Volume 35 | Number 1 | January-March, 2022

Journal of
FOOD LEGUMES
An Ofcial Journal of Indian Society of Pulses Research and Development (Registration No. 877)
ISSN: 0970-6380; Online ISSN: 0976-2434

The Indian Society of Pulses Research and Development (ISPRD) was founded in April 1987 with the following
objectives:
• To promote research, development and extension activities in pulses
• To facilitate close association amongst pulse workers nationally and internationally
• To publish “Journal of Food Legumes”, a quality research journal of the Society
Membership: any person interested in pulses research and development is eligible for membership of the Society
by becoming ordinary, life or corporate member by paying respective membership fee as detailed below:
Membership Fee Indian (Rs.) Foreign (US$)
Ordinary (Annual) 500 40
Life member 5000 400
Admission Fee 50 10
Libarary/Institute 5000 400
Corporate Member 7500 –
Contribution to the Journal, except in case of invited articles, is open to the members of the society only. Any
non-member submitting a manuscript will be required to become at least an annual member. Members will be
entitled to receive the Journal and other communications issued by the Society. Renewal of the subscription is due
in January each year. If the subscription is not received by February 15, the membership will stand cancelled and
can be revived by paying readmission fee of Rs. 50/-. The membership fee will be paid through online bank
transfer as per given details:
Account Holder’s name: INDIAN SOCIETY OF PULSES RESEARCH AND DEVELOPMENT
Name of the Bank: Union Bank of India
Address: Kalyanpur-Kanpur 208024
Account No.: 349502010003620
IFSC Code: UBIN0534951
Communication regarding transfer of membership fee alongwith the transfer receipt should be communicated
to Secretary, ISPRD, ICAR-Indian Institute of Pulses Research, Kanpur-208024, India at secretary.isprd@gmail.com.

EXECUTIVE COUNCIL 2020-2023

Chief Patron
Dr Trilochan Mohapatra
Patron Co-Patron
Dr TR Sharma Dr Shiv Sewak
President: IP Singh, ICAR-IIPR, Kanpur
Vice-President: Rajeev Varshney, ICRISAT, Hyderabad
Secretary: Aditya Pratap, ICAR-IIPR, Kanpur
Joint Secretary: CS Praharaj, ICAR-IIPR, Kanpur
Treasurer: DR Mishra, ICAR-IIPR, Kanpur
Councilors
AK Srivastava, ICAR-IIPR, Kanpur; Ravinder Singh, PAU, Ludhiana; C. Bharadwaj, ICAR-IARI, New Delhi;
Mudalgiriyappa, GKVK UAS, Bengaluru; S.S. Punia, CoA, Bharatpur, Rajasthan; RP Singh, RAK College, Sehore
Editor-in-Chief
Meenal Rathore
ICAR-Indian Institute of Pulses Research, Kanpur, India
Editorial Board
SK Sharma, Palampur, India; Pooran Gaur, ICRISAT, Hyderabad, India; Nguyen, Henry T, Columbia, USA; Suk-Ha Lee,
Seoul, Korea; Kadambot Siddique, Perth, Australia; Shiv Kumar, ICARDA, Morocco; Ramakrishnan Madhavan Nair,
WorldVeg, Hyderabad, India; Liao Boshou, China; Sushil Chaturvedi, Jhansi, India; AR Sharma, Jhansi, India; Jayamani
P, Coimbatore, India; PS Basu, Kanpur, India; Jitendra Kumar, Kanpur, India; Dinesh Yadav, Gorakhpur, India; Harsh K
Dikshit, New Delhi, India; A Amarender Reddy, Hyderabad, India; Uma Sah, Kanpur, India; Mohd. Akram, Kanpur,
India; Gaurav K Taggar, Ludhiana, India; ; Sanjay Singh Rathore, New Delhi, India; Narendra Kumar, Kanpur, India;
Prasoon Verma, Kanpur, India; Om Gupta, Jabalpur, India; Awnindra K. Singh, Kanpur, India; Vikas Singh, Varanasi,
India; Manoj K. Tripathi, Bhopal, India, Alok Das, Kanpur, India; Rajan Katoch, Palampur, India; N. Manivannan,
Coimbatore, India
 Journal of
FOOD LEGUMES
An Ofcial Journal of Indian Society of Pulses Research and Development
ISSN: 0970-6380; Online ISSN: 0976-2434

Vol. 35 (1) January - March, 2022

Content
CURRENT AFFAIRS
1. Elucidating Diversity of Transcription Factors to Develop Stress-Tolerant Crops: 1
An Overview
Dinesh Yadav

RESEARCH PAPERS
2. Trait associations and diversity analysis based on quantitative traits under moisture stress 3
conditions in chickpea (Cicer arietinum L.)
S K Jain, Gayacharan, LD Sharma, KC Gupta, RS Sharma, Vipin Kumar, Neeta Singh,
Sushil Pandey, Girish P Dixit, Ashok Kumar
3. Assessment of traits association and genetic divergence in a diverse panel of eldpea 11
(Pisum sativum L.) genotypes
Theint Theint Tun, Ravika, Rajesh Yadav and Seema Kamboj
4. A combined selection approach using modied multivariate analysis for identication of 17
fast cooking beans (Phaseolus vulgaris L.) based on seed physical parameters
Parvaze A. So, Sajad Majeed Zargar, Sujeela Rani, Samreen Fatima, Sadiah Sha, Aaqif Zaffar and
Ramsha Khalid
5. Identication and characterization of oxalyl-CoA synthetase gene (LsAAE3) in grasspea 27
(Lathyrus sativus L.)
Neetu Singh Kushwah, Shanmugavadivel P.S., Alok Das, Meenal Rathore, Archana Singh and
Narendra Pratap Singh
6. Identication and validation of new sources of resistance for Mungbean Yellow Mosaic India 41
Virus in urdbean [Vigna mungo (L.) Hepper]
Mohammad Akram, Naimuddin, Debjyoti Sen Gupta, Sanjeev Gupta, PK Katiyar, AK Singh and
NP Singh
7. Population dynamics of major insect-pests of lentil and correlation with abiotic factors 47
Dilbag Singh Ahlawat, Tarun Verma and Rajesh Yadav
8. Biologically effective dose of sodium aciuorfen + clodinofop-propargyl applied as post 51
emergent for weed management in greengram
Mudalagiriyappa, KR Shyamasundar, Pratima Ningaraddi Morab and Subhash Sannappanavar
9. Effect of weed management and sulphur levels on weed density, nutrient depletion and 58
productivity of cluster bean [Cyamopsis tetragonoloba (l.) Taub]
RK Yadav, SL Mundra, Santosh Devi Samota and SL Yadav
10. Growth, instability and decomposition analysis of lentil production in India 65
Hemant Kumar, Devraj Mishra and Uma Sah

SHORT COMMUNICATION
11. Identication of transgressive segregants for yield and earliness in blackgram 68
[Vigna mungo (l) Hepper]
A Kavitha Reddy, DM Reddy, Lakshminarayana R Vemireddy, P Sudhakar and BV Bhaskara Reddy
12. Tillage and weed management effects on yield performance of chickpea (Cicer arietinum) 71
grown after sorghum (Sorghum bicolor)
Tony Manoj Kumar N and AR Sharma

COMMENTARY
13. Innovative approach to further genetic gain in pulses 76
PS Basu

List of Referees for Vol. 35 (1) 78

 Journal of Food Legumes 35(1): 1-2, 2022

Current Affairs

Elucidating Diversity of Transcription Factors to Develop Stress-

Tolerant Crops: An Overview
Dinesh Yadav
Department of Biotechnology With more than 21 years of experience in research
D.D.U. Gorakhpur University,
Gorakhpur (U.P.) 273009 and teaching, Professor Dinesh Yadav holds
specialization in molecular biology,
*E-mail: dinesh_yad@rediffmail.com bioinformatics, plant biotechnology, and enzyme
technology. Presently he is working on Plant
specic transcription factor-DOF (DNA binding
with one nger) and Nuclear Factor-Y (NF-Y) for
developing biotic and abiotic stress tolerance crops
and pectinases group of enzymes with potential
applications in different industries. He has served
as Head, Department of Biotechnology, D.D.U. Gorakhpur University
and as Associate Professor in the Department of Molecular Biology and
Genetic Engineering at G.B Pant University of Agriculture and
Technology, Pantnagar. He has availed DST-BOYSCAST Fellowship at
Australian Centre for Plant Functional Genomics (ACPFG), University
of Adelaide, South Australia. He is also recipient of Dr. Pushpendra
Kumar Gupta Vishisht Krishi Vaigyanik Puraskar-2015 in the eld of
Agricultural Sciences by Uttar Pradesh Academy of Agricultural
Sciences (UPAAS), Lucknow, and Young Scientist Award-2008 by
Uttarakhand State Council of Science & Technology in the discipline
Biotechnology, Biochemistry, and Microbiology. With more than 130
research publications to his credit and more than 230 GenBank accession
numbers, he has guided 12 doctorate students and mentored DST and
SERB fellows. Currently, he is the Coordinator of Centre for Genomics
and Bioinformatics and Nodal ofcer IPR cell, DDU Gorakhpur
University. His areas of specialization include Molecular biology,

Over the years agriculture has witnessed several
technological innovations to achieve the goal of global
food and nutritional security. The omics-driven
research has substantially inuenced the pace of
traditional plant breeding approaches for crop
improvement and several varieties with desired traits
are being developed. Plant genome sequences have
revealed a large complement of transcription factors
(TFs) genes accounting for more than 6% of the total
ESTs. Transcription factors (TFs) are sequence-
specic DNA-binding proteins playing a signicant
role in the regulation of diverse genes by targeting
unique DNA sequences known as cis-elements
present in the gene promoters. The variability among
transcription factors is due to different DNA binding
domains. Several families of TFs exist, some of which
are ubiquitously observed in all eukaryotic systems
while many of them are plant-specic with unique
DNA binding domains. Families of TFs
predominately observed in plants are zinc ngers,
DNA binding with One Finger (DOF), basic-region
leucine-zipper (bZIP), basic-region helix-loop-helix
(bHLH), MYB, NAC, MADS-box, HMG-box, AP2/
EREBP, and WRKY family. Engineering of
transcription factors is preferred because a single TF
can control the expression of many downstream genes
by binding to the cis-acting element in the promoters
of the many target genes. The diversity of TF families
across eukaryotes especially in plants is a matter of
systematic research to harness the immense potential
for developing tolerant crops. These TF genes are
essential for controlling plant development processes
2 Journal of Food Legumes 35 (1), 2022

and responses to the environment, including As FAO statistics, nearly 20,000 species of legumes
functions that have a key role in agronomy. It is (Fabaceae) make up the third-largest family of
associated with several functions like morphology, angiosperms with varied morphology and ecology. In
inorescence/ower formation, reproduction, addition to their symbiotic relationship with specic
embryogenesis, fruit development, and ripening, diazotrophic bacteria, legumes exhibit interesting
plant morphology, organ development, senescence, ecological and agricultural properties. Several studies
signaling, metabolism, and abiotic and biotic stress elucidating the potential role of TF genes in
responses. Each of the transcription factors has developing biotic and abiotic stress tolerant legumes
different promoter recognition sequences. The action have been reported recently. At present, 20 legume
of TFs can be seen by binding their target site within genomes are accessible, containing many TF genes.
the promoter region, which has cis-acting elements for The role of many of the TFs like Dof, WRKY, NF-Y,
desired traits. The binding of TFs can initiate the HSF, and NAC for biotic and abiotic stress tolerance is
formation of complexes that show various types of being studied. A list of available TFs observed in
responses, viz., physiological, biochemical, and different legume genomes is depicted in Fig. 1.
molecular responses. The stress-responsive TFs Keeping in view of the enlisted transcription factor of
inuence the expression of several genes associated seven legumes, transcription factor families like Zinc-
with biotic and abiotic stresses by a cascade of events nger, Dof, WRKY, MYB, NAC, and NF-Y seems to
as shown in Fig.1. The receptors present on the have immense potential for developing abiotic stress-
membrane recognize the signals of different stresses tolerant crops.
and are modulated in the presence of several Identied Transcription factor in legumes

intracellular elements like ROS (Reactive oxygen 1800

1600

species), phytochrome, phosphatase, Ca+2, and 1400

protein kinase. The presence of phytohormones 1200

1000

coordinates the signal transduction pathway which 800

culminates with either upregulation or 600

400

downregulation by binding specic TFs to cis- 200

elements of stress-responsive genes. 0

A
n)

n)
D
P1
B

n)

IP
S

S
C

AT
X

SF

F
LH

of
AT
EB

A
PH
Y

R
(Z

(Z
A

O
K
(Z

BZ

D
V

H
A

R
M

G
N
bH

EB
R

G
3/
R

n)
2

PE
M

G
C

C
W

2H
BI
-E

n)
H

(Z
M

Y
C

A
P2

(Z
C

-T

2
C

2C
H
A

2
3H

2C
n/

C
ai

C
m
do
eo
om

tic
Bio ress es,
H

Medicago truncatula Lotusjaponicus Glycine max Arachis duranenis Arachis ipaenis Cajanus cajan Cicer arietinum
St rob s Abiotic Stress
ic se
( isea sects)
M
D In
(Foods, Drought, Fig. 1. Diversity of transcription factors in legumes based
d Heat, Cold, salinity,
an Minerals etc. on available TF databases.
Receptor
mbra
ne The diversity of these TFs gene families in plants
Me
sma
Pla
is deciphered using bioinformatics tools and genome-
Phytohormones
CAM ROS Phytochrome wide prediction, identication, structural and
functional characterization of several TFs gene
MAPKs CIPKs

PPs CDPKs families in different crops have been reported. These

s NAC NF-Y
serve as important resources for its utilization in crop
cleu HSF 2F
Nu
MYB DOF
improvement especially for stress tolerance using
WRKY
DREB
bZIP approaches like transgenic, genome-editing, and
Metabolism, oxidative
TF binds at
promoter
damage, Fe+2 & H2
blancing
RNAi silencing.
Stress resistant plant

Transcription of stress
response gene begins
ACKNOWLEDGEMENT
Schematic representation of the general mechanism Figure made by Ph.D. Scholar Varsha Rani is
revealing the role of stress-responsive transcription factors.
duly acknowledged.
 Journal of Food Legumes 35(1): 3-10, 2022

Trait associations and diversity analysis based on quantitative traits

under moisture stress conditions in chickpea (Cicer arietinum L.)
1 2 1 1 1 1
S K Jain *, Gayacharan , LD Sharma , KC Gupta , RS Sharma , Vipin Kumar ,
Neeta Singh2, Sushil Pandey2, Girish P Dixit3, Ashok Kumar2

1
Rajasthan Agricultural Research Institute
(RARI), SKNAU, Durgapura, Jaipur,
India 302018, 2Division of Germplasm
Evaluation, ICAR-NBPGR, New Delhi,
India 110012, 3ICAR-Indian Institute of
Pulses Research, Kanpur, India 208017
*E mail: skjain.pbg.coalalsot@sknau.ac.in
Received: 14 February, 2022
Accepted: 20 April, 2022
Handling Editor:
Dr P.Jayamani, TNAU, Coimbatore
ABSTRACT
Two hundred and sixteen genotypes of chickpea were evaluated to
assess the genetic diversity for various agronomic traits. The study
revealed that all the genotypes were signicantly different for the traits
and a wide range of variability exists for most of the traits. Correlation
studies exhibited that seed yield had positive signicant correlation
with 100-seed weight, number of branches per plant and number of pod
per plant. Cluster analysis classied 216 genotypes into 10 distinct
groups. A large number of genotypes (51) were placed in cluster IV
followed by cluster I with 45 genotypes. The maximum inter-cluster
distance was observed between clusters V and X indicating the
possibility of high heterotic effect if the individuals from these clusters
are cross-bred. Principal component analysis yielded 12 eigen vectors
and PCA analysis revealed signicant variations among traits with ve
major principal components explaining about 75.58 per cent of
variations. The estimates of eigen value associated with the principal
components and their respective relative and accumulated variances
explained 41.95 per cent of total variation in the rst two components.
The characters with highest weight in component rst were root weight,
root girth, number of seeds per pod, seed yield per plant, number of pods
per plant, plant height and number of primary branches which
explained 25.08 per cent of the total variance. The results of principal
component analysis were closely in line with those of the cluster
analysis. On the basis of inter cluster distances, cluster means, per se
performance observed in the present study the four genotypes viz.,
IC407968, IC408198, ICC3498 and EC538477 were found to be superior
and can be used as a potent parents for improvement of seed yield in
chickpea.
Key words: Correlations, Diversity, Euclidean cluster distances, Principal
component analysis

INTRODUCTION a leading role in food safety in the world by covering

Chickpea (Cicer arietinum L.) belongs to the sub-
family Papilionaceae of family Leguminoceae and is an
important and unique food legume. It is a self-
pollinated crop with a genome size of 740 Mbp
(Arumuganathan and Earle, 1991). It is native to the
Mediterranean region and the Middle East. It is
occupying third position amongst pulses over the
world and grown in more than 44 countries
representing all the continents for its nutritious seeds.
Its seeds are rich in bre and protein and are a good
source of iron, phosphorus and folic acid and playing
the decit in proteins of daily food ration of Indian
and African Sub Sahara populations (Merga and
Jema, 2019). In India the area under chickpea is 9.44
million hectares with 10.13 million tons of production
and 1073 kg/ha of productivity (Anonymous, 2019).
Major chickpea producing states in India are Madhya
Pradesh, Uttar Pradesh, Rajasthan, Uttrakhand,
Gujarat, Haryana, Punjab and Maharashtra. In
Rajasthan, the area under chickpea cultivation is 2.37
million hectares with the production of 2.83 million tons
and productivity of 1192 kg/ha (Anonymous, 2021).
4 Journal of Food Legumes 35 (1), 2022

Recent plant breeding practices have narrowed
genetic base of cultivated chickpea. However,
characterization of newly developed genotypes for
economic traits will assist in the development of
superior cultivars (Naveed et al. 2015). Continuous
efforts are required to increase the production and
productivity of chickpea using diverse and exotic
sources. Crop improvement depends immensely on
the availability of diverse materials and their judicial
utilization. Therefore, present investigation was
undertaken to assess the genetic components and trait
associations in diverse set of chickpea genotypes for
their utilization in crop improvement programmes.
MATERIAL AND METHODS
Source of chickpea germplasm
A total of 216 accessions of chickpea which were
the part of chickpea core collection were selected for
this study (Archak et al. 2016). The germplasms were
obtained from Indian National Genebank, ICAR-
National Bureau of Plant Genetic Resources, New
Delhi. The chickpea germplasm consists of 165
accessions of Indian origin, 49 accessions of exotic
origin and two local popular release varieties RSG 963
and RSG 888.
Experiment site selection and experimental design
The experiment was conducted at experimental
farm, Rajasthan Agricultural Research Institute,
Durgapura, Jaipur. The location falls under semi-arid
northern plains with latitude of 26.50° North and
longitude of 75.47° East having altitude of 450 meters
above msl. The soil texture of the experimental eld
was sandy loam which is suitable for exposing low
moisture stress conditions in chickpea. The
experiment was laid out in augmented block design
(ABD) using two local adapted popular drought
tolerant chickpea varieties i.e., RSG963, and RSG888
which were replicated in each of the eight blocks to
assess experimental error. Moisture content in the soil
was observed at the time of sowing (12.2 %), 30 days
after sowing (10.2%), 60 days after sowing (8.4%), 90
days after sowing (6.2%) and 120 days after sowing
(6.3 %). Irrigation was skipped during all growing
period for maintain the water decit condition in the
crop but 18 mm rain received at the time of maturity
(II fortnight of march).
Observations recorded
Each accession was grown in single row of four
meter length and inter and intra row spacing were
kept at 30 cm and 10 cm, respectively. The
recommended packages of practices were followed to
raise the healthy crop. After eliminating the border
plants, observations were recorded on ve randomly
chosen plants for 12 quantitative drought responsive
traits viz., days to 50 per cent owering, days to
maturity, plant height (cm), number of primary
branches/plant , number of secondary
branches/plant, number of pods/plant, number of
seeds/pod, 100 seed weight (g), seed yield/plant (g),
root length (cm), root girth (cm) and root weight (g).
Statistical analysis
Analysis of variance (ANOVA) for augmented
design was performed for all traits using statistical
software SAS, version 9.3 (SAS, 2012). D2 analysis,
principal component analysis (PCA) and hierarchical
cluster analysis was done by using statistical software
XLSTAT version 2021.4 (XLSTAT, 2021). Correlation
coefcients were estimated to determine the level of
interrelationship between all pairs of traits using the
method given by Singh and Chaudhary (1979).
RESULTS AND DISCUSSION
Analysis of variance for quantitative traits
showed the signicant differences among the
genotypes for all the quantitative traits. This indicates
that sufcient amount of variability was present
among the genotypes for all quantitative traits.
Correlation analysis
Phenotypic correlation coefcients among the 12
quantitative traits were estimated (Table 1). Days to 50
per cent owering showed positive signicant
correlation with days to maturity, root length and 100-
seed weight while negative for primary branches per
plant, secondary branches per plant, pods per plant,
root weight, root girth and seed yield per plant.
Similarly, days to maturity had signicant positive
correlation with seeds per pod, root length, while
negative signicant correlation with plant height,
pods per plant and seed yield per plant. Primary
branches per plant had positive correlation with
number of pods per plant, root girth and seed yield
per plant. Secondary branches per plant had positive
correlation with root length while negative signicant
correlation with seeds per pod and root girth. Number
of pods/plant had signicant positive association
with seed yield per plant, root length, 100-seed weight
and seed yield per plant. Root length had positive
signicant correlation with root girth. Seed yield per
plant exhibited highly signicant positive correlation
 Jain et al.: Association and diversity analysis in chickpea 5

Table 1. Phenotypic correlation among different yield contributing traits in chickpea

Traits DF DM PH PB SB PP SP RL RW RG SW SY

DF 1.000 0.816** -0.100 -0.213* -0.238* -0.393** -0.138 0.503** -0.329** -0.248** 0.194* -0.380**
DM 1.000 -0.382** -0.032 0.038 -0.484** 0.263** 0.469** 0.079 0.163 -0.058 -0.619**
PH 1.000 -0.066 -0.014 -0.118 -0.158 -0.096 -0.030 0.137 -0.579** -0.585**
PB 1.000 0.101 0.440** -0.006 -0.290** 0.014 0.307** -0.166 0.451**
SB 1.000 0.168 -0.520** 0.465** -0.148 -0.313** 0.081 0.032
PP 1.000 0.164 0.351** -0.288** -0.373** 0.491** 0.628**
SP 1.000 -0.220 -0.743** -0.686** -0.184 -0.144
RL 1.000 -0.016 0.215* -0.581** 0.032
RW 1.000 -0.910** 0.308** -0.138
RG 1.000 0.504** -0.114
SW 1.000 0.316**

* &** Signicant at 5% & 1% respectively, DF: days to 50 per cent owering; DM: days to maturity; PH: plant height (cm); PB: number of
primary branches/plant; SB: number of secondary branches/plant; PP: number of pods/plant; SP: number of seeds/pod; SW: 100 seed
weight (g); SY: seed yield/plant (g); RL: root length (cm);,RG: root girth (cm) and RW: root weight (g)

with primary branches per plant, number of pods per
plant and 100-seed weight, while signicant negative
correlation with days to 50 per cent owering, days to
maturity and plant height. The strong positive
correlation of seed yield per plant with 100 seed-
weight, number of branches per plant, number of
pods per plant,has previously been reported in
chickpea (Borate and Dalvi 2010; Dawane et al. 2020;
Jain et al. 2020). It suggests the possibilities of
improving seed yield per plant by simultaneous
improvement of these characters. Therefore, due
emphasis is to be paid on above mentioned traits for
improving the productivity during selection.
Diversity and Cluster analysis
genotypes within these clusters. With regard to inter
cluster distance, the cluster V and cluster X were most
diverse with each other as distance between them was
78.00. It can be inferred that crossing between these
genotypes (EC267224, ICC4213, IC408040, ICC4250,
EC267263, EC555273, IC408004, IC408075, ICC5980,
IC486755, IC587352, IC407968, IC408198, ICC3498 and
EC538477) may result in good recombinants for
successful breeding programme.
As indicated by inter cluster values, the cluster I
and cluster II were closest (15.62) which revealed that
those genotypes were not very distant. Several
350

Euclidean cluster distances on the basis of 300

Ward's method (Ward 1963), the 216 chickpea
genotypes were grouped into 10 clusters. For the ease 250
Eucllidian's dissimilarity

of presentation of genotypes through two way

200
dendogram using Ward's method (Ward, 1963) (Table
2 & Fig. 1). Cluster IV consisted of maximum number 150
of genotypes (49) followed by cluster I (45) and cluster
II (36) while minimum number of genotypes were 100

observed in cluster X which consisted four genotypes

50
Intra-cluster distance was highest in cluster X (22.49)
followed by cluster VII (20.22), cluster VIII (15.46), 0
cluster IV (14.53) and cluster VI (14.35) (Table 3). The
high intra cluster distance values revealed the
presence of genetic diversity between the genotypes Fig. 1. Agglomerative hierarchical clustering of chickpea
which were grouped together in those clusters. Hence, germplasm using Ward's method and Euclidian
there is a lot of scope for exchange of genes among dissimilarity matrix.
 6
Table 2: Distribution of 212 genotypes of chickpea in to different clusters and their mean values
Cluster Number of Name of germplasm DF DM PH PB SB PP SP RL RW RG SW SY
Genotypes

I 45 IC76623, IC552192, IC372345, IC209235, IC272456, IC486303, 70.16 125.67 44.18 2.21 7.21 26.74 1.97 23.86 3.58 1.55 17.36 11.40
IC275448, ICC6410, IC269280, IC83811, EC382406, IC305498,
IC486329, C272459, IC48448, IC9181, IC589273, C223489,
EC555405, IC270928, IC44204, IC269439, RSG888, IC32767654,
IC487344, IC487431, IC244245, IC275501, IC269378, IC272252,
IC274100, IC468642, IC223122, IC271700, IC418133, IC24608,
IC587352, RSG963, IC487426, IC486744, IC408259, IC41651,
IC327529, EC498756, IC487243
II 36 EC220084, IC268882, EC220087, IC328047, IC272499, IC269161, 77.61 128.36 41.49 2.18 5.89 29.14 1.56 25.39 3.16 1.51 14.11 7.32
IC486919, EC267318, IC269473, IC270707, IC272303, IC275505,
IC269210, IC468615, IC486816, IC244324, IC7887, IC468742,
IC275500, EC223122,EC555702, IC83999, IC468785, IC486058,
EC555548, EC555720, IC485688, IC486809, IC269360, IC272503,
EC441990, IC486925, EC538490, IC485969, ICC5776, IC117350
III 7 IC268895, IC255447, IC275775,IC299163, IC552202, EC54381, 73.43 127.29 42.43 2.10 5.83 32.29 1.36 23.74 3.16 1.35 34.40 11.38
IC297322
IV 49 IC95174, IC270867, IC269603, IC331552, IC272278, IC408182, 64.57 119.45 40.75 2.35 5.52 32.22 2.04 23.65 4.04 1.98 14.38 9.45
EC267437, IC328026, IC270846, IC272401, EC498771, IC269271,
IC305613, IC117677, IC244423, IC272362, IC333208, IC327349,
IC506739, IC118913, IC270422, IC552170, IC209613, ICC6485,
ICC7745, IC408161, IC328146, IC408212, EC547382, ICC1198,
ICC2682, IC305442, IC372332, IC251700, IC486253, IC244595,
IC485669, IC269628, IC269743, IC269374, IC328058, IC328261,
IC551980, IC270805, ICC6025, EC538493, ICC7316, IC305519,
ICC8517
V 11 EC267224, ICC4213, IC408040, ICC4250, EC267263, EC555273, 56.09 113.91 39.57 2.26 6.34 31.02 1.48 25.66 2.98 1.41 14.64 6.73
IC408004, IC408075, ICC5980, IC486755, IC587352
Journal of Food Legumes 35 (1), 2022

VI 11 IC244398, IC269759, IC486999, IC305593, IC244263, IC273434, 72.36 126.27 49.89 3.46 8.68 31.20 1.91 24.46 4.32 1.55 19.16 13.83
IC270739, IC56780, IC27627, IC51206, IC272642
VII 10 IC251811, IC538501, IC486734, ICC3714, ICC10825, IC244651, 59.00 116.30 44.57 2.88 6.60 22.23 1.85 26.21 4.55 1.99 30.58 14.57
IC244241, IC24484, IC46885, IC56758
VIII 23 EC219981, IC272496, IC269122, EC267160, EC441855, IC551995, 77.04 128.00 44.89 2.40 6.07 39.15 2.40 25.63 4.98 2.52 14.54 13.46
IC269053, IC269404, IC269467, IC275490, IC506934, IC272399,
IC305487, IC490046, IC486965, EC223457, EC441827, IC117651,
IC373430, IC551991, IC209243, IC486697, IC486462
IX 20 IC244317, EC267174, EC412984, EC442055, IC299185, IC487199, 79.85 130.85 40.57 2.39 6.58 53.26 2.03 23.37 4.01 1.98 12.98 14.29
IC485912, IC395468, IC486882, IC271292, EC442024, ICC3178,
IC512099, EC442098, EC528347, IC487196, IC486219, IC486501,
IC487504, IC589275
X 4 IC407968, IC408198, ICC3498, EC538477 71.50 126.00 43.05 2.13 6.25 68.50 2.33 28.05 4.66 2.33 27.30 43.02

