49 1.37
Salicyclic acid 100 ppm 87323 96379 91851 49919 58975 54447 1.34 1.59 1.47
NPK(19:19:19)@0.5% 87212 95809 91511 49475 58072 53774 1.32 1.55 1.44
SEm(±) -- -- - -- -- - -- -- -
CD (0.05) -- -- - -- -- - -- -- -
Common cost of cultivation INR 32284/-ha, Thiourea INR 1.34/g, Salicylic acid INR 1.33/g, NPK at INR 160/kg, Hydrogel at
1500/kg

plant and 100-seed weight due to application of
thiourea, salicylic acid and NPK were 18.78, 21.69 and
22.21% and 5.58, 5.91 and 5.65%, respectively over
control. Application of salicylic acid @100 ppm
recorded maximumgrain yield of chickpea closely
followed by NPK 19:19:19 during both the years and
both were statistically at par with thiourea @ 500 ppm
and significantly superior over grain yield under urea
@ 2% and control. However, straw yield failed to
influence significantly during 2018-19 but during
2019-20 foliar nutrition significantly influenced straw
yield. The mean increases in grain and straw yield
due to application of salicylic acid were 23.58 and
11.08 percent;13.11 and 5.76 percent, respectively over
control and urea @ 2%. Similarly,the mean increases
in grain and straw yield due to application of N,P,K
19:19:19 @ 0.5% were 22.41 and 13.58 and 12.04 and
8.14 percent , respectively over control and urea 2%.
The increase in yield was due to the increase in the
number of pods per plant underthe foliar application
of nutrient chemicals and plant growth regulators.
Similar findings were also reported by Shankarappa
et al., 2020 in lentil where significantly highest grain
yield was recorded in the NPK spray of 0.5% remained
on par with salicylic acid 75 ppm. Chickpea though
produces large number of flowers but most of them get
abscised without forming pods. The retention of
flowers and pods can be increased by either foliar
application of nutrients or plant growthregulators as
reported by Sharma and Dey (1986). Similarly, the
foliar application of thiourea, salicyclic acid and NPK
19:19:19 significantly improved harvest index of
chickpea compared to control. Further, the harvest
index and water use efficiency improved significantly
under application of foliar nutrition during both the
years. The mean increases in harvest index and water
use efficiency due to application of salicylic acid were
2.32 and 23.26; 1.50 and 12.77; 0.61 and 3.25 percent
over control, urea 2% and thiourea 500 ppm,
respectively. Similarly, the mean increases in harvest
index and water use efficiency due to application of
NPK 19:19:19 were 1.64 and 22.48 and 0.82 and
12.06%, respectively over control and urea 2%.
Similarly, the mean maximum gross, net returns and
B:C ratio (Rs. 91851/-, Rs. 54447/- and 1.47) was
obtained under application of salicylic acid @ 100 ppm
closely followed by application of N,P,K 19:19:19
@ 0.5% (Rs. 91511, Rs. 53774 and 1.44) while, the
least were recorded under control (Rs. 75805/-,
Rs. 38988/- and 1.07).
It is inferred from the above that hydrogel (5 kg/
ha) application before sowing of chickpea crop and
foliar supplementation with salicylic acid at 100 ppm
at flowering and pod development stages could be
useful in terms of crop and water productivity and
profitability under semiarid condition of Rajasthan,
India.
ACKNOWLEDGEMENT
We sincerely acknowledge Indian Council of
Agricultural Research (ICAR-IIPR, Kanpur) for
financial support and Director- RARI, Durgapura,
Jaipur for providing field staff, facilities and assistance
in conducting this research.
REFERENCES
Ali MA, Rehman I, Iqbal A, Din S, Rao AQ, Latif A,
Samiullah TR, Azam S and Husnain T. 2014.
Nanotechnology: A new frontier in Agriculture.
Nanotechnology, a new frontier in Agriculture. Adv.
Life Sci. 1: 129-138.
256 Journal of Food Legumes 33(4), 2020
Anonymous 2020. Fourth Advance estimates, Rajasthan
Agricultural Statistics at a Glance. Commissionerate
of Agriculture, Rajasthan, Jaipur. pp:1.
Baldeo Ram, Punia SS, Tetarwal JP, Meena DS, Singh P and
Chaudhary HR. 2018. Effect of Hydrogel and Foliar
nutrition sprays on productivity and profitability of
lentil under rainfed situation of south eastern plain
zone of Rajasthan. Int. J. Adv. Sci. Res. Manag., Spec.
Issue I: 67-70.
Davies SL, Turner NC, Palta JA, Siddique KHM and
Plummer JA. 2000. Remobilization of carbon and
nitrogen supports seed filling in desi and kabuli
chickpea subject to water deficit. Aust. J. Agri. Res. 51:
855-866.
Dingre SK, Pawar DD, Shinde MG and Tarte GL. 2017.
Effect of Water Retaining Polymer Application on the
Productivity of Chickpea (Cicer arietinum) Under Dry
land Agriculture. International Journal of Bio-resource
and Stress Management 8: 388-392.
skine W, Sarker A and Kumar S. 2011. Crops that feed the
world 3. Investing in lentil improvement toward a
food secure world. Food Secur. 3: 127-139.
Gomez KA and Gomez AA. 1984. Statistical Procedures
for Agricultural Research. John Wiley & Sons.
Halagalimath SP and Rajkumara S. 2017. Response of
chickpea (Cicerarietinum L.) varieties to irrigation and
hydrogel application in Vertisols. Legume Research.
Print ISSN:0250-5371 / Online ISSN:0976-0571. DOI:
10.18805/LR-3735
Kalhapure A, Kumar R, Singh VP and Pandey DS. 2016.
Hydrogels: a boon for increasing agricultural
productivity in waterstressed environment. Current
Science 111: 1773-1779.
Khadem SA, Galavi M, Ramrodi M, Mousavi SR, Rousta
MJ and Rezvani-moghadam P. 2010. Effect of animal
manure and super absorbent polymer on corn leaf
relative water content, cell membrane stability and
leaf chlorophyll content under dry condition. Aust. J.
Crop Sci. 4: 642-647.
Kumar PH M and Rajkumara S. 2016. Effect of irrigation
and hydrogel application on chickpea varieties in
Malaprabha Command area. J. Farm Sci. 29: 208-211.
Pereira LS, Oweis T and Zairi A. 2002. Irrigation
Management under Water Scarcity. Agricultural Water
Management 57: 175-206.
Raharaj CS,Ummed Singh, Singh SS and Kumar N. 2018.
Tactical water management in field crops: the key to
resource conservation. Current Science 115: 1262-1269.
Sharma SC and Dey SC 1986. Foliar application of macro
and micronutrients and NAA on growth and yield of
green gram (Vigna radiata L.). Legume Research 13: 71-
74.
Shankarappa SK, Muniyandi SJ Chandrasekhar AB, Singh,
AK, Nagabhushanaradhya P, Bhuvaneshwari
Shivashankar, B, El-Ansary, DO, Shabir H, Wani SH,
and Hosam OE. 2020. Standardizing the Hydrogel
Application Rates and Foliar Nutrition for Enhancing
Yield of Lentil (Lens culinaris). Processes 8: 420.
Shooshtarian S, Abedi KJ and Tehrani FA. 2012. Evaluation
of application of superabsorbent polymers in green
space of arid and semi-arid regions with emphasis on
Iran. Int. J. For. Soil Eros. 2: 24-36.
Singh NP, Praharaj CS and Sandhu JS. 2016. Utilizing
untapped potential of rice fallow of East and North-
east India through pulse production. Indian J. Genet.
76: 388-98.
 Journal of Food Legumes 33(4): 257-261, 2020

Effect of frontline demonstrations on summer moong in Amritsar district

of Punjab
ASTHA*, RAMINDER KAUR HUNDAL and BHUPINDER SINGH DHILLON

Krishi Vigyan Kendra, Amritsar,
Punjab
*Email: astha-asr@pau.edu
Received: December 11, 2020
Accepted: February 20, 2021
Handling Editor:
Dr Uma Sah, ICAR-IIPR, Kanpur
ABSTRACT
The productivity of pulse crops continues to be quite low due to technological
gaps in adoption of pulse technologies and other factors also. The yield of
pulses could be increased by demonstrating the cultivation technologies at the
farmer’s fields under the supervision of scientists working in the operational
area. The Front line demonstrations were conducted on summer moong variety
SML 668 and SML 832 across 89 villages in Amritsar district of Punjab. Two
hundred and forty three front line demonstrations were conducted by KVK
Amritsar from the year 2011 to 2019 on area of 106 ha during the summer
seasons. The results of the study showed that the average yield of summer
moong in FLD plots over the years was 10.5 q/ha, which was 20.6 % higher than
average yield at farmers plots (8.7 q/ha), this difference may be attributed to
dissemination of improved and latest technology viz., HYV, recommended
seed rate, fertilization and integrated weed control and integrated plant
protection measures. The demonstration technology gave higher net return as
compared to check plots and benefit cost ratio was also higher as compared to
farmer’s practices. The yield attributing parameters like number of branches/
plant and number of pods/plant, grain weight of moong obtained was also
better under demonstrations than the farmers practice. The total area under
moong crop in district Amritsar is steadily increasing over time as
demonstrations were effective in changing attitude of farmers of Amritsar
towards pulse cultivation.

Key words: Adoption, Front line demonstrations, Summer Moong

Technological gaps

INTRODUCTION farmers and the main objective of this programme is to

demonstrate newly released crop production and
India is the largest producer of pulses (around
protection technologies and management practices at
25% of global production), however, the productivity
the farmer’s field under real farming situation. The
of pulses in India is 755 kg/ha, whereas in the USA
country would require 39 million tonnes of total pulses
and Canada it is as high as 1,900 kg/ha. India is the
by 2050, which will require pulses production to grow
largest producer and consumer of pulses in the world,
at an annual rate of 2.2% (Ahlawat et al 2016).Through
accounting for about 25 per cent of global production,
this practice, the newly improved innovative
27 per cent of consumption, and 34 per cent of food
technology having higher production potential under
use (FAO, 2004). The pulse production of India in year
the specific cropping system can be popularized and
2017-18 was 24.51 million tons and imports stand at
simultaneously feedbacks from the farmers are
5.65 million tons, which is around 18 % of our total
generated on the demonstrated technology. Therefore,
pulses requirement. The Government of India had also
it is very essential to demonstrate the high yielding
established a “Technology Mission on Pulses” in the
varieties, resistant to biotic and abiotic stresses and
year 1991-92 with the objective to enhance the pulse
other pulse production technologies which the farmers
production and productivity. The concept of front line
generally do not adopt. Keeping the importance of
demonstrations (FLDs) was put forth under this
FLDs, the KVK, Amritsar conducted demonstrations
mission. These demonstrations are conducted under
on pulse crop viz., summer moong at farmers’ fields
the close supervision of scientists of
under irrigated situations in summer season during
KrishiVigyanKendra’s, SAUs and their Regional
the year 2011 to 2019.The present study has been
Research Stations. The FLD is an important tool for
undertaken, to study the performance of recommended
transfer of latest package of practices in totality to
258 Journal of Food Legumes 33(4), 2020
high yielding summer moong varieties with full
recommended package of practices for harvesting
higher crop yields, to compare the yield levels of local
check (farmers’ practices) and FLD plots and to collect
feedback for further improvement in the performance
of summer moong cultivation practices.
MATERIAL AND METHODS
Farmers of operational area of KVK, Amritsar were
selected as per allotment of FLDs to KVK by Zonal
Coordinator (Zone-I). Accordingly, the FLDs under
moong crop were laid out in 89 villages covering 106
ha of farmers fields from 2011 to 2019. Regular visits
by the KVK scientists to demonstration fields were
ensured and made to guide the farmers. These visits
were also utilized to collect feedback information for
further improvement in research and extension
programmes. Field days and group meetings were also
organized at the demonstration sites to provide the
opportunities for other farmers to witness the benefits
of demonstrated technologies. The critical inputs were
duly supplied to the farmers by the KVK. The primary
data were collected from the selected farmers with the
help of interview schedule and interpreted and
presented in terms of percentage, the qualitative data
were converted into quantitative form and expressed
in terms of per cent increased yield. Thus, a total sample
size comprised of 243 respondents from 89 villages
across Amritsar district wherein, FLDs were conducted
by KVK Amritsar. The data were collected from both
front line demonstration plots as well as control plots
(farmers practices) and finally the extension gap, and
technology gap were worked out (Samuiet al., 2000) as
Table 1. Particulars showing the technology gap between summer moong grown under Front Line Demonstrations
and farmers practices.
SR. no. Particulars
1. Method of sowing
2. Variety
3. Seed Source
4. Seed treatment
5. Bio-fertilizer
6. Time of Sowing
7. Spray Technology (amount of water
used/acre)
8. Weed management
Mechanical removal of weed with hand
hoeing
9. Pest & Disease management
given below:
Technology Gap in (q/ha) = Potential yield –
Demonstration yield.
Extension Gap in (q/ha) = Demonstration yield
– Farmer’s yield.
RESEARCH AND DISCUSSION
The technological gaps in adoption of moong
production technologies under demonstrations and
local farmers’ practices were measured. The major
technological gaps were observed regarding
recommended varieties, seed rate, seed treatment, time
of sowing, fertilizer dose, method of fertilizer
application and plant protection measures. Table 1
elaborate that in case of demonstration plots
recommended moong varieties and pesticides were
provided to farmers by KVK and all the other package
of practices were timely performed by the farmers under
the supervision of KVK scientists. Under farmer’s
practice, they generally sow seed of local moong
variety using lower seed rate that too without seed
treatment. Sowing is done by broadcasting method in
fields under farmer practice whereas in demonstration
plots it’s done in equally spaced lines. It was also
observed that under farmer field, sowing of moong is
done late, leading to reduction in yield. Regarding the
method of fertilization, under demonstrations, all
fertilizers were drilled at the time of sowing, whereas,
under farmer’s practice broadcast method of
fertilization was adopted. Out of nine blocks of district
Amritsar summer moong or green gram crop is popular
in vegetable belt,which is confined to three blocks i.e.
Jandiala Guru, Majitha and Verka. Summer crop is
Farmers Practice FLD
Broadcasting Line with spacing 22.5 x7 cm
Muskan, local SML-668 and SML-832
Own + seed from Private sources sold by PAU Ludhiana
No treatment / un-recommended Captan @ 3gm/Kg
chemicals
Not used Rhizobium culture
10 March – End April 20 March- 10 April
Half of recommended As per recommendation
No weedicide Stomp (Pendimethalin 30 EC) 2.5 L /
ha as pre- emergence
Difficult as sowing by broadcasting Easy as sowing is done in lines
Un-recommended & overdose of Need based by following Integrated
pesticides is used pest and disease management
principles
 Astha et al. : Effect of frontline demonstrations on summer moong in Amritsar district of Punjab 259

best suited after potato and pea crop in these particular
blocks (Table 2).
Effect of FLD programme on production
performance of summer moong
The results obtained during last eight years
revealed that the average yield of summer moong sown
after harvesting of rabi crops under FLD plots for all
the years was 10.7q/ha, whereas, under the farmer’s
practice, it was 8.9 q/ha. The FLD plots recorded on
an average 20.9 per cent increase in moong yield as
compared to farmer’s field similar results are
documented by Lalit et al. (2015). The data regarding
increase in yield over the farmer practice along with
cost benefit ratio and technology gap is given in table
3. Cost benefit ratio of front line demonstration was
observed at 2.5 compared to 1.58 in case of farmer’s
practice, which is quite a significant difference. These
results collaborate with the studies of Raj et al. (2013)
and Kumar et al. (2015) who also reported that
additional return was increased under front line
demonstration plots. The average technology gap of
0.55 q/ha in yields of FLDs on summer moong and
potential yield of summer moong was observed and
average extension gap of 1.86 q/ha was calculated
between the yields of demonstration plots of summer
moong, when compared to farmers field. The results
confirm the findings of frontline demonstrations on
oilseed and pulse crops by Yadav et al (2004) and
Lathwal (2010).
Performance of moong under demonstration and
farmer’s practice sown after wheat, pea and potato
crop
Yield of summer moong crop sown after potato
and pea crop was better than moong crop sown after
wheat crop. Per cent increase in yield in summer moong
FLDs sown after potato crop (14.6%) and after pea crop
(13%) was higher than that sown after wheat crop
(11.28%) because of the difference in sowing dates.
Also the fertility status of soil was highest in potato
fields followed by pea fields because farmers use
excessive fertilizers in vegetable crops. Least fertility
status was observed in moong crop sown after wheat

Table 2. Block wise cropping pattern of district Amritsar

Blocks Crop Rotations
Jandiala Guru Rice/Basmati (short duration varieties)-Peas/Potato/Wheat-Spring Maize/Celery/Summer Vegetables/Summer
Moong
Majitha Rice/Basmati (short duration varieties)--/Peas/Potato/Wheat-Spring Maize/Celery/Summer
Vegetables//Summer Moong
Verka Rice/Basmati (short duration varieties) - wheat/Potato/Peas/Berseem for fodder –Celery/Summer Moong/
Fodder crops/summer vegetables
Tarsika Rice/Basmati (short duration varieties) -Peas/Potato/Wheat- Spring Maize/ Celery/Summer Vegetables
Baba Bakala Basmati/Rice-Wheat/Peas/Potato/Sugarcane
Ajnala Basmati/Rice-Wheat/Sugarcane
Chogawan Basmati/Rice-Wheat
HarshaChhina Basmati/Rice-Wheat
Attari Basmati/Rice-Wheat

Table 3. Performance of summer moong varieties through CFLDs during 2011-12 to 2018-19
Yield (q/ha) Technology Extension Net returns BCR
Crop Variety Demo Farmers Gap gap (Rs./ha)
area (No.) Demo Check Increase (q/ha) (q/ha) Demo Check Demo Check
(ha) (%)
2011-12 SML 668 15 35 10.4 8.5 22.4 0.85 1.9 29445 18554 2.7 1.15
2012-13 SML 668 4 33 10.3 8.6 19.8 0.95 1.7 29445 19654 2.6 1.33

2013-14 8 12 10.8 8.8 22.7 0.45 2.0 22870 13900 2.12 1.45
SML 668
2014-15 9 15 10.5 8.7 20.7 0.75 1.8 22970 13950 2.4 1.55
SML 668
2015-16 SML 668 10 23 10.9 8.9 22.5 0.35 2.0 25941 16544 2.42 1.67
2016-17 SML 832 20 51 11.2 9.4 19.1 0.30 1.8 29738 17011 2.62 1.77
2017-18 SML 668 20 40 11.1 9.2 20.7 0.15 1.9 27600 17544 2.52 1.78
2018-19 SML 832 20 34 10.9 9.1 19.8 0.6 1.8 29715 17032 2.72 1.95
Cumulative sum 106 243 86.1 71.2 167.7 4.4 14.9 217724 134189 20.1 12.65
Average of eight years 13.25 30.35 10.76 8.9 20.96 0.55 1.86 27215 16774 2.5 1.58
260 Journal of Food Legumes 33(4), 2020

Table 4. Performance of moong under demonstration and farmer’s practice sown after wheat, pea and potato
Yield After wheat crop (q/ha) Yield After Pea crop(q/ha) Yield After potato crop (q/ha)
Crop Variety Demonst Farmers % increase Demonstr Farmers % increase Demonstr Farmers % increase
ration practice ation practice ation practice
2011-12 SML 668 9.70 9.20 11.5 11.7 10 17.0 10.55 9.50 11.1
2012-13 SML 668 10.3 9.0 12.6 11.6 11.4 1.8 11.75 9.75 20.5
2013-14 SML 668 8.80 8.00 11.35 11.35 10.15 11.8 13.25 11.50 15.2
2014-15 SML 668 10.9 8.5 10.8 11.8 10.6 11.3 12.50 10.90 14.7
2015-16 SML 668 10.3 8.9 11.5 11.5 10 15.0 12.00 10.70 12.1
2016-17 SML 832 10.05 9.70 10.5 10.8 9.87 9.4 11.75 10.50 11.9
2017-18 SML 668 9.5 9.2 11.25 11.55 10.5 10.0 11.22 9.86 13.8
2018-19 SML 832 10 8.9 10.75 11.75 9.2 27.7 12.26 10.75 14.0
Cumulative sum 79.55 71.4 90.25 92.05 81.72 104 95.28 83.46 113.3
Average of eight years 9.94 8.92 11.28 11.50 10.21 13.0 11.91 10.43 14.16

crop. The sowing time of summer moong is
recommended between March 20 to April 10 and the
harvesting of wheat commence from 15th April in
Punjab, which delays sowing of following summer
moong crop. Therefore, summer moong sown after
wheat matures in first fortnight of July and it came
under the effect of pre monsoon showers whereas
summer moong sown after pea and potato matures in
first fortnight of June and so it escapes damage by
monsoon (Table 4). The similar results of yield
enhancement is documented by Roy et al. (2006). The
yield attributing parameters like number of branches/
plant and number of pods/plant, grain weight of
moong obtained over the years under recommended
practice as well as farmers practice were also observed
(Table 5). The number of branches/plants of moong
ranged from 3 to 5 under recommended practice as
against farmer’s field it ranged from 2 to 4. Similarly,
higher number of pods/plants were recorded under
recommended practice in demonstration from 12 to 28
as compared to farmer’s practice where it ranged from
8 to 24.Grain weight per 100 seeds was also higher in
demonstration plots i.e. 7.6 g whereas it was 6.8 g in
case of farmers practice. Average number of grains per
pod in demonstration ranged from 9-11 compared to
8-10 in farmers practice, similar findings in
enhancement of yields under FLD have also been
observed by Kirar et al. (2006), Asiwal and Hussain
(2008). The productivity of pulse crops continues to be
quite low due to technological gaps in adoption of
pulse technologies and other factors also (Jagmohan
Table 5. Average of Yield parameters under
demonstrations and existing farmers practice.
Yield parameters Demonstration Farmers
Package practices
Number of branches/plant 3-5 2-4
Number of pods/plants 12-28 10-24
100 grain weight (g) 7.6 6.8
Grains per pod 9-11 8-9
et al, 2012). The yield of pulses could be increased by
demonstrating their cultivation technologies at the
farmer’s fields under the supervision of scientists
working in the operational area. Balai et al (2013)
recorded more than 50 % increase in yield in
groundnut FLDs in Rajasthan state through
technology intervention.
Fig 1: Status of summer moong in district Amritsar
2011-12 to 2018-19
CONCLUSION
From the study, it is concluded that the FLD
programme is an effective tool for increasing the
production and productivity of moong crop and
changing the knowledge, attitude and skill of farmers.
The per cent increase in yield of summer moong created
greater awareness and motivation in the other farmers
to adopt the improved package of practices of summer
moong. These demonstrations have also built the
relationship and confidence between farmers and
scientists. The beneficiary farmers of FLDs also played
an important role as source of information and
distribution of quality seeds for wider dissemination
of the high yielding varieties of summer moong for
other nearby farmers. The selection of specific
technology like improve variety, seed treatment, seed
inoculation with biofertilizers i.e. Rhizobium,
recommended dose of Phosphorus, Pre-emergence
 Astha et al. : Effect of frontline demonstrations on summer moong in Amritsar district of Punjab
weed management and plant protection measure were
undertaken in a proper way. Frontline demonstration
was effective in changing attitude of farmers towards
pulse cultivation. Cultivation of demonstrated plots
of summer moong with improved technologies has
increased the skill and knowledge of the farmers.
There is steady increase in yield and area under
summer moong in district Amritsar (Fig 1) in last eight
years.
REFERENCES
Ahlawat I P S, Sharma Purushottam and Singh Ummed.
2016. Production, demand and import of pulses in India.
Indian Journal of Agronomy 61 4th IAC Special issue:
S33-S41 2016
Asiwal B L and Hussain Akhter 2008. Demonstration- An
effective technology for increasing The productivity
of gram. Rajasthan Journal Extension Education, 6.
Balai C M , Bairwa R K, Verma L N, Roat B L, and Jalwania
R . 2013. Economic impact of front line demonstrations
on cereal crops in Tribal Belt of Rajasthan International
Journal of Agricultural Sciences 3(7 ): 566-570.
Food and Agriculture Organization of the United Nations
(FAO). 2004. “FAOSTAT.”
Jagmohan Singh, Dhillon B S, Astha and Parvinder Singh.
2012. Front line demonstration – An effective tool for
increasing the productivity of summer moong in
Amritsar district of Punjab. An Asian Journal of Soil
Science 2(7): 315-318.
Kirar B S, Nashine R, Gupta AK and Mukharjee SC. 2006.
261
Demonstration: An effective tool for increasing the
productivity of urd. Indian Research Journal Extension
Education.63.
Kumar P, Singh K and Kaur P. 2015. Economic impact of
frontline demonstration on pulses in Punjab a step
towards diversification. Indian J Econo & Develop,
11(1): 111-116.
Lalit M, Patil D J, Modi H M,Vasava and S R Gomkale.
2015. Evaluation of Front Line demonstration
programme on green gram variety Meha IPM 99 – 125
in Bharuch district of Gujrat. Journal of Agri and Vet
Science, 89 : 01 – 03.
Lathwal O P (2010). Evaluation of front line demonstrations
on blackgram in irrigated agro ecosystem. Annals of
Agricultural Research 31 (1&2) : 24-27.
Raj A D , Yadav V and Rathod J H. 2013 . Impact of front
line demonstrations on the yield of pulses. Interernat.
J Sci & Res Public, 3 (9): 1-4.
Roy Burman, Singh R, Singh, S K, Lakhan and Singh, AK.
2006. Adoption of improved pulses production
technologies and related constraints in Uttar Pradesh.
Indian J Pulses Res, 191 : 104-106.
Samui S K, S Mitra, D K Roy, A K Mandal and D Saha. 2000.
Evolution of front line demonstration on groundnut.
Journal Indian Soc. Coastal Agric. Res., 18 (2): 180 –
183.
Yadav D B, Kamboj B K and Garg R B .2004. Increasing the
productivity and profitability of sunflower through
front line demonstrations in irrigated agro ecosystem
of eastern Haryana. Haryana Journal of Agronomy,
20 (2): 33-35.
 Journal of Food Legumes 33(4): 262-264, 2020

Short Communication
A systematic methodology to assess bruchid field infestation and the
impact of field-carry-over infestation in stored pulses
REVANASIDDA*, SANJAY M. BANDI, PRASOON VERMA, KIRAN GANDHI BAPATLA and BANSA SINGH

Division of Crop Protection, ICAR-
Indian Institute Pulses Research,
Kanpur
Email: Revanasidda@icar.gov.in;
rshlb1114@gmail.com
Received: December 26, 2020
Accepted: February 12, 2021
Handling Editor:
Dr Gaurav K Taggar, PAU, Ludhiana
ABSTRACT
Bruchids (Callosobruchus spp.) are serious pests of stored pulses whose incidence
starts at field level and field-carry-over infestation persists in the stores. The
temporal occurrence of bruchid infestation on standing crop and its subsequent
impact on stored pulses has not been worked out in most of the pulses. A
systematic methodology was developed to identify the crop stage where
bruchids initiate the primary infestation on standing crop (i.e. infestation
window) and its subsequent losses at storage level arising due to field-carry-
over infestation. In this methodology, the observations on pest infestation on
seeds/pods were recorded at definite intervals from open and caged plants
starting from the first week after flower initiation (WAFI) till harvesting of
mungbean, cowpea, and pigeonpea. Further, during storage, the observations
were also recorded from grains harvested from the open and caged plants
representing each interval and stored in cloths bags separately and observed on
a bimonthly basis for one year. Results revealed that the field infestation on
the seeds/pods started from 3, 4 and 7 WAFI in mungbean, cowpea, and
pigeonpea, respectively. The infestation was found to be incremental towards
crop maturity and overall, the infestation on the pods at field level did not cross
6 per cent. The results obtained through systematically designed methodology
explicit the timeline of bruchid infestation at field level and the impact of field-
carry-over infestation under storage conditions. This can help to identify and
intervene a timely management programme in the existing IPM schedule to
break the bruchid field-carry-over chain.