DF: days to 50 per cent owering; DM: days to maturity; PH: plant height (cm); PB: number of primary branches/plant; SB: number of secondary branches/plant; PP: number of
pods/plant; SP: number of seeds/pod; SW: 100 seed weight (g); SY: seed yield/plant (g); RL: root length (cm);,RG: root girth (cm) and RW: root weight (g)
 Jain et al.: Association and diversity analysis in chickpea 7

Table 3. Inter-Intra cluster distances in chickpea genotypes

Clusters I II III IV V VI VII VIII IX X

I 9.28 15.62 21.95 16.69 19.98 21.03 27.91 25.87 18.07 55.33
II 13.53 23.44 23.26 22.69 31.43 40.62 34.65 21.71 70.42
III 11.94 33.04 29.26 36.28 33.03 47.85 33.64 63.79
IV 14.53 21.21 29.95 28.06 24.59 22.14 57.79
V 10.15 37.10 32.81 47.48 35.56 78.00
VI 14.35 29.62 31.92 27.20 60.04
VII 20.22 37.35 40.69 55.50
VIII 15.46 20.37 45.70
IX 12.15 45.78
X 22.49

authors have suggested that the crossing between the different cluster has been reported by earlier workers
genotypes of clusters with high inter cluster would (Vishnu et al. 2020, Dar et al. 2020, Reddy et al. 2021).
yield good segregates for selection (Parsi et al. 2013;
Per cent contribution of characters towards
Jakhar et al. 2016; Dar et al. 2020). The best combination
divergence was analyzed and it was found that
of parents for improvement in various characters can
number of pods per plant was the maximum
be recommended on the basis of per se performance of
contributor towards divergence (49.41%) followed by
the genotypes and inter cluster divergence. It means
days to 50 per cent owering (23.65%), plant height
the overall genetic similarity found in the germplasm
(10.40), 100-seed weight (9.40%), %), seed yield/plant
was presented within the cluster. The pattern of
(3.00 %), days to maturity (2. 32 %) and root length
distribution of genotypes in different clusters
(1.67%). The traits primary and secondary branches
exhibited that geographical diversity was not related
per plant, seeds per pod, root girth and root weight
to genetic diversity as genotypes of same geographical
contributed least for genetic divergence (Fig. 2).
region were grouped into different cluster and vice-
Kumar et al. (2018) observed that the characters
versa, as supported by earlier ndings (Agrawal et al.
viz.,100 seed weight, number of pods per plant, days
2018; Kumar et al. 2018). Based on mean performance
to 50% owering, plant height and seed yield
of 12 characters, cluster IV exhibited higher seed yield
contributed more towards divergence. Reddy et al.
(43.02 g/plant). It contained genotypes having
medium maturity, higher number of pods/plant, Per cent contribution of different characters to genetic
higher 100 seed weight and superior root traits. This diversity

cluster consisted of four genotypes viz., IC407968, RL

RW RG
SY
3%
1% 0%
IC408198, ICC3498 and EC538477. Early maturing SP 2%
SW DF
0%
genotypes were found in cluster V (EC267224, 9% 23%
DM
ICC4213, IC408040, ICC4250, EC267263, EC555273, 2%
PH
IC408004, IC408075, ICC5980, IC486755, IC587352) 10%
PP
and VII (IC251811, IC538501, IC486734, ICC3714, 49%
ICC10825, IC244651, IC244241, IC24484, IC46885, PB

IC56758). Higher primary and secondary branches SB 1%

were found in cluster VI (IC244398, IC269759,
IC486999, IC305593, IC244263, IC273434, IC270739,
IC56780, IC27627, IC51206 and IC272642). These
genotypes were also found better for one or two other
yield traits also. Genotypes from clusters which had
more inter-cluster distance and contrast in mean
values could be crossed for creation of maximum
variability for effective selection of transgressive
segregants. The grouping of chickpea genotypes in
0%
DF: days to 50 per cent owering; DM: days to maturity; PH: plant
height (cm); PB: number of primary branches/plant; SB: number
of secondary branches/plant; PP: number of pods/plant; SP:
number of seeds/pod; SW: 100 seed weight (g); SY: seed
yield/plant (g); RL: root length (cm);,RG: root girth (cm) and
RW: root weight (g)
Fig. 2. Per cent contribution of different characters to
genetic diversity in chickpea
8 Journal of Food Legumes 35 (1), 2022

(2021) observed that number of pods per plant, seed attribute characteristics. The purpose of the PCA is to
yield per plant and plant height, contributed high in identify the minimum number of components, which
relation to genetic divergence. The diversity analysis can explain the maximum variation from the total
thus proved to be a very useful technique in isolating variation based on the PC scores.
diverse groups from the germplasms under study.
The rst principal component (PC1) showed
Principal Component Analysis (PCA) high positive loading for root weight (0.842), root girth
(0.828), number of seeds per pod (0.795), seed yield per
In principal component analysis, the variance-
covariance matrix was used to transform all the Biplot (axes PC1 and PC2: 41.96 %)
quantitative attributes into a single index of similarity
in the form of principal component, which yielded 12
eigen value for 12 eigen vectors but, here discussed
only ve eigen vectors which showed eigen values
more than 1 (Table 4). A biplot plot (Fig. 3) between
eigen values and principal component was

PC2 (16.87 %)
constructed to illustrate results and also to summarize
the involvement of principal components (PCs).
Maximum variation was present in PC1 with
maximum eigen value of 3.010 followed by PC2
(2.025), PC3 (1.692), PC4 (1.303) and PC 5 (1.040).
These rst ve PCs showed 75.58 per cent variability
and important for the further explanation. The PC1
explained total variation 25.08 per cent followed by
respectively among the genotypes for the traits under
study. PC1, PC2 and PC3 showed the maximum
PC1 (25.08 %)
contribution to the total diversity. PC1 accounted for
the maximum variability i.e. 25.08 per cent which Active variables Active observations

gradually decreased to PC2 (16.87), PC3 (14.10), PC4 Fig. 3. Distribution of 216 genotypes of chickpea based on
(10.86) and PC5 (8.66). From the above results it can be principal component PC1 and PC2
concluded that PC1 has the greatest difference in yield

Table 4. Eigen values, proportional and cumulative per cent variation and principal component for 12 yield
contributing traits
Parameters PC1 PC2 PC3 PC4 PC5
Eigenvalue 3.010 2.025 1.692 1.303 1.040
Variability (%) 25.08 16.87 14.10 10.86 8.668
Cumulative % 25.08 41.95 56.05 66.91 75.58
Factor loadings:
Days to flowering 0.105 0.949 -0.146 0.022 0.115
Days to maturity 0.089 0.957 -0.061 0.043 0.133
Plant height 0.228 0.120 0.584 -0.010 -0.425
Number of primary branches 0.227 0.039 0.575 -0.503 0.091
Number of secondary branches 0.031 0.267 0.715 -0.195 -0.123
Number of pods per plant 0.593 0.150 -0.082 0.421 -0.166
Number of seeds per pod 0.795 -0.089 -0.243 -0.182 -0.025
Root length 0.130 -0.100 0.237 0.003 0.861
Root weight 0.842 -0.119 0.026 -0.342 0.066
Single plant yield 0.701 -0.024 0.220 0.604 -0.002
100-seed weight 0.032 -0.218 0.476 0.537 0.179
Root girth 0.828 -0.133 -0.295 -0.171 0.002
 Jain et al.: Association and diversity analysis in chickpea
plant (0.701), number of pods per plant (0.593), plant
height (0.228) and number of primary branches
(0.227). Principal factor two (PC2) enabled high
positive loading for days to owering (0.949), days to
maturity (0.957), number of secondary branches
(0.267). Principal factor three (PC3) enabled high
positive loadings for number of secondary branches
(0.715), plant height (0.584), number of primary
branches per plant (0.575), 100-seed weight (0.476),
root length (0.237) and seed yield per plant (0.220)
(Table 4). Yield and some yield contributing traits
appear strongly in the rst three components reported
by earlier workers also (Janghel et al. 2020; Jain et al.
2021). Twelve traits of chickpea are distributed on the
basis of their relative performance with respect to
principal factor one and two. All the traits showed
signicant relation to the variance, most of the traits
showed positive loading and few are showed negative
loadings, depending on the distance from center of
origin represent the variance of a particular trait.
Considering the importance of biplot in data
analysis, the relationship between the yield
contributing traits and the genotypes were depicted in
biplot graph (Fig.3). Two hundred sixteen genotypes
of chickpea are distributed on the basis of their relative
performance with respect to principal factor one and
two. Genotypes clustered towards positive side of
PC1 are better in terms of grain yield. The genotypes
which are clustered towards negative side of PC2,
were less effective on grain yield. Earlier scientist
reported that a high value of PC scores can be used for
selection and for further utilization in future breeding
programme (Shivwanshi and Babbar 2017; Kumar et
al., 2019).
CONCLUSION
In the present study, 100-seed weight, number of
branches per plant and number of pod per plant had
high positive association with seed yield. Therefore,
selection based on these traits would be fruitful.
Further the study of diversity index reect that in
present set of germplasm, ample genetic variation
exists for seed yield and other traits. PC1, PC2, and
PC3 showed the maximum contribution to the total
diversity and have the greatest difference in yield
attribute characteristics. On the basis of inter cluster
distances, cluster means, per se performance
observed in the present study the four genotypes viz.,
IC407968, IC408198, ICC3498 and EC538477 were
found to be superior and can be used as a potent
parents for improvement of seed yield in chickpea.
9
ACKNOWLEDGEMENT
The authors are thankful to the ICAR-Indian
Institute of Pulses Research and ICAR-National
Bureau of Plant Genetic Resources, New Delhi for
providing the grant under CRP-Agro-biodiversity for
conduct the experiment.
REFERENCES
Agrawal T, Kumar A, Kumar S, Kumar A, Kumar M
and Perveen S. 2018. Assessment of genetic
diversity in Chickpea (Cicer arietinumL.)
germplasm under normal sown condition of
Bihar.International Journal of Current
Microbiology and Applied Sciences 7: 3552-3560.
Anonymous 2019. Agricultural Statistics at a
glance.Ministry of Agriculture & Farmers
Welfare Department of Agriculture,
Government of India.
Anonymous 2021. Agricultural Statistics.
Commissionerate of Agriculture, Government
of Rajasthan.
Archak S, Tyagi RK, Harer PN, Mahase LB, Singh N,
Dahiya OP, Abdul Nizar M, Singh M, Talukar V,
Kumar V, Dutta M, Singh NP and Bansal KC.
2016. Characterization of chickpea germplasm
conserved in the Indian National Gene Bank and
development of core set using qualitative and
quantitative data. The Crop Journal 4: 417-424.
Arumuganathan K and Earle ED. 1991. Nuclear DNA
content of some important plant species. Plant
Molecular BiologyReporter 9: 208-218.
Borate VV and Dalvi VV. 2010. Correlation and path
analysis in chickpea.Journal of Maharashtra
Agricultural University 35:43-46.
Dar MA, Khuroo NU, Mir RU, Dar ZA, So PA, Dar
SA, Lone BA, Sheikh FA and Bhat UR. 2020.
Diversity analysis in Chickpea (Cicer arietinum
L.) genotypes under temperate conditions.
Current journal of applied science and
technology 39: 9-14.
Dawane JK, Jahagirdar JE and Shedge PJ. 2020.
Correlation Studies and Path Coefcient
Analysis in Chickpea (Cicer arietinum L.).
International Journal of Current Microbiology
and Applied Sciences 9: 1266-1272.
Jain SK, Sharma LD, Gupta KC, Kumar V and Yadav
MR. 2020. Variability and character association
10 Journal of Food Legumes 35 (1), 2022
for yield and quantitative traits under late sown
conditions in Chickpea (Cicer arietinum). Legume
Research 10.18805/LR-4432.
Jain SK, Sharma LD, Gupta KC, Kumar V and Sharma
RS.2021. Principal Component and Genetic
diversity analysis for seed yield and its related
components in the genotypes of chickpea (Cicer
arietinum L.). Legume Research DOI:
10.18805/LR-4489.
Jakhar DS, Singh R and Kamble MS. 2016. Genetic
diversity studies in chickpea (Cicer arietinum L.)
in Kolhapur region of Maharashtra. Bangladesh
Journal of Botany 45: 459-464.
Janghel DK, Krishan K, Verma SS and Chhabra AK.
2020. Genetic relationships and principal
component analysis in elite chickpea (Cicer
arietinum L.) genotypes for seed yield and its
component traits. Legume Research 43:770-775.
Kumar A, Kumar A, Kumar RR, Sanjay Kumar,
Satyendra, Kumari Rajani and Singh PK. 2019.
Principal component analysis of Agro-morpho-
genetic traits in desi chickpea (Cicer arietinum L.).
International Journal of Chemical Studies SP6:
362-366.
Kumar A, Perween S, Kumar M, Kumar S, Satyendra,
Kumar RR and Kumar S. 2018. Genetic diversity
analysis and identication of promising lines for
hybridization in chickpea (Cicer arietinum L.).
Journal of Agri Search 5: 236-239.
Merga B and Jema H. 2019. Economic importance of
chickpea: Production, value, and world trade.
Cogent Food and Agriculture 2331-1932.
Naveed M, Shaq M, Raq CM and Zahid MA. 2015.
Genetic diversity in new chickpea accessions for
fusarium wilt resistance, canopy temperature
and yield components under drought milieus.
Australian journal of crop science 9:538-544.
Parashi VS, Lad DB, Mahse LB, Kute NS and
Sonawane CJ. 2013. Genetic diversity studies in
chickpea (Cicer arietinum L.). Bioinfolet 10: 337-
341.
Reddy JM, Lal GM, Redd VP, Pattanayak S, Guptha
VR, Sagar CK. and Brahmanjaneyulu PVB. 2021.
Studies on genetic diversity in desi Chickpea
(Cicer arietinum L.) using D 2 statistics.
International Journal of Plant and Soil Science
33:100-104.
Shivwanshi R and Babbar A. 2017. Principal
component analysis of Chickpea (Cicer arietinum
L.) germpasm. International Journal of Current
Microbiology and Applied Sciences 6: 166-173.
SAS, 2012. Statistical analysis System. Version 9.3.,
SAS Institute Inc. Cary, NC., USA.
Singh, R.K. and B.D. Chaudhary, 1979. Biometrical
methods in quantitative genetic analysis. Pp:
303. Kelyani publisher, New Delhi, India
Vishnu B, Jayalakshmi V and Rani MS. 2020. Genetic
diversity studies among chickpea (Cicer
arietinum L.) genotypes under rainfed and
irrigated conditions for yield attributing and
traits related to mechanical harvesting. Legume
Research 43: 190-194.
Ward JH. 1963. Hierarchical grouping to optimize an
objective function. Journal of the American
Statistical Association 58: 236-244.
XLSTAT. 2021. Data Analysis and Statistical Solution
for Microsoft Excel. Addinsoft, New York.
 Journal of Food Legumes 35(1): 11-16, 2022

Assessment of trait association and genetic divergence in a diverse

panel of eldpea (Pisum sativum L.) genotypes
Theint Theint Tun, Ravika*, Rajesh Yadav and Seema Kamboj

Department of Genetics and Plant ABSTRACT

Breeding, CCS Haryana Agricultural
University, Hisar- 125004, India
*E-mail : ravika.sheoran@hau.ac.in
Received: 09 August, 2021
Accepted: 22 April, 2022
Handling Editor:
Meenal Rathore, ICAR-Indian Institute of
Pulses Research, Kanpur
One hundred and twenty six eldpea genotypes were evaluated for
eight yield attributing traits in augmented design during Rabi 2018-19
to ascertain genetic divergence, correlation and path coefcients. Seed
yield had signicant positive association with days to maturity, number
of branches, number of pods, number of seeds and 100-seed weight. Path
analysis revealed maximum positive direct effect of 100-seed weight
followed by number of pods, number of seeds per pod, days to owering
and number of branches therefore, these traits may be considered of
prime importance in formulating selection criteria for improvement of
yield in eldpea. Hierarchical cluster analysis grouped these genotypes
into ten discrete clusters containing one to 46 genotypes. Maximum inter
cluster distance was observed between cluster VIII and IX. Cluster VII
had highest mean values for number of pods, number of seeds, seed
yield and 100-seed weight. Based on yield and other traits studied, the
genotypes viz., HFP 1104, HFP 1201 (early in owering and maturity with
medium tall plant height, good number of pods per plant, number of
seeds per pod and seed yield per plant), HUDP 1301 (medium owering
and maturity), SPC 1-01, IPF 11-13, Pant P-42, NDPT 2017-04, Pant P-339
(early owering and maturity, tall plant height and medium 100-seed
weight) and RFP 11-09, HFP 1125, RFPG 114 (medium dwarf plant
height with very good number of pods per plant, number of seeds per
pod, seed yield per plant and 100-seed weight) were found genetically
diverse with superior per se performance and these can be used in
hybridization programmes for further improvement of eld pea.
Key words: Correlation, Diversity, Field pea, Path analysis

INTRODUCTION technologies. Genetic variation provides an

opportunity for improvement of autogamous crop
Fieldpea (Pisum sativum L.) is a self-pollinated
plant such as eldpea through hybridization and
diploid rabi season crop (2n=14) and third most
heterosis is known to depend on the extent of genetic
widely grown food legume worldwide (Tyagi et al.,
diversity between the parents. Before commencing
2012). It is considered to be an inexpensive source of
any breeding programme, a thorough knowledge of
high quality proteins especially rich in the essential
the nature and magnitude of genetic variability and
amino acids tryptophan and lysine, complex
genetic divergence is indispensable. Adequate
carbohydrates, high bre (soluble and insoluble), B
information on variability and diversity will be useful
vitamins, folate and mineral content such as calcium,
in designing the breeding strategies for yield
iron and potassium, 86–87% total digestible nutrients
improvement. Selection of parents with desirable
and very low sodium and fat content (Tiwari and
characters for utilization in hybridization programme
Singh, 2012; Yadav and Ravika, 2014; Parihar et al
is of paramount importance. It is a well established
2016; 2020, 2021). To achieve self sufciency in pulses
that yield is a complex trait and inclusion of all the
we have to go a long way and make effective and
component traits in selection scheme for such intricate
judicious use of genetic resources and advanced
12 Journal of Food Legumes 35 (1), 2022
characters is impractical. Therefore, knowledge of
association of various traits is fundamental in
formulating efcient breeding programme.
Information about the direct and indirect effects
contributing characters to yield in addition to the
association of the characters will be an added
advantage for the further possibility of crop
improvement. All these will help in the identication
of superior genetic stocks and their subsequent
utilization in breeding programmes (Yadav and
Ravika, 2014). Therefore, the present investigation
was formulated to evaluate the genetic variability,
diversity and character association in a set of eldpea
genotypes.
MATERIALS AND METHODS
A total of 126 genotypes of diverse origin and
four checks viz., HFP 8909, HFP 715, HFP 529 and HFP
9426 were undertaken for present study. The material
was sown in Rabi season of 2018-2019. The study was
conducted in Augmented Design with experimental
unit of ve blocks and each genotype was grown in a
single row of 4m length with 45 and 10cm spacing.
First four blocks comprised of 25 genotypes each and
the fth block was sown with 26 genotypes. Four
checks (viz., HFP 8909, HFP 715, HFP 529 and HFP
9426) were repeated in all the ve blocks. The soil of
experimental plot was sandy loam and all the
recommended package of practices was followed to
raise a good crop. The observations on metric traits
were recorded on ve randomly selected plants in
each genotype as per procedure whereas, for traits
days to 50% owering and days to maturity data was
recorded on plot basis. The considered traits are days
to 50% owering, days to maturity, plant height (cm),
number of branches per plant, number of pods per
plant, number of seeds per pod, seed yield per plant
(g) and 100-seed weight (g) Genotypic and phenotypic
Table 1. Estimates for Correlation coefficients for different characters in fieldpea
DF DM PH
DM 0.358**
PH -0.327** -0.294**
NB 0.051 0.021 -0.089
NP 0.015 0.065 -0.126
NS -0.033 0.209* -0.297**
SY 0.012 0.175* -0.246**
SW -0.087 0.220* -0.147
**Signicant (p=0.01), *Signicant (p=0.05)
DF: Days to owering, DM: Days to maturity, PH: Plant height, NB: Number of branches per plant, NP: Number of pods per plant, NS:
Number of seeds per pod, SY: Seed yield per plant, SW: 100-seed weight.
coefcients of correlation for the undertaken traits
were calculated as per method of Al-Jibouri et al.
(1958). Path analysis was carried out as per method
suggested by Dewey and Lu (1959). Unweighted Pair
Group Method Using Arithmetic Averages (UPGMA)
method of hierarchical cluster analysis was used with
City Block distances to classify the 126 eldpea
genotypes for their genetic diversity
RESULTS AND DISCUSSION
Seed yield per plant had signicant positive
association with days to maturity, number of branches
per plant, number of pods per plant, number of seeds
per pod and 100-seed weight and negative with plant
height (Table 1). Plant height was found to be
negatively correlated with days to 50% owering,
days to maturity, number of seeds per pod and seed
yield per plant. Number of pods per plant was
observed to be having positive association with
number of branches per plant, number of seeds per
pod, seed yield per plant and 100-seed weight. 100-
seed weight was positively correlated with days to
maturity, number of pods per plant, number of seeds
per pod and seed yield per plant. Our results are in
partial agreement with those reported by Basaiwala et
al. (2013); Arya et al (2014a); Arya et al (2014b); Parihar
et al (2014a); Parihar et al (2014b); Verma (2014),
Georgieva et al. (2016), Rahman et al. (2017), Singh et al.
(2017), Ton et al. (2018) and Abdolla (2019) in eldpea.
Maximum positive direct effect on seed yield
was observed to be of 100-seed weight followed by
number of pods, number of seeds per pod, days to
owering and number of branches per plants and
negative direct effect of days to maturity followed by
plant height (Table 2). Apart from its direct effects,
100-seed weight exhibited positive indirect effect via
number of pods per plant, number of seeds per pod,
days to maturity and number of branches per plant
NB NP NS SY
0.303**
0.224* 0.239**
0.217* 0.647** 0.469**
0.124 0.482** 0.416** 0.868**
 Tun et al.: Trait association and genetic divergence in eldpea 13

Table 2. Direct (diagonal) and indirect (off diagonal) effects of different traits on seed yield in eldpea

Trait DF DM PH NB NP NS SW
DF 0.079 -0.021 0.019 0.001 0.006 -0.005 -0.075
DM 0.026 -0.063 0.015 0.0007 0.018 0.018 0.137
PH -0.024 0.015 -0.061 -0.002 -0.039 -0.028 -0.104
NB 0.005 -0.001 0.005 0.025 0.080 0.022 0.084
NP 0.001 -0.004 0.009 0.007 0.261 0.024 0.339
NS -0.004 -0.011 0.017 0.005 0.064 0.099 0.296
SW -0.008 -0.012 0.009 0.003 0.124 0.041 0.710
SY (r2) 0.012 0.175* -0.246** 0.217* 0.647** 0.469** 0.868**

Residual Effect = 0.159

and negative indirect effect through plant height and
days to owering. Likewise, number of pods apart
from its positive direct effect on seed yield exhibited
positive indirect effect via 100 seed weight, number of
branches per plant and number of seeds per pod
while, negative indirect effects via plant height.
Besides its direct effect on seed yield, number of seeds
per pod exhibited positive indirect effect via 100-seed
weight, number of pods per plant, number of
branches per plant and days to maturity and negative
indirect effects through plant height. Numerous
correlation and path coefcients studies by various
workers in eldpea like, Parihar et al (2014a); Parihar et
al (2014b); Jeberson et al. (2016) and Gautam et al.
(2017) support the present ndings.
The hierarchical cluster analysis grouped 126
eldpea genotypes into ten distinct clusters. The
distinction of these lines into ten discrete clusters
indicated presence of substantial amount of diversity
in the material evaluated. Maximum number of
genotypes (Table 3) were grouped in cluster I (46
genotypes) followed by cluster V (35 genotypes),
cluster VI (20 genotypes), cluster II (8 genotypes),
cluster III (ve genotypes), cluster X (four genotypes),
and cluster VII and VIII (three genotype each) and
cluster IV and IX (one genotype each). Earlier workers
Parihar et al (2014a); Parihar et al (2014b); Negisho et al.
(2017) and Kumar et al. (2019) have also reported
existence of high degree of genetic diversity in
eldpea.
In the present study, the maximum intra cluster
distance was observed in cluster I followed by cluster
X and cluster V. The maximum inter cluster distance
was observed between cluster VIII and IX followed by
cluster VII and VIII and cluster III and IX (Table 4).
Since high or optimum genetic divergence is required
between the parents of hybridization plan for
obtaining high frequency of desirable recombinants in
the segregating generations it would be logical to
attempt crosses between the diverse genotypes
belonging to clusters separated by large inter-cluster
distances.
The cluster means for the eight quantitative traits
studied in genotypes of eldpea revealed
considerable differences among all the clusters.
Cluster wise means for the characters studied are
presented in Table 5. It was evident from the study
that genotypes of Cluster VII had highest number of
pods per plant, number of seeds per pod, seed yield
per plant and 100-seed weight whereas, genotypes
belonging to Cluster VIII showed highest mean for
plant height. Cluster IX genotypes exhibited highest
mean value days to 50% owering and days to
maturity and lowest for plant height meaning thereby
that these genotypes were late in maturity and tallest
in height whereas, Cluster X genotypes were observed
to be earliest in owering and maturity. Assessment of
mean performance of different clusters for various
traits unveiled that Cluster VII can be ranked as rst as
it was having dwarf plants with highest performance
for seed yield and its attributes. This was closely
followed by Cluster V, VI and VIII and for early
maturity Cluster X was found to be the best. The
clusters performing better for different traits are also
widely distant from each other, therefore, genotypes
from these when used as parents in hybridization will
yield promising desirable transgressive segregants.
The present study was intended to examine the
genotypic variation, correlations, path coefcient and
genetic diversity for yield and yield contributing
14 Journal of Food Legumes 35 (1), 2022

Table 3. Cluster membership and number of genotypes in each cluster of eldpea

Cluster No. of
Name of Genotypes
No. Genotypes
20/1062, Ambika, DDR -36, DMR-7, HFP 0110, HFP 0130, HFP 0145, HFP 0149, HFP 46
1024, HFP 1107, HFP 1120, HFP 1129, HFP 1130, HFP 1132, HFP 1137, HFP 1140,
HFP 1314, HFP1315, HFP 2008, HFP 9426, HFP 99907A, HUPT 1701, IPF 11 -13, IPF
1
17-18, IPF 17 -19, IPF 5 -19, IPF 17 -2, KPF 115, KPF 14 -35, KPF 14 -36, NDPT 2017 -04,
NGSN-14, NGSN-3, NGSN-5, NGSN-9, Pant P -125, Pant P -180, Pant P -207, P ant P-
215, Pant P-399, Pant P-42, RFP 72, SKUA P-8, SPC 1-01, VL-56, VL-67
Aman, HUDP 1301, HUDP 1302, HUDP 1715, KPMR 745, NGSN -8, Pant P-365, Pant 8
2
P-367
3 DDR-4, EC 398601, IP2K 83-1, IPF 11-15, NGSN-13 5
4 EC 412882 1
HFP 1010, HFP 1306, HFP1125, HFP 1302, HFP 1307, HFP 1405, HFP 1425, HFP 1428, 35
HFP1463, HFP 530B, HUDP 1711, IPFD 12-2, IPFD 12-8, IPFD 13-14, IPFD 17-16, IPFD
5 2014-11, KFP 12 -4, KFP 14 -64, KPMR 910, NDP 11 -102, NDP 14 -11, NDPD 2017 -06,
Pant P-186, Pant P -195, Pant P -200, Pant P -222, Pant P -223, Pant P -247, Pant P -250,
Pant P-347,Pant P-375, RFP 11-09, RFPG 114, VL-202, VL-55
HFP 1104, HFP 1201, HFP 9106, HFP 920, IPFD 13-2,KPF 1024, KPMR 851, KPMR 935, 20
6 NDP 11-101, NGSN-4, Pant P-184, Pant P-217, Pant P-38, Pant P-397, Pant P-402, RFP
2010-11, RFP 2010-3, RFP 2011-1, VL-58, VL-66
7 HFP 1306, Pant P-2009-3, VL-201 3
8 HFP 9907B, PH-1, RFPG 112 3
9 KPMR 928 1
10 NGSN-10, NGSN-11, NGSN-6, RFP 2009-2 4
Total 126