Key words: Bruchids, Field infestation, Field-carry-over inoculum, Methodology,

Stored pulses

Bruchids (Callosobruchus spp.) are known to infest
seed or grain pulses in storehouses (or godowns) via
different sources of infestations, viz. field-carry-over
infestation, migration from nearby infestation, through
dormant stages hiding under debris, cracks and
crevices of storage infrastructures, previously used
storage receptacles and cross infestation. The primary
infestation of bruchids which starts on mature and
dry pods including exposed seeds at field level has
been reported to be 1–6 per cent (Nahdy et al. 1998;
Schmale et al. 2002; Antoine et al. 2005; Paul et al. 2010).
Earlier studies to identify bruchid field infestation at
field level were limited to; (1) identifying the adult
beetles collected from the field by net sweeping
(Antoine et al. 2005), (2) recording infestation on pods/
seeds at field level (Warui 1984) and (3) random
collection of infested seeds/pods from the open fields
or experimental plots and storing them for up to 60
days to confirm the adult emergence (Schmale et al.
2002). Few studies were also attempted to identify; (4)
the preference (oviposition) of bruchids between seeds
and pods (Nahdy et al. 1998), (5) suitability of preferred
pod stage (young or mature green or dry) for grubs
development and effect of pod texture (Messina 1984;
Paul et al. 2010), (6) the effect of early, timely and late
harvest including the influence of intercropping and
distance of the experimental field from the nearby
storage on bruchid field infestation (Olubayo and Port,
1997; Khadim and Mbacke, 2011). However, systematic
information on the crop stage wherein bruchids
initiate primary infestation on standing crop (i.e.
infestation window) and the subsequent losses at
storage level arising due to field-carry-over infestation
have not been quantified in most of the pulses. We
report a systematic methodology to identify the
bruchid infestation window at field level and to
quantify the subsequent losses in stored mungbean,
cowpea, and pigeonpea.
The approach consists of two experimental
conditions at the field level, viz. caged (plants protected
with insect-proof nylon net) and open field plot
conditions of about one (mungbean and cowpea) to
two (pigeonpea) square meter area. In caged
conditions, caging of plants was initiated a week after
 Revanasidda et al. : A systematic methodology to assess bruchid field infestation and the impact of
field-carry-over infestation in stored pulses
flower initiation (WAFI) and continued till harvest at
definite intervals (for every five days- mungbean,
weekly- cowpea, and biweekly- pigeonpea) depending
upon their total reproductive period. Each caging
interval constituted a treatment, hence, there were five
caging intervals each with four replications for cowpea
and mungbean, and seven caging intervals each with
three replications for pigeonpea in RCBD experimental
layouts (Fig. 1). A set of plants (mungbean and cowpea-
n=30, pigeonpea- n=10, each per replication in open
and caged conditions) were tagged during each caging
interval. The observations from open plants were
recorded during every caging interval and at harvest,
whereas, the observations from caged plants were
recorded only at harvest. The observations included
pod density, adult bruchid density, egg density per
pod, per cent pod infestation, and pod damage.
Apart from field observations, grains representing
each treatment were harvested and stored in cloth
bags, separately and observed for bruchid infestation
parameters (% oviposition, grain damage, and adult
density) at bimonthly intervals for one year to confirm
the entry of field-carry-over infestation into storage
and also to assess its impact on grains during the
storage. The results of this methodology were verified
in confirmatory trials in the following seasons.
Fig. 1: Bruchid field infestation studies in mungbean,
cowpea, and pigeonpea: caged and open field
conditions
The data recorded on infestation parameters
following this methodology during different time
intervals were analyzed and presented as infestation
during different WAFI. The results of the field
infestation studies revealed that the bruchid infestation
on seeds/pods started from 3rd, 4th, and 7th WAFI in
mungbean, cowpea, and pigeonpea, respectively, and
continued till harvest at field level. The overall
infestation was found to be incremental towards crop
maturity, however, the infestation level did not cross 6
263
per cent on observed pods at field level (Fig. 2). The per
cent oviposition (0.41–0.92), mean eggs per pod (0.38–
1.41), per cent pods damage (0–0.54), and adult density
(0.80–0.98) per plant were observed between 4–5 WAFI
in cowpea. For mungbean, the per cent oviposition
(2.19 – 3.91), mean eggs per pod (0.3–1.50), per cent
pods damage (0–1.97), and adult density (0.92–3.16)
per plant were observed between 3–4 WAFI. Bruchid
infestation on pigeonpea started 7 WAFI and increased
nearly 3 times by the time of crop maturity as compared
to previous weeks. The per cent oviposition (0.11, 0.21,
0.82, 1.17, 4.91and 5.32), per cent pod damage (0, 0.02,
0.06, 0.1, 0.12 & 2.41) and adult density observed per
plant (0.51, 0.71, 0.86, 1.17, 2.16 & 3.56) were observed
during 7–12 WAFI. In these three crops, the
observations were from open plants. Here the plants
representing all the observation weeks recorded equal
bruchid infestation parameters. This might be due to
the exposure of open plants for bruchids attack during
the flag end-stage of crop i.e., from 3–5 WAFI.
Infestation in cowpea was found to be higher on
exposed seeds of shattered pods than intact pods,
whereas, in mungbean and pigeonpea, shattering was
not noticed, hence, the infestation was observed only
on intact pods (Fig. 3).
Fig. 2: Temporal occurrence of bruchid field infestation
on mungbean, cowpea, and pigeonpea
Fig. 3: Infestation of bruchids on pods of mungbean,
cowpea, and pigeonpea.
264 Journal of Food Legumes 33(4), 2020
The field-carry-over studies revealed that seeds
harvested from caged plants during 1–2, 1–3, 1–7
WAFI, respectively in mungbean, cowpea, and
pigeonpea suffered no damage during storage as they
were not exposed to infestation at that time. Whereas,
the seeds harvested from caged plants during 3–5, 4–
5, and 8–12 WAFI, respectively in mungbean, cowpea,
and pigeonpea carried field infestation and hence
suffered considerable damage during storage.
However, the seeds harvested from open plants from
all the WAFI suffered complete damage in storage. This
was because the pods from open plants of all the WAFI
were equally exposed to infestation towards the
maturity of crop where bruchid activity at field level
was higher. Our observations confirmed the activity
or occurrence of bruchid infestation in mungbean,
cowpea, and pigeonpea during 3–5, 4–5, and 8–12
WAFI on standing crop at field level.
The results obtained through systematically
designed methodology reveal the timeline of bruchid
infestation at field level and the impact of field-carry-
over infestation under storages. This would help to
identify and intervene with a timely insecticidal
schedule in the existing IPM schedule to break the
bruchid field-carry-over chain.
ACKNOWLEDGEMENTS
Authors are highly thankful to ICAR-Indian
Institute of Pulses Research, Kanpur for the support
received during the study.
REFERENCES
Antoine S, Clementine D, Patoin OA and Jacques H. 2005.
Field occurrence of bruchid pests of cowpea and
associated parasitoids in a sub-humid zone of Burkina
Faso: importance on the infestation of two cowpea
varieties at harvest. Plant Pathology Journal 4(1): 14-
20.
Khadim K. and Mbacke S. 2011. Cowpea (Vigna unguiculata
(L.) Walp) field infestation by the bruchids (Coleoptera:
Bruchidae) in the northern Senegal: preliminary
biological and ecological data. Journal of Applied
Biosciences 41: 2788-2796.
Messina FJ. 1984. Influence of cowpea pod maturity on the
oviposition choices and larval survival of a bruchid
beetle Callosobruchus maculatus. Entomologia
Experimentalis et Applicata 35(3): 241-248.
Nahdy MS, Ellis RH, Silim SN and Smith J. 1998. Field
Infestation of Pigeonpea (Cajanus cajan (L.) Millsp.) by
Callosobruchus chinensis (L.) in Uganda. J. stored Prod.
Res. 34(4): 207-216.
Olubayo FM and Port GR. 1997. The Efficacy of Harvest
Time Modification and Intercropping as Methods of
Reducing the Field Infestation of Cowpeas by Storage
Bruchids in Kenya.J. stored Prod. Res. 33(4): 271-276.
Paul UV, Hilbeck A and Edwards PJ. 2010. Pre-harvest
infestation of beans (Phaseolus vulgaris L.) by
Acanthoscelides obtectus Say (Coleoptera: Bruchidae) in
relation to bean pod maturity and pod aperture.
International Journal of Pest Management 56(1): 41–
50.
Schmale I, Wackers FL, Cardona C and Dorn S. 2002. Field
Infestation of Phaseolus vulgaris by Acanthoscelides
obtectus (Coleoptera: Bruchidae), Parasitoid
Abundance, and Consequences for Storage Pest
Control. Environmental Entomology 31(5):859-863.
Warui CM. 1984. Bruchid infestation of cowpea varieties
in the field. Insect Sci. Applic. 5(4): 283-286.
 Journal of Food Legumes 33(4): 265-269, 2020

Short Communication
Variability and correlation studies for yield and yield contributing traits
in kabuli chickpea
GAZAL SAINI1, G KATNA1* , KAMAL DEV SHARMA2 and ARCHANA JOSHI SAHA3

1
Department of Genetics and Plant
Breeding, CSK Himachal Pradesh
Agriculture University, Palampur
(HP)–176062 India; 2 Department of
Agriculture Biotechnology, CSK
Himachal Pradesh Agriculture
University, Palampur (HP)– 176062
India; 3 Nuclear Agriculture and
Biotechnology Division, Bhabha Atomic
Research Centre, Mumbai-400085,
Maharashtra, India
Email: gkatna@gmail.com
Received: October 14, 2020
Accepted: December 30, 2020
Handling Editor:
Dr S. K. Chaturvedi, RLBCAU, Jhansi
ABSTRACT
Thirty M5 desirable chickpea mutants were evaluated at Research Sub-Station
(CSKHPV, Palampur) Akrot, Una during rabi 2018-19 for various agro-
morphological traits. Genotypic and phenotypic coefficients of variation were
found to be higher for number of primary branches, biological yield, number
of pods per plant and seed yield per plant. PCV was moderate for plant height,
100-seed weight and harvest index. High heritability coupled with high genetic
advance was observed for number of primary branches, biological yield, number
of pods per plant and seed yield per plant while moderate heritability with
high genetic advance was observed for harvest index. Seed yield per plant had
positive and significant correlation with biological yield, number of pods per
plant, 100-seed weight and harvest index. Path analysis revealed direct positive
effect of biological yield, harvest index, days to 75% maturity and plant height
with seed yield per plant. Selection index traits for increasing seed yield per
plant are number of pods per plant, biological yield, 100-seed weight, harvest
index and plant height.
Key words: Chickpea, correlation, mutants, path analysis, variability, yield

Chickpea (Cicer arietinum L.) is one of the most
important grain legume and belongs to family
Leguminosae or Fabaceae. The only cultivated species
in the genus Cicer, it is the third important pulse crop
in the world (Jalota et al. 2006). Chickpea contains about
6% fat, which is important in the vegetarian diets of
resource-poor consumers (Kishor et al. 2018). Broadly
there are two types of chickpea, namely Kabuli grown
in temperate regions, while desi grown in the semi-
arid tropics (Muehlbauer and Singh 1987). The extent
of genetic variability has been considered as an
important factor, which is prerequisite for a successful
hybridization aimed at producing high yielding
progenies. To broaden the genetic base of chickpea,
mutation breeding programme was initiated. Till date,
more than 3,274 varieties in more than 224 plant
species derived from mutagenesis programs have been
officially released as listed in the FAO/IAEA Mutant
Varieties Database (MVD). The knowledge of
heritability helps plant breeders in predicting the
behaviour of succeeding generations, making
desirable selections and assessing the magnitude of
genetic improvement through selection. The
knowledge of interrelationship of grain yield with
other important characters is necessary to determine
characters associated with high grain yield. The inter-
relationship between yield contributing traits could
be grasped best if a coefficient assigned to each path
in the diagram designed to measure the direct
influence among them. Path coefficient analysis is a
statistical technique of partitioning the correlation
coefficients into its direct and indirect effects, so that
the contribution of each character to yield could be
estimated. The aim of the present study was to assess
induced variations and association among yield and
its contributing traits in mutants of kabuli chickpea
(Cicer arietinum L.) derived from variety PG0027.
Desirable top 30 mutants over the best check were
selected and used in the present study.
The present study was conducted at CSK HPKV,
Research Sub Station, Akrot, Distt. Una, Himachal
Pradesh. The experimental material comprised of 30
desirable Kabuli chickpea mutants in M5 generation
derived from the variety PG0027. The mutants were
generated using gamma rays treatments and first
selection for yield and related traits was made in M2
generation. This was followed by advancement of
progenies and selection in each progeny. Top 30
mutants selected in M4 for yield were used in the
present study. The experiment was laid out in a
randomized block design with three replications. At
the time of maturity, the data were recorded on plot
266 Journal of Food Legumes 33(4), 2020

basis (days to 50 per cent flowering, days to maturity)
and on plant basis [plant height (cm), number of
primary branches, biological yield (g), number of pods
per plant, number of seeds per pod, 100-seed weight
(g), harvest index (%) and seed yield per plant (g)] from
five competitive plants. Analysis of variance was
carried out as suggested by Panse and Sukhatme
(1985); heritability (h2), PCV and GCV were estimated
as per the methods suggested by Burton and Devane
(1953) and genetic advance as per the formula
suggested by Johnson et al. (1955). The phenotypic and
genotypic correlation co-efficients were estimated
among all possible combination of characters in each
mutant as suggested by Al-Jibouri et al. (1958) and path
coefficient analysis was carried out according to
Dewey and Lu (1959).
The analysis of variance revealed that all the traits
had significant variation at five per cent level of
significance. The variation for number of days to 50
per cent flowering ranged from 102 to 133 days with
over all mean of 120.83 days, and variation for days to
75 per cent maturity ranged from 156 to 177 days with
overall mean of 169 days (Table 1). The estimates of
the mean values indicated that plant height ranged
from 54.20 cm to 83.77 cm with a mean value of 72.94
cm. Mean of number of primary branches was 3.14
with highest value of 5.20 and lowest value of 2.13.
The variation for biological yield trait ranged from
24.00 g to 99.33 g with an average of 56.11 g. Mean
number of pods per plant was found to be 48.50 with
highest value of 89.67 and lowest value of 18.47.
Average for number of seeds per pod ranged from 0.94
to 1.14 with an overall mean of 1.02. 100-seed weight
ranged from 32.36 g to 49.06 g with overall mean of
40.28 g and mean for harvest index was found to be
33.99 with highest value of 45.37 and lowest value of
22.31. Seed yield per plant ranged from 7.67 g to 45.00
g with an average of 19.54 g. High PCV and GCV
(>20%) was observed for number of primary branches,
biological yield, number of pods per plant and seed
yield per plant indicating that there is greater scope
for selection for improvement of these characters (Table
1). These findings are in confirmation with Vaghela et
al. (2009) and Dwivedi and Gabriyal (2009). The PCV
was moderate (10-20%) for traits like plant height, 100-
seed weight and harvest index. These observations
are in alignment with the earlier reports by Nizama et
al. (2013). However days to 50 per cent flowering, days
to 75 per cent maturity and number of seeds per pod
showed low value of PCV and GCV (<10%). Similar
results were reported by Chopdar et al. (2017), Kishore
et al. (2018) and Parida et al. (2018). The low GCV and
moderate PCV were observed for plant height, 100-
seed weight and harvest index. Similar observations
were also reported earlier (Desai et al. 2015, Joshi et al.
2018, Katna et al. 2020).
High heritability coupled with high genetic
advance as per cent of mean was observed for number
of primary branches, biological yield, number of pods
per plant and seed yield per plant suggesting that these
characters are under the control of additive gene action
and phenotypic selection for these traits may be
effective. These results are in agreement with the reports
of Vaghela et al. (2009), Arora et al. (2018), Barad et al.
(2018) and Joshi et al. (2018). Moderate heritability
along with moderate genetic advance was observed
for harvest index as has been reported by Dwevedi
and Gabriyal (2009). However, low heritability
coupled with low genetic advance as per cent mean
was observed for 100-seed weight (Table 1).
Correlation studies indicated higher magnitude
of genotypic correlation than the corresponding
phenotypic ones, indicating inheritance association
among various traits. At both phenotypic and
genotypic correlation level, seed yield per plant had
positive and significant association with biological
yield, number of pods per plant, 100-seed weight and

Table 1. Mean performance and variability parameters for various traits studied in chickpea mutants
Character Mean ± SE(m) Range PCV GCV Heritability Genetic
Minimum Maximum (%) (%) (%) advance
(% of mean)
Days to 50% flowering 120.83 ± 2.48 102.67 133.00 7.21 6.27 75.6 11.23
Days to 75% maturity 169.72± 2.07 156.00 177.00 3.87 3.24 70.1 5.59
Plant height (cm) 72.94 ± 1.57 54.20 83.77 10.44 9.75 87.3 18.77
Number of primary branches 3.14 ± 0.19 2.13 5.20 26.69 24.63 85.2 46.83
Biological yield (g) 56.11 ± 3.33 24.00 99.33 47.28 46.15 95.3 92.80
Number of pods per plant 48.50 ± 2.94 18.47 89.67 54.62 53.60 96.3 108.35
Number of seeds per pod 1.02 ± 0.03 0.94 1.14 7.34 4.63 39.8 6.02
100-seed weight (g) 40.28 ± 2.63 32.36 49.06 13.12 6.66 25.8 6.96
Harvest index (%) 33.99 ± 1.70 24.36 45.37 12.99 9.70 55.7 14.90
Seed yield per plant (g) 19.54 ± 1.69 7.67 45.00 54.20 52.09 92.3 103.10
 Saini et al. : Variability and correlation studies for yield and yield contributing 267
traits in kabuli chickpea

harvest index (Table 2). Similar results were also
reported by Thakur et al. (2015), Sharifi (2017) and
Mohan and Thiyagarajan (2019).
Path coefficient analysis provides better means
for selection by resolving the correlation coefficient of
yield and its components into direct and indirect
effects. At both phenotypic as well as genotypic level,
high direct positive effect for seed yield per plant was
contributed by biological yield followed by harvest
index, days to 75 per cent maturity and plant height
(Table 3). In order to obtain the cause and effect
relationship between yield per se, ten yield components
were studied in chickpea through path co-efficient
analysis and the results are in agreement with previous
reports from Padmavathi et al. (2013), Jakhar et al.
(2016) and Tadesse et al. (2016).
Significant differences among the mutants for all
the traits under study suggested prevalence of wide

Table 2. Estimates of phenotypic (P) and genotypic (G) correlation coefficient among various traits in chickpea mutants
Traits Days to 75% Plant Number of Biological Number of Number of 100-seed Harvest Seed
maturity height primary yield pods per seeds per weight index yield per
(cm) branches (g) plant pod (g) (%) plant (g)
Days to 50% P 0.937* 0.063 -0.072 -0.048 -0.066 0.022 -0.170* -0.241* -0.122
flowering G 0.960* 0.058 -0.066 -0.055 -0.076 -0.030 -0.349* -0.317* -0.138*
Days to 75% P 0.081 -0.063 -0.165 -0.177* 0.072 -0.150* -0.232* -0.217*
maturity G 0.103 -0.074 -0.204* -0.220* 0.086 -0.364* -0.365* -0.275*
Plant height (cm) P 0.078 0.300* 0.301* -0.071 -0.145 -0.007 0.276
G 0.086 0.334* 0.337* -0.208* -0.220 -0.024 0.311*
No. of primary P 0.209* 0.217* -0.222* -0.102 0.007 0.159
branches G 0.224* 0.232* -0.409* -0.183 -0.034 0.171
Biological yield (g) P 0.994* -0.275* 0.099 0.397* 0.970*
G 0.998* -0.471* 0.100 0.484* 0.979*
Number of pods per P -0.279* 0.051 0.403* 0.963*
plant G -0.476* 0.097 0.504* 0.978*
Number of seeds P -0.095 0.192 -0.195
per pod G -0.024 0.138 -0.379*
100-seed weight (g) P 0.608** 0.243*
G 0.643* 0.260*
Harvest index (%) P 0.580*
G 0.633*

Table 3. Estimates of direct and indirect effects on seed yield at phenotypic (P) and genotypic (G) level for various traits
in chickpea mutants
Traits Days to Days to Plant Number Biological Number Number 100-seed Harvest Seed yield
50% 75% height of primary yield of pods of seeds weight index per plant
flowering maturity (cm) branches (g) per plant per pod (g) (%) (g)
Days to 50% P -0.0769 0.0431 0.0009 0.0021 -0.0577 0.0201 -0.0001 0.0007 -0.0546 -0.1223
flowering G -0.1464 0.0967 0.0018 0.0012 -0.1351 0.1228 0.0013 0.0017 -0.0824 -0.1384*
Days to 75% P -0.072 0.046 0.0012 0.0018 -0.1975 0.0551 -0.0002 0.0006 -0.0524 -0.2174*
maturity G -0.1405 0.1008 0.0031 0.0014 -0.5009 0.358 -0.0036 0.0018 -0.0948 -0.2747*
Plant height (cm) P -0.0048 0.0037 0.0143 -0.0023 0.359 -0.0936 0.0002 0.0006 -0.0015 0.2756
G -0.0084 0.0103 0.0305 -0.0016 0.8229 -0.5467 0.0088 0.0011 -0.0062 0.3109*
No. of primary P 0.0055 -0.0029 0.0011 -0.0294 0.2493 -0.0674 0.0007 0.0004 0.0016 0.1590
branches G 0.0096 -0.0075 -0.0026 -0.0187 0.5521 -0.377 0.0173 0.0009 -0.0089 0.1705
Biological yield (g) P 0.0037 -0.0076 0.0043 -0.0061 1.1949 -0.3093 0.0009 -0.0004 0.0897 0.9702*
G 0.008 -0.0205 0.0102 -0.0042 2.4616 -1.6213 0.0199 -0.0005 0.1259 0.9791*
Number of pods P 0.005 -0.0081 0.0043 -0.0064 1.1874 -0.3112 0.0009 -0.0002 0.091 0.9628*
per plant G 0.0111 -0.0222 0.0103 -0.0043 2.4571 -1.6242 0.0201 -0.0005 0.1311 0.9785*
Number of seeds P -0.0017 0.0033 -0.001 0.0065 -0.3291 0.0867 -0.0033 0.0004 0.0434 -0.1950
per pod G 0.0044 0.0086 -0.0064 0.0077 -1.1604 0.7734 -0.0423 -0.0001 0.0359 -0.3792*
100-seed weight P 0.0131 -0.0069 -0.0021 0.003 0.1178 -0.0159 0.0003 -0.0039 0.1374 0.2428*
(g) G 0.0511 -0.0367 -0.0067 -0.0034 0.2462 -0.1582 -0.001 -0.0049 0.1671 0.2602*
Harvest index (%) P 0.0185 -0.0106 -0.0001 -0.0002 0.4741 -0.1252 -0.0006 -0.0024 0.2262 0.5796*
G 0.0464 -0.0368 -0.0007 0.0006 1.1916 -0.8189 -0.0058 -0.0032 0.2601 0.6333*

Residual effect = 0.1037 (P), 0.0279 (G) *Significant at 5% level, respectively.

268 Journal of Food Legumes 33(4), 2020
range of genetic variability and scope of selection for
these traits. Mean performance revealed that mutants
viz., A5P5-5-1, A8P4-1-1, C20P6-5-2, C48aP1-4-3,
C48aP3-3-1, M50P3-1-3, N20P3-1-3 were the best for
yield and its contributing traits. High phenotypic and
genotypic coefficient of variation was observed for
number of primary branches, biological yield, number
of pods per plant and seed yield per plant indicating
that selection for these traits will be beneficial because
of additive gene action. High heritability and genetic
advance for number of primary branches, biological
yield, number of pods per plant and seed yield per
plant indicated that selection of these traits will yield
maximum genetic gain in the upcoming generation.
Correlation and path coefficient analysis indicated
that higher seed yield per plant can be obtained by
maintaining characters like plant height, biological
yield, number of pods per plant, 100-seed weight and
harvest index.
ACKNOWLEDGEMENTS
Grant received from BRNS, BARC, Trombay,
India is duly acknowledged. We thank The Mahatma
Phule Krishi Vidyapeeth (MPKV), Rahuri for
providing seed of PG0027.
REFERENCES
Al-Jibouri HA, Miller PA and Robinson HP. 1958.
Genotypic and environmental variances and
covariances in upland cotton cross of interspecific
origin. Agronomy Journal 50: 633-636.
Arora RN, Kumar K and Manav. 2018. Genetic variability
studies for yield contributing traits in Kabuli chickpea
(Cicer arietinum L.). Journal of Pharmacognosy and
Phytochemistry 7: 2675-2677.
Barad SH, Javia RM, Solanki HV and Panera A.
2018.Estimation of genetic variability for Kabuli
chickpea (Cicer arietinum L.) under timely and late
sowing condition.Journal of Pharmacognosy and
Phytochemistry 7: 421-423.
Burtone GW and De Vane GM. 1953. Estimating heritability
in tall Fescus (Festuca arundinaceae) from replicated
clonal material. Agronomy Journal 45: 478-481.
Chopdar DK, Bharti B, Sharma PP, Dubey RB and Meena
BB. 2017. Studies on genetic variability, character
association and path analysis for yield and its
contributing traits in chickpea (Cicer arietinum L.).
Legume Research-An International Journal 40: 824-829.
Desai K, Tank CJ, Gami RA, Patel AM and Chauhan RM.
2015. Genetic variability in indigenous collection of
chickpea (Cicer arietinum L.) genotypes for seed yield
and quality traits.The Ecoscan 9: 59-62.
Dewey DR and Lu KH. 1959. A correlation and path
coefficient analysis of components of crested wheat
grass seed production. Agronomy Journal 51: 515-518.
Dwevedi KK and Gaibriyal ML. 2009.Assessment of genetic
diversity of cultivated chickpea (Cicerarietinum
L.).Asian Journal of Agricultural Sciences 1: 7-8.
Jakhar DS, Kamble MS, Singh A and Raj P. 2016. Genetic
variability, character association and path coefficientt
analysis in Chickpea (Cicer arietinum L.).EM
International 22: 239-244.
Jalota SK, Sood A and Harman WL. 2006. Assessing the
response of chickpea (Cicer arietinum L.) yield to
irrigation water on two soils in Punjab (India): A
simulation analysis using the CROPMAN model.
Agricultural Water Management 79: 312-320.
Johanson HW, Robinson HF and Comstock RC. 1955.
Estimates of genetic and environmental variability in
soybeans. Agronomy Journal 47: 314-318.
Joshi P, Yasin M and Sundaram P. 2018. Genetic variability,
heritability and genetic advance study for seed yield
and yield component traits in a chickpea recombinant
inbred line (RIL) population. International Journal of
Pure and Applied Bioscience 6: 136-141.
Katna G, Naval Kishore and Kamal Dev Sharma 2020.
Studies on induced chickpea mutants for seed yield
and its component traits. International Conference on
Pulses as the Climate Smart Crops: Challenges and
Opportunities held at Bhopal during February 10-12,
2020, Pp 200-201.
Kishor L, Swarup I, Nehra A, Kirar G and Jeeterwal RC.
2018. Genetic variability, heritability and genetic
advance analysis in chickpea (Cicer arietinum L.).
International Journal of Pure and Applied Bioscience
6: 141-144.
Mohan S and Thiyagarajan K. 2019.Genetic variability,
correlation and path coefficient analysis in chickpea
(Cicer arietinum L.) for yield and its component traits.
International Journal of Current Microbiology and
Applied Sciences 8: 1801-1808.
Muehlbauer FJ and Singh KB. 1987. Genetics of chickpea.
The Chickpea CAB International Wallingford, UK. Pp
99-126.
Nizama JR, Patel SR and Patel AI. 2013. Asian resonance
45 genetic variability and heritability among
quantitative traits in chickpea under tropical region.
Asian Resonance 5: 45-48.
Padmavathi V, Sreemannarayana S, Satyanarayana V and
Lal A. 2013.Correlation and path coefficient analysis
in Kabuli chickpea (Cicer arietinum L.).International
Journal of Applied Biology and Pharmaceutical
Technology 4: 107-110.
Panse VG and Sukhatme PV. 1985. Statistical methods for
agricultural workers. Indian Council of Agricultural
Research, New Delhi. Pp 87-89.
Parida G, Saghfi S, Eivazi A, Akbarzadeh A, Kavetskyy T,
Aliyeva I and Khalilov R. 2018. Study of genetic
 Saini et al. : Variability and correlation studies for yield and yield contributing 269
traits in kabuli chickpea