Table 4. Inter and intra – cluster distances in eldpea

Cluster Cluster Cluster Cluster Cluster Cluster Cluster Cluster Cluster Cluster Cluster
No. I II III IV V VI VII VIII IX X
Cluster I 44.42
Cluster II 105.78 37.14
Cluster III 62.871 135.63 29.89
Cluster IV 157.50 79.68 152.01 -
Cluster V 129.95 63.44 156.25 67.30 38.40
Cluster VI 64.97 72.81 91.71 127.75 92.19 38.02
Cluster VII 166.60 107.25 181.31 85.23 63.87 125.78 31.15
Cluster VIII 73.25 148.57 70.41 199.19 167.86 105.47 202.82 29.84
Cluster IX 171.41 86.80 200.77 72.140 72.15 140.31 68.75 209.90 -
Cluster X 84.06 90.95 75.95 104.32 124.04 69.23 155.22 125.94 154.75 38.84

Table 5. Cluster means for different characters in eldpea

Clusters DF DM PH NB NP NS SY SW
I 74 122 194 2.2 25 4.9 16.26 16.37
II 77 124 123 2.2 21 5.0 12.91 13.65
III 75 122 208 2.1 27 4.4 17.72 16.14
IV 78 120 91 2.8 23 3.3 10.40 13.27
V 77 124 98 2.3 27 5.5 21.16 17.62
VI 74 122 159 2.3 27 5.2 18.51 16.08
VII 78 125 74 2.4 33 5.6 25.10 19.80
VIII 75 123 236 2.7 28 4.9 18.45 16.24
IX 85 129 68 1.7 24 5.2 13.10 13.71
X 72 121 164 1.9 23 4.7 12.75 13.47
General Mean 77 123 142 2.3 26 4.9 16.64 15.64
 Tun et al.: Trait association and genetic divergence in eldpea
traits, will be of great use and will serve as a
springboard in formulation and effective execution of
future breeding programmes in eldpea. On the basis
of results it can be concluded that, the genotypes viz.,
HFP 1104, HFP 1201 (early in owering and maturity,
more number of pods per plant, number of seeds per
pod and seed yield per plant), HUDP 1301 (medium
owering and maturity), SPC 1-01, IPF 11-13, Pant P-
42, NDPT 2017-04, Pant P-339 (early owering and
maturity, tall plant height and medium 100-seed
weight) and RFP 11-09, HFP 1125, RFPG 114 (medium
dwarf plant height with very more number of pods
per plant, number of seeds per pod, seed yield per
plant and 100-seed weight) were found genetically
diverse and superior. To initiate a systematic breeding
programme and to develop eldpea varieties with
high seed yield the above specied genotypes can be
used in eldpea breeding programmes for further
improvement.
REFERENCES
Abdolla BA. 2019. Assessing the relationship between
yield component in pea (Pisum sativum L.)
varieties using correlation and path analysis
under Sulaimani condition. Journal of Kerbala
for Agricultural Sciences, 6(3): 1-15.
Al-Jibouri HA, Miller PA and Robinson AF. 1958.
Genotypic and environmental variances in an
upland cotton cross of interspecic origin.
Journal of Agronomy, 51: 515-518.
Arya S, Yadav R, Malik BPS and Yadav RK. 2014a.
Visualizing immediate components of seed yield
to identify plant ideotype in eldpea (Pisum
sativum L.). Research in Plant Biology, 4(1): 26-35.
Arya S, Yadav R, Malik BPS and Yadav RK. 2014b.
Variability and association studies in F3 and F4
populations of eldpea (Pisum sativum L.).
Journal of Food Legume, 27: 77-79.
Basaiwala P, Rastogi NK and Parikh M. 2013. Genetic
variability and character association in eldpea
(Pisum sativum L.) genotypes. Asian Journal of
Horticulture, 8(1): 288-291.
Dewey DR and Lu KH. 1959. A correlation and path-
coefcient analysis of components of crested
wheat grass seed production. Agronomy
Journal, 42: 515-517.
Gautam KK, Syamal MM, Singh AK and Gupta N.
2017. Variability, character association and path
15
coefcient analysis of green pod yield and its
related traits in pea (Pisum sativum L.). Legume
Research-An International Journal, 40(5): 818-
823.
Georgieva N, Nikolova I and Kosev V. 2016.
Evaluation of genetic divergence and heritability
in pea (Pisum sativum L.). Journal of BioScience &
Biotechnology, 5(1): 61-67.
Jeberson MS, Shashidhar KS and Singh AK. 2017.
Agro-morphological diversity analysis in
eldpea (Pisum sativum L.) genotypes grown
under protected irrigation at marginal soils of
Manipur. Journal of Food Legumes, 30: 179-182.
Kumar N, Pandey S, Mishra S, Mishra DP and Pandey
VP. 2019. Studies on genetic divergence for yield
and its component traits in pea (Pisum sativum L.)
in sodic condition. Journal of Pharmacognosy
and Phytochemistry, 8(1): 302-304.
Negisho K, Teshome A and Keneni G. 2017. Genetic
diversity in Ethiopian eldpea (Pisum sativum L.)
germplasm collections as revealed by SSR
markers. Ethiopian Journal of Agricultural
Sciences, 27(3): 33-47.
Parihar AK, Bohra A and Dixit GP. 2016. Nutritional
benets of winter pulses with special emphasis
on peas and rajmash. In: Biofortication of Food
Crops (pp. 61-71). Springer, New Delhi.
Parihar AK, Dixit GP, Bohra A, Gupta DS, Singh AK,
Kumar N, Singh D and Singh NP. 2020. Genetic
advancement in dry pea (Pisum sativum L.):
Retrospect and Prospect. In: Accelerated Plant
Breeding, Volume 3 (pp. 283-341). Springer,
Cham.
Parihar AK, Dixit GP, Pathak, V and Singh D. 2014a.
Assessment of the genetic components and trait
associations in diverse set of eldpea (Pisum
sativum L.) genotypes. Bangladesh Journal of
Botany, 43(3): 323-330.
Parihar AK, Dixit GP, Pathak V and Singh D. 2014b.
Genetic diversity and trait inter-relationship
studies in a diverse set of eldpea (Pisum sativum
L.) genotypes. Journal of Food Legumes, 27: 297-
301.
Parihar AK, Dixi, GP, Singh U, Singh AK, Kumar N
and Gupta S. 2021. Potential of eld pea as a
nutritionally rich food legume crop. In: Breeding
for Enhanced Nutrition and Bio-Active
16 Journal of Food Legumes 35 (1), 2022
Compounds in Food Legumes (pp. 47-82).
Springer, Cham.
Rahman MM, Zaman MS, Iqba MS, Naher N and
Hossain MM. 2017. Characterization and
evaluation of pea germplasm in Bangladesh.
Eco-friendly Agricultural Journal, 10(04): 40-44.
Singh BK, Sutradhar M, Singh AK, and Singh SK. 2017.
Evaluation of genetic variability, correlation and
path coefcients analysis for yield attributing
traits in eldpea [Pisum sativum (L.) var. arvense].
Research on Crops, 18(2): 316-321.
Tiwari BK and Singh N. 2012. Pulse Chemistry and
Technology. The Royal Society of Chemistry,
United Kingdom ISBN 10: 1849733317/ISBN 13:
9781849733311.
Ton A, Karakoy T, Anlarsal AE and Turkeri M. 2018.
Genetic variability, heritability and path analysis
in eldpea (Pisum sativum L.). Fresenius
Environmental Bulletin, 27(4): 2275-2279.
Tyagi N, Singh AK, Rai VP, Kumar S and Srivastava
CP. 2012. Genetic variability studies for lodging
resistance and yield attributes in pea (Pisum
sativum L.). Journal of Food Legumes, 25(3): 179-
182.
Verma V. 2014. Genetic variability, correlation and
path analysis in eldpea (Doctoral dissertation
submitted to the Jawaharhlal Nehru Krishi
Vishaw Vidyalaya, Jabalpur).
Yadav R and Ravika. 2014. Characterization of
eldpea (Pisum sativum L.) genotypes for DUS
descriptors. Haryana agricultural University
Journal of Research, 44: 29-38.
 Journal of Food Legumes 35(1): 17-26, 2022

A combined selection approach using modied multivariate analysis

for identication of fast cooking beans (Phaseolus vulgaris L.)
based on seed physical parameters
Parvaze A So*, Sajad Majeed Zargar, Sujeela Rani, Samreen Fatima,
Sadiah Sha, Aaqif Zaffar and Ramsha Khalid

Division of Genetics & Plant Breeding, ABSTRACT

FOA, Wadura, J&K, 193201, India
*Email: parvazeso@gmail.com
Received: 08 December, 2021
Accepted: 13 May, 2022
Handling Editor:
Dr. Rajan Katoch, CSKHPKV, Palampur
The present study reports comparative advantage of a modied multivariate
analysis based on seed physical parameters related to cooking in beans. The
modied GC*T biplot represents functional relationship of cooking time
score with seed physical traits. Compared to normal GT based principal
component analysis (PCA) that concentrated variability in rst six principal
components (83.40 per cent) the GC*T concentrated the variability in rst
three principal components (91.63 per cent) with rst two accounting for
88.40 per cent variation. In terms of cooking time score, WB-216 and WB-
1518 were easy to cook (5) followed by WB-1678, GLP-1, WB-1634, WB-N-14,
WB-869, WB-957, WB-501, WB-22, WB-2020-180 and WB-6 (CTS 4).
Eighteen genotypes had longer cooking times and eight were intermediate in
cooking time. Based on mean superiority index (MSI) WB-216 had highest
MSI value (2.14) followed by WB-1518 (1.45) while as highest negative MSI
values were recorded for WB-371 (-1.005). The GC*T approach used helps us
translate seed physical traits into faster cooking trait making the GC*T
approach more meaningful as compared to GT based on traits per se.
Key words: Common bean, GC*T approach Multi-trait selection, Superiority
index
Abbreviations: GT= Genotype x Trait, GC*T= Genotype x Cooking time*Trait,
CTS= Cooking Time Score, CP= Coat Proportion, HA= Hardness, MSI= Mean
Superiority Index

INTRODUCTION Moniem, 1999) to 1.5 hours in common bean (Shehata,

Cooking time is one of the most important
determinants of varietal adoption and consumer
acceptability in common beans (Phaseolus vulgaris L.)
(Kelly and Cichy, 2013). As a process, cooking is
essential for bean consumption, as it renders beans
palatable, increases digestibility, nutritional and
biological value, inactivates anti-nutritional factors
and confers the characteristics sensory, textural,
colour, taste, tenderness and overall organoleptic
features for consumer acceptability (Taiwo et al. 1997,
Costa et al. 2006). The cooking of beans causes several
physical, biochemical and nutritional quality changes
while prolonged cooking may even reduce the
nutritive quality of beans (Iram Saba et al. 2016). Since
the major consumption patterns of beans are cooked
grain form, the cooking quality attributes are
important for the adoption of bean varieties (Kelly
and Cichy, 2012). Legumes vary in their cooking times
ranging from as low as 0.5 hours in mung bean (El-
1992), 2.4 hours in cowpea (Onayemi and Osibogun,
1986), 3-4 hours in bambara groundnut (de-Kock,
2005) and 3.6 hours for soybean (Aykroyd et al. 1982,
Destro et al. 2013). Bean breeding programs have
invariably focused on the identication and
development of easy to cook (ETC) bean varieties to
increase their consumption and market acceptability.
There is greater market preference for genotypes that
can cook in less than one hour because of decreased
energy utilization and preparation time. In addition,
fast cooking genotypes retain more nutrients as
compared to delayed cooking beans (Cichy et al. 2015).
Cooking, as a trait, is quite complex and is
implicated by a large number of physical and
biochemical phenes, and identication of set of
screening surrogates that are easy to score, high
throughput, reliable and can be translated into fast
cooking is an essential component of breeding for fast
cooking beans (Iram Saba et al. 2015). This requires
18 Journal of Food Legumes 35 (1), 2022
large scale genotypic evaluation that targets the traits
of interest directly or indirectly through traits whose
relationship with the target trait is established
through rigorous genetic analysis. However, the
genotype evaluation faces certain key challenges; one
the target traits are invariably highly complex, second
the genotype by environment interaction (GE) for the
target as well as underlying traits, and third the
unfavourable associations among key traits (Yan,
2014, Yan et al., 2007).
In conventional plant breeding, two strategies
viz., independent culling and index selection have
been proposed to overcome this situation. In
independent culling selection is made simultaneously
for all the characters but, independently, rejecting all
individuals that fail to meet the minimum standard
for any one trait (Xu et al. 2017). Despite having
obvious advantages over tandem selection, it is not as
efcient as index selection, where genotypes are
ranked based on an index, which is a linear
combination of the target traits which indicates the net
merit of an individual, constructed by combining
together the scores for component characters (Xu et al.
2017). The major bottleneck of this treatment is that
economic values or weights used in the index change
continuously, and values for all traits must be
collected before selection can occur. Moreover, there is
greater subjectivity in xing the weights and
truncation points, that can potentially vary from
breeder to breeder and from time to time for the same
researcher, even for the same dataset (Yan and
WB-501 WB-111 WB-341
WB-2020-182 WB-6 WB-333
WB-1282 WB-1319 N-4
WB-371 WB-1678 WB-966
Fig 1: Representative variability of bean germplasm used in present study
Frégeau-Reid, 2018). Such variations in weights and
truncation points can lead to different selection
decisions. A genotype by yield*trait (GYT) biplot
approach originally proposed by Yan and Fregeau-
Reid, 2018) in oats was validated in this paper to assess
the comparative efciency of GC*T approach (that
combines cooking time with underlying seed physical
characteristics) over GT approach in genotypic
selection on multiple seed physical traits in common
bean that lead to faster cooking time. The approach is
proposed based on the premise that traits other than
target trait (cooking time in our case) assume practical
importance only when combined with faster cooking
and that the selection for genotypic superiority should
be based on its potential to combine desirable trait
value with desirable cooking time score rather than
individual trait values per se. In this paper we report
the comparative efciency of the GC*T approach
based on 18 seed physical traits on 40 common bean
genotypes. The overall genotypic superiority is
decided based on the yield-trait combinations and
trait proles (i.e., strengths and weaknesses).
MATERIALS AND METHODS
Experimental material
The material for present study was initially a
core set of 300 lines representing diverse market
classes that were subjected to cooking test and based
on cooking time score and seed hardness after
cooking, 40 representative genotypes were selected
for detailed study in 2020-21 (Fig 1).
WB-1129 WB-1518 WB-1189
WB-869 WB-957 WB-2020-310
WB-112 WB-2020-39 WB-716
WB-492 WB-83 WB-2020-242
 So et al.: Multivariate analysis for identication of fast cooking beans
Cooking time score
Cooking test was done in all 300 lines in
autoclave using the procedure described by Revilla
and Vivar-Quintana (2008), with some modications.
Fifty soaked grains were placed in glass beaker, lled
with 200 ml of distilled water, covered with watch
glass, and cooked under the conditions 100°C for 20
min. Following scale was used for the scoring of
cooking properties of bean genotypes. The
softness/hardness (cookability) of the beans was
determined subjectively by pressing the cooked beans
between the thumb and forenger (Vindiola et al.
1986) as well as a seed hardness test using a Digital
Hardness Tester. Based on cooking time score and
seed hardness, twenty genotypes each from two
groups (Easy to cook and delayed cooking beans)
were selected for the assessment of seed physical
parameters and to understand as to how physical
traits affect water absorption and cooking.
GT (Genotype by trait) data
The sample data presented in table 1 was
recorded for 18 seed physical traits for 40 genotypes of
beans harvested during two experimental years (2020
and 2021) at experimental farm of Faculty of
Agriculture at Wadura (34o 17' North and 74o 33 E at an
altitude of 1594 metres above sea level) and represents
are mean values for each genotype-trait combination
across two years. Data was recorded on seed physical
traits as follows:
1. Seed length (mm): Seed length (mm) was
measured using a digital vernier caliper and
averaged across 10 representative seeds for each
genotype.
2. Seed width (mm): Seed width (mm) was
measured using vernier calipers and averaged
across 10 representative seeds for each genotype
3. Seed thickness (mm): Seed thickness (cm) was
measured using vernier calipers and averaged
across 10 representative seeds for each genotype
4. 100-seed weight (g): 100-seed weight of three
randomly drawn samples of sun dried seeds
from each experimental plot was weighed in
grams and averaged.
5. Length/width ratio: The length/width ratio of
seeds (LWR) was calculated using the
relationship LWR=L/W given by 'Hauhouout-
Ohara et al. (2000). The average of ten randomly
drawn seeds was taken.
19
6. Seed brilliance: Seed brilliance was measured
visually and seeds were classied as dull,
medium and brilliant.
7. Equivalent diameter: The geometric mean
diameter, D m , was calculated using the
relationship Dm = (LWT)1/3 given by Mohsenin
(1970). The average of ten randomly drawn seeds
was taken.
8. Sphericity: The sphericity of seeds (Φ) was
calculated as a function of the three principal
dimensions as shown below using the
relationship Φ = [(LWT)1/3/L]×100 given by
Mohsenin (1970) and was averaged for ten
randomly drawn seeds.
9. Aspect ratio: The aspect ratio of seeds (Ra) was
calculated using the relationship Ra = W/L
given by 'Hauhouout-Ohara et al. (2000). The
average of ten randomly drawn seeds was taken.
10. Seed volume: The volume of the seeds V in mm3,
was calculated using the relationship V = πB2L2/
6 (2L-3) where B = (WT)1/2 given by Mohsenin
(1970) and was averaged for ten randomly
drawn seeds.
11. Surface area of seeds: The surface area of the
seeds A in mm 2 , was calculated using the
relationship A=πBL2/2L-B, given by Mohsenin
(1970) and was averaged for ten randomly
drawn seeds.
12. Hilum length: Measured by Celestron
Microcapture Pro Digital Microscope (Celestron
LLC, USA) with inbuilt provision for measuring
distances after calibration.
13. Hilum width: Measured by Celestron
Microcapture Pro Digital Microscope
Microscope (Celestron LLC, USA) with inbuilt
provision for measuring distances after
calibration
14. Coat proportion (%): Seed coat proportion was
determined on 20 seeds per accession, as the
ratio in weight between coat and cotyledon
expressed in percentage, after removing the seed
coat from the cotyledons, both after soaking and
keeping them for 24h at 105o C.
15. Water absorption capacity (%): Water
absorption was measured under both ambient
conditions as well as accelerated ageing
conditions. For ambient conditions, the seeds
 20
Table 1: Mean performance of seed physical traits in 40 common bean genotypes
Genotype SLN SWD ST 100SW LBR EQD SPH AR SV SA HL HB HLSL HWSW CP WAAM HA CTS
WB-716 15.08 8.92 3.62 36.20 1.69 7.87 52.17 0.59 141.49 165.77 3.32 1.50 22.02 41.44 12.36 200.34 15.26 3
WB-352 16.43 5.69 3.00 30.00 2.89 6.55 39.84 0.35 80.76 121.90 3.26 1.52 19.84 50.67 13.26 108.56 38.20 2
WB-966 17.89 7.24 4.18 50.36 2.47 8.15 45.56 0.40 154.63 182.59 3.12 1.70 17.44 40.67 11.12 105.56 11.29 3
WB-492 15.45 7.14 4.04 30.54 2.16 7.64 49.44 0.46 129.15 157.68 3.50 1.61 22.65 39.85 11.26 200.67 13.27 3
WB-2020-242 12.22 6.19 3.20 30.40 1.97 6.23 51.00 0.51 72.20 104.40 3.62 1.71 29.62 53.44 13.24 108.4 44.40 2
WB-2020-39 16.54 8.42 3.20 40.12 1.96 7.64 46.18 0.51 128.24 159.88 2.99 1.80 18.08 56.25 13.49 104.55 45.68 2
WB-341 17.92 7.64 2.96 24.43 2.35 7.40 41.30 0.43 115.73 154.26 2.98 1.62 16.63 54.73 14.42 200.34 30.66 3
WB-1678 19.88 7.46 3.46 40.22 2.66 8.01 40.27 0.38 145.23 181.80 3.12 1.43 15.69 41.33 14.62 101.72 10.12 4
WB-1129 19.64 7.23 3.06 20.49 2.72 7.57 38.56 0.37 123.10 164.76 3.13 2.10 15.94 68.63 14.54 106.44 38.9 2
WB-2020-182 18.22 7.28 3.21 30.69 2.50 7.52 41.29 0.40 121.41 159.43 3.54 1.70 19.43 52.96 11.92 100.99 48.88 2
GLP-1 19.74 8.83 3.61 30.42 2.24 8.57 43.41 0.45 178.19 204.18 3.26 1.42 16.51 39.34 15.39 200.56 11.20 4
WB-112 14.63 7.18 3.20 50.73 2.04 6.95 47.53 0.49 98.00 131.67 3.39 1.22 23.17 38.13 14.44 108.22 44.53 2
WB-216 16.56 7.64 5.50 40.54 2.17 8.86 53.51 0.46 200.22 209.55 3.78 1.40 22.83 25.45 14.69 200.56 18.46 5
WB-662 13.67 5.84 3.31 30.62 2.34 6.42 46.94 0.43 77.67 112.44 3.11 1.33 22.75 40.18 15.64 202.23 35.17 2
WB-N-4 13.54 6.42 3.36 30.16 2.11 6.63 49.00 0.47 85.95 119.17 3.20 1.80 23.63 53.57 13.29 204.55 50.12 2
WB-1634 12.34 6.22 3.08 25.64 1.98 6.18 50.11 0.50 70.42 103.08 2.98 1.52 24.15 49.35 12.48 105.22 10.98 4
WB-2020-310 16.54 6.98 3.40 22.50 2.37 7.32 44.27 0.42 112.96 148.35 3.12 1.45 18.86 42.65 12.96 107.96 42.26 2
WB-N-14 15.58 7.28 4.40 21.68 2.14 7.93 50.91 0.47 144.50 169.17 3.20 1.56 20.54 35.45 11.44 202.43 11.88 4
WB-869 15.49 6.97 3.84 31.22 2.22 7.46 48.14 0.45 120.12 151.04 3.40 1.45 21.95 37.76 11.29 200.96 13.44 4
WB-1319 14.99 6.22 3.40 30.42 2.41 6.82 45.49 0.41 92.17 127.84 3.14 1.62 20.95 47.65 12.92 112.90 18.90 3
WB-401 16.11 6.39 3.21 30.02 2.52 6.91 42.91 0.40 95.34 133.29 3.26 1.70 20.24 52.96 11.59 102.42 15.45 2
WB-1518 14.52 6.78 2.92 21.50 2.14 6.60 45.45 0.47 83.88 119.78 3.12 1.52 21.49 52.05 12.96 127.55 25.66 5
WB-957 19.04 7.43 4.32 31.14 2.56 8.49 44.57 0.39 173.59 198.96 3.54 1.70 18.59 39.35 14.64 214.11 33.46 4
WB-501 18.46 7.19 3.70 30.74 2.57 7.89 42.74 0.39 139.87 173.76 3.62 1.11 19.61 30.00 14.91 200.13 11.20 4
WB-185 16.24 6.24 3.80 31.18 2.60 7.28 44.80 0.38 111.02 146.05 3.23 1.16 19.89 30.53 13.26 204.81 19.81 3
Journal of Food Legumes 35 (1), 2022

WB-N-1 16.28 6.31 3.20 50.33 2.58 6.90 42.39 0.39 94.75 133.24 3.23 1.12 19.84 35.00 13.98 162.20 34.23 3
WB-22 18.54 7.44 3.99 30.11 2.49 8.20 44.20 0.40 156.69 185.91 3.41 1.54 18.39 38.60 12.98 177.34 33.9 4
GL-2 14.45 6.23 2.88 30.16 2.32 6.38 44.13 0.43 75.70 112.60 3.44 1.26 23.81 43.75 12.64 163.22 12.66 2
GLY-1 16.46 7.33 3.17 31.16 2.25 7.26 44.10 0.45 110.11 145.94 3.45 1.50 20.96 47.32 14.41 105.62 12.39 3
WB-1189 19.70 6.55 3.90 20.46 3.01 7.95 40.38 0.33 142.53 179.33 3.16 1.40 16.04 35.90 13.97 102.88 18.88 2
WB-371 14.86 6.34 2.26 30.14 2.34 5.97 40.18 0.43 61.97 101.20 3.52 1.13 23.69 50.00 14.41 100.66 43.25 2
WB-2020-180 19.54 7.46 4.80 31.65 2.62 8.88 45.43 0.38 198.31 216.77 3.11 1.68 15.92 35.00 14.66 101.21 48.60 4
WB-N-7 18.48 6.42 3.40 50.82 2.88 7.39 39.98 0.35 114.88 155.17 3.20 1.22 17.32 35.88 13.60 202.44 12.11 2
WB-6 14.08 8.18 4.40 30.14 1.72 7.97 56.62 0.58 148.42 168.52 2.60 1.25 18.47 28.41 13.12 142.33 46.27 4
WB-333 16.69 6.90 3.07 30.74 2.42 7.07 42.37 0.41 101.65 139.89 3.12 1.49 18.69 48.53 14.56 143.11 11.20 2
WB-1496 16.31 7.50 5.53 30.12 2.17 8.78 53.82 0.46 194.93 205.48 3.67 1.39 22.50 25.14 14.99 165.65 18.68 2
WB-1282 15.84 6.07 2.88 30.54 2.61 6.52 41.15 0.38 80.04 119.79 3.13 1.23 19.76 42.71 13.58 145.98 51.25 2
WB-1683 18.92 7.97 4.61 50.66 2.37 8.86 46.82 0.42 197.56 214.40 3.54 1.12 18.71 24.30 12.49 198.99 33.23 2
WB-111 15.93 8.12 4.31 40.86 1.96 8.23 51.67 0.51 161.04 181.69 3.33 1.13 20.90 26.22 13.46 200.22 32.37 4
WB-83 15.40 7.30 4.10 40.44 2.11 7.72 50.16 0.47 133.62 160.84 3.32 1.99 21.56 48.54 14.57 201.56 12.30 4
Table 2: Mean superiority index based on GC*T values for seed physical traits in 40 genotypes of common bean
Mean
Superiority
Genotype CTS SLN SWD ST 100SW LBR EQD SPH AR SV SA HL HB HLSL HWSW CP WAAM HA index
WB-716 0.05 -0.19 0.69 -0.03 0.30 -0.79 0.14 0.38 0.93 0.20 0.12 0.09 0.09 0.32 0.09 0.25 0.61 0.38 0.20
WB-352 -0.96 -0.89 -1.20 -0.99 -0.95 -0.47 -1.06 -1.09 -1.17 -1.05 -1.05 -0.94 -0.82 -0.94 -0.46 -0.88 -1.03 -0.98 -0.94
WB-966 0.05 0.28 0.07 0.30 1.39 0.26 0.24 0.01 -0.19 0.39 0.36 -0.09 0.46 -0.34 0.03 0.62 -0.61 1.02 0.24
WB-492 0.05 -0.13 0.03 0.22 -0.14 -0.16 0.06 0.23 0.17 0.03 0.01 0.25 0.29 0.41 -0.03 0.62 0.61 0.66 0.18
WB-2020-242 -0.96 -1.36 -1.07 -0.91 -0.93 -1.30 -1.13 -0.66 -0.54 -1.14 -1.21 -0.73 -0.58 -0.01 -0.33 -0.88 -1.03 -0.98 -0.87
WB-2020-39 -0.96 -0.88 -0.53 -0.91 -0.43 -1.31 -0.81 -0.84 -0.54 -0.60 -0.70 -1.10 -0.47 -1.10 -0.20 -0.88 -1.06 -1.07 -0.80
WB-341 0.05 0.28 0.22 -0.42 -0.61 0.10 -0.02 -0.24 -0.01 -0.17 -0.04 -0.22 0.31 -0.45 1.04 -0.13 0.61 -0.53 -0.01
WB-1678 1.06 1.73 1.06 0.56 1.64 1.72 1.10 0.47 0.44 0.95 1.18 0.84 0.85 0.16 1.07 0.62 -0.22 2.2
0 0.97
WB-1129 -0.96 -0.53 -0.82 -0.97 -1.44 -0.63 -0.82 -1.13 -1.09 -0.65 -0.65 -1.02 -0.10 -1.31 0.40 -1.00 -1.05 -0.98 -0.82
WB-2020-182 -0.96 -0.69 -0.81 -0.91 -0.91 -0.82 -0.83 -1.03 -0.97 -0.67 -0.70 -0.77 -0.60 -0.97 -0.35 -0.63 -1.10 -1.07 -0.82
GLP-1 1.06 1.70 1.73 0.68 0.63 0.96 1.36 0.71 0.99 1.58 1.60 1.01 0.82 0.31 0.88 0.50 1.47 1.84 1.10
WB-112 -0.96 -1.09 -0.83 -0.91 0.11 -1.24 -0.96 -0.79 -0.62 -0.89 -0.96 -0.86 -1.19 -0.62 -1.07 -1.00 -1.03 -1.07 -0.89
WB-216 2.07 1.91 2.09 3.25 2.71 1.81 2.50 2.51 1.97 2.96 2.67 2.76 1.64 2.60 0.16 1.50 2.32 1.02 2.14
WB-662 -0.96 -1.20 -1.16 -0.87 -0.92 -0.97 -1.09 -0.81 -0.85 -1.08 -1.14 -1.03 -1.06 -0.66 -0.97 -1.13 -0.23 -0.89 -0.94
WB-N-4 -0.96 -1.21 -1.02 -0.85 -0.94 -1.18 -1.04 -0.74 -0.70 -1.00 -1.07 -0.98 -0.47 -0.58 -0.33 -0.88 -0.21 -1.07 -0.84
WB-1634 1.06 0.04 0.46 0.26 0.14 0.49 0.27 1.23 1.38 -0.48 -0.27 0.67 1.07 1.76 1.84 1.25 -0.16 1.84 0.71
WB-2020-310 -0.96 -0.88 -0.88 -0.83 -1.33 -0.94 -0.88 -0.92 -0.89 -0.75 -0.81 -1.02 -0.91 -1.03 -0.85 -0.88 -1.04 -0.98 -0.93
WB-N-14 1.06 0.76 0.98 1.30 -0.26 0.78 1.07 1.29 1.15 0.94 0.95 0.93 1.17 1.08 0.51 1.62 1.50 1.66 1.03
WB-869 1.06 0.74 0.82 0.86 0.71 0.92 0.85 1.07 0.99 0.47 0.62 1.17 0.90 1.35 0.73 1.62 1.47 1.29 0.98
WB-1319 0.05 -0.21 -0.30 -0.16 -0.15 0.18 -0.22 0.00 -0.13 -0.50 -0.40 -0.07 0.31 0.16 0.53 0.12 -0.51 0.02 -0.07
WB-401 -0.96 -0.92 -1.02 -0.91 -0.95 -0.81 -0.97 -0.97 -0.97 -0.91 -0.94 -0.94 -0.60 -0.90 -0.35 -0.63 -1.08 -0.25 -0.84
WB-1518 2.07 1.34 1.56 0.71 0.27 1.74 1.21 1.74 2.07 0.18 0.59 1.77 2.01 2.28 3.35 2.12 0.76 0.29 1.45
WB-957 1.06 1.54 1.05 1.24 0.71 1.54 1.32 0.80 0.52 1.49 1.50 1.34 1.52 0.71 0.88 0.62 1.70 -0.34 1.07
WB-501 1.06 1.41 0.93 0.75 0.67 1.55 1.05 0.66 0.52 0.85 1.04 1.44 0.05 0.90 -0.02 0.62 1.46 1.84 0.93
WB-185 0.05 0.00 -0.30 0.08 -0.09 0.44 -0.06 -0.04 -0.30 -0.23 -0.15 0.01 -0.55 0.01 -0.70 0.12 0.66 -0.07 -0.06
WB-N-1 0.05 0.01 -0.27 -0.28 1.38 0.41 -0.19 -0.18 -0.24 -0.47 -0.33 0.01 -0.62 0.01 -0.38 -0.13 0.12 -0.62 -0.10
WB-22 1.06 1.43 1.05 0.98 0.60 1.41 1.19 0.77 0.60 1.17 1.26 1.19 1.12 0.67 0.81 1.12 1.07 -0.34 0.95
GL-2 -0.96 -1.11 -1.06 -1.04 -0.94 -0.99 -1.09 -0.92 -0.85 -1.10 -1.14 -0.83 -1.14 -0.56 -0.80 -0.75 -0.56 0.02 -0.88
GLY-1 0.05 0.04 0.10 -0.30 -0.09 -0.04 -0.07 -0.08 0.11 -0.25 -0.15 0.20 0.09 0.17 0.51 -0.13 -0.60 0.75 0.02
WB-1189 -0.96 -0.52 -0.99 -0.63 -1.44 -0.37 -0.74 -1.07 -1.24 -0.46 -0.52 -1.00 -0.97 -1.30 -1.17 -1.00 -1.08 -0.43 -0.88
So et al.: Multivariate analysis for identication of fast cooking beans