advance and broad sense heritability for grain yield
and yield components of chickpea (Cicer arietinum L.)
genotypes. Advances in Biology & Earth Sciences 3: 5-
12.
Sharifi P. 2017.Correlation and path analysis for grain
yield and yield components in chickpea (Cicer arietinum
L.).Genetika 49: 273-284.
Tadesse M, Fikre A, Eshete M, Girma N , Korbu L ,
Mohamed R , Bekele D , Funga A and Ojiewo CO. 2016.
Correlation and path coefficient analysis for various
quantitative traits in desi chickpea genotypes under
rainfed conditions in Ethiopia. Journal of Agricultural
Science 8: 1916-9752.
Thakur TS, Johnson PL and Nanda HC. 2015. Evaluation
of desi chickpea (Cicer arietinum L.) genotypes for yield
and yield contributing traits under rainfed rice based
cropping ecosystem of Chattisgarh. Journal of Food
Legumes 28: 21-26.
Vaghela MD, Poshiya VK, Savaliya JJ, Kavani RH and
Davada BK. 2009. Genetic variability studies in Kabuli
chickpea (Cicer arietinum L.). Legume Research 32: 191-
194.
 Journal of Food Legumes 33(4): 270-273, 2020

Short Communication
Assessment of genetic divergence among blackgram (Vigna mungo (L.)
Hepper) genotypes under organic fertilizer management
A KAVITHA REDDY*1, M SHANTHI PRIYA2, D MOHAN REDDY3 and B RAVINDRA REDDY4

*1Dept of Genetics and Plant Breeding,
S.V. Agricultural College, Tirupati-
517502, Andhra Pradesh, India, 2Dept
of Genetics and Plant Breeding, ARS,
Perumallapalli - 517505, Andhra
Pradesh, India, 3Dept of Genetics and
Plant Breeding, RARS, Tirupati-
517502, Andhra Pradesh, India, 4Dept
of Statistics and Computer
Applications, S.V. Agricultural College,
Tirupati- 517502, Andhra Pradesh,
India
*Email: appagari@gmail.com
ABSTRACT
Thirty blackgram genotypes evaluated for genetic divergence under organic
fertilizer management for 17 parameters including yield, yield component and
water use efficiency traits were grouped into seven clusters by Mahalanobis’
D2 analysis. Hundred seed weight was recorded as the major contributor towards
genetic divergence. The crosses PU-31 × KU-14-01, KU-12-56 × LBG-752 and KU-
12-56 × KU-14-01 were identified for successful utilization in hybridization
programmes to get desirable transgressive segregants for yield and water use
efficiency.
Key words: Black gram, D2 analysis, hybridization program, organic fertilizer
management

Received: September 18, 2020

Accepted: January 20, 2021

Handling Editor:
Dr Sanjeev Kumar, ICAR-Research Complex
for Eastern Region, Patna

Blackgram or urdbean (Vigna mungo [L.] Hepper)
is a highly prized pulse crop of India that enjoys
considerable importance from the point of food and
nutritional security. In the present regime of global
climate change, a major shift towards sustainable and
ecofriendly cropping systems is observed.With
increased awareness on negative effects of chemical
based crop management, organic crop management
has gained momentum and so has the need to breed
cultivars suited to it. Availability of genetically diverse
germplasm is a basic requirement essential to develop
superior and desirable segregants. The D2 analysis
(Mahalanobis, 1936) -a powerful tool in quantifying
the degree of divergence among all possible pairs of
population at the genotypic level, aids to achieve this
as it classifies genotypes into relatively homogeneous
groups in such a way that intra- cluster diversity is
minimized and inter-cluster diversity is maximized.
Respective genotypes from the diverse clusters can then
be utilized in breeding programmes. As genotype
performance is affected by prevailing environment, the
variability under environmental conditions can also
be assessed and utilized for genotype selection using
the multivariate D2 statistics analysis. In this pretext,
the present experiment was conducted to identify
divergent genotypes under organic fertilizer
management.
The present investigation was carried out among
30 blackgram genotypes during Kharif, 2017 at dry
land farm of Sri Venkateswara Agricultural College,
Tirupati using a Randomized Block Design with three
replications. Majority of the genotypes (26) were
procured from ARS, Madira, while LBG752, LBG787
and LOP1070 were taken from Lam, Guntur. Only one
genotype viz. TBG 104 was procured from RARS,
Tirupati.
FYM was applied @ 20 t ha-1 at the time of field
preparation and Jeevamrutha @ 500 L ha-1(Ruchi, and
Akshay, 2017) was applied at 15 days interval 20 days
after sowing (DAS). Seed treatment was done with 3%
Panchagavya (Ram, 2017) and it was again sprayed 25
and 35 DAS. For control of sucking pests,
Bramhasthram @ 2.5 % (Ruchi, and Akshay, 2017) as
sprayed. No inorganic chemicals were used. Cultural
practices like weeding and irrigation were followed to
maintain good crop growth. Observations were
recorded on five randomly selected plants in each
genotype for plant height, number of primary branches
per plant, number of clusters per plant, number of pods
per cluster, number of pods per plant, pod length,
number of seeds per pod, 100 seed weight, harvest
index, SPAD chlorophyll meter reading at 35 DAS,
SPAD chlorophyll meter reading at 50 DAS, Specific
leaf area at 35 DAS, Specific leaf area at 50 DAS, relative
 Reddy et al. : Assessment of genetic divergence among blackgram (Vigna mungo (L.) Hepper) 271
genotypes under organic fertilizer management

water content (taken at peak flowering i.e., 40 DAS)
and seed yield per plant. Observations on days to 50
% flowering and days to maturity were recorded on
plot basis. Genetic divergence was estimated using
Mahalanobis D2 statistics (Mahalanobis,1936) and
genotypes were grouped into clusters following the
Tochers’ method as described by Rao,1952.
The 30 genotypes were grouped into seven
clusters using Tocher’s method and the distribution
of genotypes in various clusters is presented in Table
1. Among seven clusters, cluster I was the largest with
16 genotypes followed by cluster II with 9 genotypes.
Remaining five clusters were monogenotypic. The
average inter and intra cluster D2 and D values are
presented in the Table 2. Intra cluster distances ranged
from 0.00 to 6.58. Among the clusters, cluster II had
maximum intra cluster distance (6.58), followed by
cluster I (6.08). The clusters III, IV, V, VI, VII recorded
Table 1. Clustering pattern of 30 blackgram genotypes
by Tocher’s method under organic fertilizer
management
Cluster no. No. of Name of the genotypes
genotypes
I 16 KU-10-1169, KU-14-39, KU-14-47,
NDU-11-201, P-1032, P-728, PU-205,
PU-31, RFU-13-04, SU-13-509, TBG-
104, UG-708, VBG-09-005, VBG-11031,
VBN-7, WBG-26
II 9 KDRS-136, KU-11-685, LBG-752, LBG-
787, LOP-1070, MBG-1045, MBG-1050,
SU-13-08, TU-94-02
III 1 KU-10-1170
IV 1 KU-12-56
V 1 KU-14-01
VI 1 VBN-4
VII 1 P-112
zero intracluster distances as they were
monogenotypic. Maximum inter cluster distance is
observed between cluster III and VI (16.44) followed
by cluster III and IV (16.14), cluster V and VI (16.04).
The minimum inter cluster distance was observed
between cluster III and V (7.26) followed by cluster I
and II (7.87), Cluster IV and VI (7.98). Intra and inter
cluster D2 values worked out from the above divergence
analysis indicated that the inter-cluster distances were
greater than intracluster distances, revealing that
considerable amount of genetic diversity existed
amongst the genotypes. Similar results were also
reported by Ali et al. (2008), Srimathy et al. (2012), Singh
et al. (2012), Jayamani and Sathya (2013), Panigrahi et
al. (2014b), Geethanjali et al. (2015) and Vinod et al.
(2017).
The number of times that each of the 17 characters
appeared first rank and its respective per cent
contribution towards genetic divergence is presented
in Table 3. 100 seed weight (45.98%) was found to be
the major contributor towards total genetic divergence.
The contribution of other traits towards genetic
divergence in descending order in were number of
clusters per plant, seed yield per plant, SLA at 50 DAS,
pod length, SLA at 35 DAS, SCMR at 50 DAS, SCMR at
35 DAS, plant height, relative water content, days to
50% flowering, number of primary branches per plant,
number of pods per cluster and number of seeds per
pod.
Considering the cluster mean yield, yield
component and water use efficiency traits in
blackgram under organic fertilizer management as
given in Table 4, the values of cluster mean for seed
yield per plant varied from 0.79 g (III) to 2.78 g (IV)
with a general mean of 1.47 g and higher values than

Table 2. Average intra and inter cluster distances formed by Tocher’s method in blackgram under organic fertilizer
management.
Cluster 1 Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 7
36.17 61.96 135.69 79.08 148.14 77.82 85.92
Cluster 1
(6.08) (7.87) (11.65) (8.89) (12.17) (8.82) (9.27)
43.34 70.79 133.63 86.67 139.25 112.86
Cluster 2
(6.58) (8.41) (11.56) (9.31) (11.80) (10.62)
0.00 260.43 52.77 270.29 197.13
Cluster 3
(0.00) (16.14) (7.26) (16.44) (14.04)
0.00 215.46 63.76 121.31
Cluster 4
(0.00) (14.68) (7.98) (11.01)
0.00 257.32 139.36
Cluster 5
(0.00) (16.04) (11.81)
0.00 153.35
Cluster 6
(0.00) (12.38)
0.00
Cluster 7
(0.00)
Figures in parenthesis indicate D values
272 Journal of Food Legumes 33(4), 2020

Table 3. Percent contribution of different characters

towards divergence in blackgram genotypes
under organic fertilizer management
Times ranked Contribution
S. No. Characters
first (%)
1. Days to 50 % flowering 1 0.23
2. Days to maturity - -
3. Plant height (cm) 11 2.53
No. of primary branches
4. 1 0.23
per plant
5. No. of clusters per plant 50 11.49
6. No. of pods per cluster 1 0.23
7. No. of pods per plant - -
8. Pod length (cm) 26 5.98
9. No. of seeds per pod 1 0.23
10. 100 seed weight (g) 200 45.98
11. Seed yield per plant (g) 46 10.57
12. Harvest index (%) - -
SPAD chlorophyll meter
13. 12 2.76
reading at 35 DAS
SPAD chlorophyll meter
14. 20 4.6
reading at 50 DAS
Specific leaf area at 35
15. 21 4.83
DAS (cm2 g-1)
Specific leaf area at 50
16. 39 8.97
DAS (cm2 g-1)
Relative water content
17. 6 1.38
(%)
Cluster means for 17 characters in blackgram under organic management

the general mean was observed in the clusters IV and

II. Number of clusters per plant was highest in VII
(15.27) and lowest in VI (5.53) and clusters VII, V and
IV recorded higher values than general mean. The
cluster means for number of pods per cluster varied
from 2.62 (I) to 3.27 (III), whereas clusters III, V and II
registered higher values than the general mean (2.88).
Number of pods per plant exhibited an overall mean
value of 28.24 with cluster means ranging from 18.77
(VI) to 42.80 (VII). The superior clusters that crossed
general mean value were VII, V and IV. The cluster
means for 100 seed weight ranged between VI (2.31 g)
to V (4.81 g). Higher values than the general mean
(7.92%) for harvest index were observed in clusters IV,
V and I.
Considering the cluster mean values for five water
use efficiency traits (SPAD chlorophyll meter reading
at 35 DAS, SPAD chlorophyll meter reading at 50 DAS,
Specific leaf area 35 DAS, Specific leaf area 50 DAS,
relative water content), the clusters III, VII, I and V were
found to be desirable. Based on the divergence analysis
under organic fertilizer management, the crosses PU-
31 × KU-14-01, KU-12-56 × LBG-752 and KU-12-56 ×
KU-14-01 could be recommended to get desirable
transgressive segregants for yield and water use
Table 4.