WB-371 -0.96 -1.06 -1.04 -1.28 -0.94 -0.97 -1.19 -1.07 -0.85 -1.23 -1.24 -0.78 -1.30 -0.57 -0.50 -1.00 -1.10 -0.98 -1.00
WB-2020-180 1.06 1.65 1.06 1.61 0.76 1.64 1.50 0.87 0.44 1.97 1.83 0.83 1.47 0.20 0.46 0.62 -0.23 -0.71 0.95
WB-N-7 -0.96 -0.66 -1.02 -0.83 0.12 -0.48 -0.86 -1.08 -1.17 -0.73 -0.74 -0.98 -1.19 -1.17 -1.18 -0.88 -0.23 0.11 -0.77
WB-6 1.06 0.43 1.42 1.30 0.60 0.02 1.08 1.72 2.01 1.01 0.94 0.22 0.40 0.69 -0.17 1.00 0.47 -0.62 0.75
WB-333 -0.96 -0.86 -0.90 -0.96 -0.91 -0.90 -0.94 -0.99 -0.93 -0.85 -0.88 -1.02 -0.86 -1.04 -0.57 -1.00 -0.74 0.20 -0.84
WB-1496 -0.96 -0.90 -0.75 0.01 -0.94 -1.12 -0.55 -0.55 -0.73 0.04 -0.28 -0.70 -0.98 -0.68 -1.69 -1.13 -0.54 -0.43 -0.72
WB-1282 -0.96 -0.95 -1.10 -1.04 -0.92 -0.73 -1.06 -1.04 -1.05 -1.06 -1.07 -1.02 -1.18 -0.94 -0.85 -0.88 -0.71 -1.07 -0.98
WB-1683 -0.96 -0.61 -0.64 -0.35 0.11 -0.94 -0.53 -0.82 -0.89 0.06 -0.19 -0.77 -1.32 -1.04 -1.73 -0.75 -0.26 -0.89 -0.70
WB-111 1.06 0.84 1.39 1.23 1.70 0.45 1.20 1.35 1.46 1.25 1.18 1.09 0.10 1.15 -0.38 1.00 1.46 -0.34 0.96
WB-83 1.06 0.72 0.99 1.06 1.66 0.72 0.97 1.23 1.15 0.73 0.80 1.08 2.24 1.27 1.76 0.62 1.48 1.57 1.17
21
22 Journal of Food Legumes 35 (1), 2022

were sundried and kept in plastic boxes for three
weeks for equilibration of moisture content. For
accelerated aging (AA), seeds were stored at
600C for 96 hours at 95% relative humidity. The
percent water absorption was determined by
rst soaking 30 seeds for 24 h in de-ionized water
at room temperature and dividing the difference
in weight before and after soaking by the dry
weight of the 30-seed sample.
GCT (Genotype by cooking * trait) data
The GCT data presented in Table 2 was obtained
by taking trait data as a function of cooing time score
using procedure proposed by Yan and Fregeau-Reid
(2018). For traits such as coat proportion and seed
hardness after cooking , where higher values are
undesirable, GCT values were obtained by dividing
the cooking time score with the trait value for each
genotype (CTS/CP and CTS/HA). This ensures that
in the GCT table a larger value is always more
desirable. The units for the yield-trait combinations
are not important as it is the standardized data that are
used in genotype evaluation.
Data standardization
The GCT table was standardized so that the
mean for each trait or yield-trait combination becomes
0 and the variance becomes unit (Table 3). The
standardization was performed as:
(Tij - Tj)
Pij =
Sj
where Pij is the standardized value of genotype i
for trait or yield-trait combination j in the
standardized table, Tij is the mean value of genotype i
across years for trait or cooking time-trait
combination j in the GC*T table (Tables 2), Tj is the
mean across genotypes for trait or cooking time-trait
combination j, and Sj is the standard deviation for trait
or cooking time-trait combination j.
GT (Genotype by trait) biplot
The GT biplots (Fig. 1a) was based on the rst
two principal components (PC) resulting from
singular value decomposition (SVD) of the
standardized GT table. SVD decomposes the GT table
into genotype Eigen values, trait Eigen values, and
singular values. The GT biplot was based on trait-
standardized GT data (indicated by “Scaling = 1” and
“Centering = 2” on the biplot) and trait-focused
singular value partitioning (indicated by “SVP = 2”).
GCT (Genotype by cooking time score* trait) biplot
The GCT biplots (Fig. ?) was constructed in
exactly the same manner as that used for construction
of GT biplot barring that the term “trait” was replaced
with “cooking time score-trait combination.”
Statistical analysis
The multivariate analysis based on GT and GC*T
values was done using the software STAR (Statistical
Tool for Agricultural Research) version 2.0.1
developed by IRRI (International Rice Research
Institute, Los Banos, Phillipines) (IRRI, 2020)
RESULTS AND DISCUSSION
Trait relationships by Genotype by trait (GT) biplot
The mean data of 18 recorded seed physical traits
for 40 sampled genotypes across two years during
2020-2021 is presented in Table 1. The genotypes WB-
216 and WB-1518 were fast cooking in terms of
cooking time score (5) followed by WB-1678, GLP-1,
WB-1634, WB-N-14, WB-869, WB-957, WB-501, WB-
22, WB-2020-180, WB-6, WB-111, WB-83 (with cooking
time score of 4). Eighteen genotypes were hard to cook
whereas eight genotypes were intermediate in
cooking time score. The GT data are approximately
displayed in a GT biplot (Fig. 2a and 3a), which can be
used to visualize the trait associations. In terms of the
trait-standardized GT data, when two vectors are
close, forming a small angle (acute, < 900), the two
variables they represent are strongly positively
correlated. If vector rays meet each other at ~ 90°, they
are not likely to be correlated. Similarly, if the rays
Fig 2 a: GT biplot for 18 seed physical traits in 40 common
bean genotypes
 So et al.: Multivariate analysis for identication of fast cooking beans 23

deciencies.
Trait relationships by Genotype by cooking time
score*trait (GCT) biplot
As originally proposed by Yan and Fregeau-Reid
(2018), the GC*T table (Table 2) was constructed from
the original GT table (Table 1) as elaborated in
materials and methods. In the GC*T estimates
division is operated in case of coat proportion and
hardness after cooking whereas for other traits
multiplication is operated to create respective GC*T
values for a genotype, resulting in a situation where
higher GC*T values are more desirable and the mean
ranking on the basis of GC*T values are free from any
ambiguity on account of differential direction of
individual GC*T values. The GC*T biplot (Fig. 2b and
Fig 2 b: GC*T biplot for 18 seed physical traits in 40 3b) graphically represent the GC*T table. In the GC*T
common bean genotypes biplot since cooking time is included in all GC*T
values, all the traits tend to be positively correlated as
diverge and form a large angle (close to 180°), they are indicated by the acute angles of all trait vectors
negatively correlated. In the present study, based on segregated on the same side of biplot. However, the
the factor loading graph (Figure 1a), cooking time degree of effective trait relationships is depicted by
score is strongly correlated with water absorption, the degree of angle between the traits. Thus in effect,
hilum length, seed width, seed thickness, seed volume the GC*T biplot retains the positive trait correlations
and surface area, while as cooking time score was that are depicted by the GT biplot. Similarly the traits
negatively correlated with seed hardness (after such as CT*HWSW is negatively correlated with
cooking) and hilum breadth. The GT biplot can thus be
effectively used as independent selection criteria
based on several traits and in yield trials for grain
yield evaluation (Yan and Rajcan, 2012). The vector
length (the distance to the biplot origin) of a trait
indicates how well the trait is represented in the
biplot; a relatively short vector indicates that the
variation of the trait across genotypes is either small or
not well presented in the biplot, which is due to its
weak or lack of correlation with other traits (Yan and
Fregeau-Reid, 2018). This invariably occurs due to
poor goodness of t of the biplot as the two PCs (PC1
and PC2) account for only a part of total variation (the
goodness of t of the GT biplot in Fig. 1a is 54.46 %).
Similar results have been reported in beans by Correa
et al. (2010), Iram Saba et al. (2016) and Syanda et al.
(2018). However, despite the usefulness of GT biplots
in elucidating the trait associations and trait proles of
genotypes, the GT biplot is not always efcient in
selection or rejection of cultivars as the trait
associations are dispersed in all directions and may
not dispel the value of a trait even though the existing
hypotheses may stand for a potential role. The GC*T
biplot as proposed by Yan and Fregeau-Reid (2018)
and validated in earlier study (So et al. 2021) and the
Fig 3 a:Path diagram of GT PCA for 18 seed physical traits
present study is expected to overcome these
in 40 common bean genotypes based on rst 3 components
24 Journal of Food Legumes 35 (1), 2022

In cases of involving complex traits such cooking

time that is a result of large number of physical,
physiological and biochemical traits, plant breeders
invariably nd selection based on multiple trait
evaluations as too complicated to handle efciently
(Yan and Fregeau-Reid, 2018). In earlier methods such
as individual cull and index selection, breeders
invariably apply their collective wisdom to set more
subjective weights and truncation points for each
contributing trait in making decisions regarding
selection or otherwise. The GY*T biplot as originally
proposed by Yan and Fregeau-Reid (2018) was
validated in this paper to provide for its use in case of
multiple trait evaluations of germplasm. This method
is based on normal multivariate analysis based on
standardized GC*T data but can provide more
comprehensive insight into target-component
relationship and has been found to be more effective
in reliable ranking of the genotypes by a combined
GC*T value from target and component traits used in
evaluation procedure across different crops (So et al.
2020, 2021). There is increased published evidence to
Fig 3 b:Path diagram of GC*T PCA for 18 seed physical traits state that method is signicantly more efcient in
in 40 common bean genotypes based on rst 2 components delineating genotypic strengths and weaknesses vis-
a-vis cooking time and seed physical traits.
cooking time score as shown by the angles between
these traits. As against the traditional GT biplot Ranking of genotypes for selection of fast cooking
approach where genotypes are ranked on the basis of beans
their levels in individual traits, the GC*T biplot not The mean similarity index (Table 4) revealed that
only ranks genotypes based on their levels in the genotypes WB-216 had highest mean value (2.14)
combining cooking time score with seed physical based on mean Pij values, followed by WB-1518 (1.45),
traits, but simultaneously shows their trait proles in WB-83 (1.17), GLP-1 (1.10 )and WB-N-14 (1.03) while
terms of their strengths and weaknesses. GC*T as highest negative values were recorded for WB-371
method is graphical, objective, effective, and (-1.005) followed by WB-1282 (-0.98). Out of 40
straightforward. A major consideration in the genotypes, 18 had positive values of mean superiority
reliability of results in GT biplot is the goodness of t index while as 22 had negative values. The mean
as indicated by the amount of variation accounted for superiority index provides a better picture as
by the rst two PC's. Here we could demonstrate that compared to a normal trait values, as, it takes care of
the GC*T approach increases the goodness of t as the both target trait superiority (cooking time in our case)
variation accounted for by rst two PC's was 88.40 % as well as all contributing traits regardless of their
of variation (Table 3) as against 55.46 % in GT direction of linear relationship in terms of how the
approach. higher or lower values of contributing traits are
Table 3: Comparative Eigen value, variability translated into the better target trait values (Yan and
contribution of rst two PC's in PCA based on GT and Fregeau-Reid, 2018). Moreover, for improvement of a
GY*T datasets complex trait like cooking, there are various
compensatory trait directions that ultimately
Component GT GY*T culminate in better target trait expression.
PC1 PC2 PC1 PC2
The ranking based on mean superiority index
Eigen value 2.43 2.19 14.81 1.09 offsets the subjective weightage and truncation of
Variability (%) 32.91 22.65 82.30 6.10 traits assumed by plant breeders and as such is more
objective treatment of multi-trait datasets. The mean
Cumulative % 32.91 55.46 82.30 88.40
 So et al.: Multivariate analysis for identication of fast cooking beans
superiority index so calculated is more meaningful
and effective tool to rank genotypes based on various
yield-trait combinations and to show the strengths
and weaknesses of the genotypes. The superiority
index integrating all yield-trait combinations can be
easily calculated using a spreadsheet by creating a
standardized GYT table from GYT table which in turn
is created from GT table followed by calculation of
mean across the standardized yield-trait combination
values for each genotype. In this method the observed
superiority of a genotype is not only a function of its
seed physical traits and cooking time per se but is also
elucidated by combining cooking time with seed
physical traits (So et al. 2021). Therefore, the obvious
novelty of this approach is the paradigm shift in our
appreciation of the fact that observed values of seed
physical traits of genotypes per se have no signicance
unless they are translated into faster cooking trait.
This makes the GC*T approach more meaningful as
compared to GT based on traits per se. The genotypic
classication based on GC*T biplot (Fig 4) clearly
distinguished the genotypes that corresponded with
mean superiority index (MSI) values generated from
standardized GC*T table. The genotypes WB-216,
WB-1518 and WB-1634 were grouped as separate,
while as most other genotypes were grouped in
clusters as per their MSI values. This further
substantiates the reliability of GC*T approach for use
in complex traits that are implicated by large number
of underlying physical and biochemical mechanisms.
Fig 4: Genotypic clustering based on GC*T approach in
common bean for cooking quality
CONCLUSION
The present study provided experimental
evidence to validate the comparative efciency of
GC*T approach which is originally proposed for
25
complex trait like yield. Since cooking time is also a
complex trait governed by a large number of seed
physical, physiological and biochemical parameters
and as such it is imperative to develop an index that
not only delineates the component trait relationships
but also their contribution towards target trait as well
as removes the subjectivity of available index
selection methods. This approach provides a better
insight in the trait values as well as helps identify the
superior genotypes as well as underlying traits that
confer superiority.
ACKNOWLEDGEMENT
The nancial support from J&K State
Technology & Innovation Council (Grant #
JKSTIC/SRE/1058-62) is highly acknowledged
CONFLICT OF INTEREST
The authors declare no conict of interest
AUTHOR CONTRIBUTIONS
PAS conceived the research and design of
experiment, analyzed the data and lead the
manuscript preparation; SR, SF, SS, AZ executed the
experiment
REFERENCES
Araujo KC and Vivas M. 2018. Multivariate analysis
used as a tool to select snap bean (Phaseolus
vulgaris L.) genotypes. Australian Journal Crop
Science 12(1): 67.
Aykroyd WR, Doughty J and Walker A. 1982.
Legumes in Human Nutrition. Food and
Agricultural Organization of the United Nations
(FAO), Food and Nutrition Paper. No.20, FAO,
Rome.
Cichy KA, Wiesinger JA and Mendoza FA. 2015.
Genetic diversity and genome-wide association
analysis of cooking time in dry bean (Phaseolus
vulgaris L.). Theoretical and Applied Genetics.
128(8): 1555-1567.
Costa GE, Da Silva K, Queiroz-Monici SMP and de
Oliveira AC. 2006. Chemical composition, dietary
bre and resistant starch contents of raw and
cooked pea, common bean, chickpea and lentil
legumes. Food Chemistry 94(3): 327-330.
de-Kock C. 2005. Bambara Groundnut. In: Speciality
foods of Africa Pvt Ltd, Harare, Zimbabwe.
undated: Zimbabwe.
Destro D, Faria AP, Destro TM, Faria RTD, Gonçalves
26 Journal of Food Legumes 35 (1), 2022
LSA and Lima WF. 2013. Food type soybean
cooking time: a review. Crop Breeding and
Applied Biotechnology 13: 194-199.
El-Moniem GMA. 1999. Sensory evaluation and in
vitro protein digestibility of mung bean as
affected by cooking time. Journal of the Science of
Food and Agriculture 79(14): 2025-2028.
Hauhouout-O'hara M, Criner R, Brusewitz GH and
Solie JB. 2000. Selected physical characteristics
and aerodynamic properties of cheat seed for
separation from wheat. GIGR Journal of Scientic
Research and Development 2: 1-14
Iram Saba, So PA, Zeerak NA and Zargar IA. 2015.
Evaluation of Common Bean (Phaseolus vulgaris
L.) for Seed Physical, Cooking and Sensory Traits.
Trends in Biosciences 8(24): 6788-6795
Iram Saba, So PA, Zeerak NA, Bhat MA and Mir RR.
2016. Characterisation of a core set of common
bean (Phaseolus vulgaris L.) germplasm for seed
quality traits. SABRAO Journal of Breeding and
Genetics 48(3): 359-376.
IRRI. 2020. Statistical Tool for Agricultural Research.
STAR.2.0.1. http://bbi.irri.org
Kelly JD and Cichy KA. 2012. Dry bean breeding and
production technologies. Dry beans and Pulses:
Production, Processing and Nutrition Pp23-54.
Mohsenin NN. 1970. Physical Properties of Plant and
Animal Materials. Gordon and Breach Science
Publishers, New York
Oliveira TR, Gravina AD, Oliveira GD, Araújo GH,
Araújo HC, Daher L and Cruz D. 2018. The GT
biplot analysis of green bean traits. Ciência Rural
48(6): 1-6
Onayemi O and Osibogun OA. 1986. Effect of different
storage and cooking methods on some
biochemical, nutritional and sensory
characteristics of cowpea. Journal of Food Science
51(1): 153-156.
Revilla I and Vivar-Quintana AM. 2008. Effect of
canning process on texture of Faba beans (Vicia faba
L.). Food Chemistry 106(1): 310-314.
Shehata AM. 1992. Hard to cook phenomenon in
legumes. Food Reviews International 8(2): 191-
221.
So PA, Asmat Ara and Musharib Gul. 2020. GY*T
biplot: An efcient approach for genotypic
selection in multiple trait evaluations: case study
of cowpea (Vigna unguiculata l.). Agricultural
Research Journal 57:140-47
So PA, Iram Saba, Asmat Ara and Rehman K. 2021.
Comparative Efciency of GY* T Approach Over
GT Approach in Genotypic Selection in Multiple
Trait Evaluations: Case Study of Common Bean
(Phaseolus vulgaris L.) Grown Under Temperate
Himalayan Conditions. Agricultural Research
https://doi.org/10.1007/s40003-021-00577-5
Taiwo KA, Akanbi C and Ajibola OO. 1997. The
effects of soaking and cooking time on the
cooking properties of two cowpea varieties.
Journal of Food Engineering 33(3-4): 337-346.
Vindiola OL, Seib PA and. Hoseney RC. 1986.
Accelerated development of the hard-to-cook
state in beans. Cereal Foods World 31(8): 538-552.
Wani IA, Sogi DS, Wani AA and Gill BS. 2017. Physical
and cooking characteristics of some Indian
kidney bean (Phaseolus vulgaris L.) cultivars.
Journal of the Saudi Society of Agricultural
Sciences 16(1): 7-15.
Xu N, Fok M, Li J, Yang X and Yan W. 2017.
Optimization of cotton variety registration
criteria aided with a genotype-by-trait biplot
analysis. Scientic Reports 7(1): 17237.
Yan W. 2014. Crop variety trials: Data management
and analysis. John Wiley & Sons.
Yan W and Frégeau-Reid J. 2018. Genotype by Yield*
Trait (GYT) Biplot: a Novel Approach for
Genotype Selection based on Multiple Traits.
Scientic Reports 8(1): 1-10
Yan W, Kang MS, Ma B, Woods S and Cornelius PL.
2007. GGE biplot vs. AMMI analysis of genotype-
by-environment data. Crop science 47(2): 643-653
Yan W and Rajcan I. 2002. Biplot analysis of test sites
and trait relations of soybean in Ontario. Crop
Science 42: 11-20.
 Journal of Food Legumes 35(1): 27-40, 2022

Identication and characterization of oxalyl-CoA synthetase gene

(LsAAE3) in grasspea (Lathyrus sativus L.)
Neetu Singh Kushwah*, Shanmugavadivel PS, Alok Das, Meenal Rathore,
Archana Singh, and Narendra Pratap Singh

ICAR-Indian Institute of Pulses Research, ABSTRACT

Kanpur-208 024, India.
*E-mail: neeturajawat@gmail.com
Received: 20 February, 2022
Accepted: 12 May, 2022
Handling Editor:
Dr. Dinesh Yadav, DDU University,
Gorakhpur
Grasspea is a pulse crop popular due to its hardiness and low cost of
production. Presence of the anti-nutritional factor 'β-ODAP' in seeds
and other plant parts hinders widespread cultivation and usage of
grasspea. Oxalyl-CoA synthetase is one of the key enzymes of the CoA-
dependent pathway of oxalate degradation and the β-ODAP
biosynthesis pathway in grasspea. ACYL ACTIVATING ENZYME 3
(AAE3) gene has been characterised to encode an oxalyl-CoA synthetase
enzyme in many plant species. We report here the identication and
isolation of full-length AAE3 homolog in grasspea. The AAE3 homolog
in grasspea was identied by PCR using degenerate primers. The partial
gene sequence was then used for identication and cloning of full-
length gene by the RT-PCR method. Determination of LsAAE3 gene and
protein structure and phylogenetic relationship analysis strongly
suggests that LsAAE3 is a true homolog of AAE3 gene that encodes an
oxalyl-CoA synthetase. Subcellular localization and expression pattern
of grasspea AAE3 was similar to AAE3 orthologs specically involved in
CoA-dependent pathway oxalate degradation, thus indicating the
existence of CoA-dependent pathway of oxalate degradation in
grasspea. The existence of this catabolic pathway in grasspea was further
conrmed by the identication of other components of the CoA-
dependent pathway of oxalate degradation in the transcriptome datasets
of grasspea. These ndings suggest that LsAAE3 encoded oxalyl-CoA
synthetase most likely functions in CoA-dependent pathway of oxalate
degradation. As grasspea also uses oxalate and oxalyl-CoA synthetase
for the biosynthesis of β-ODAP, therefore, this study paves way for
functional characterization of LsAAE3 gene to understand how the CoA-
dependent pathway of oxalate degradation and β-ODAP biosynthesis
pathway in grasspea are regulated.
Key words: β-ODAP; CoA-dependent pathway of oxalate degradation;
Expression analysis; Grasspea, LsAAE3; Oxalyl-CoA synthetase