efficiency traits.
 Reddy et al. : Assessment of genetic divergence among blackgram (Vigna mungo (L.) Hepper) 273
genotypes under organic fertilizer management

REFERENCES Ram M. 2017. Panchagavya is a bio-fertilizer in organic

farming. International Journal of Advanced Science
Ali MN, Somnath SG and Sarkar HKB. 2008. Genetic and Research. 2:54-57.
divergence studies in blackgram. Environment and
Rao, C.R. 1952. Advanced statistical methods in biometrical
Ecology Research. 26: 943-945.
research. John Wiley and Sons. New York. 236-272.
Geethanjali, Anuradha Ch and Suman. 2015. Genetic
Ruchi B And Akshaya B. 2017. An Overview: Zero Budget
diversity for yield and its components in blackgram
Natural Farming. Trends in Biosciences. 10: 9314-9316.
(Vigna mungoL.). International Journal of Scientific
Research. 4: 563-565. Singh M, Swarup I, Billore M and Chaudhari PR.
2012.Genetic diversity for yield and its components in
Jayamani P and Sathya M. 2013. Genetic diversity in pod
blackgram (Vigna mungo L.). Research Journal of Recent
characters of blackgram (Vigna mungo L. Hepper).
Sciences. 2: 4-6.
Legume Research. 36: 220-223.
Srimathy M, Sathya M and Jayamani P. 2012. Genetic
Mahalanobis PC. 1936. On the generalized distances in
diversity studies in blackgram (Vigna mungo (L.)
statistics. Proceedings of National Institute of Science
Hepper). Journal of Food Legumes. 25: 279-281.
India. 2: 49-55.
Vinod Y, Lal SS and Lal GM. 2017. Studies on genetic
Panigrahi KK, Baisakh B, Kar M and Mohanty A.
diversity in blackgram (Vigna mungo L. Hepper)
2014.Genetic divergence in mutants and land races of
germplasm. Global Journal of Bioscience and
blackgram (Vigna mungo (L.) Hepper) from Odisha.
Biotechnology. 6: 296-302.
Electronic Journal of Plant Breeding. 5: 567-572.
 Journal of Food Legumes 33(4): 274-277, 2020

Short Communication
Response of mungbean (Vigna radiata L.) cultivars to integrated nutrient
management in Bundelkhand region of Uttar Pradesh
ANKIT TIWARI1, A.K. TRIPATHI*1 and JAGANNATH PATHAK2

1
Department of Agronomy, Banda
University of Agriculture and
Technology, Banda-210 001 (Uttar
Pradesh), India; 2 Department of Soil
Science and Agriculture Chemistry,
Banda University of Agriculture and
Technology, Banda-210 001 (Uttar
Pradesh), India
*Email: aktripathiak@gmail.com
Received: September 25, 2020
Accepted: February 04, 2021
Handling Editor:
Dr Sanjay S Rathore, ICAR-Indian
Agricultural Research Institute, New Delhi
ABSTRACT
A field experiment was conducted at Banda University of Agriculture and
Technology, Banda (Uttar Pradesh) to study the effect of integrated nutrient
management on growth and yield of mungbean (Vigna radiata (L.) Wilczek)
cultivars in Bundelkhand region of Uttar Pradesh during kharif season of 2019.
The experiment comprised of 12 treatment combinations of integrated nutrient
management practices in asymmetrical factorial randomized block design with
three replications. Results revealed that cultivar ‘IPM 2-3’ was better over “Virat”
in respect of growth, yield attributes, seed yield and economics. Similarly,
INM practices had better effect on growth, yield parameters such as number of
pods/plant, number of seeds/pod, seed weight/plant and 1000-seed weight, seed
yield and economics as compared to sole application of inorganic fertilizers
and vermicompost treatments. However, 100% RDF + 100% vermicompost
had highest seed yield (822 kg/ha), closely followed by 75% RDF + 50%
vermicompost (791 kg/ha) compared to rest of treatments. Among the INM
treatments, application of 50% RDF blended with 50% vermicompost recorded
at par values of growth, yield attributes and seed yield over the application of
100% RDF + 100% vermicompost and 75% RDF + 50% vermicompost. On an
average, INM treatments recorded 169.2, 14.5 and 64.5% higher net returns as
well as 43.0, 2.3 and 26.3% more benefit: cost ratio over the control, 100% RDF
and 100% vermicompost, respectively. Therefore, application of 50% RDF +
50% vermicompost (1.25 t/ha) was optimum under the existing condition of
Bundelkhand.

Key words: Economics, Integrated nutrient management, Mungbean,

Nodulation, Varieties, Vermicompost, Yield

Pulses occupy predominant position in context
of food and nutritional security, particularly for low
income consumers as it is popularly known as “poor
man’s meat” and “rich man’s vegetable”. In India due
to diverse agro climatic conditions pulses are grown
throughout the year. India has appreciably 35% and
26% share in global area and production, respectively,
and the largest producer and consumer of pulses.
Realizing the importance of pulses for human diet,
year 2016 was declared as International Year of Pulses.
In India, mungbean (Vigna radiata (L.) Wilczek) is
cultivated on an area of 4.29 million hectares with total
grain production of 2.46 million tonnes and average
yield of 475 kg ha -1 during 2019-20 (4 th Advance
Estimates) (Anonymous, 2019). In Uttar Pradesh,
mungbean occupies 89.5 thousand hectares of area
with a production of 44.1 thousand metric tonnes and
a productivity of 478 kg/ha during the same year. Out
of this, Uttar Pradesh Bundelkhand alone occupies
33.7% in area and 21.0% in total production of
mungbean (Anonymous, 2019). Average yield of this
crop in the country is very low, which is primarily due
to substandard methods of cultivation, poor crop
stands, imbalanced nutrition, lack of high yielding
varieties, etc.
Bundelkhand is a major pulses growing region
of India. Here, the major kharif growing pulse crops
are pigeonpea, urdbean, and mungbean. About 80%
of total pulse area grown in this region. Integration of
inorganic and organic sources such as vermicompost,
poultry manure, farm yard manure and their efficient
management has shown promise in sustaining the
productivity and soil health, besides meeting part of
crop nutrient requirement (Chaudhary et al., 2014).
Organic manure like farmyard manure and
vermicompost is considered as an important source of
macro- and micro-nutrients for increasing crop yield.
The use of organic manures alone will not result in
spectacular increase in crop yields due to slow release
of nutrients from organic sources. Mungbean yield and
quality can be improved by the balanced use of
fertilizers and also by managing the organic manures
 Tiwari et al. : Response of mungbean (Vigna radiata L.) cultivars to integrated nutrient management 275
in Bundelkhand region of Uttar Pradesh

properly. Keeping all above facts in view, a field trial
was carried out at Banda, Uttar Pradesh to study the
effect of integrated nutrient management on
mungbean cultivars in Bundelkhand region of Uttar
Pradesh.
A field experiment was conducted at University
Farm, Banda University of Agriculture and
Technology, Banda (Uttar Pradesh) during kharif 2019.
Representative soil samples were collected from 0-15
cm depth randomly before laying out the experiment
for studying the initial soil physico-chemical
properties. The initial soil analysis indicates a pH of
7.3, organic carbon 0.42%, 212 kg/ha available N, 8.95
kg/ha available P2O5 and 219 kg/ha available K2O
which were observed to be in medium to low range.
The experimental farm lies between 25º31’36.98"
North latitude and 80º21’31.92" East longitude at an
elevation of 123 MSL with hot and semi-arid climatic
zone with winter temperature touching a low of 1ºC
and a high of above 40ºC during summer. The rainfall
distribution pattern of this zone is uneven, and
approximately 90% of the rain falls during the
monsoon months. Average rainfall is 800-900 mm but
most of the rain is lost to runoff.
The experiment was laid out in asymmetrical
factorial randomized block design with three
replications. The 12 treatment combinations comprised
of two cultivars viz., IPM 2-3 (V1) and IPM 205-7 (V2)
and six INM treatments with absolute control viz.,
Control (N0), 100% recommended dose of fertilizer-RDF
(N1), 100% Vermicompost-VC @ 2.5 t/ha (N2), 100%
RDF + 100% VC @ 2.5 t/ha (N3), 75% RDF + 50% VC @
1.25 t/ha (N4) and 50% RDF + 50% VC @ 1.25 t/ha
(N5). Vermicompost was applied during the final land
preparation as per treatment. Di-ammonium
phosphate (DAP) @ 100 kg/ha was applied as
recommended dose of fertilizer (RDF) as per treatment.
Seed treatment was done with rhizobium. PSB @ 3 kg/
ha mixed with 50 kg well decomposed FYM was
broadcasted over the entire experimental land during
last ploughing. Mungbean was sown on 01 August
2019 using 15 kg seed/ha. Sowing was done in rows
spaced at 45 cm apart. Other agronomic practices were
adopted for harvesting good crop. Three plants
altogether were taken from second row from each sides
of every plot at 45 DAS for growth analysis and at
harvest for yield attributes. The pods were picked when
they attained their full maturity. Three pickings were
done in both the varieties from the net plot area of each
treatment.
The effect of variety on growth parameters such
as dry matter accumulation, nodulation/plant and
branches/plant was recorded comparable values
(Table 1). Variety ‘IPM 2-3’ produced numerically
higher values of dry matter accumulation, nodulation/
plant and branches/plant over ‘IPM 205-7’. Similarly,
maximum yield attributes viz., number of pods/plant,
seeds/pod and 1000-seed weight were also recorded

Table 1. Effect of integrated nutrient management practices on growth, yield attributes and seed yield of mungbean
cultivars
Treatment Branches/ Dry weight/ Nodulation/plant at Pods/ Seeds/ Seed 1000- Seed
plant plant at 45 45 DAS plant pod weight/ seed yield
DAS Counts Dry weight plant weight (kg/ha)
(g) (mg)
Variety (V)
V1: IPM 2-3 4.76 7.79 61.31 101.58 20.83 7.86 5.81 45.30 703
V2: IPM 205-7 4.60 7.44 52.89 85.16 18.46 7.24 5.63 40.16 686
SE(d)± 0.11 0.21 4.88 7.89 0.84 0.22 0.34 2.38 14
CD (P=0.05) NS NS NS NS 1.76 0.47 NS 4.96 NS
INM Protocols (N)
N0; Control 2.96 6.79 41.11 71.29 12.62 6.78 3.42 34.24 450
N1; 100% RDF 4.84 7.54 56.39 88.42 17.63 7.53 6.01 43.74 710
N2; 100% VC (2.5 t/ha) 4.54 7.01 49.78 81.04 16.97 7.10 5.40 40.68 613
N3; 100% RDF + 100% VC 5.49 8.75 66.95 113.25 21.37 8.64 6.74 47.67 822
(2.5 t/ha)
N4; 75% RDF + 50% VC 5.16 7.87 66.00 104.60 20.21 7.65 6.50 45.60 791
(1.25 t/ha)
N5; 50% RDF + 50% VC 5.09 7.74 62.39 101.60 20.07 7.57 6.26 44.46 779
(1.25 t/ha)
SE(d)± 0.20 0.37 8.48 7.89 1.46 0.39 0.60 4.12 25
CD (P=0.05) 0.28 0.77 17.63 19.53 3.05 0.81 1.25 8.59 52
Interactions NS NS NS NS NS NS NS NS NS