INTRODUCTION 2005; Nakata, 2015). However, high concentrations of

free oxalate in the cytosol are toxic as it is a strong acid,
Oxalate, the smallest dicarboxylic acid, is widely
reductant, and chelator of divalent cations. For
distributed in plants in soluble and insoluble forms.
instance, exposure of renal epithelial cells to this
Its biosynthesis in plants occurs through several
strong acid can result in a series of harmful effects like
pathways and glycolate, glyoxylate, isocitrate,
increased free radical production, disruption of
oxaloacetate and L-ascorbic acid have been proposed
membrane integrity, mitochondrial metabolism, and
to serve as a possible substrate for forming oxalic acid
metal precipitation (Scheid et al., 1996). Some plant
(Franceschi and Nakata, 2005). Oxalate has been
pathogenic fungi utilise the toxic attributes of oxalate
shown to function in calcium regulation, plant
for invasion of plant tissue. For example, Sclerotinia
protection against herbivory, and heavy metal
sclerotiorum synthesizes and secret oxalic acid to assist
detoxication (Nakata, 2003; Franceschi and Nakata,
the entry of fungus into plant tissue, possibly by
28 Journal of Food Legumes 35 (1), 2022
acidifying plant tissue surrounding the site of
infection and causing tissue damage (Dutton and
Evans, 1996). This acidication by oxalic acid
enhances the activity of cell wall-degrading enzymes
(Dong et al., 2008). Further, it can chelate calcium ions
present in the cell wall and weaken the host cell wall
(Bateman and Beer, 1965). Besides, oxalic acid also
stimulates the stomatal opening (Guimarães and
Stotz, 2004) and elicits programmed cell death (Kim et
al., 2008). These harmful effects of oxalic acid indicate
that oxalate degradation is important for the growth
and development and overall health of the plants.
In plants, two pathways for oxalate degradation
have been proposed, viz. via oxidation and via the
CoA-dependent pathway of oxalate degradation. The
oxidation pathway of oxalate degradation is mediated
by cell wall localised oxalate oxidase, which catalyses
the oxygen-dependent degradation of oxalate into
CO2 and H2O2 (Lane, 2002; Svedruži´c et al., 2005).
However, oxalate oxidase activity has not been
detected in all plants (Membré et al.1997; Membré et
al. 2000). The CoA-dependent pathway is another
pathway of oxalate degradation that proceeds from
oxalate to oxalyl-CoA to formyl-CoA to formate and
nally to CO2 (Foster et al. 2012; Giovanelli and Tobin,
1961). The key enzymes of this pathway are: oxalyl-
CoA synthetase, oxalyl-CoA decarboxylase, formyl-
CoA hydrolase and formate dehydrogenase (Foster et
al., 2012; Fig 1a). Oxalyl-CoA synthetase is proposed
to catalyse the rst step of CoA-dependent pathway of
oxalate degradation (Giovanelli, 1966). This enzyme
activity has been reported in a variety of plants
(Malathi et al. 1970; Adsule and Barat, 1977).
However, no gene encoding oxalyl-CoA synthetase
Fig. 1. Schematic representation of proposed ODAP
biosynthesis and CoA-dependent pathway of oxalate
catabolism in plants. a ODAP biosynthesis pathway in
grasspea Malathi et al. 1970 b CoA-dependent oxalate
degradation pathway in plants (Foster at al. 2012; Foster et
al. 2016).
enzyme was available until 2011. Foster et al. (2012)
discovered that Acyl Activating Enzyme 3 (AAE3) gene
functions as oxalyl-CoA synthetase. Later, the AAE3
ortholog encoding an oxalyl-CoA synthetase were
reported in various plants, including Medicago
(Foster et al., 2016), Soybean (Xian et al., 2020), rice
bean (Lou et al., 2016), rice (Peng et al., 2017), maize
(Yang et al., 2018), Amaranthus and buckwheat (Chen
et al. 2016) as well as in Saccharomyces cerevisiae (Foster
and Nakata, 2014). Unlike oxalate oxidase, oxalyl-
CoA synthetase activity has been reported in both
dicots and monocots and was found to be located in
the cytosol (Foster et al., 2016; Xian et al., 2020; Xian et
al., 2020; Lou et al., 2016; Yang et al., 2018) suggesting
that the CoA- dependent pathway is the major
pathway of oxalate degradation in plants. However, it
is not known whether such oxalate degradation
pathway also exists in grasspea, that uses oxalate for
the synthesis of neurotoxin'
β-N-Oxalyl-l-α,β-diaminopropionic Acid(β-
ODAP) (Xiong et al., 2015). Published report suggests
that the β-ODAP biosynthesis pathway involves
oxalyl-CoA synthetase and ODAP synthase enzymes
(Malathi et al. 1970). Oxalyl-CoA synthetase catalyses
the conversion of oxalate to oxalyl-CoA, which then
acts as one of the substrates for the ODAP synthase
enzyme to catalyse the formation of β-ODAP (Fig. 1b).
Oxalyl-CoA synthetase appears to be a key enzyme of
both the CoA-dependent pathway of oxalate
degradation and ODAP biosynthesis. Though
biochemical activity of oxalyl-CoA synthetase has
been reported in grasspea (Malathi et al. 1970), but
neither oxalyl-CoA synthetase gene nor the other
components of CoA-dependent pathway of oxalate
degradation have been reported in grasspea, so far. To
understand how β-ODAP biosynthesis and oxalate
degradation pathway are regulated in grasspea, it is
necessary to identify the key genes involved in these
pathways. Here, we identied and cloned the AAE3
gene of grasspea (LsAAE3)and studied its gene
structure and expression pattern using molecular and
bioinformatics tools. We also advance our
understanding of CoA-dependent pathway of oxalate
catabolism in grasspea by identifying the
genesencoding the key enzymes of this pathway.
MATERIALS AND METHODS
Plant materials and growth conditions
Grasspea seeds (cv. Pusa-24) were procured
from ICAR-IIPR, Regional Station, Bhopal (MP),
India. Seeds were sown in pots lled with autoclaved
 Kushwah et al.: Oxalyl-CoA synthetase gene in grasspea 29

vermiculite and grown for 15 to 20 days in the culture Table 1 . Sequences of primers used in various
room, maintained at 23±2°C and 16/8 h light/ dark experiments
photoperiod. Pots were then transferred to the S. No. Primer name Sequence (5'-3')
greenhouse under controlled environment and Primers for amplication of LsAAE3 gene
maintained until owering and podding.
1 Degenerate primer F ATGATHCARTAYAAYGCNACNTGGTA
Cloning and bioinformatics analysis of LsAAE3 2 Degenerate primer R CCDATRTCNCCNGTRTGRAACCA

AAE3 protein sequences from Medicago 3 LsAAE3-1F (+1) CCACGTCCGTGTCTGAATATAAATAT

truncatula (GenBank: XP003599555), Arabidopsis 4 LsAAE3-1R (+429) TCTTGCGCCGGCTTGTTACCTTCT
thaliana (GenBank: NP190468), Oryza sativa (GenBank: 5 LsAAE3-2F (+150) ATGGAAACCGCAACCACCCTCAC
BAS91706) and Vigna umbellata (GenBank:
6 LsAAE3-2R (+1283) AACCAATGTCACCCGTATGAAACC
AOO87786) were retrieved from the NCBI
7 LsAAE3-3F (+1119) GTCAAGAAATGGCTACACTTGATGAG
(https://www.ncbi.nlm.nih.gov/) and subjected to
8 LsAAE3-3R (+1575) GGCAGAGAATCAGTAATGAAAACCTT
multiple sequence alignment by the ClustalW
9 LsAAE3-4F (+1273) TGACATTGGTTACTTTGATTCTGATGG
function of BioEdit (Hall 1999) to identify the
10 LsAAE3-4R(+1394) GATGAGATAGAAGAACAGCATCCACT
conserved region. Degenerate primers (Table 1) were
designed from the conserved region of the AAE3 11 LsAAE3-5F (+1603) TCGCTCCATAGCAGAACACTTTG

proteins to PCR amplify the AAE3 gene from the
genomic DNA of grasspea (cv. Pusa-24). The reaction
mixture comprised of 2.5 µL 10X buffer, 0.5 µL 10 mM
dNTP, 1 µL of each primer (10 µM), 0.5 µLTaq DNA
polymerase, 1 µL DNA (100 ng/µl), 19.5 µl H2O. PCR
conditions were: initial denaturation 94°C for 5 min
followed by 36 cycles of denaturation at 94°C for 1
min, annealing at 52°C for 1 min and extension at 72°C
for 1 min and a nal extension at 72°C for 10 min. The
amplied fragment was cloned into pGEM®-T Easy
vector (Promega, USA) and sequenced. The obtained
sequence was trimmed to remove vector sequence
and then BLAST searched to identify its similarity
with the known AAE3 genes. Two assembled but
uncharacterized grasspea transcriptomes were
retrieved from the GenBank (accession no.
GBSS01000000, Almeida et al. 2014) and Dryad Digital
Repository (http://dx.doi.org/10.5061/
dryad.k9h76; Chapman 2015) and used as a subject to
identify the contigs/transcript matching with the
partial LsAAE3 sequence used as a query. The
identied transcript was subjected to NCBI ORF
nder (https://www.ncbi.nlm.nih.gov/orfnder/)
to nd the Open reading frame (ORF) and translate it
to protein. The predicted protein was subjected to
BLAST to check its similarity with other known AAE3
proteins and ClustalW for multiple sequence
alignment.
LsAAE3 cDNA Isolation
Total RNA was extracted from 2-days-old
seedlings of grasspea using RNA isolation kit
(MilliporeSigma, USA) according to the
manufacturer's instructions. On column DNAse I
treatment (ON-COLUMN DNASE I DIGESTION
12 LsAAE3-5R (+1789) GTCTCATACACGAATCACAAGTTGCATA
Primers for cDNA cloning
13 LsAAE3F-1 ATGGAAACCGCAACCACCCTCAC
14 LsAAE3R-1566 TCAAACTTTAGAAACAAAGTGTTCTGC
Primers for quantitative real time PCR analysis
15 BTTBRTFP TGCCTAGGATCAGCAGCACAC
16 BTTBRTRP TCTCATTCCATTCCCTCGTC
17 LsAAE3RT-F TGACATTGGTTACTTTGATTCTGATGG
18 LsAAE3RT-R GATGAGATAGAAGAACAGCATCCACT
SET, (MilliporeSigma, USA) was given to remove
genomic DNA from the RNA preparation. Total RNA
was used for rst-stand cDNA synthesis using oligo
(dT) and RevertAid reverse transcriptase (Thermo
Scientic, USA) following the manufacturer's
protocol. The LsAAE3 coding sequence was amplied
by PCR using gene specic primers (Table 1), 1uL
cDNA, and phusion High Fidelity (NEB) DNA
polymerase according to the manufacturer's
instructions. The PCR product was A tailed and
cloned into the pGEM-T Easy vector (Promega, USA)
as per the manufacturer's instructions and conrmed
by Sanger sequencing (Eurons Genomics, USA).
Genomic PCR and determination of LsAAE3 gene
structure
Genomic DNA was isolated from young leaves
of grasspea (cv. Pusa-24) using CTAB method (Doyle
and Doyle 1990) with few modications. Five sets of
overlapping primers were designed from the LsAAE3
cDNA/transcript sequence (Table 1) and used to
amplify various overlapping fragments from the
genomic DNA of grasspea. The PCR reaction mixture
comprised 5 µL 5× buffer, 0.5 µL 10 mM dNTP, 1 µL of
each primer (10 µM), 0.3 µL Phusion high-delity
30 Journal of Food Legumes 35 (1), 2022
DNA polymerase 2U/µL, 1 µL DNA (100 ng/µL), 16.2
µL H2O. PCR conditions were: initial denaturation
98°C for 30 s followed by 36 cycles of denaturation at
98°C for 10 s, annealing at 60°C for 30 s, and extension
at 72°C for 1 min and a nal extension at 72°C for 10
min. The amplied fragment was gel eluted using a
gel extraction kit (Genetix, New Delhi) and
sequenced. The obtained genomic sequences were
assembled into a contiguous sequence and aligned
with the LsAAE3 cDNA sequences to identify the gene
structure, number of exons and introns present in the
gene sequences.
Phylogenetic analysis and in silico subcellular
localization study
AAE3 proteins and coding sequences (CDS)
from different plant species were retrieved from the
Legume Information System (LIS), RAP_DP,
http://plants.ensembl.org, Phytozome, TAIR
database and aligned by ClustalW in MEGA5
software (Tamura et al. 2011 ) with the default
parameters. The phylogenetic tree was constructed
using MEGA5 based on neighbor-joining method. To
evaluate the reliability of the tree, a bootstrap analysis
was performed with 1000 replications. The subcellular
localization of LsAAE3 was predicted through
TargetP2.0 (http://www.cbs.dtu.dk/services/
TargetP/), WoLFPSORT (https://wolfpsort.hgc.jp/),
Mitofates (http://mitf.cbrc.jp/MitoFates/cgi-
bin/top.cgi), TPpred3.0 (https://tppred3.biocomp.
unibo.it/welcome/default/index), and SCLpred
(https://schloro.biocomp.unibo.it/) web servers.
Structural bioinformatics
The protein sequence of LsAAE3 was submitted
to swissmodel database (swissmodel.expasy.org/) for
in silico structure prediction based on homologous
crystal structure available in the protein data bank.
The top hit template (PDB Id: 5ie2.1, oxalate-CoA
ligase from Arabidopsis thaliana) was selected to build
3D model of LsAAE3 protein. The stereo-chemical
quality of LsAAE3 protein structure was assessed by
PROCHECK web server (https://servicesn.mbi.
ucla.edu/PROCHECK) and the predicted structure
was visualised through PyMol software.
Total RNA isolation and real time quantitative PCR
analysis
To examine the expression pattern of the LsAAE3
gene in different tissues of grasspea, total RNA from
seedling shoots (6 DAS), seedling roots (6 DAS),
young leaves (10 DAS), open owers, mature leaves
(during podding stage), and early pods were isolated
from the variety Pusa-24. Total RNA isolation was
performed using Trizol reagent (Invitrogen, USA)
(Connolly et al., 2006). DNaseI (Thermo Scientic,
USA) treatment was given to remove any
contaminating DNA. The quantity and purity of RNA
were measured using NanoDrop 8000
Spectrophotometer (Thermo Scientic, USA). One µg
of total RNA was used for reverse transcription
reaction using OligodT primer and RevertAid reverse
transcriptase (Thermo Scientic, USA) following the
manufacturer's protocol. qRT–PCR was performed
using PowerUp SYBR Green Master Mix (Thermo
Scientic, USA) in ABI 7500 real-time PCR system.
PCR reaction was carried out in 10 µL using 5 µL of 2×
SYBR green master mixes, 0.5 µL of each primer, 25.0
ng of cDNA from each sample. The Real-time PCR
program was 50ºC for 2 min, 95ºC for 2 min and then
40 cycles of 95ºC for 15 sec, 60ºC for 1 min followed by
dissociation curve program: 95ºC for 15 sec, 60ºC for 1
min, 95ºC for 30 sec and 60ºC for 15 sec to check for
nonspecic amplication. All the reactions were
conducted in duplicate and each biological replicate
comprised the pooled tissues from 3-5
plants/seedlings. β-tubulin of L. sativus was used as
internal control and primers for β-tubulin were as per
Chakraborty et al. (2018) (Table 1). The gene-specic
primers for LsAAE3 were designed in such a way so
that they anneal to exons anking intron sequences to
identify any potential genomic DNA contamination.
Relative expression levels of LsAAE3 in various
tissues were calculated using the 2–∆∆CT method (Livak
and schmittgen 2001) using root tissue as a calibrator.
In silico identication of CoA dependent pathway of
oxalate degradation
The cDNA sequence of At5g14780 (Formate
dehydrogenase, FDH) and At5g17380 (Oxalyl-CoA
decarboxylase, OCD) were downloaded from the
TAIR database and grasspea transcriptome datasets
were downloaded from the GenBank (accession no.
GBSS01000000, Almeida et al. 2014) and Dryad Digital
Repository (http://dx.doi.org/10.5061/dryad.
k9h76; Chapman 2015). The local nucleotide database
le was created using Bioedit program. The BLASTN
search was performed against the local nucleotide
database le and the homologs of grasspea FDH and
OCD were identied with an E-value of <1e−6 and
exhibiting >70% nucleotide sequence identity. Full
length transcript of grasspea FDH and OCD were then
subjected to NCBI ORF nder and NCBI BLASTP
search to conrm its identity with the other related
 Kushwah et al.: Oxalyl-CoA synthetase gene in grasspea 31

plant species. belonging to diverse organisms. The grasspea AAE3

protein displayed high sequence similarity with the
RESULTS AND DISCUSSION
AAE3 proteins of plants such as PsAAA3 of P. sativum
Identication and Cloning of an grasspea AAE3 (96.5%), MtAAE3 of M. truncatula (88%), CaAAE3 of
Homolog Cicer arietinum (87%), and least sequence similarity
Due to limited availability of suitable genome with the ScAAE3 of Saccharomyces cerevisiae (46%)
sequence information and transcriptome datasets of (Table 2). Thus, we annotated the identied grasspea
grasspea in the public domain, we amplied the AAE3 ORF as LsAAE3. Previous in-silico studies have shown
gene from the genomic DNA of grasspea (cv. Pusa-24) that AAE3 protein sequences are conserved among
using the degenerate primers designed from the plant species (Wang et al. 2011; Chen et al. 2017) and
conserved region (Fig. 2a) of already characterized have been shown to function as oxalyl-CoA
AAE3 proteins of other plants (Foster et al. 2012; synthetase in Arabidopsis, Medicago, rice bean and rice
Foster et al. 2016; Lou et al. 2016; Peng et al. 2017). A as well as in yeast (Foster et al. 2012; Foster and Nakata
~443 bp fragment was PCR amplied (Fig. 2b), cloned 2014; Foster et al. 2016; Lou et al. 2016; Peng et al. 2017).
into the TA-cloning vector (Fig. 2c) and sequenced. Although the biochemical function of LsAAE3 protein
After trimming the vector sequences, 443 bp unique has to be investigated, but its high sequence similarity
sequence having degenerate forward and reverse with the known AAE3 proteins strongly suggests that
primers at the end of sequence was obtained LsAAE3 also functions as oxalyl-CoA synthetase.
(Supplementary Fig. 1). The obtained grasspea
sequence was translated and then BLAST searched Table 2. Percentage amino acid identity of grasspea
against the protein databases which showed 88% LsAAE3 protein with its orthologs in plants and yeast
amino acids sequence identity with the characterised
Plant species (common name) % Amino acids identity
AAE3 gene of M. truncatula (Foster et al. 2016),
and their AAE3 proteins name with the grasspea
conrming that cloned sequence is a true homolog of
and protein size (aa) LsAAE3 protein (521 aa)
AAE3 gene. A BLAST search of the partial AAE3 gene
of grasspea in the two publically available, assembled Pisum sativum (Pea), PsAAE3, 521 96.35%
but unannotated grasspea transcriptome data Cicer arietinum (Chickpea), 87%
(Chapmen et al. 2015; Almeida et al. 2014) identied CaAAE3, 527
two contigs of 1849 bp (c19944_g1_i1) and 2474 bp
Medicago truncatula(Barrel 88%
(GBSS01000590.1) (Fig. 3a) with an E-value of 0.0,
displayed >98% identity with the cloned fragment. clover), MtAAE3, 515
Both the contigs shared an open reading frame (ORF) Glycine max (Soybean), GmAAE3, 81%
of 1566 bp, predicted to encode a protein of 521 amino 518
acids (Fig. 3b), however, the length of 5' and 3' UTR
Vigna umbellata (Rice bean), 79%
varied between the two contigs (Fig. 3a). The contig
GBSS01000590.1 was found to be chimeric, in which VuAAE3, 519
680 bp transcript of elsewhere locus was Vigna radiata(Mungbean), 80%
misassembled (Fig. 3a). Due to error in de novo VrAAE3, 518
transcriptome assembly, it is always preferable to use Arabidopsis thaliana(Arabidopsis), 75%
two and three independent transcriptome datasets
AtAAE3,514
and align them to get the consensus sequences and
accurately predict gene sequence. To further validate Solanum lycoperscicum(Tomato), 74%
the identied sequence, we amplied the full length SlAAE3, 523
coding sequence of AAE3 from the cDNA using the Oryza sativa(Rice), OsAAE3, 518 67%
RT-PCR method, cloned into TA-cloning vector and
Zea mays (Maize), ZmAAE3, 527 67%
sequenced (Supplementary Fig. 2). The sequencing
results revealed the 1566 bp ORF encoding a protein of Sorghum bicolor(Sorghum), 67%
521 amino acids. The deduced full length AAE3 SbAAE3, 530
protein of grasspea was subjected to BLAST search to Saccharomyces cerevisiae (Yeast), 46%
identify its similarity with known AAE3 proteins ScAAE3, 543
aa: amino acids
32 Journal of Food Legumes 35 (1), 2022

a M 1 M 1 2
b c

443 bp

443 bp

Fig. 2. Cloning of grasspea AAE3 homolog by PCR with degenerate primers. a Multiple sequence alignment of characterised
AAE3 proteins. Conserved regions were marked in black lines. Conserved regions selected for degenerate primers were
marked with black boxes. b Agarose gel image of degenerate oligo nucleotide-primed amplicon of AAE3 in grasspea. M: 100
bp ladder; 1: putative partial AAE3amplicon. c Restriction digestion of TA-cloning vector. M: 1 kb ladder, 1: undigested
plasmid; 2: plasmid digested with NotI

Fig. 3. Nucleotide and deduced amino acid sequences of grasspea LsAAE3 transcript. a Alignment of c19944_g1_i1 and
GBSS01000590.1 contigs to determine consensus sequence of cDNA. b Consensus cDNA sequence and deduced amino acid
sequences. The translational start codon is underlined and the translational stop codon is marked with an asterisk
 Kushwah et al.: Oxalyl-CoA synthetase gene in grasspea 33

Determination of LsAAE3 gene structure divergence from the monocots orthologs (Table 3).
Further, phylogenetic relationship analysis using
To elucidate the gene structure, full length
protein and nucleotide sequences revealed clustering
genomic sequence of LsAAE3 is required. Using ve
of the AAE3 genes into two groups, one consisting of
sets of overlapping primers designed around its
AAE3 gene of dicots and the other consisting of
cDNA sequence (Fig. 4; Table 1), full length of the
monocots AAE3 genes. The dicot AAE3 cluster further
LsAAE3 gene from genomic DNA of grasspea (cv.
diverged into legume and non-legume sub-clusters
Pusa-24) was amplied and sequenced. The resultant
(Fig. 6a, b). The legume sub-cluster forms two groups
overlapping sequences were assembled into one
with one comprising of soybean, rice bean and
contiguous fragment (3,555 nucleotides). Alignment
mungbean and the second group including grasspea,
of the LsAAE3 genomic sequence with the LsAAE3
pea, Medicago and chickpea. As expected, closely
cDNA sequence revealed the presence of four exons
related species showed less sequence divergence than
and three introns in the LsAAE3 gene (Fig. 5, GenBank
distantly related species. The close clustering of
accession no. MH469748). Comparison of the LsAAE3
LsAAE3 with the Medicago AAE3 gene that has proven
gene structure with the predicted or characterised
oxalyl-CoA synthetase activity (Foster et al. 2016)
AAE3 genes of dicots, monocots and yeast revealed
suggests that LsAAE3 most likely also functions as
that LsAAE3 shares a highly conserved gene structure
oxalyl-CoA synthetase.
with the dicots AAE3 but showed considerable

Fig. 4. Various primers designed from the grasspea LsAAE3 transcript. Arrows indicate the location of forward and reverse
primers
34 Journal of Food Legumes 35 (1), 2022

Fig. 5. Structure of LsAAE3 gene. The black boxes indicate exons and the black solid lines indicate introns. 5' and 3'
UTR are indicated by gray lines

Table 3. Structure of AAE3 genes in different plant species

AAE3 gene structure Size of AAE3
AAE3 gene
proteins (aa)
No. of exons and their size No of introns and their size
Lathyrus sativus, Four exons, Exon1: 204 bp, Intron1: 92 bp; Intron2: 710 521
(MH469748) Exon2: 1069 bp, Exon3: 104 bp, bp; Intron3: 968 bp
Exon4: 189 bp
Gene size-3555 bp
Pisum sativum, Four exons, Exon1:204 bp, Intron1: 92 bp; Intron2:601 521
uncharacterised Exon2:1069 bp, Exon3:104 bp, bp; Intron3: 869 bp
scaffold, Exon4:189 bp;
Psat0s2062g0040.1 Gene size-3857 bp
Arabidopsis thaliana, Five exons, Exon1: 204 bp; Intron1: 193bp; Intron2: 119 514
At3g48990 Exon2:678 bp; Exon3: 370 bp; bp; Intron3: 249bp; Intron4:
Exon4: 104; Exon5: 189 bp; 158bp
Gene size: 2922 bp
Medicago truncatula, Two isoforms: Isoform1: Four introns, 515
Medtr3g035130.1 Isoform1-Five exons: Exon1: Intron1: 325 bp; Intron2:1485
204 bp; Exon2: 691 bp; Exon3: bp; Intron3: 1711 bp;
360 bp; Exon4: 104 bp; Exon5: Intron4:2659 bp
189 bp, Gene size-8143 kb Isoform2: Three
Medtr3g035130.2 introns,Intron1: 325 bp; 470
Isoform 2-Four exons: Exon1: Intron2:1485 bp; Intron3:1711
204 bp; Exon2:691 bp; Exon3: bp
360 bp; Exon4:158 bp; Gene
size: 7953 bp
Cicer arietinum, Four exons, Exon1: 204 bp; Intron1: 87bp; Intron2: 516 527
uncharacterised Exon2: 1078 bp Exon3: 104 bp; bp; Intron3: 2017 bp
scaffold, Exon4: 198 bp; Gene size: 4205
Ca_23199 bp
Glycine max, Four exons, Exon1: 204 bp; Intron1: 259 bp; Intron2: 1115 518
Glyma.09G138100.1 Exon2: 1060 bp; Exon3: 104 bp; bp; Intron3: 1275bp
Exon4: 189 bp; Gene size: 4637
bp
Vigna radiata, Four exons, Exon1: 204 bp; Intron1: 165 bp; Intron2: 705 520
Vradi01g14280 Exon2: 1063 bp; Exon3: 104 bp; bp; Intron3: 726 bp
Exon4: 189 bp; Gene size: 3615
Oryza sativa, Two exons, Exon1: 204 bp; Intron1: 87 bp 518
Os04g0683700 Exon2: 1353 bp; Gene size: 1900
bp
Zea mays, Two exons, Exon1: 219 bp; Intron1: 116 bp 527
Zm00001d026649 Exon2: 1365 bp; Gene size: 1957
bp
Sorghum bicolor, Two exons, Exon1: 201 bp; Intron 1: 106 bp 530
Sb06g033410 Exon2: 1392;
Gene size: 1965 bp
Saccharomyces One Exon, Exon: 1632 bp; Gene No intron 543
cerevisiae, PCS60 size: 1632 bp
aa: amino acids
 Kushwah et al.: Oxalyl-CoA synthetase gene in grasspea 35

Fig. 6. Phylogenetic relationship of LsAAE3 and its orthologs. a Phylogenetic tree of AAE3 based on nucleotide coding
sequences. b Phylogenetic tree of AAE3 based on proteins sequences. AAE3 proteins were derived from Pisum sativum
(PsAAE3), Lathyrus sativus(LsAAE3; GenBank: MH469748), Cicer arietinum(CaAAE3), Medicago truncatula (MtAAE3),
Glycine max (GmAAE3), Vigna radiata (VrAAE3), Vigna umbellata (VuAAE3), Solanum lycoperscicum (SlAAE3), Arabidopsis
thaliana (AtAAE3), Oryza sativa (OsAAE3), Hordeum vulgare (HvAAE3), Sorghum bicolor (SbAAE3), Zea mays (ZmAAE3),
Saccharomyces cerevisiae (ScAAE3). AtAAE13 (TAIR:AT3G16170), AtAAE14 (TAIR:AT1G30520) of Arabidopsis were
included in the tree as an outgroup

Domain and sequence analysis of LsAAE3 protein amino acid sequence alignment of LsAAE3 with
tArabidopsis and Medicago AAE3 revealed the presence
LsAAE3 is predicted to encode a protein of 521
of highly conserved AMP binding domain
amino acids. Pfam search (http://pfam.xfam.org/
'FLHTSGTTSRPK' and Acetyl-CoA synthetase
search) using the LsAAE3 protein sequence identied
domain 'FGWFHTGDXGXXDXXGYXXLVGRIK'
two conserved domains, a large N-terminal AMP
(Fig. 8) as reported in other AAE3 orthologs (Wang et
binding enzyme domain and smaller C-terminal AMP
al. 2011; Lou et al. 2016: Chen et al. 2017). Recently, the
binding enzyme domain (Fig. 7). These domains are
crystal structure of Arabidopsis AAE3 encoding an
characteristics of ANL superfamily of adenylating
oxalyl-CoA synthetase was elucidated (Fan et al.
enzymes which comprise of three subfamilies: Acyl-
2016). Because of high sequence identity of LsAAE3
CoA synthetases, the non-ribosomal peptide
protein with Arabidopsis and other AAE3 orthologs
synthetases, and the rey luciferase enzymes (Gulick
of dicots (Fig. 6, Table 2), the three dimensional
2009). In Arabidopsis, the Acyl-CoA synthetase
structure of Arabidopsis AtAAE3 can serve as a
family contains 63 different genes which occur in
template for homology modelling of LsAAE3.
seven different clades (Shockey et al. 2003). AAE3
Homology model structure of LsAAE3 revealed the
belongs to clade VII of the family, which consists of
conserved three-dimensional folding patterns similar
three genes, AAE3, AAE13, and AAE14 (Shockey et al.
to Arabidopsis AtAAE3 (Fig. 9a). Structure-based
2003). The biochemical function of all three genes in
sequence alignment revealed that residues involved
the clade VII was identied. AAE14 gene encodes o-
in oxalate and ATP binding are highly conserved
succinyl benzoyl-CoA ligase, AAE13 gene encodes
malonyl-CoA synthetase and AAE3 gene encodes
oxalyl-CoA synthetase (Kim et al. 2008; Chen et al.
2011; Foster et al. 2012). Since LsAAE3 is a grasspea
ortholog of AAE3 and shares close similarity with the
AAE3 clade VII (Fig. 6; Table 2), hence LsAAE3 may Fig. 7. Schematic diagram of the LsAAE3 protein showing
also function as oxalyl-CoA synthetase. Further, the conserved domains
36 Journal of Food Legumes 35 (1), 2022

Fig. 8 Amino acid sequence alignment of oxalyl-CoA synthetase proteins from Oryza sativa (OsAAE3), A. thaliana (AtAAE3),
Vigna umbellata (VuAAE3), M. truncatula (MtAAE3) and Lathyrus sativus (LsAAE3). The conserved AMP binding domain (red
box) and Acetyl-CoA synthetase domain (black box) are indicated.