DAS = Days after sowing; RDF = Recommended dose of fertilizer; VC = Vermicompost; NS = Non significant
276 Journal of Food Legumes 33(4), 2020

with variety ‘IPM 2-3’ over variety ‘IPM 205-7’. The followed by 75% RDF + 50% vermicompost and 50%
difference among varieties was attributed due to RDF + 50% vermicompost, respectively. The least
genetic makeup which truly indicated total values of dry matter accumulation, nodulation/plant
photosynthates production. Similarly, seed yield, net and branches/plant were recorded with the control.
return and benefit: cost ratio were recorded comparable INM treatments viz., application of 100% RDF +
values with variety ‘IPM-2-3’ with corresponding 100% vermicompost (N 3), 75% RDF + 50%
figures of 703 kg/ha, Rs. 25919/ha and 2.09, vermicompost (N4) and 50% RDF + 50% vermicompost
respectively (Table 1). (N5) being at par together recorded higher values of
Growth parameters viz., dry matter yield attributing characters such as number of pods/
accumulation, nodulation/plant and branches/plant plant, number of seeds/pod, seed weight/plant and
influenced significantly due to various INM practices 1000-seed weight over the control, 100% RDF and
(Table 1) and INM treatments established its 100% vermicompost treatments (Table 1). In other
superiority in terms of higher growth parameters over words, results revealed that all yield attributing
rest of the treatments. Dry weight/plant was observed characters of mungbean improved notably with the
that the application of 100% RDF + 100% application of vermicompost along with inorganic
vermicompost (N3) recorded significantly higher fertilizers irrespective of doses when compared with
values, followed by 75% RDF + 50% vermicompost the application of 100% RDF, 100% vermicompost and
(N4) and 50% RDF + 50% vermicompost (N5). However, the control. Application of 100% RDF + 100%
application of 100% vermicompost remained at par vermicompost recorded numerically higher values
with treatment receiving 100% RDF which increased than in plots received 75% RDF + 50% vermicompost
total dry matter/plant by 3.24% over the absolute and 50% RDF + 50% vermicompost. This is also in
control recorded at 45 DAS. The higher accumulation conformity with the findings of Patel et al. (2016) and
of assimilates in these treatments reflected in higher Singh et al. (2017) in case of greengram.
number of pods/plant, seed weight/plant and 1000- INM treatments (mean of N3, N4, and N5) being
seed weight, further indicating their yield superiority. recorded comparable values of seed yield of mungbean
The reason for the increase in quantity of total dry but these INM treatments obtained significantly higher
matter production may be due to the fact that values of seed yield than plots receiving 100% RDF,
vermicompost might have stimulated biological 100% vermicompost and the control (Table 1). Analysis
activity in the soil and better availability of nutrients of data further revealed that on an average INM
and effective conversion of nutrients such as Fe, Mg treatments recorded higher values of seed yield to the
and Zn at the site of photosynthesis into pigments magnitude of 77.20, 12.39 and 30.05% over the control,
when apply in combination. Similarly, this treatment 100% RDF and 100% vermicompost, respectively. It
(N3) had maximum number of branches/plant, was also observed that organic manures alone viz.,
number of root nodules/plant and its dry weight, vermicompost (613 kg/ha) noticed significantly lower
Table 2. Effect of integrated nutrient management practices on economics of mungbean cultivars
Treatment Gross return Net return B:C ratio
(₹/ha) (₹/ha)
Variety (V)
V1: IPM 2-3 49542 25919 2.09
V2: IPM 205-7 48336 24713 2.03
SE(d)± 1023 1023 0.04
CD (P=0.05) NS NS NS
INM Protocols (N)
N0; Control 31725 11625 1.58
N1; 100% RDF 50020 27346 2.21
N2; 100% VC (2.5 t/ha) 43228 19030 1.79
N3; 100% RDF + 100% VC (2.5 t/ha) 57927 31156 2.17
N4; 75% RDF + 50% VC (1.25 t/ha) 55789 31492 2.30
N5; 50% RDF + 50% VC (1.25 t/ha) 54943 31246 2.32
SE(d)± 1773 1773 0.07
CD (P=0.05) 3700 3700 0.15
Interactions NS NS NS

DAS = Days after sowing; RDF = Recommended dose of fertilizer; VC = Vermicompost; NS = Non significant
 Tiwari et al. : Response of mungbean (Vigna radiata L.) cultivars to integrated nutrient management
in Bundelkhand region of Uttar Pradesh
yield compared to combined application of organic
and inorganic fertilizer treatments (779-822 kg/ha)
which might be due to slow mineralization of organic
manure and non-availability of required nutrients
resulted in setback of crop growth at early stage of
crop growth and thus affected the crop yield. The plot
receiving no fertilizer (control) recorded the lowest
values of seed yield (450 kg/ha) of mungbean.
Krishnaprabu (2018) reported that integrated nutrient
management not only increased the yield of greengram
but also increased the nutrient uptake besides
improving the physico-chemical and biological
properties of soil which provide better soil environment
for growth. The akin results are in lend support to
those reported by Chaudhari et al. (2017), Singh et al.
(2017) and Bhavya et al. (2018).
Gross return, net return and benefit: cost ratio
were recorded higher values with variety ‘IPM-2-3’
being at par to variety ‘IPM 205-7’with corresponding
figures of ₹ 49542/ha, ₹ 25919/ha and 2.09,
respectively (Table 2). Among the different INM
treatments, the mean effect of INM irrespective of doses
(mean of N3, N4 and N5) registered significantly higher
gross (₹ 56220/ha) and net return (₹ 31298/ha) to the
tune of 12.40 and 30.05% gross and 14.45 and 64.47%
more net return compared to sole application of 100%
RDF and 100% vermicompost, respectively (Table 2).
The benefit: cost ratio (2.26) was also higher in these
treatments. The superiority in gross and net returns
with these treatments was mainly attributed to their
higher yield of greengram. However, significantly
lower gross and net returns as well as benefit: cost
ratio was obtained with the control plot. Among the
INM treatments, the maximum gross (₹ 54943/ha)
and net return (₹ 31246/ha) as well as benefit: cost
ratio (2.32) was recorded from the application of 50%
RDF + 50% vermicompost (1.25 t/ha), closely followed
by two other INM treatments i.e. N3 and N4. These
results are in agreement with the results obtained by
Arsalan et al. (2016) in case of mungbean.
The present research work reveals that the
application of 50% RDF + 50% vermicompost (1.25 t/
277
ha) to mungbean varieties is more beneficial for higher
growth, yield and income as compared to other
remaining integrated nutrient management practices
studied.
References
Anonymous. 2019. Ministry of Agriculture and Farmers
Welfare, Department of Agriculture, Cooperation and
Farmers Welfare, Directorate of Economics and
Statistics, Fourth Advance Estimates of Production of
Food Grains for 2017-18.
Arsalan, Ahmed Shoaib, Chauhdary Nawaz Junaid and
Sarwar Muhammad. 2016. Effect of vermicompost and
phosphorus on crop growth and nutrient uptake in
mungbean. Journal of Applied Agriculture and
Biotechnology, 1(2): 38-46.
Bhavya G, Chandra Shaker K, Jayasree G and Reddy M.
Malla. 2018. Nutrient uptake and yield of greengram
(Vigna radiata L.) as influenced by phosphorus
fertilization, organic manures and biofertilizers.
International Journal of Chemical Studies, 6(3): 32-35.
Chaudhari SD, Naik VR, Patel JM and Sodavadiya HB.
2017. Effect of soil conditioner and integrated nutrients
management on yield of mungbean (Co-4) grown on
partially reclaimed coastal salt affected soil of south
Gujarat, India. International Journal of Current
Microbiology and Applied Sciences, 6(8) : 2835-2840.
Chaudhary SK, Singh SP, Singh Y and Dharminder, 2014.
Influence of integrated use of fertilizers and manures
on SRI grown rice (Oryza sativa) and their residual effect
on succeeding wheat (Triticum aestivum) in calcareous
soil. Indian Journal of Agronomy, 59(4): 527-533.
Krishnaprabu S. 2018. Integrated approach in nutrient
management of greengram on nutrient uptake and
economics. International journal of Pure and Applied
Bioscience, 6(5): 832-834.
Patel Swetha A, Chaudhari PP and Desai NH. 2016. Yield
and economics of greengram cultivars as influenced
by integrated nutrient management. Journal of Crop
Research, 51(1): 1-3.
Singh Mandhata, Mishra JS and Bhatt BP. 2017. Effect of
integrated nutrient management on production
potential and quality of summer mungbean (Vigna
radiata L.). Journal of Krishi Vigyan, 5(2): 39-45.
 Journal of Food Legumes 33(4): 278-279, 2020

Short Communication
Identification of a unique accession in cowpea with dense pubescence
KULDEEP TRIPATHI1*, AK PARIHAR2, NIRANJANA MURTHY3, REVANASIDDA 2, DP WANKHEDE1,
NEETA SINGH1, SANJEEV K DESHPANDE4 and ASHOK KUMAR1

1
ICAR-National Bureau of Plant
Genetic Resources, New Delhi 110 012,
India. 2ICAR-ICAR-Indian Institute of
Pulses Research, Kanpur 208 024, Uttar
Pradesh, India. 3 University of
Agricultural Sciences, Bengaluru 560
065, Karnataka, India. 4 University of
Agricultural Sciences, Dharwad 580
005, Karnataka, India
*Email: kdtripathi89@gmail.com
Received: October 12, 2020
Accepted: January 21, 2021
ABSTRACT
Cowpea is a multi-season and multipurpose leguminous crop cultivated in arid
and semi-arid regions of Indian sub-continent. To exploit the available
variability, intensive efforts towards the characterization of entire germplasm
conserved in Indian national gene bank is need of the hour. Therefore, the
present study emphasized on delineation of existing variability for different
morphological traits in mega characterization programme conducted at ICAR-
NBPGR, New Delhi. Consequently, a rare and unique cowpea accession, namely
EC762384, was identified with very high pubescence and also validated over
multiple seasons and locations. Pubescence plays an instrumental role in
protecting the crop from different biotic and abiotic stresses along with its
adaptation mechanism. Thus, identified germplasm accession may be utilized
as a donor for the development of cowpea varieties with high pubescence
which would be helpful for sustainable food and nutritional security under
climate change scenario.

Handling Editor: Key words: Characterization, Cowpea, Germplasm, Pubescent, Trichome

Dr. Gaurav Kumar Taggar, PAU,
Ludhiana

Cowpea is an important multipurpose The germplasm accessions conserved at Indian

leguminous crop which has been a part of the human
diet since ancient time (Choudhary et al., 2015). It is
also grown as livestock feed, green manure and as
environment-friendly crop (water-efficient and low
carbon footprint food) . Besides being an excellent
source of nutrition, cowpea is resilient to abiotic
stresses induced due to climate change. It is superior
to other competitive legumes with respect to both
nutritional and agronomical performance (Togola et
al. 2017). Owing to its excellent quality, this important
pulse crop is predominantly grown in many parts of
the tropics, especially in Africa and Asia (Tripathi et
al. 2019). Considering the adverse impact of abiotic
and biotic stresses on cowpea production in India
and to ensure food and nutritional security to the
millions of the poor residing in the developing world,
it is imperative to search for new genotypes under
changing climate. The global cowpea collections still
have considerable genetic diversity to mine within and
the diverse germplasm stored in genebanks are a vital
source of desirable traits. Adequate phenotyping for
discovering useful genes that may aid in the cowpea
improvement programme is essential. The present
investigation aimed to assess the existing variability
in cowpea for different morphological parameters and
other descriptors.
National Genebank (NGB) situated at Indian Council
of Agricultural Research-National Bureau of Plant
Genetic Resources (ICAR-NBPGR), New Delhi are
routinely monitored through various activities
including germplasm characterization and evaluation
programmes as a quintessential strategy to identify
novel sources of economically important traits for
accelerating the national and international breeding
programme(s). In this study a total of 2,023 accessions
of cowpea, having originated from diverse geographic
regions of the world, were characterized for agro-
morphological characters during kharif 2018-2019 at
ICAR-NBPGR, New Delhi, and a distinct cowpea
accession, namely EC762384 with very dense
pubescence (Fig.1) was identified. This accession had
very prominent trichomes on the entire plant that was
visible to naked eye. It is a climbing type with dense
hair on leaves, pods and stems (1.5-2m) ; trifoliate
leaves, 7-8.7 x 10-12.2 cm leaflets: ovate, acute at apex;
4-5.4 cm long petiole; light purple flowers (2-4 in
raceme); light purplish petals; standard of 22 x 25 mm,
orbicular, wings 20-22 x 16-18 mm, keel 20-22-18-20
mm long; pods 15-18 x 3-5 mm, 10-12 number of seeds
per pod; aril developed. For validation, EC762384 was
evaluated at Indian Institute of Pulses Research,
Kanpur during kharif 2019 and 2020 where it exhibited
 Tripathi et al. : Identification of a unique accession in cowpea with dense pubescence
dense pubescence on stem and both upper and lower
surface of the leaves (Fig. 2). Pubescence is measured
by counting number of trichomes on leaf. Younger
leaves exhibited higher pubescence (185.3±35.39 and
137.5±38.18, respectively) compared to mid-age
(163.7±36.94 and 132.4±38.91, respectively) and older
leaves (112.4±25.79 and 97.5±27.75, respectively).
Based on the study of distinct morphology and other
descriptor traits, EC762384 was identified as a unique
and rare accession.
Fig 1: Morphological characteristics of EC762384
Fig 2: Pubescence on the upper and lower surface of
cowpea leaves
Present work suggested that the trichomes in the
cowpea accession functioned as an adaptive trait (data
not produced). Presence of trichomes are reported to
increase tolerance towards freezing in plants. They
can help reduce evaporation by protecting the plant
from wind and heat (Serna and Martin, 2006). In many
cases, trichomes protect plants from herbivorous
insects by acting as a barrier for oviposition, mobility
and feeding on cowpea (Oghiake, 1995a). The length
and density of trichomes on the leaf surface and other
plant parts demonstrated a significant negative
correlation with percent damage (Nasiya and
Subramanian, 2019), mobility and survival of spotted
pod borer, Marucaspp. on cowpea (Oghiake, 1995b).
279
This opens further window to study the influence of
observed pubescence on the oviposition, feeding and
mobility of insect-pests infesting cowpea. In some
cases, if the trichomes are especially stiff or irritating,
they may protect a plant from herbivores. Additional
study is needed to determine if the trichomes are
responsible for any of the adaptive trait that can be
harnessed for cowpea improvement programme.
Characterization of the cowpea germplasm
accessions of NGB in the present investigation led to
the identification of germplasm accession EC762384
as a distinct potential donor for dense pubescence. It
is a unique and stable character consistently observed
over the years (kharif, 2019-2020 and 2020-2021) and
locations (NBPGR, Issapur farm, IIPR, Kanpur, UAS
Dharwad and UAS Bengaluru). The identified
accession could be further used in the hybridization
programme for various genetical studies and
development of cowpea varieties with high
pubescence. In addition, further studies may be
conducted to understand the role of trichomes in insect
tolerance and defence mechanism through
phenotyping under controlled conditions.
REFERENCES
Nasiya BAN and Subramanian M. 2019. Effect of trichomes
in cowpea on infestation by spotted pod borer, Maruca
vitrata (Fab.) (Lepidoptera: Crambidae). Journal of
Horticultural Sciences 14(1): 69-72.
Oghiakhe S. 1995a. Trichomes and resistance to major
insect pests in cowpea, Vigna unguiculata (L.)Walp.: a
review. Discovery and Innovation 9(3/4): 173-178.
Oghiakhe S. 1995b. Effect of pubescence in cowpea
resistance to the legume pod borer Maruca testulalis
(Lepidoptera: Pyralidae). Crop Protection 14(5): 379-
387.
Togola A, Boukar O, Belko N, Chamarthi SK, Fatokun C,
Tamo M and Oigiangbe N. 2017. Host plant resistance
to insect pests of cowpea (Vigna unguiculata L. Walp.):
achievements and future prospects. Euphytica 213(11):
239.
Tripathi K, Gore PG, Ahlawat SP, Tyagi V, Semwal DP,
Gautam NK, Rana JC and KumarA. 2019. Cowpea
genetic resources and its utilization: Indian perspective-
A review. Legume Research 42(4): 437-446.
Serna L and Martin C. 2006. Trichomes: different regulatory
networks lead to convergent structures. Trends in Plant
Science 11: 274-280.
Choudhary MD, Bharpoda TM, Sushmadeb and
Choudhary S. 2015. Screening of cowpea (Vigna
unguiculata) varieties against Callosobruchus chinensis
under storage condition. Journal of Food Legumes
28(2): 153-156.
 Journal of Food Legumes 33(4): 280-282, 2020