Model structure of oxalyl-CoA synthetase Model structure of oxalyl-CoA synthetase superimposed

(Yellow) with template structure (Red)

PROCHECK summary for LsAAE3

(http://servicesn.mbi.ucla.edu/PROCHECK)

180 Subject Residue Percentage

Residues in most favoured regions 416 93.7%
135
[A,B,L]

90 Residues in additional allowed 23 5.1%

regions [a,b,l,p]

45 Residues in generously allowed 4 0.9%

Phi (degrees)

regions [~a,~b,~l,~p]
0
Residues in disallowed regions 1 0.2%
-45 Non-glycine and non-proline 444 100.0%
residues
-90
End-residues (excl, Gly and Pro) 3
-135 Glycine residues (shown as 36
triangles)
-180 -135 -90 -45 0 45 90 135 180 Proline residues 31
Phi (degrees)
Ramchandran Plot Total number of residues 514

Fig. 9. Homology-model structure of grasspea oxalyl-CoA synthetase. a The generated model structure of LsAAE3 protein,
model structure was superimposed with the template crystal structure of oxalyl-CoA synthetase from Arabidopsis thaliana. b
Structure based sequence alignment of LsAAE3 protein with the oxalyl-CoA synthetase of A. thaliana, the residues involved in
ATP and oxalate binding are marked by black and red circles, respectively. c Ramachandran plot and procheck summary of
LsAAE3 model structure.
 Kushwah et al.: Oxalyl-CoA synthetase gene in grasspea
between AtAAE3 and LsAAE3 proteins (Fig. 9b). The
quality of LsAAE3 protein structure was checked by
Procheck web server which showed the presence of
93.7% residues in the most favoured region (red) of the
Ramachandran plot (Fig. 9c), indicating predicted
structure of LsAAE3 protein is quite good (Fig. 9c). The
conservation of functional key sites required for
oxalate and ATP binding as well as three-dimensional
fold of LsAAE3 as of AtAAE3 that has been shown to
encode an oxalyl-CoA synthetase (Foster et al. 2012),
assures that LsAAE3 encodes an oxalyl-CoA
synthetase.
In-silico subcellular localization of LsAAE3 protein
The subcellular localization study of LsAAE3
revealed its localization in multiple compartments
with a very low-reliability score. However, none of the
results from different web servers study have
predicted the localization of LsAAE3 in chloroplast or
mitochondria (Table 4). The results are in agreement
with the previous work reported in Medicago,
Arabidopsis, maize, rice, and rice bean, where
localization of AAE3 proteins were reported to be in
the cytoplasm based on the transient or stable
expression of GFP-tagged AAE3 proteins in the plant
cell (Foster et al. 2012; Foster et al. 2016; Lou et al. 2016;
Peng et al. 2017).
Expression analysis of LsAAE3
To estimate the relative expression level of
LsAAE3 gene in different tissues such as seedling
shoot and root, leaf at seedling and podding stage,
ower, and green pod (containing immature seeds),
qRT–PCR assay was performed. The qRT–PCR
detected transcripts of the LsAAE3 gene in different
tissues at varying levels, with the highest being in leaf
and the lowest in root at the seedling stage (Fig. 10a).
Based on report from Arabidopsis and Medicago eFP
browser (http://bar.utoronto.ca/efp2/Arabidopsis/
Arabidopsis_eFPBrowser2.html),
(http://bar.utoronto.ca/efpmedicago/cgi-
Table 4. Summary of possible sub-cellular localization of LsAAE3 protein of grass pea
Protein
name TargetP-2.0 WoLF PSORT
LsAAE3 Other (with Plastid: 4;
likelihood of Endoplasmic
0.9363), No N- Reticulum: 4;
terminal pre- Vacuole: 3;
sequence Chloroplast: 2;
Peroxisome: 1
37
bin/efpWeb.cgi), AAE3 gene of Medicago and
Arabidopsis is also expressed in broad range of tissues.
Similarly, AAE3 orthologue in maize also showed
wider expression patterns in tissues like root, stem,
leaf, husk, silk, tassel, ear, and kernel (Wang et al.
2011).
Identication of CoA-dependent pathway of oxalate
degradation in grasspea
To support that LsAAE3 is indeed an oxalyl-CoA
synthetase specically involved in CoA-dependent
pathway of oxalate degradation, it is necessary to
explore the other components of the pathway to
unequivocally establish the existence of such a
pathway in grasspea. We searched the other genes
encoding enzymes of CoA-dependent pathway of
oxalate degradation, namely, Oxalyl-CoA
decarboxylase (OCD) and Formate dehydrogenase
(FDH) homolog in publically available transcriptome
database of grasspea using known FDH, At5g14780
and OCD, At5g17380 gene of Arabidopsis as a query
(Foster et al. 2012; Foster et al. 2021). For the grasspea
FDH homolog, two transcripts of 1619 bp
(c29619_g1_i3; Chapmen 2015) and 2059 bp
(GBSS01000739.1; Almeida et al. 2014) were identied
that shared 75% nucleotide sequence identity with the
Arabidopsis AtFDH gene. Both the grasspea transcripts
predicted to have an ORF of 1137 bp, encoding a
protein of 378 amino acids. A BLASTP search using
grasspea FDH as a query identied its homologs in
Arabidopsis, Medicago and rice bean that shares 81%,
89% and 81% sequence identity with the AtFDH,
MtFDH and VuFDH proteins, respectively. Similarly,
for the OCD gene, two transcripts of 2984 bp
(c27876_g1_i2; Chapmen 2015) and 2412 bp
(GBSS01001545.1; Almeida et al. 2014) were identied
that displayed 73 to 74% nucleotide sequence identity
with the AtOCD gene of Arabidopsis. Both these
transcripts are predicted to have an ORF of 1716 bp,
encode a protein of 571 amino acids. BLASTP search
using the putative OCD protein of grasspea identied
Sub-cellular localization
TPpred3 SChloro Mitofates
No targeting No chloroplast - No mitochondrial pre -
signal detected targeting peptide sequence
38 Journal of Food Legumes 35 (1), 2022
its homologs in A. thaliana, maize, M. truncatula, which
shared 78%, 74% and 87% amino acid identity with the
AtOCD, ZmOCD, MtOCD proteins, respectively. The
presence of transcript of Oxalyl-CoA decarboxylase
and Formate dehydrogenase gene in the two
independent transcriptome database of grasspea as
well as high similarity of deduced protein with the
known genes indicate the presence of functionally
active CoA-dependent pathway of oxalate
degradation in grasspea. Similar approach has also
been used to support the existence of CoA-dependent
pathway of oxalate degradation in Arabidopsis and
Medicago (Foster et al. 2012; Foster et al. 2016).
Fig. 10. Analysis of LsAAE3 gene transcript in various
tissues of grasspea. Bar chart showing relative expression
of LsAAE3 in tissues like seedling root, seedling shoot,
seedling leaf, mature leaf, ower and green pod (cv. Pusa-
24). Error bar represents Standard Error of six technical
replicates and two biological replicates. Root tissue was
taken as calibrator.
CONCLUSION
This study reports the identication, cloning and
characterization of AAE3 homolog encoding an
oxalyl-CoA synthetase from grasspea. We also found
the existence of CoA-dependent pathway of oxalate
degradation in grasspea. CoA-dependent pathway of
oxalate degradation has been discovered in many
plant species. However, existence of this pathway in
grasspea has special signicance because grasspea
also uses oxalate and oxalyl-CoA synthetase for the
biosynthesis of anti-nutritional compound β-ODAP.
If the entire oxalate is diverted towards the CoA-
dependent pathway of oxalate degradation, the issue
of β-ODAP toxicity in grasspea would be resolved.
Therefore, understanding the regulation of the CoA-
dependent pathway of oxalate degradation and β-
ODAP biosynthesis is important, and identication of
genes encoding the enzyme of these pathways is a
signicant advancement in this direction.
ACKNOWLEDGMENT
The authors are thankful to the Indian Council of
Agricultural Research (ICAR) for providing nancial
support.
CONFLICTS OF INTEREST
The authors declare no competing
nancial/personal interest related to this study.
REFERENCES
Adsule RN, Barat GK. 1977. Occurrence of oxalyl-CoA
synthetase in Indian pulses. Experientia
33(4):416-417
Almeida NF, Leitão ST, Krezdorn N, Rotter B, Winter
P, Rubiales D, and Patto, MCV. 2014. Allelic
diversity in the transcriptomes of contrasting
rust-infected genotypes of Lathyrus sativus, a
lasting resource for smart breeding. BMC Plant
Biol 14(1):1-15
Bateman DF, Beer SV. 1965. Simultaneous Production
and Synergistic Action of Oxalic Acid and
Polygalacturonase during Pathogenesis by
Sclerotium Rolfsii. Phytopathology 55: 204–211.
Chakraborty S, Mitra J, Samanta MK, Sikdar N,
Bhattacharyya J, Manna A et al. 2018. Tissue
specic expression and in-silico characterization
of a putative cysteine synthase gene from
Lathyrus sativus L. Gene Expr Patterns 27:128-134
Chapman MA. 2015. Data from: Transcriptome
sequencing and marker development for four
underutilized legumes. Dryad, Dataset,
https://doi.org/10.5061/dryad.k9h76
Chen H, Kim HU, Weng H. 2011. Malonyl-CoA
synthetase, encoded by ACYL ACTIVATING
ENZYME13, is essential for growth and
development of Arabidopsis. The Plant Cell,
23(6):2247-2262
Chen WW, Fan W, Lou HQ, Yang JL, Zheng SJ. 2017.
Regulating cytoplasmic oxalate homeostasis by
Acyl activating enzyme3 is critical for plant Al
tolerance. Plant Signal Behav 12(1):e1276688
Cheng N, Foster J, Mysore KS, Wen J, Rao X, Nakata
PA. 2018. Effect of Acyl Activating Enzyme
(AAE) 3 on the growth and development of
Medicago truncatula. Biochem Bioph Res Co.
 Kushwah et al.: Oxalyl-CoA synthetase gene in grasspea 39

505(1):255-260 Hall TA. 1999. BioEdit: a user-friendly biological

sequence alignment editor and analysis program
Connolly MA, Clausen PA, Lazar JG. 2006.
for Windows 95/98/NT. Nucleic acids
Preparation of RNA from plant tissue using
symposium series 41:95-98.
trizol. Cold Spring Harbor Protocols, 2006 (1),
pdb-prot4105. Kim HU, Oostende CV, Basset GJ, Browse J. 2008. The
AAE14 gene encodes the Arabidopsis o-
Dong X, Ji R, Guo X, Foster SJ, Chen H, Dong C, Liu Y,
succinylbenzoyl-CoA ligase that is essential for
Hu Q, Liu S. 2008. Expressing a gene encoding
phylloquinone synthesis and photosystem-I
wheat oxalate oxidase enhances resistance to
function. Plant J 54(2): 272-283.
Sclerotinia sclerotiorum in oilseed rape (Brassica
napus). Planta, 228: 331–340. Kim KS, Min JY, Dickman MB. 2008. Oxalic Acid Is an
Elicitor of Plant Programmed Cell Death during
Doyle JJ, Doyle JL. 1990. Isolation of plant DNA from
Sclerotinia sclerotiorum Disease Development.
fresh tissue. Focus 12(13):39-40.
Mol. Plant-Microbe Interact., 21: 605–612.
Dutton MV, Evans CS. (1996) Oxalate production by
Lane BG (2002) Oxalate, Germins, and Higher-Plant
fungi: Its role in pathogenicity and ecology in the
Pathogens. IUBMB Life, 53: 67–75.
soil environment. Can. J. Microbiol. 42: 881–895
Livak KJ, Schmittgen TD. 2001. Analysis of relative
Fan M, Xiao Y, Li M, Chang W. 2016. Crystal
gene expression data using real-time
structures of Arabidopsis thaliana oxalyl-CoA
quantitative PCR and the 2−ΔΔCT method.
synthetase essential for oxalate degradation.
Methods 25(4): 402-408.
Mol. Plant 9(9):1349-1352.
Lou HQ, Fan W, Xu JM, Gong YL, Jin JF, Chen WW et
Foster J, Cheng N, Paris V, Wang L, Wang J, Wang X,
al. 2016. An oxalyl-CoA synthetase is involved in
Nakata PA. 2021. An Arabidopsis Oxalyl-CoA
oxalate degradation and aluminum tolerance.
Decarboxylase, AtOXC, Is Important for Oxalate
Plant Physiol, 172(3):1679-1690
Catabolism in Plants. Int J Mol Sci. 22:3266.
Malathi K, Padmanaban G, Sarma PS. 1970.
Foster J, Kim HU. Nakata PA. 2012. A previously
Biosynthesis of β-N-oxalyl-l-α,β-
unknown oxalyl-CoA synthetase is important
diaminopropionic acid, the Lathyrus sativus
for oxalate catabolism in Arabidopsis. The Plant
neurotoxin. Phytochemistry 9(7):1603-1610.
Cell 24(3):1217-1229.
Membré N, Bernier F, Staiger D, Berna A. 2000.
Foster J, Luo B, Nakata PA. 2016. An oxalyl-CoA
Arabidopsis thaliana germin-like proteins:
dependent pathway of oxalate catabolism plays
Common and specic features point to a variety
a role in regulating calcium oxalate crystal
of functions. Planta 211:345–354.
accumulation and defending against oxalate-
secreting phytopathogens in Medicago Membré, N, Berna A, Neutelings G, David A, David
truncatula. PLoS One 11(2): e0149850. H, Staiger R, Vásquez JS, Raynal M, Delseny M,
Bernier F. 1997. cDNA sequence, genomic
Foster J, Nakata PA. 2014. An oxalyl-CoA synthetase
organization and differential expression of three
is important for oxalate metabolism in
Arabidopsis genes for germin/oxalate oxidase-
Saccharomyces cerevisiae. FEBS letters, 588(1):160-
like proteins. Plant Mol. Biol. 35: 459–469.
166.
Peng C, Liang X, Liu EE, Zhang JJ, Peng XX. 2017. The
Guimarães, R.L.; Stotz, H.U. 2004. Oxalate Production
oxalyl-CoA synthetase-regulated oxalate and its
by Sclerotinia sclerotiorum Deregulates Guard
distinct effects on resistance to bacterial blight
Cells during Infection. Plant Physiol. 136:
and aluminium toxicity in rice. Plant Biol
3703–3711.
19(3):345-353.
Gulick AM. 2009. Conformational dynamics in the
Scheid C, Koul H, Hill WA, Luber-Narod J,
Acyl-CoA synthetases, adenylation domains of
Kennington L, Honeyman T, Jonassen J, Menon,
non-ribosomal peptide synthetases, and rey
M. 1996. Oxalate toxicity in LLC-PK1 cells: Role
luciferase. ACS Chem Biol 4(10): 811-827.
of free radicals. Kidney Int. 49: 413–419.
40 Journal of Food Legumes 35 (1), 2022
Shockey JM, Fulda MS. 2003. Arabidopsis contains a
large superfamily of acyl-activating enzymes.
Phylogenetic and biochemical analysis reveals a
new class of acyl-coenzyme A synthetases. Plant
Physiol 132(2):1065-1076.
Svedruži´c D, Jonsson S, Toyota CG, Reinhardt LA,
Ricagno S, Lindqvist Y, Richards NG. 2005. The
enzymes of oxalate metabolism: Unexpected
structures and mechanisms. Arch. Biochem.
Biophys 433: 176–192.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M,
Kumar S. 2011. MEGA5: molecular evolutionary
genetics analysis using maximum likelihood,
evolutionary distance, and maximum
parsimony methods. Mol Biol Evol 28(10):2731-
2739.
Wang G, Sun X, Wang G, Wang F, Gao Q, Sun X et al
(2011) Opaque7 encodes an acyl-activating
enzyme-like protein that affects storage protein
synthesis in maize endosperm. Genetics
189(4):1281-1295
Xian P, Cai Z, Cheng Y, Lin R, Lian T, Ma Q, Nian H.
2020. Wild soybean oxalyl-CoA synthetase
degrades oxalate and affects the tolerance to
Cadmium and Aluminum stresses. International
Journal of Molecular Sciences 21(22):8869.
Yang J, Fu M, Ji C, Huang Y, Wu Y. 2018. Maize
Oxalyl-CoA Decarboxylase1 degrades oxalate
and affects the seed metabolome and
nutritional quality. The Plant Cell 30(10):2447-
2462
 Journal of Food Legumes 35(1): 41-46, 2022

Identication and validation of new sources of resistance for Mungbean

Yellow Mosaic India Virus in urdbean [Vigna mungo (L.) Hepper]
1 1 2 2
Mohammad Akram , Naimuddin , Debjyoti Sen Gupta , Sanjeev Gupta ,
2 2 3
PK Katiyar , AK Singh and NP Singh

1
Division of Crop Protection; 2Division of
Crop Improvement, 3Division of Plant
Biotechnology, ICAR-Indian Institute of
Pulses Research, Kanpur, India
*Email: naimk@rediffmail.com
Received: 01 December, 2021
Accepted: 20 April, 2022
Handling Editor:
Dr Om Gupta, JNKVV, Jabalpur
ABSTRACT
Mungbean Yellow Mosaic India Virus (MYMIV) causes considerable
damage to the susceptible urdbean cultivars or landraces wherever they
are grown. To manage yellow mosaic disease caused by MYMIV,
development of genetically resistant cultivars is strongly advisable. To
identify a stable source for MYMIV resistance in urdbean a set of sixty-
ve advanced urdbean breeding lines/genotypes were screened under
eld conditions. MYMIV was conrmed by PCR assays in the
symptomatic yellow mosaic leaves of urdbean genotypes. Based on the
disease reactions genotypes were grouped into different categories. The
average disease rating score recorded for test genotypes ranged from 1 to
6.16 as against 8.83 of YMD susceptible check (Co-5). Of the 65 test
genotypes, 43 showed resistant reaction (1-2 scale) during all six years of
testing against YMD. However, eight of them (IPU 10-1, IPU 96-6, IPU 99-
220, IPU 13-7, NP 21, PDU-3, IPU 13-3 and PLU 99-10 ) consistently
showed resistant reaction (disease rating scale 1) with no visible
symptoms on leaves indicating that these genotypes have stable
resistance for MYMIV. Thirteen genotypes were identied as
moderately resistant (disease rating score 3-4). Rest of the genotypes
showed moderately susceptible to highly susceptible reactions (disease
rating score 5-9). The identied MYMIV resistant urdbean genotypes
can be used in yield evaluation trials in breeding programmes.
Key words: Black gram, Disease resistance, Genetic resistance, MYMIV,
Yellow mosaic disease

INTRODUCTION seeds/pod, 1000 seed wt but also the seed colour,

texture and size of the seeds (Gurha et al. 1982). The
Urdbean or blackgram [Vigna mungo (L.)
disease is commonly characterized by yellow mosaic
Hepper] is an important pulse crop grown around the
symptoms in the leaves of affected plants. Symptoms
year under different agro-climatic conditions in India
rst appear as small yellow ecks on young leaves and
and consumed as a source of protein. In India,
subsequently emerging younger leaves exhibit more
urdbean occupied 4.11 m hectares with a total
conspicuous and irregular yellow and green patches
production of 2.45 million tonnes and productivity of
alternating with each other. Yellow spots may also be
596 kg/hectare in 2020-21(Anonymous 2021).
observed on pods and seeds (Williams et al. 1968).
Urdbean is affected by several fungal and viral
Generally, two types of symptoms such as yellow
diseases causing substantial production losses (Singh
mottle and necrotic mottle are observed. These two
and De 2006). Among viral diseases, yellow mosaic
types of distinct symptoms are infact due to varied
disease (YMD), rst described by Williams et al. (1968)
reactions of urdbean genotypes to the YMD causing
and Nene (1973) is the most important biotic
virus (Nair et al. 1974). YMD in urdbean is whitey
constraint faced by the crop in all growing areas of the
transmitted and caused by at least three begomovirus
country. Yield losses due to YMD vary from 10-100%
species viz., Mungbean yellow mosaic India begomovirus
and depend on the stage the crop gets infection (Nene
(MYMIV), Mungbean yellow mosaic begomovirus
1972; Naimuddin et al. 2016). YMD adversely affects
(MYMV), Horsegram yellow mosaic begomovirus
not only yield-related parameters like pods/plant,
(HgYMV), individually or as mixed infection
42 Journal of Food Legumes 35 (1), 2022

(Akram et al. 2020; Mishra et al. 2020). ICAR-Indian Institute of Pulses Research (ICAR-IIPR,
Kanpur) using the pedigree method of breeding. The
Managing viral diseases in general and yellow
other genotypes used are released cultivars or
mosaic disease in urdbean, in particular, has always
germplasm lines from other research centers. To
been a challenge before the researchers; however,
further enhance the resistance level of urdbean
deployment of resistant cultivars is one of the most
genotypes, crosses were made involving YMD
cost-effective and environmentally friendly methods
resistant and agronomically superior genotypes at
to reduce the losses inicted by YMD. Developing
ICAR-IIPR Kanpur. The genotypes with initials of IPU
disease-resistant cultivars is a continuous process and
are the product of crosses made to improve seed yield
a major objective of a crop improvement programme
and related traits besides disease and insect-pest
that requires sources of resistance against target
resistance. Many of these genotypes are currently
disease. Screening of urdbean genotypes to identify
under multi-location evaluation in All India
the sources of resistance (against YMD) therefore
coordinated trials or state adaptive trials and have the
becomes important. Several researchers have
potential to be released as a variety. All the test
screened urdbean genotypes/advanced breeding
genotypes were evaluated continuously for 6 years
materials and identied YMD resistant genotypes
(2015-2020) during Kharif season for their reaction to
(Biswas and Verma 2001; Basandrai et al. 2003; Kumar
yellow mosaic disease caused by Mungbean yellow
and Bal 2012; Gopalaswamy et al. 2012; Panigrahi and
mosaic India virus.
Baisakh 2013; Bag et al. 2014; Peeta Gopi et al. 2016;
Devi et al. 2017; Bhanu et al. 2017; Pavishna et al. 2019). Growing of genotypes
Present paper deals with the screening against YMD
All the genotypes were grown during Kharif
of advanced breeding lines of urdbean developed
2015, 2016, 2017, 2018, 2019 and 2020 in the eld at
from such crosses. The identity of the virus prevalent
Main Campus, ICAR-IIPR Kanpur (26.4499° N,
in the disease (YMD) screening nursery was
80.3319° E). Each genotype was sown in 2 rows of 4
ascertained by PCR assays.
meter length every year alternated by the infector
MATERIALS AND METHODS rows of susceptible genotypes (Co5 or MDU-1) and
the experiment was replicated twice in test years
Urdbean genotypes
(2015-2020) following row-to-row and plant-to-plant
The urdbean genotypes (n=65) and two spacing of 30 x10 cm approximately. Some years, these
susceptible checks, Co-5 and MDU-1were screened genotypes were grown in a at and some years on
against yellow mosaic disease. All the genotypes ridges to avoid water stagnation due to heavy rains.
designated with initials of IPU were developed at The infector-row technique (Fig. 1) is known to ensure
IOI I I t I t i 1 I • Ill II IJ

.-- ---------
... 1 , , , , . , 1 1 1 w u u

-- ----------
1r,11 1 : 1 ~ ) • t 1 • 1 o u u

--
,.
M
----------
ltit~lll'JWUU

--
r, 111
----------
o!,1,/l9191JU

-- ----------
"'1, 1 • ~,. 1 • 9 ut nu

-- ----------
Fig. 1. Field view of the screening using infector row technique (A); severe symptoms (indicated by arrows) of YMD on
susceptible check (cultivar Co-5) used as infector row and resistant genotypes with no visible symptoms of YMD (B); Gel
photographs showing presence of bands (~1kb) amplied from 10 randomly selected infected samples (lane 3-12) of urdbean
genotypes subjected to PCR using MYMIV specic primers during different growing years (2015-2020); Lane M= 1 kb DNA
ladder (Thermo Scientic), Lane 2= Positive control and Lane 3= Negative control in each gel.
 Akram et al.: New sources of resistance for MYMIV in urdbean 43

proper exposure of the test genotype against yellow
mosaic disease-causing viruses which are harboured
by the susceptible genotype (infector-row) and the
virus inoculum is spread to the genotypes by the
whitey vector of YMD. Recommended agronomic
and cultural practices were adopted to raise the crop.
However, no herbicide, insecticide and fungicide
were sprayed. The need-based weeding was done
manually.
Observation of disease data
The YMD data were recorded on a 1-9 scale as
followed in the All Indian Coordinated Research
Project on MULLaRP (Anonymous 2021). Final
observations of disease were recorded when the crop
was 50-60 days old and used for the determination of
genotypes reaction. Finally, the average data of all the
years of disease rating score were used to categorize
the genotypes.
Diagnosis of viruses involved in causing YMD
The identity of the virus causing yellow mosaic
disease in urdbean during the growing seasons was
conrmed by PCR assays. Every year leaves of ten
genotypes samples showing yellow mosaic
symptoms were collected randomly at the crop stage
of 30-45 days and used to detect the virus involved.
The total DNA from the collected leaves was extracted
using DNeasy Plant Mini Kit (Qiagen Inc., USA),
following the manufacturer's instructions. A set of
four primer pairs (NM1/NM2, MYMV-CP-
F/MYMV-CP-R, HgYMV-CP-F/HgYMV-CP-R and
DoYMV-CP-F/DoYMV-CP-R) specic to detect
MYMIV, MYMV, HgYMV and DoYMV were used to
amplify the coat protein region of targeted viruses
(Table 1). The polymerase chain reaction mix (total
volume of 25 μl for each reaction) was prepared using
Dream Taq Green Master Mix 2x (Fermentas) as per
instructions given by the manufacturer. The reaction
was carried out in an automated Mastercycler ProS
(Eppendorf AG, Germany) as per the following
thermal regimes: Initial denaturation at 94 °C for 3
minutes followed by 35 cycles of denaturation at 94°C
for 30 seconds, annealing at 54 °C for 1 minute,
extension at 72 °C for 1 min and a nal step at 72 °C for
10 min. The PCR products were resolved in 1%
agarose gel prepared in 1xTAE buffer and
photographed.
RESULTS AND DISCUSSION
Based on average disease rating, eight genotypes
(IPU 10-1, IPU 96-6, IPU 99-220, IPU 13-7, NP 21, PDU-
3, IPU 13-3 and PLU 99-10) were categorized as
resistant (disease rating scale 1) as these genotypes did
not show any visible symptoms of YMD at any growth
stage of the plants during the six years of testing
(Table 2). Another 35 genotypes (IPU 12-4, UPU 85-15,
IPU 99-200, UH 84-4, IPU 10-16, UH 84-01, PLU 570,

Table 1. Detection of the virus involved in causing yellow mosaic disease and the primers used
Year Number of Result of PCR assays using primer pairs specic
samples tested MYMV MYMIV HgYMV DoYMV
2015 10 All -ve All +ve All -ve All -ve
2016 10 All -ve All +ve All -ve All -ve
2017 10 All -ve All +ve All -ve All -ve
2018 10 All -ve All +ve All -ve All -ve
2019 10 All -ve All +ve All -ve All -ve
2020 10 All -ve All +ve All -ve All -ve
Details of the primers used to detect the viruses causing yellow mosaic disease
Primer ID Sequences 5’…3’ Annealing Expected Virus to be
temperature amplicon size in identied
base pair
NM1 GTATTTGCAKCAWGTTCAAGA 54 ºC ~1000 bp MYMIV
NM2 AGGDGTCATTAGCTTAGC
MYMV -CP-F ATGGG KTCCGTTGTATGCTTG 54 ºC ~1000 bp MYMV
MYMV -CP-R GGCGTCATTAGCATAGGCAAT
HgYMV -CP-F ATGCTTGCAATTAAGTACTTGCA 54 ºC ~1000 bp HgYMV
HgYMV -CP-R TAGGCGTCATTAGCATAGGCA
DoYMV -CP-F CTGTGAAATTTGTGCAGG 54 ºC ~1000 bp DoYMV
DoYMV -CP-R TACGCGGTTGCGAATATGTAT
44 Journal of Food Legumes 35 (1), 2022

Table 2. Categorization of urdbean genotypes based on disease rating score of yellow mosaic disease
*Average Per cent disease Genotypes Reaction
disease rating severity range
score
1 0 IPU 10 -1, IPU 96 -6, IPU 99 -220, IPU 13 -7, NP 21, PDU -3, IPU R
13-3, PLU 99-10
1.16-2 0.1 to 5 IPU 12-4, UPU 85 -15, IPU 99 -200, EH 84 -4, IPU 10 -16, UH 84 -
01, PLU 570, IPU 99 -336, IPU 13 -6, IPU 13 -01, IPU 99 -218, IPU
99-204, IPU 10 -117, IPU 99 -31, IPU 2 -33, IPU 99 -4, IPU 99 -1,
UH 84-04, IPU 12 -29, IPU 99-211, IPU 99-45, PLU 648, NHKD -
31, IPU 13 -5, IPU 12 -19, IPU 88 -31, IPU2-37, V 3108, IPU 96 -3,
IPU 13-10, PLU 96-06, IPU 6-2, IPU 11-6, EH 82-2, IPU 83-2
2.16-3 5.1 to 10 IPU 11-1, IPU 12-9, IPU 12-21, IPU 99-62, IPU 96-1, VBN 7, IPU MR
367, IPU 9-16, IPU 99-40, UPU 85-86
3.83-4 10.1 to 15 PLU 856, PLU 557, IPU 2-43
4.16-4.33 15.1 to 30 PLU 62, UH 82-23 MS
5-6 30.1 to 50 IPU 13-8, IPU 99-222, PLU 710, KARS 159, IPU 12-3 S
6.16 50.1 to 75 IPU 13-4 HS

8.0 75.1 to 90 Nil

8.66-8.83 >90.1 MDU-1, PLU 285, Co-5

*
Average disease rating score based on the disease data recorded consecutively for 6 years

IPU 99-336, IPU 13-6, IPU 13-01, IPU 99-218, IPU 99-
204, IPU 10-117, IPU 99-31, IPU 2-33, IPU 99-4, IPU 99-
1, UH 84-4, IPU 12-29, IPU 99-211, IPU 99-45, PLU 648,
NHKD-31, IPU 13-5, IPU 12-19, IPU 88-31, IPU2-37, V
3108, IPU 96-3, IPU 13-10, PLU 96-06, IPU 6-2, IPU 11-
6, UH 82-2 and IPU 83-2) had a disease rating score
between 1.16-2.0 and were also considered resistant as
per illustration of disease rating score. Thirteen
genotypes (IPU 11-1, IPU 12-9, IPU 12-21, IPU 99-62,
IPU 96-1, VBN 7, IPU 367, IPU 9-16, IPU 99-40, UPU
85-86, PLU 856, PLU 557 and IPU 02-43) were
categorized as moderately resistant with a disease
score of >2 to 4. Two genotypes (PLU 62 and UH 82-23)
were found moderately susceptible (disease rating
score >4 to 5), 5 genotypes (IPU 13-8, IPU 99-222, PLU
710, KARS 159 and IPU 12-3) were susceptible (disease
rating >5 to 6) and one genotype (IPU 13-4) was highly
susceptible (disease rating > 6). Genotypes used as a
susceptible check and one test genotype PLU 285 also
showed highly susceptible reaction with an average
disease rating score of 8.66 to 8.83 (Table 2). Genotypes
with a high level of resistance can be exploited as
sources of resistance in breeding urdbean for YMD
(caused by MYMIV) resistance. Some of the advanced
breeding lines can be evaluated under the AICRP
programme and utilized as YMD resistant cultivars.
Since different viruses are involved in casing
YMD in urdbean (Malathi and Jones 2008; Naimuddin
et al. 2016; Mishra et al. 2020), it is important to
ascertain the identity of the virus causing YMD in a
screening nursery at a location, as it would be more
meaningful to report sources of resistance against the
virus rather than disease. Product of PCR assays
performed using specic primers to ascertain the
identity of the virus prevalent in the disease nursery
analyzed in agarose gel electrophoresis revealed the
presence of an amplicon of the expected size (1000 bp)
with primer pairs specic to MYMIV (Fig. 1) and
indicated that the virus causing YMD in disease
nursery was MYMIV every year. No band was
observed in products of PCR with MYMV, HgYMV
and DoYMV specic primers indicating a negative
reaction (Table 1). Most of the workers (Basandrai et al.
2003; Bhanu et al. 2017; Devi et al. 2017; Gopalaswamy
et al. 2012; Kumar and Bal 2012) have identied and
reported YMD resistant genotypes of urdbean
without ascertaining the identity of the causal virus
responsible for YMD at the place of screening.
However, at present, it is unequivocally proved that
more than one virus causes YMD in urdbean at
different places and therefore while reporting the
sources of resistance against YMD, the identity of the
causal virus should be mandatory.
It is concluded that a high level of eld resistance
is present in urdbean genotypes against MYMIV and
these genotypes can be evaluated for resistance
against other YMD causing viruses such as MYMV
and HgYMV, mostly prevalent in the southern part of
 Akram et al.: New sources of resistance for MYMIV in urdbean
the country to identify the multi-virus resistant
genotypes among them. While evaluating for the
other YMD causing viruses, the identity of the virus
should be ascertained unequivocally. Further, these
genotypes may be used in a breeding programme to
improve the resistance level of the high yielding
urdbean cultivars.
ACKNOWLEDGEMENT
Authors are thankful to the Director, ICAR-
Indian Institute of Pulses Research, Kanpur for
providing facilities and constant encouragement.
REFERENCES
Akram M, Naimuddin K, Pratap A, Muin A, Ahmad S,
Agnihotri AK, Shinde P, Saable PR and Singh
NP. 2020. Molecular characterization of
begomoviruses causing yellow mosaic disease in
Vigna stipulacea and evidence of recombination.
Journal of Food Legumes 33(4):232-244.
Anonymous 2021. Project coordinator report: virtual
group meet on mungbean and urdbean, May
27–28, 2021. AICRP on MULLaRP, ICAR-IIPR,
Kanpur, Annexure VI, page 38.
Bag MK, Gautam NK, Prasad TV, Pandey S, Dutta M
and Roy A. 2014. Evaluation of an Indian
collection of blackgram germplasm and
identication of resistance sources to Mungbean
Yellow Mosaic Virus. Crop Protection 61:92-101.
Basandrai D, Basandrai AK, Singh I and Kalia V. 2003.
Multiple disease resistance against anthracnose,
Cercospora leaf spot, powdery mildew and
mungbean yellow mosaic virus in blackgram
(Vigna mungo). Journal of Mycology and Plant
Pathology 33:56–58.
Bhanu AN, Singh MN and Srivastava K. 2017.
Screening mungbean [Vigna radiata (L.) Wilczek]
genotypes for mungbean yellow mosaic virus
resistance under natural conditions. Advances in
Plant & Agricultural Research 7 (6):417-420. DOI:
10.15406/apar.2017.07.00276
Biswas KK and Varma A. 2001. Evaluation of
resistance in blackgram (Phaseolus mungo) to
variants of mungbean yellow mosaic
geminivirus. Indian Journal of Agricultural
Sciences 71:215–218
Devi CH, Kumari VP, Devi PHS and Sinha B. 2017.
Screening of blackgram genotypes for molecular
variability in reaction to Mungbean yellow
45
mosaic disease. Indian Phytopathology 70 (3) :
353-358. DOI 10.24838/ip.2017.v70.i3.74242
Gopalaswamy SVS, Ramana MV and Krishna YR.
2012. Screening of blackgram entries for
resistance to insect pests and diseases under rice
fallows. Annals of Plant Protection Sciences
20:237-238.
Gurha SN, Misra DP and Kamthan KP. 1982. Studies
on some aspects of yellow mosaic disease of
black gram (Vigna mungo (L.) Hepper). Madras
Agricultural Journal 69:435- 438.
Kumar A and Bal RS. 2012. Screening of blackgram
germplasm against MYMV and Cercospora leaf
spot diseases. Trends in Biosciences 5:127-128.
Malathi VG and John P. 2008. Geminiviruses infecting
legumes. In: Characterization, Diagnosis &
Management of Plant Viruses, Volume 3:
Vegetables and Pulse Crops (G.P. Rao, P. Lava
Kumar and Ramon J. Holguin-Pena, Ed.),
Stadium Press LLC, Texas, USA. Pp 97-123.
Mishra GP, Dikshit HK, Ramesh SV, Tripathi K,
Kumar RR, Muraleedhar A, Singh A, Roy A,
Priti, Kumari N, Dasgupta U, Kumar A, Shelly P
and Nair RM. 2020. Yellow Mosaic Disease
(YMD) of Mungbean (Vigna radiata (L.) Wilczek):
Current Status and Management Opportunities.
Frontiers in Plant Science 11:918: DOI=10.3389/
fpls.2020.00918
Naimuddin K, Akram M and Singh NP. 2016. Yellow
mosaic of mungbean and black gram: current
status and future strategies. Journal of Food
Legumes 29(2): 77-93
Nair NG and Nene YL. 1974. Studies on yellow mosaic
of blackgram (Phaseolus mungo L.) caused by
mungbean yellow mosaic virus. Factors
inuencing transmission and symptom
expression. Indian Journal of Farm Sciences 2:42-
47.
Nene YL. 1972. A survey of viral disease of pulse crops
in Uttar Pradesh. G.B. University of Agriculture
and Technology Research Bulletin No 4, pp: 191
Nene YL. 1973. Viral diseases of warm weather pulse
crops in India. Plant Disease Reporter
57:463–467.
Panigrahi KK and Baisakh B. 2013. Reaction of local
and mutant lines of blackgram (Vigna mungo [L]
Hepper) to yellow mosaic virus and powdery
46 Journal of Food Legumes 35 (1), 2022
mildew. Journal of Plant Protection and
Environment 10: 57-60.
Pavishna M, Kannan R, Arumugam Pillai M and
Rajinimala N. 2019. Screening of blackgram
genotypes against mungbean yellow mosaic
virus disease. Journal of Pharmacognosy and
Phytochemistry 8(3): 4313-4318.
Peeta Gopi, Satyanarayana A, Rama Krishna A and
Sambasiva Rao KRS. 2016. Evaluation of
blackgram germplasm for resistance against
YMV. Journal of Plant Pathology &
Microbiology 7(7):2157-7417
Singh RA and De RK. 2006. Major diseases and their
management. In: Advances in Mungbean and
Urdbean (Eds. Ali M, Kumar S), Indian Institute
of Pulses Research, Kanpur. Pp. 283-334
Williams FJ, Grewal JS and Amin KS. 1968. Serious
and new diseases of pulse crops in India in 1966.
Plant Disease Reporter 52:300-304.
 Journal of Food Legumes 35(1): 47-50, 2022

Population dynamics of major insect-pests of lentil and

correlation with abiotic factors
Dilbag Singh Ahlawat*, Tarun Verma and Rajesh Yadav

CCS Haryana Agricultural University, ABSTRACT

Hisar-125 004, India
*Email: ahlawatento@gmail.com
Received: 14 February, 2022
Accepted: 22 April, 2022
Handling Editor:
Dr Gaurav Kumar Taggar, Punjab
Agriculture University, Ludhiana
Population dynamics of insect-pests, viz. Helicoverpa armigera Hubner,
Etiella zinckenella (Treitschke) and Aphis craccivora Koch on lentil were
studied under eld conditions during Rabi 2018-19 and 2019-20 at
Research farm of CCS Haryana Agricultural University, Regional
Research Station, Rohtak. The rst appearance of H. armigera and E.
zinckenella on lentil was observed from 5th Standard meteorological
week (SMW), while A. craccivora was noted from 1st SMW during both
the years. Peak population of H. armigera (0.96 larvae / plant), E.
zinckenella (1.64 larvae / plant) and A. craccivora (12.22 aphids / plant)
was recorded during the 8th, 10th and 6th SMWs, respectively (Rabi 2018-
19). While, during Rabi 2019-20, the peaks of H. armigera (1.30 larvae /
plant), E. zinckenella (1.65 larvae/ plant) and A. craccivora (10.70 aphids/
plant) were recorded during the 8th, 9th and 6th SMW, respectively. Abiotic
factors viz. temperature showed positive and signicant correlation
with H. armigera and E. zinckenella, while negative correlation with A.
craccivora. Similarly, relative humidity and rainfall showed positive
and signicant correlation with H. armigera and A. craccivora, whereas
negative and signicant correlation was found with E. zinckenella
during 2018-19. However, the association of abiotic factors with insect-
pests was found to be non-signicant during 2019-20.
Key words: Abiotic factors, Aphis craccivora, Correlation, Etiella zinckenella,
Helicoverpa armigera, Lentil, Population dynamics

INTRODUCTION prevailing weather conditions, particularly

temperature and relative humidity (Kumar and
Lentil (Lens culinaris Medikus) locally known as
Yadav, 2018). Etiella zinckenella infests lentil at the
Masoor is a major Rabi season pulse crop grown in
owering and pod formation stages and is considered
India. It ranks second after chickpea among rabi pulse
as main reason of low productivity, besides reduction
crops and occupies an area of 1.3 m ha with average
in the quality of the grains. In India, pod infestation by
production and productivity of 1.10 m tones and 591
E. zinckenella has been reported by various workers,
kg/ha, respectively (Anonymous, 2021). In India
viz. 11.4 per cent (Singh and Dhooria, 1971), 12 to 15
Uttar Pradesh, Bihar, Madhya Pradesh and West
per cent (Sandhu and Verma, 1968) and 17.5 per cent
Bengal are the major states contributing together more
(Jaglan et al., 1993). Yield loss of about 10.6 has been
than 80% in terms of area and production of lentil
reported in lentil due to E. zinckenella by Singh and
crop. Though lentil is the second most important rabi
Dhooria (1971). Aphid causes damage directly by
pulse crop after chickpea, but average yields of this
sucking the phloem from the different parts of the
crop in our country yet low as compared to other
plants (Ali and Rizvi, 2007). Sharma et al. (2014)
countries due to poor crop management, insect pests
reported that aphids feed on the plant sap, disrupting
and diseases incidence, delay sowing and other
the normal plant growth pattern including reduction
management practices. Among the different insect
in root and nodulation growth. At high aphid
pests, aphid (Aphis craccivora Koch.), Helicoverpa
densities, plants are deformed; stunted and seed set is
armigera Hubner, Etiella zinckenella (Treitschke) are
reduced (Sharma et al., 2014). Efforts have been made
major pests of lentil. The population dynamics of
by Kishore et al. (2019) to correlate the temperature
these pests is considered to be inuenced by the
48 Journal of Food Legumes 35 (1), 2022

and relative humidity with the incidence and from the middle 10 cm apical twig. Weather data were
multiplication of aphid in the lentil crop. The collected during the period of study (Table 1) and
uctuations in the aphid population with change in correlated with the incidence of insect-pests.
weather parameters enable to forecast the aphid
RESULTS AND DISCUSSION
population in lentil using statistical approaches.
Statistical forecasting model is the best approach that Data presented in Table 1 and Fig. 1 & 2 predict
would be helpful to provide the prediction of severity about the population dynamics of major insect pests
of pest population or damage over a long period of of lentil during the year 2019 and 2020. Insect-pests,
time along with other variable factors, which affect the viz. H. armigera, E. zinckenella and A. craccivora were
development of pest, may be helpful in forecasting the recorded on the lentil crop from 1st to 13th standard
pest incidence. Thus, an attempt has been made to meteorological weeks (SMW). The population of H.
quantify the relationship between weather armigera and E. zinckenella appeared in the 5th SMW
parameters and pest appearance, disappearance and (0.08 and 0.02 larvae/plant) in 2019, while in 2020, it
their development in lentil crop. appeared in 5 t h and 4 t h SMW (0.08 and 0.02
larvae/plant), with rise in minimum temperature.
MATERIALS AND METHODS
Peak activity of H. armigera was recorded during 8th
A eld experiment was conducted on lentil SMW (0.96 and 1.30 larvae / plant), when the
during winter season of two consecutive years (2018- maximum temperature, minimum temperature,
19 and 2019-20) at Research farm of CCS HAU relative humidity (morning), relative humidity
Regional Research Station, Rohtak (India). Lentil var. (evening), rainfall was 23.10C & 23.4oC, 11.90C &
Garima was sown during second fortnight of 12.4oC, 85.9 & 82.4%, 63.7 & 56.3%, 3 & 0 mm,
November, 2018 and 2019 following the respectively (2019 and 2020). Peak activity of E.
recommended agronomic practices except the zinckenella was recorded during 10th (1.63 larvae /
insecticidal sprays in a randomized block design with plant) and 9th SMW (1.65 larvae / plant) during 2019
ve replications in plot size of 10 x 10 m2. The climate of and 2020, respectively. Aphis craccivora appeared
Rohtak region is semi-arid and is characterized by hot during the 1st SMW (0.48 and 0.42 nymph and
and dry winds during summer months and dry and adults/plant) during 2019 and 2020, when maximum
severe cold conditions during winter months. The and minimum temperature was 19.0 & 17.3 and 7.1&
maximum and minimum temperature shows wide 6.7 0 C, respectively. Peaks of A. craccivora were
range of uctuations during summer, while the recorded during 6th SMW in both the years i.e., 12.22
temperature below freezing point accompanied by and 10.70 nymphs and adults per plant, respectively.
frost may also be recorded during winter months The present ndings are more or less in accordance
(December-January). The rainfall is mainly conned with Manisha et al. (2018) who reported peak
to the monsoon months from July to September, but population of H. armigera (1.55 larvae/plant) and E.
light showers cyclonic rains also occur sometimes zinkenella (5.94 larvae/plant) during the 8th SMW in
during the winter and spring months. The population eld pea. However, Kumar and Yadav (2018)
of H. armigera, E. zinckenella and A. craccivora was recorded the peak population of H. armigera (0.17
recorded in the morning hours at weekly intervals larvae/plant), E. zinckenella (11 larvae+ faecal
starting from rst week of January till the harvesting material/plant) and A. craccivora (15.6 aphids/plant)
of the crop from ve randomly selected tagged plants. on 9th, 12th and 7th SMW crop name, respectively on
Aphid population (nymphs & adults) was recorded lentil crop.
Table 1. Mean population of Helicoverpa armigera, Etiella zinckenella and Aphis craccivora on lentil during Rabi,
2018-19
SMW Max. Temp. R.H. R.H. Rainfall Borer complex/plant Aphid/
Temp. (Min.) morning evening (mm) 10 cm
(oC) (%) (%) apical twig
H. armigera E. zinckenella A. craccivora
2019 2020 2019 2020 2019 2020 2019 2020 2019 2020 2019 2020 2019 2020 2019 2020
1 19.0 17.3 7.1 6.7 93.4 91.1 59.6 78.4 3 7.2 0.00 0.00 0.00 0.00 0.48 0.42
2 19.5 17.3 7.8 7.1 88.6 90.4 53.4 86.0 0 0.0 0.00 0.00 0.00 0.00 1.80 1.62
3 19.8 14.5 5.1 7.5 86.0 92.6 54.4 79.9 0 5.0 0.00 0.00 0.00 0.00 6.30 5.02
 Ahlawat et al.: Major insect-pests of lentil and correlation with abiotic factors 49

4 17.2 18.3 7.3 7.0 90.2 86.7 61.2 58.4 5 12.0 0.00 0.00 0.00 0.02 8.80 7.27
5 18.4 17.7 8.2 5.5 86.6 88.6 59.4 55.5 0 0.0 0.08 0.12 0.02 0.03 10.0 8.59
6 20.6 19.2 9.1 5.4 93.3 85.7 60.3 50.1 8 0.0 0.16 0.20 0.24 0.24 12.20 10.70
7 21.1 23.1 11.4 9.3 94.3 82.4 65.3 40.0 0 0.0 0.38 0.46 0.40 0.43 8.16 9.27
8 23.1 23.4 11.9 12.4 85.9 82.4 63.7 56.3 3 0.0 0.96 1.30 1.09 1.16 7.70 7.58
9 21.0 25.0 9.9 13.7 91.7 92.0 65.7 56.7 4 0.0 0.80 1.24 1.44 1.65 5.16 4.26
10 23.7 22.2 11.3 12.6 83.1 87.1 50.0 61.7 0 90.0 0.72 1.02 1.64 1.19 3.36 2.38
11 24.9 24.3 12.6 13.5 78.0 86.4 52.9 48.6 0 0.0 0.40 0.66 1.31 0.82 0.31 0.21
12 29.8 28.6 16.2 16.2 67.6 82.3 50.0 46.3 2 0.0 0.16 0.24 0.90 0.02 0.10 0.03
13 31.7 26.7 17.9 16.9 70.7 78.6 62.4 49.9 0 0.0 0.00 0.00 0.07 0.00 0.00 0.00
SMW- Standard Meteorological Week

Helicoverpa armigera E ella zinckenella Aphis Craccivora Helicoverpa armigera E ella zinckenella
Temp. (Max) Temp. (Min) R.H. morning (%) Aphis Craccivora Temp. (Max)
14 100 12 100

Temperature ( 0C), Rela ve humidity (%) and

Temperature ( 0C), Rela ve humidity (%)
90 90
12 10
80 80
Insect Popula on/Plant

Insect Popula on/Plant

10 70 70
8
and Rainfall (mm)

Rainfall (mm)
8 60 60
50 6 50
6 40 40
30 4
4 30
20 20
2 2
10 10
0 0 0 0
1 2 3 4 5 6 7 8 9 10 11 12 13 1 2 3 4 5 6 7 8 9 10 11 12 13
Standard Meteorological week Standard Meteorological week

Fig. 1. Weather parameters and insect-pests population Fig. 2. Weather parameters and insect-pests population
during different SMWs (2019) during different SMWs (2020)

The correlation of different weather parameter ndings are in accordance with those of Manisha et al.
with insect-pest population is presented in Table 2. (2018) who reported signicant positive correlation of
During the year 2018-19, temperature (max. and min.), temperature (max. & min.) with the larval population
relative humidity (mor. And eve.) and low rainfall of E. zinkenella on eld pea. However, Vaibhav et al.
showed highly signicant positive correlation with (2018) reported negative and positive correlation of
larval population of H. armigera. However, the maximum temperature and minimum temperature
relative humidity (morning & evening) and rainfall with larval population of E. zinkenella and H.
showed a highly signicant negative correlation with armigera on vegetable pea.
the larval population of E. zinkenella. The present
Table 2.Correlation coefcient between Helicoverpa armigera, Etiella zinkenella and Aphis craccivora during
Rabi, 2018-19 and 2019-20
Insect pests Max. T (oC) Min. T (oC) R.H. (M) R.H. (E) Rainfall (mm)
2018-19 2019-20 2018-19 2019-20 2018-19 2019-20 2018-19 2019-20 2018-19 2019-20
H. armigera 0.110** 0.462NS 0.221** 0.449NS 0.086** -0.059NS 0.201** -0.298 NS 0.061** 0.313NS
E. zinkenella 0.338** 0.406NS 0.385** 0.414NS -0.231** 0.074NS -0.195** -0.238NS -0.046** 0.341NS
A. craccivora -0.592* 0.022NS -0.465** -0.238 NS 0.612* -0.129 NS 0.470** -0.494 NS 0.486** -0.045 NS
*Signicant (P=0.05), **Highly signicant (P=0.01), NS: Non signicant

Temperature (maximum and minimum) and minimum). During the year 2019-2020, H. armigera,
relative humidity (morning) showed a signicant E. zinckenella and A. craccivora population showed a
negative and signicant positive correlation, whereas non-signicant positive and negative correlation with
relative humidity (evening) and rainfall exhibited a the weather parameters.
highly signicant correlation with the aphid
Present ndings concluded the appearance of H.
incidence. Present ndings are in conrmation with
armigera, E. zinckenella and A. craccivora on lentil in 5th ,
those of Kumar and Yadav (2018) who reported a
5th and 1st SMW, respectively. Peaks of H. armigera and
signicant negative correlation of A. craccivora
A. craccivora were recorded during 8th SMW (0.96 &
population with the temperature (maximum and
50 Journal of Food Legumes 35 (1), 2022
1.30 larvae / plant) and 6th SMW (12.22 & 10.70 aphids
/ plant), whereas E. zinckenella attained peaks during
10 th and 9 th SMW (1.64 & 1.65 larvae / plant),
respectively during 2018-19 and 2019-2020.
Temperature (max. & min.) exhibited signicant
positive correlation with H. armigera and E. zinckenella,
while signicant negative correlation with A.
craccivora. Relative humidity (mor. & eve.) and rainfall
showed signicant positive correlation with H.
armigera and A. craccivora, whereas negative and
signicant correlation with E. zinckenella.
ACKNOWLEDGEMENT
The authors thankfully acknowledge CCS HAU,
Regional Research Station, Rohtak (India) for
providing research facilities and Department of
Entomology for their kind cooperation.
REFERENCES
Ali A and Rizvi PQ 2007. Development and predatory
performance of Coccinella septempunctata L. on
different aphid species. Journal of Biological
Science,7: 1478-83.
Anonymous. 2021. Project Coordinator's Report (Rabi
Pulses) 2020-2021. All India Coordinated
Research Project on MULLaRP (Mungbean,
Urdbean, Lentil, Lathyrus, Rajmash & Peas)
online Group Meet on Rabi Pulses held on 16-17
August, 2021.
Jaglan MS, Khokhar KS, Solanki IS. 1993. Screening
lentil for susceptibility to Etiella zinckenella
Treitschke infestation (Lens culinaris). Lens
20(2):13-14.
Kishore DR, Prasad R, Moses S and Singh PP 2019.
Population dynamics of aphid and pod borer on
lentil and their natural enemies during rabi
season 2017 at Pusa, Samastipur. Current Journal
of Applied Sciences and Technology32(2): 1-6.
Kumar G and Yadav SS. 2018. Population dynamics of
major insect-pests of lentil. Journal of
Entomology and Zoology Studies 6(4): 1274-
1276.
Manisha, Verma T, Lal R, Nadaf AV and Devi M.
2018.Seasonal incidence of major insect pests
infesting eld pea. Journal of Entomology and
Zoology Studies 6(2): 2213-2215.
Sandhu GS and Verma GC. 1968. Etiella zinckenella
(Lepidoptera: Phycitidae) as a pod borer of lentil
in the Punjab. Journal ofthe Bombay Natural
History Society. 65(3):799-800.
Sharma OP, Singh SK, Vennila S, Bhagat S, Saini MR,
Kumari A and Chattopadhyay C. 2014. Field
Guide of Lentil Pest and their Management.
Technical Bulletin No. 36. National Centre for
Integrated Pest Management (NCIPM), Indian
Council of Agricultural Research, LBS Building,
IARI Campus, New Delhi – 110012. India. Pp 36.
Singh H and Dhooria MS. 1971. Bionomics of the pea
pod borer, Etiella zinckenella (Treitschke). Indian
Journal of Entomology 33(2): 123-130.
Vaibhav V, Singh G, Deshwal R, Maurya N K and
Vishvendra. 2018. Seasonal incidence of major
pod borers Etiella zinckenella (Treitschke) and
Helicoverpa armigera (Hubner) of vegetable pea in
relation with abiotic factors. Journal of
Entomology and Zoology Studies 6(3): 1642-
1644.
 Journal of Food Legumes 35(1): 51-57, 2022

Biologically effective dose of sodium aciuorfen + clodinofop-

propargyl applied as post emergent for weed management
in greengram
Mudalagiriyappa*, KR Shyamasundar, Pratima Ningaraddi Morab and Subhash Sannappanavar

AICRP for Dryland Agriculture, UAS, ABSTRACT

GKVK, Bengaluru, Karnataka 560065,
India
*E mail: mudal68@yahoo.com
Received: 19 February, 2022
Accepted: 15 April, 2022
Handling Editor:
Dr S. S. Rathore, Indian Agricultural
Research Institute, New Delhi
Field experiments were conducted during Kharif 2015 andSummer2016
at AICRP for Agro-forestry, University of Agricultural Sciences, GKVK,
Bengaluru. The experiments were laid out in RCBD with three
replications comprising of seven treatments. Major weed species
observed were Cyperus rotundus, Eleuisine indica, Dactyloctenium
aegyptium, Borreria articularis, Echinochloa colona, Commelina
benghalensis, Euphorbia geniculata, Phyllanthus nirurietc., Theresults
revealed that post emergence application of sodium aciuorfen 16.5% +
clodinofop-propargyl 8% EC @ 206.25 + 100 g a.i., at 22 DASrecorded
signicantly higher grain yield (1145 kg ha-1) and haulm yield (1650 kg
ha-1), followed by sodium aciuorfen 16.5% + clodinofop-propargyl 8%
EC @ 165 + 80 g a.i., (968 kg ha-1 and 1377 kg ha-1, respectively)with 87.92
per cent weed control efciency when compared to weedy check (460kg
ha-1 and 731 kg ha-1, respectively)with no phytotoxicity effect on
succeeding crop (Finger millet)
Key Words: Bio-efcacy, Greengram, Clodinofop-propargyl, Sodium
aciuorfen, Weed index, Weed control efciency