Commentary
Insight into virus disease challenges in food legumes in Genomic era
VG MALATHI

Dr. V.G. Malathi With more than 35 years of research experience on

Advanced Centre for Plant characterization, diagnosis, comparative and
Virology, functional genomics of whitefly transmitted
Division of Plant Pathology, geminiviruses infecting grain legumes, cotton and
ICAR-IARI, New Delhi tomato, Dr V.G. Malathi has developed and
deposited more than 100 full length genomic
clones of 20 begamovirus, one mastrevirus
Email: vgmalathi@rediffmail.com
deposited with the Clone Bank at Advanced Centre
for Plant Virology, IARI, New Delhi, developed
Partial tandem dimeric infectious constructs of 14
begamovirus and complete tandem repeat construct of one mastrevirus
deposited with Clone Bank at Advanced centre for Plant Virology, IARI,
and several RNA I constructs targeting the geminivirus rep gene, coat
protein and intergenic regions. She has to her credit more than 200 NCBI
sequence submissions and more than a hundred publications. She was
nominated as a Member in the Study Group on Geminiviruses in the
International Committee on the taxonomy of viruses (2010-2015). She is
also recipient of several awards like ICAR Best women scientist award
2010 and Khwarizmi International Award 2007, Islamic Republic of Iran
to name a few.

Food legumes have been cultivated from
time immemorial and constitute the most
valuable ingredient in vegetarian diet providing
full complement of proteins. They are cultivated
in both tropical and subtropical regions in
nearly 200 million hectares. Their adaptation
to diverse climatic conditions makes them more
vulnerable to biotic constraints, especially viral
diseases. From perusal of data available in
International Committee on Taxonomy of
Viruses (ICTV report, 2020) it is evident that
about 145 viruses belonging to 27 groups and
31 unclassified viruses naturally infect legumes.
The genome of legume viruses include positive,
negative and ambisense RNA, and both single
stranded and double stranded DNA viruses.
The puzzling phenomenon about legume
viruses is the contrast observed in their
distribution. While some viruses such as
Groundnut bud necrosis virus, Pigeonpea sterility
mosaic virus and whitefly transmitted yellow
mosaic viruses are endemic and occur only in
Asia, viruses like Bean common mosaic virus,
soybean mosaic virus and cucumber mosaic virus
are wide spread and infect wide range of
leguminous hosts worldover. Novel insights
gained in the turn of millennium on legume
viruses will be briefly discussed in this
communication.
Great advancements in next generation
sequencing and high throughput genotyping
technologies led to the establishment of
etiological agents of many devastating diseases.
The etiology of sterility mosaic disease remained
a mystery for well over 70 years despite
extensive efforts and finally the full genome was
revealed by deep sequencing of double-
stranded RNA preparations, from SMD-
affected genotype ICP8863 from ICRISAT-
Patancheru (India) and was shown to contain
five RNA segments (Elbeaino et al., 2014) The
virus was designated as new species, Pigeonpea
sterility mosaic virus (PPSMV). It had a very high
homology with European mountain ash ringspot-
associated virus (EMARaV), Fig mosaic virus
(FMV) and Rose rosette virus (RRV), members
 V.G. Malathi : Commentary: Insight into virus disease challenges in food legumes in Genomic era
grouped in the genus Emaravirus. Differential
reaction of pigeonpea genotypes across different
locations in India suggested probable
occurrence of several variants of PPSMV. Soon
it was resolved that in an another variant
(PPSMV 2) sequences corresponding to RNA-
3 and RNA-4 share less than 60% homology at
the nucleotide level with PPSMV1 and probably
could explain the differential response of
genotypes in Karnataka and Tamil Nadu (Patil
and Lavakumar, 2015). Deep sequencing of
RNA and small RNA led to discovery of arrays
of virome in legumes in wild eco system and
agrosystem . From a study on virome using NGS
in pea in Germany, thirty-five different viruses
were detected in addition to nine associated
nucleic acids. From these viruses, 25 are
classified as either new viruses, novel strains
or viruses that have not been reported
previously from Germany. One of the new
viruses was a member of Emaravirus (Gaafar,
et al., 2020). Similar studies in cowpea revealed
presence of new polerovirus in Burkino Faso,
new enamoviruses and rhabdoviruses in wild
legumes in different countries. In India
association of cowpea mild mottle virus was
demonstrated in leaf crinkle affected
blackgram. From NGS data the possibility of
multiple infection of the hosts by different
groups of viruses has been established.
However why only one or two viruses give rise
to symptom expression and others remain as
cryptic needs to be studied. It is essential that
at least few elite genotypes of legume hosts and
highly prevalent wild legumes in cultivation
area are subjected to NGS so that we are fully
geared up for any emergence of new diseases.
NGS also has opened up opportunities for
development and application of highly specific,
sensitive diagnostics which may help in robust
resistance screening.
The discovery of new virus group
Endornaviridae infecting wide range of
eukaryotes and crops such as rice, faba bean,
common bean and winged bean is another
interesting development. Endornaviruses are
naked single stranded positive sense RNA of 9
to 19 kb length, present in low copy number.
They are highly seed transmitted and
increasingly getting detected in many plants.
281
We may have to see how these RNA will
interfere with viral pathogenesis.
The grey area in legume virology is the
highest seed transmitted viruses recorded in
legumes. Despite high rate of transmission and
quarantine issues this problem has not been
addressed as intensely as it deserves to be. In
addition to RNA viruses, in recent years,
whitefly transmitted yellow mosaic viruses also
were shown to be seed borne. Even for RNA
viruses the mechanism of seed transmission,
movement of virus or virome from sperm
mother cells to embryo is not understood. For
example, Maule et al., (2003) suggested, that
discontinuities or pore like structures in the
suspensor sheath at the base of suspensor at
the endosperm- suspensor boundary may allow
the virus to pass through en route to the embryo.
They also hypothesized that at some point
symplastic movement may be taking place.
Using in situ hybridization labelling studies
sugar transporter proteins (SWEET) have been
studied in soybean and Arabidopsis. It is
demonstrated in Arabidopsis that there is
exchange of solutes between apoplast and
symplast whereby there is flow of nutrients from
mother cells to embryo. We should look for such
transporters in our legumes, characterize it and
see its interaction with viral movement proteins.
Management of viral diseases continue to
be enigmatic, as virus diversity, lack of genetic
variability and absence of robust protocols for
resistance screening specifically against one
virus. Exploitation of genetic resources,
deployment of resistance gene, use of molecular
diagnostics for detection are looked upon as
reliable strategy for mitigation of virus diseases.
In that direction valuable information have
been generated on the basis of genome
sequencing of soybean, chickpea, groundnut
and pigeonpea. Resistance genes conferring
resistance to sterility mosaic disease have been
characterized and markers developed and
introgression into elite cultivar is in progress.
The pathogen derived resistance approach
has been attempted either through coat protein
or si RNA. However till date only success story
is the genetically engineered bean cultivar
Olathe with hairpin construct targeting Rep
282 Journal of Food Legumes 33(4), 2020
gene of the the begomovirus Bean golden mosaic
virus. Very high level of resistance has been
observed in field even under mixed infection
with Bean common mosaic necrosis and Bean
rugose mosaic as RNA defense system of plants
have been triggered. Alternatively, the
approach gaining impetus is to identify host
factors facilitating replication and movement
of viruses, and try to knock them out. For
example eukarotic elongation factor (eEF1A)in
cowpea and soybean play a major role in
replication of soybean mosaic virus in soybean
and turnip mosaic virus in cowpea. Genome
editing of sequences by using artificial zinc
finger proteins would prevent the replication
of virus resulting in resistance.
Instead of transgenic route which is
difficult in legumes and time consuming,
spraying of double stranded RNA targeting
either viral sequence or proviral factors (spray
induced gene silencing, SIGS) is an emerging
new strategy. One interesting research showed
that about 73% reduction in symptoms was
achieved by delivering ds RNA constructs
against Asian rust through Bean pod mottle virus.
Molecular docking study of small
molecules of microbial or plant origin has
helped in identifying peptide aptamers, cationic
peptides that would destabilize assembly,
movement and replication of viruses.
Application of catinic peptide Melittin has
already been shown to work against Tomato
spotted wilt virus. With lot of hopes consortia of
microbes to trigger PAMP mediated immunity
are being developed
The legumes/viruses is a complex
biological system. In some cases both the hosts
and viruses are so confined to a region and
highly different that knowledge gained in other
systems cannot be applied directly. Perhaps this
exclusiveness also is advantageous as it opens
up plethora of opportunities to researchers. The
resilient nature of these crops combined with
knowledge on genomic resources and
innovative technologies like genome editing and
marker assisted selection of trait should help
us to improve productivity and sustainable food
security.
 Journal of Food Legumes 33(4): 283, 2020

Obituary

The Indian Society of Pulse Research and development (ISPRD), Kanpur, India, mourns
the sad demise of Prof. Dr. Sanjaya Rajaram who left for his heaven abode on Feb. 17, 2021 in
Mexico. Dr Rajaram was an Indian-born Mexican agricultural scientist and one of the most
renowned wheat breeders at the global level whose research efforts led to development of about
500 bread wheat varieties, released and cultivated in >50 countries all over the globe. These varieties
led to an increase in world wheat production by >200 million tons ensuring food and nutritional
security to millions of people.
A wonderful human being, an able
administrator and a researcher par excellence Dr.
Rajaram was an alumnus of ICAR - Indian
Agricultural Research Institute, New Delhi. He got
an honor to work with the global stalwarts, initially
with Prof. M.S. Swaminathan in India and
thereafter with Dr. Norman E. Borlaug at
CIMMYT, Mexico. He served CIMMYT for 33 years
including 7 years as the Director of ‘Global Wheat
Programme’ and later ICARDA as Director of
‘Integrated Gene Management’. He formally retired
from ICARDA in 2008 and still continued to work
for the greater cause of the humanity.
His outstanding contributions in scientific
research have been well recognized globally and
he was bestowed upon with numerous awards by
several governments. Government of India
recognized his contributions by conferring Padma Shri to him in 2001. He received the World
Food Prize in 2014, a coveted global recognition for his unparalleled contributions towards food
and nutrition security in a sustainable way.
Dr Rajaram had graced the International Conference on Pulses held in Kanpur in 2009 which
was organized by ISPRD and we have sweet memories of his evening lecture delivered on Feb. 14,
2009, which will never fade.
The entire ISPRD family prays for peace to his noble soul and may the almighty Lord bless all
his beloved ones with courage to bear this irreparable loss.
 Journal of Food Legumes 33(4): 284, 2020

List of Referees for Vol. 33(4)

List of Reviewers for Vol. 33(4)

1. Dr. Sanjeev Kumar, ICAR-RCER, Patna

2. Dr. S.S. Rathore, ICAR-IARI, New Delhi

3. Dr. V. Jayamani, TNAU, Coimbatore

4. Dr. E. Rajeswari, CRS, Aliyarnagar

5. Dr. C.P. Nath, ICAR-IIPR, Kanpur

6. Dr. Gaurav K Taggar, PAU, Ludhiana

7. Dr. Shayla Bindra, PAU, Ludhiana

8. Dr. Uma Sah, ICAR-IIPR, Kanpur

9. Dr. S.K. Chaturvedi, RLBCAU, Jhansi

10. Dr. Asmita Sirari, PAU, Ludhiana

11. Dr. Abhishek Sharma, PAU, Ludhiana

12. Dr. Shantanu Dubey, ICAR-ATARI, Kanpur

Proof Readers for Vol. 33(4)

1. Dr. Shanmugavadivel P.S., ICAR-IIPR, Kanpur

2. Mr. Sudhir Kumar, ICAR-IIPR, Kanpur

3. Dr. A.K. Srivastava, ICAR-IIPR, Kanpur

4. Dr. C.P. Nath, ICAR-IIPR, Kanpur