INTRODUCTION decreasing every year in India as well in Karnataka,

Pulses are considered most important or integral
part of the protein supplement and Indian dietary
system. As the recommendation of the Food and
Agriculture organization, the per capita requirement
of pulses is 80 g per day but current availability is 31.6
g per day. Among the different pulses grown in India,
greengram is the third most important pulse crop in
terms of area, production and productivity next to the
chickpea and pigeonpea. It is third important pulse
crop of India grown in nearly 16 per cent of the total
pulse area of the country. In India it is grown in about
4.5 m ha with a total production of 2.64 mt with a
productivity of 548 kg/hand contributing 10 % to the
pulse production. (Anon, 2021). In Karnataka, it is
widely grown in Kharif and covers an area of 3.05 lakh
ha with a production of 0.92 lakh tonnes and
productivity of 243 kg ha-1(Anon, 2020-21). More than
90 per cent of the growing area is concentrated in the
northern parts of the Karnataka. Mung bean an
annual, herbaceous, self-pollinated pulse crop that
is raised for grain, foodstuff, vegetable, green
manure and feed stock. Yield potential of greengram
when compared to the world.Its input requirement is
very low, and its drought tolerance crop permits it to
face up to adverse environmental conditions,
permitting its successful growth in rainfed areas.
Production of pulses has remained almost
stagnant over the years since green revolution in the
country due to various kinds of biotic and abiotic
stresses. Weeds are the principal biotic constraint in
production of pulses. One of the major reasons for the
decreasing yield due to the inadequate weed
management practices leads to the deceasing yield
trend. It is estimated that out of total annual losses of
agricultural produce from various pests, weeds alone
account for 37% loss, which is higher than insect-pests
or diseases (Kumar et al., 2013a).Uncontrolled weeds
may reduce the yield ranges from 50-90 per cent
depending on the season and cultivars (Kumar etal.,
2006). Therefore, proper weed management may
results in higher yield. Weed interference can be
effectively controlled in greengram by hand weeding
and inter-cultivation,but, timely availability of labour
and continuous rainfall may hinder the management
52 Journal of Food Legumes 35 (1), 2022

practices, besides it is costly and time consuming. So,
to address these problems, chemical control of weeds
i.e., application of herbicides to manage weeds during
the critical period of crop weed competition is very
important. Several pre and post emergent herbicides
are now available in the country. It is necessary to test
the bio-efcacy ofthe newly developedherbicide
molecules which are effective in control of weed ora
at two to three leaf stages of the weeds in greengram.
Keeping the above facts in view an investigation was
carried out study the bio-efcacy and phyto-toxicity
of early post emergent herbicides on growth and yield
of greengram.
MATERIALS AND METHODS
Field experiments were conducted during Kharif
and summer seasons of 2015-16 at theEastern Dry
Zone of Karnataka which is locatedbetween 130 52'
183'' N Latitude and 770 332' 583''Longitude, Gandhi
KrishiVignan Kendra, Universityof Agricultural
Sciences, Bengaluru, Karnataka, India,to determine
the effective doses of sodium aciuorfen +
clodinofoppropargyl on greengram.
Greengramvariety (KKM-3) was sown at aspacing of
30 × 10 cm during Kharif (rainy season) 2015, the
available N, P and K were 253, 32and 260 kg/ha,
respectively at harvest and in summer(2016) same
variety of crop was sown soil samples were analysed
at harvest available N, P, K were 259, 32.4 and
269kg/ha, respectively. The recommended dose of
NPK 12.35:25:25 kg/ha application for two seasons
asrainfed crop. Seventreatments were assigned in a
randomized completeblock design with three
replications. The treatments included sodium
aciuorfen 16.5% + clodinafoppropargyl8% EC
(123.75 + 60, 165 + 80 and 206.25+ 100 g/ha) as post-
emergence (PoE), sodium aciuorfen 20% SL (165
g/ha) as PoE, clodinafoppropargyl15% WP (80 g/ha)
as PoE, hand weeding (twice) at20 and 45 days after
sowing (DAS), and weedycheck
(untreated).Herbicides were applied at a spray
volume of 500 litres of water/ha at 22 DAS,
usingknapsack sprayer tted with at fan
nozzle.Weed counts were taken in a quadrat of 50 ×
50cm at 20, 45, 65 DAS and harvest, and expressed
asweed density (no./m 2 ). Category–wise dry
weights(g/m2) of weeds (sedges, grasses and broad-
leaved)were also recorded at 20, 45, 65 DAS and at
harvest.Data on weed density and weed dry weight
wereanalyzed using square root transformation.Data
on seed yield, haulm yield and weedindex were
recorded at harvest. Herbicide efciencyindex (HEI)
and Weed control efciency (WCE) of different
treatments were also calculated as per the formula
suggested by Krishnamurthy et al. (1975) and Walia
(2003), respectively.
Yield of treated plot-Yield in Control
HEI= Yield in Control
Weed dry weight in control-Weed dry weight in treated
WCE= Weed dry weight in control
× 100
After the harvest of the greengram crop, the
residual crop Finger millet was grown to know the
phytotoxicity effect on succeeding crop.
RESULTS AND DISCUSSION
Weed ora
Variation in the weed ora of greengram elds
grown under different situation; vary with the soil,
varieties, season and place of growth (Patel etal., 2011
and Chhodavidia et al., 2013). The weeds ora
observed during the experimental period comprised
of grasses, sedges and broad leaved weeds. The major
weed ora observed during the experimental
cropping period among broad-leaved weeds,

Table 1. Effect of Sodium Aciuorfen 16.5% + Clodinafop-Propargyl 8% EC and other weed control treatments
on major weed species density (Number m-2) in green gram

Treatments 20 Days After Sowing (during Kharif 2015)

Sedges Grasses Broad leaf weeds Grand
Cr Ei Da Ec Total Ba Cv Pn Cb Eg Total Total
Sodium aciuorfen + clodinafop-propargyl (123.75 + 60 g/ha) 4.1 15.4 7.0 4.3 26.7 6.8 4.3 1.5 2.3 2.6 17.5 48.3
Sodium aciuorfen + clodinafop-propargyl (165 + 80 g/ha) 6.4 13.5 6.9 3.1 23.5 7.5 4.4 2.2 2.6 2.2 18.8 48.7
Sodium aciuorfen + clodinafop-propargyl (206.25 + 100 g/ha) 5.1 16.8 7.6 3.7 28.1 6.7 4.0 2.4 2.5 2.0 17.6 50.9
Sodium aciuorfen 20% SL (165 g/ha) 5.7 13.6 7.2 2.9 23.7 5.3 3.2 1.1 2.7 2.1 14.4 43.8
Clodinafop-propargyl 15% WP (80 g/ha) 5.5 14.3 8.8 3.2 26.4 6.0 3.8 1.0 2.4 2.2 15.3 47.1
Hand weeding 20 and 45 DAS 7.3 14.3 6.1 3.1 23.5 4.9 4.4 1.8 2.8 2.2 16.1 47.0
weedy check 6.5 13.6 5.8 2.9 22.4 6.5 4.3 2.1 2.5 2.6 18.0 46.8
 Mudalagiriyappa et al.: Sodium aciuorfen + clodinofoppropargyl as PoE herbicide in greengram 53

Table 1a: Effect of Sodium Aciuorfen 16.5% + Clodinafop-Propargyl 8% EC and other weed control treatments
on major weed species density (Number m-2) in green gram

Treatments 20 Days After Sowing (during Summer -2016)

Sedges Grasses Broadleaved Grand Total
Cr Ei Da Ec Total Ba Cv Cb Eg Total
Sodium acifluorfen + clodinafop-propargyl (123.75 + 60 g/ha) 3.2 8.7 4.3 2.3 15.3 5.8 5.3 1.3 1.7 14.2 32.7
Sodium acifluorfen + clodinafop-propargyl (165 + 80 g/ha) 4.0 12.7 4.5 2.8 20.0 3.7 3.2 1.8 1.3 10.1 34.1
Sodium acifluorfen + clodinafop-propargyl (206.25 + 100 3.2 7.3 4.9 3.2 15.4 3.5 4.0 2.0 1.7 11.2 29.8
Sodium acifluorfen 20% SL (165 g/ha) 4.3 7.7 4.6 2.9 15.2 3.2 3.8 2.2 1.5 10.7 30.2
Clodinafop-propargyl 15% WP (80 g/ha) 3.7 6.0 3.5 2.6 12.1 4.5 3.5 2.0 2.0 12.0 27.7
Hand weeding 20 and 45 DAS 5.3 5.0 5.3 2.7 13.0 3.7 4.0 1.8 2.0 11.5 29.8
weedy check 4.3 7.3 3.6 1.5 12.4 5.3 2.5 1.2 1.5 10.5 27.2

Commelina benghalensis, Euphorbia geniculata, Cleome
viscosa, Phyllanthus niruri, Borreria articularis, among
the grassy weeds, Eleusine indica, Echinochloa colona
and Dactyloctenim aegyptium and among sedges,
Cyperus rotundus. The data pertaining to the species
wise weed density (number) presented in the Table 1.
Weed density
The data pertaining to the weed density
presented in the Table 2. Before imposition of
treatments i.e., at 20 DAS, the density of sedges,
grasses and broad leaf weeds were dominant. Sodium
Aciurofen 16.5% + Clodinafop-Propargyl 8% EC
(206.25+100 g a.i.,/ha) application at 22 DAS resulted
in lowering weed density (16.5/m2) at 45 DAS,
followed by Sodium Aciurofen 16.5% + Clodinafop-
Propargyl 8% EC (165+80 g a.i.,/ha) and Sodium
Aciurofen 16.5% + Clodinafop-Propargyl 8% EC
(123.75+60 g a.i.,/ha) (20.1 and 24.1/m2, respectively).
Similar trend of weed density was observed at 65 DAS
and at harvest. The lower weed density was due to the
combined application of sodium aciuorfen and
clodinafop-propargyl, as sodium aciuorfen
effectively controlled the broad leaved weeds by
inhibiting the enzyme proroporphyrinogen oxidase
(PPG) in weed species and clodinafop-propargyl due
to its inhibitory action on enzyme Acetyl co-A
carboxylase (Accase) which effectively controlled

Table 2. Effect of Sodium Aciuorfen 16.5% + Clodinafop-Propargyl 8% EC and other weed control treatments
on weed density at different stages in green gram

Treatments 20 DAS 45 DAS 65 DAS At harvest

2015 2016 Mean 2015 2016 Mean 2015 2016 Mean 2015 2016 Mean
Sodium aciuorfen + clodinafop -propargyl 5.83 6.98 6.43 4.17 4.76 4.91 3.37 3.68 3.53 3.25 3.33 3.29
(123.75 + 60 g/ha) (34.1) (48.7) (41.4) (17.4) (22.7) (24.1) (11.4) (13.5) (12.5) (10.6) (11.1) (10.9)

Sodium aciuorfen + clodinafop-propargyl (165 + 5.71 6.95 6.36 4.64 5.17 4.48 3.16 3.79 3.49 3.13 3.29 3.21
80 g/ha) (32.7) (48.3) (40.5) (21.5) (26.7) (20.1) (10.0) (14.4) (12.2) (9.8) (10.8) (10.3)
Sodium aciuorfen + clodinafop -propargyl 5.45 7.13 6.35 3.81 4.30 4.06 3.11 3.43 3.28 3.03 3.06 3.05
(206.25 + 100 (29.8) (50.9) (40.3) (14.5) (18.5) (16.5) (9.7) (11.8) (10.8) (9.2) (9.4) (9.3)
Sodium aciuorfen 20% SL (165 g/ha) 5.49 6.61 6.08 5.78 6.79 6.31 6.17 6.62 6.40 6.50 7.07 6.79
(30.2) (43.8) (37.0) (33.4) (46.1) (39.8) (38.2) (43.8) (41.0) (42.3) (50.0) (46.2)
Clodinafop-propargyl 15% WP (80 g/ha) 5.26 6.86 6.12 5.38
6.05 5.73 5.04 5.52 5.29 4.95 5.37 5.16
(36.6) (25.4) (30.5) (28.0) (24.5) (28.8) (26.7)
(27.7) (47.1) (37.4) (28.9) (32.8)
Hand weeding 20 and 45 DAS 5.46 6.85 6.20 3.45 4.39 3.95 3.09 3.21 3.16 3.39 2.89 3.15
(29.8) (47.0) (38.4) (11.9) (19.3) (15.6) (9.6) (10.3) (10.0) (11.5) (8.3) (9.9)
weedy check 5.22 6.84 6.08 6.99 7.94 7.48 7.71 8.46 8.10 8.13 8.92 8.54
(27.2) (46.8) (37.0) (48.9) (63.1) (56.0) (59.5) (71.6) (65.6) (66.2) (79.6) (72.9)

SEm ± 0.11 0.10 0.9 0.13 0.21 0.14 0.11 0.11 0.95 0.11 0.12 0.10
CD (P=0.05) 0.33 0.32 0.28 0.38 0.62 0.4 0.33 0.35 0.29 0.32 0.38 0.31
54 Journal of Food Legumes 35 (1), 2022

grassy weeds (Rao, 2011) and it might be due to the Effect on weed control efciency (WCE)
broad spectrum activity of application of this post
Weed control efciency signicantly differed
emergence herbicide on weed and their greater
among the different treatments applied with different
efciency to retard cell division of meristems as a
herbicides and its dosage. The WCE is directly
result of which weeds died rapidly (Kalpana and
proportional to the crop yield. WCEindicates the
Velayuthum, 2004)) resulted in lower weed density.
magnitude of effective reduction of weed population
Weed dry weight and their competition by weed control practices over
weedy check. This was highly inuenced by different
Dry weight of weed ora differed signicantly
weed control treatments. Among the different weed
among the different treatments.The data pertaining to
control treatments WCE found higher in the treatment
the weed dry weight presented in the Table 3.There is
applied with sodium aciuorfen 16.5% + clodinafop-
no signicant difference were noticed 20 DAS w.r.t to
propargyl 8% EC at 206.25+100 g a.i., (87.92%)
the weed dry weight before the imposition of different
followed by sodium aciuorfen 16.5% + clodinafop-
treatments. Among the different herbicides and their
propargyl 8% EC at 165+80 g a.i., and sodium
doses signicantly reduces the total weed dry weight
aciuorfen 16.5% + clodinafop-propargyl 8% EC at
at 45, 65 and at harvest. Application of sodium
123.75+60 g a.i., (86.95 and 85.78%, respectively) as
aciuorfen 16.5% + clodinafop-propargyl 8% EC at
furnished in Table 4. The signicant reduction in the
206.25+100 g a.i., signicantly reduces the weed dry
weed dry weight in turns increases the weed control
weight (2.55 g/m2, 1.95 g/m2 and 1.81 g/m2 at 45, 65
efciency due to the broad spectrum weed control
and at harvest, respectively). This was followed by the
effect and elimination of competition from weeds
sodium aciuorfen 16.5% + clodinafop-propargyl 8%
during the critical crop weed competition and their
EC at 165+80 g a.i., and sodium aciuorfen 16.5% +
greater efciency to retard cell division of meristems
clodinafop-propargyl 8% EC at 123.75+60 g a.i., The
as a result of which weeds died rapidly. These
lower weed dry weight attributed to the combination
outcomes were in ndings with the Gupta et al., 2013.
of both herbicides that have longer effect on
controlling weed population and brought signicant Effect on weed index
reduction in the weed dry weight as compared to the
Weed index is the yield reduction due to
control. Similar results of reduced weed dry weight
competition by the weeds and it was higher in un-
reported by Ali etal. (2011) and Thakare et al. (2015).
weeded control plot (66.20%). This was due to the
The dry matter accumulation of weeds is directly
lower seed yield associated with the un-weeded
proportional to the yield decline of the crop rather
control treatment throughout the cropping period.
than the weeds population by itself.
The lower weed index was noticed withthe post
Table 3. Effect of Sodium Aciuorfen 16.5% + Clodinafop-Propargyl 8% EC and other weed control treatments
on weed dry weight (g/m2) at different stages in green gram
Treatments 20 DAS 45 DAS 65 DAS At harvest
2015 2016 Mean 2015 2016 Mean 2015 2016 Mean 2015 2016 Mean
Sodium aciuorfen + clodinafop -propargyl 2.64 3.10 2.88 2.49 2.77 2.63 1.99 2.12 (3.51) 2.06 1.90 (2.62) 1.94 (2.76) 1.92
(123.75 + 60 g/ha) (5.97) (8.61) (7.3) (5.19) (6.69) (5.9) (2.97) (3.2) (2.7)
Sodium aciuorfen + clodinafop-propargyl (165 + 2.64 3.09 2.87 2.43 2.73 2.59 1.87 2.17 (3.73) 2.03 1.81 (2.26) 1.92 (2.69) 1.86
80 g/ha) (5.95) (8.53) (7.2) (4.91) (6.47) (5.7) (2.48) (3.1) (2.5)
Sodium aciuorfen + clodinafop -propargyl 2.52 3.16 2.86 2.46 2.63 2.55 1.89 2.01 (3.05) 1.95 1.80 (2.23) 1.83 (2.34) 1.81
(206.25 + 100 (5.33) (8.98) (7.2) (5.07) (5.92) (5.5) (2.57) (2.8) (2.3)

Sodium aciuorfen 20% SL (165 g/ha) 2.52 2.95 2.74 3.28 3.43 3.36 3.74 3.52 3.63 3.92 (14.36) 3.67 3.80
(5.33) (7.73) (6.5) (9.75) (10.77) (10.3) (12.97) (11.37) (12.2) (12.45) (13.4)
Clodinafop-propargyl 15% WP (80 g/ha) 2.45 3.05 2.77 2.53 3.03 2.80 2.48 2.98 (7.90) 2.74 2.37 (4.62) 2.86 (7.18) 2.63
(5.01) (8.32) (6.7) (5.41) (8.22) (6.8) (5.17) (6.5) (5.9)
Hand weeding 20 and 45 DAS 2.50 3.05 2.79 2.01 2.21 2.12 1.91 1.71 (1.92) 1.81 2.07 (3.30) 1.75 (2.08) 1.92
(5.27) (8.29) (6.8) (3.05) (3.9) (3.5) (2.66) (2.3) (2.7)
weedy check 2.41 3.04 2.75 3.77 4.08 3.93 4.12 4.42 4.27 4.36 (18.03) 4.56 4.46
(4.83) (8.27) (6.6) (13.20) (15.65) (14.4) (15.94) (18.57) (17.3) (19.83) (18.9)
SEm ± - 0.04 0.03 0.17 0.15 0.13 0.25 0.19 0.20 0.16 0.18 0.14
CD (P=0.05) NS 0.13 NS 0.52 0.46 0.41 0.77 0.59 0.62 0.49 0.54 0.43

Data averaged over three replication; Data analysed using transformation= Square root of (x+1); Data within parentheses are original values
 Mudalagiriyappa et al.: Sodium aciuorfen + clodinofoppropargyl as PoE herbicide in greengram 55

Table 4. Effect of Sodium Aciuorfen 16.5% + Clodinafop-Propargyl 8% EC and other weed control treatments
on seed yield (kg/ha), haulm yield (kg/ha), weed index (%) and weed control efciency (%) in green gram

Weed control efciency (%) at Herbicide efciency

Seed yield (kg/ha) Haulm yield (kg/ha) Weed index (%) harvest index
Treatments 2015 2016 Mean 2015 2016 Mean 2015 2016 Mean 2015 2016 Mean 2015 2016 Mean
Sodium aciuorfen + clodinafop -
760 942 851 1026 1318 1172 39.92 34.40 37.16 85.47 86.08 85.78 7.07 5.23 6.15
propargyl (123.75 + 60 g/ha)
Sodium aciuorfen + clodinafop -
863 1073 968 1208 1545 1377 31.78 25.28 28.53 87.47 86.43 86.95 10.38 7.14 8.76
propargyl (165 + 80 g/ha)
Sodium aciuorfen + clodinafop -
1068 1221 1145 1505 1795 1650 15.57 14.97 15.27 87.63 88.20 87.92 14.94 10.51 12.73
propargyl (206.25 + 100
Sodium aciuorfen 20% SL (165 g/ha) 555 725 640 884 1155 1020 56.13 49.51 52.82 20.35 37.22 28.79 0.60 0.53 0.56
Clodinafop-propargyl 15% WP (80 g/ha) 622 683 653 898 1124 1011 50.83 52.44 51.64 74.38 63.79 69.09 2.57 0.70 1.63
Hand weeding 20 and 45 DAS 1265 1436 1351 1808 2058 1933 - - - 81.70 89.51 85.61 - - -
weedy check 375 545 460 562 900 731 70.35 62.05 66.20 - - - - - -
SEm ± 65.85 79.21 62.50 84.60 98.23 88.2 - - - - - - - - -
CD (P=0.05) 199.7 237.6 188.9 248.2 294.7 266.2 - - - - - - - - -

emergence application of sodium aciuorfen 16.5% +
clodinafop-propargyl 8% EC at 206.25+ 100 g a.i., ha-1
(15.27%) followed by sodium aciuorfen 16.5% +
clodinafop-propargyl 8% EC at 165+80 g a.i., and
sodium aciuorfen 16.5% + clodinafop-propargyl 8%
EC at 123.75+60 g a.i., (28.53 and 37.16%,
respectively)as presented in Table 4. As the
satisfactory control of weeds owing to reduction in the
crop weed competition. This helps the crop to utilize
all the available sources like light, moisture, nutrients
and space resulting in higher yield was recorded and
these results were in conformity with Gupta etal.
(2013).
Herbicide efciency index
The herbicide efciency index (HEI) would
indicate about the potential of the herbicide for
controlling the weeds along with their phyto-toxicity
effect on the crop. The HEI was proposed by
Krishnamurthy et al., (1975). The herbicide efciency
index of different treatments is given in Table 5.
Maximum herbicide efciency index was observed in
the treatment applied with Sodium Aciurofen 16.5%
+ Clodinafop-Propargyl 8% EC (206.25 + 100 g a.i./ha)
(12.73), followed by Sodium Aciurofen 16.5% +
Clodinafop-Propargyl 8% EC(165 + 80 g a.i./ha) and
Sodium Aciurofen 16.5% + Clodinafop-Propargyl
8% EC(123.75 + 60 g a.i./ha (8.76 and 6.15, respectively
) as presented in Table4. Higher herbicide efciency
index was observed due to the broad spectrum of
weed control measures adopted in green gram which
have resulted in a signicantly lower weed biomass in
this treatment.
Effect on grain and haulm yield
The application of herbicides in the greengram
was found signicant on the yield of the crop. Post
emergence application of sodium aciuorfen 16.5% +
clodinafop-propargyl 8% EC at 206.25+100 g a.i., ha-
1
sprayed at 22 DAS suppresses the biomass of the
weed ora and promotes the higher yield of
greengram (1145 kg/ha) and this was followed by
sodium aciuorfen 16.5% + clodinafop-propargyl 8%
EC at 165+80 g a.i.,ha-1 and sodium aciuorfen 16.5% +
clodinafop-propargyl 8% EC at 123.75+60 g a.i., ha-1
(968 and 851 kg/ha, respectively)as furnished in Table
4. Higher greengram yield in this treatment may be
attributed to the better control of weeds that reduces
the crop-weed competition and thereby providing
better yield attributes and yield. There results were in
lined with the Viveketal., 2008.A similar improvement
in greengram under different weed control treatments
was reported by Younesabadietal. (2013).Where,
sodium aciuorfen helps in inhibition of enzyme
proroporphyrinogen oxidase (PPG or Protox). Leaves
of the susceptible plants become chlorotic and then
desiccated and necrotic within 1-2 days after spraying
and clodinofop-propargyl acts as an acetyl Co-A
carboxylase (ACCase) inhibitor, clodinofoppropargyl
is absorbed by the leaves and rapidly translocated to
the growing points of leaves and stems. It affects the
production of fatty acids needed for the plant growth
in susceptible grassy weeds and there by reduces
weed ora and increases the yield of greengram. The
same trend was followed for the production of haulm
of the greengram.
56 Journal of Food Legumes 35 (1), 2022

Table 5. Effect of different weed management treatments on economics of greengram

Treatments Cost of cultivation Gross returns Net returns

(x103 /ha) (x103 /ha) B: C Ratio
(x103 /ha)
2015 2016 2015 2016 2015 2016 2015 2016

Sodium aciuorfen + clodinafop-propargyl (123.75 + 60 g/ha) 24.50 24.85 38.00 47.10 13.50 22.25 1.55 1.90

Sodium aciuorfen + clodinafop-propargyl (165 + 80 g/ha) 25.00 25.40 43.15 53.65 18.15 28.25 1.73 2.11
Sodium aciuorfen + clodinafop-propargyl (206.25 + 100 25.50 25.85 53.40 61.05 27.90 35.20 2.09 2.36
Sodium aciuorfen 20% SL (165 g/ha) 24.50 24.85 27.75 36.25 3.25 11.40 1.13 1.46
Clodinafop-propargyl 15% WP (80 g/ha) 25.50 25.85 31.10 34.15 5.60 8.30 1.22 1.32
Hand weeding 20 and 45 DAS 31.20 31.60 63.25 71.80 32.05 40.20 2.03 2.27
weedy check 20.50 20.80 18.75 27.25 -1.75 6.45 0.91 1.31

Effect on economics frequent rainfall often limits timely manual weed

management along with the additional burden of
Higher net returns and B:C ration were
rising labour cost. From this study, among the
observedwith application of sodium aciuorfen
herbicidal management,it can be concluded that post-
16.5% +clodinafop-propargyl 8% 80 EC at 206.25 + 100
emergent application of Sodium Aciurofen 16.5% +
g/ha27900/ha and 2.09, respectively) and at 165 +
Clodinafop-Propargyl 8% EC (206.25+100 g a.i.,/ha)
g/ha( 18150/ha and 1.73, respectively). However,
at 22 DAS helps in better control of both grassy and
tworounds of hand weeding recorded higher
broad-leaved weeds in greengram. As it improved the
grossreturns (32050/ha) as compared to
growth and yield of greenram through better weed
othertreatments. The lower cost of cultivation,
control efciency and it was non phyto-toxic to the
grossreturns, net returns and B:C ratio were recorded
crop and also to the germination of the succeeding
in theweedy check plots (20500/ha, 18750/ha, -
crop nger millet.
1750/ha and 0.91, respectively). The similar results
wereobtained during 2016 (Table 5). The highest net ACKNOWLEDGEMENT
returns and B:C ratio with application of sodium
The authors are grateful to the University of
aciuorfen 16.5% + clodinafop-propargyl 8% 80 ECat
Agricultural Sciences (UAS), Bangalore, Karnataka
206.25 + 100 g/ha was due to higher pod yield
for providing all the guidance and necessary facilities
withlesser cost of weeding with herbicide application.
for conducting the research study. They are also
Similar results were reported by Mudalagiriyappa et
thankful to the technical staff who have worked in the
al. (2021).Even though higher gross returns were
eld experiments and recorded the observations on
recorded intwo hand weeding, higher labour wages
different weed parameters.
increased the cost of cultivation and lowered the B:C
ratio. Similarndings were reported by Kalhapure et REFERENCES
al. (2013). Ali, S., Patel, J. C., Desai, L. J. and Singh, J.2011. Effect
Effect on succeeding crop of herbicides on weeds and yield of rainy season
greengram (Vigna radiata L.). Legume Research.
Growth and yield of succeeding nger milletwas
34(4): 300-303.
not affected due to imposition of weedmanagement
practices in preceding greengram. Thiswas in Anonymous. 2019. Annual Reports, Directorate of
accordance with SathyaPriya and Chinnusamy (2020). Statistics and Economics, Government of India.
The germination percentagewas recorded and other
Anonymous. 2021. Greengram outlook report-
physiological factors likeyellowing, stunting, wilting
Janaury to May. Agricultural Market
and deformities i.e., epinasty, hyponasty and necrosis
Intelligence Centre, ANGRAU,Lam.
etc. were not noticed.
Anonymous. 2021. Kharif pulses prospects. DPD,
CONCLUSION
Bhopal.
Herbicidal management is an easy and cost-
Chhodavadia, S. K., Mathukiya, R. K. And Dobariya,
effective weed control option in greengram because
 Mudalagiriyappa et al.: Sodium aciuorfen + clodinofoppropargyl as PoE herbicide in greengram
V. K.2013. Pre and post-emergence herbicides
for integrated weed management in summer
greengram. Indian Journal of Weed Science.
45(2): 137-139.
Gupta, V., Singh, M., Kumar, A., Sharma, B. C. and
Kher, D. 2013. Inuence of weed management
practices on weed dynamics and yield of
urdbean (Vigna mungo) under rainfed conditions
of Jammu. Indian Journal of Agronomy.
58(2):220-225.
Kalhapure, AH, Shete, BT and Bodake PS. 2013.
Integration of chemical and cultural methods of
weed management in groundnut. Indian Journal
of Weed Science 45(2): 116–119.
Kalpana, R. and A. Velayutham. 2004.Effect of
herbicides on weed control and yield of soybean.
Indian Journal of Weed Science. 36(1 &2): 138-
140.
Kumar, A., Malik, Y. P. And Yadav, A. 2006. Weed
management in mungbean. Journal of Research.
36(2): 127-129.
Kumar, N., Hazra, K.K., Singh, M.K., Venkatesh, M.S.,
Kumar, L., Singh, J. and Nadarajan, N. 2013a.
Weed Management Techniques in Pulse Crop,
47 pp. Technical Bulletin 10/2013. Indian
Institute of Pulses Research, Kanpur, Uttar
Pradesh.
Krishnamurthy K., Raju B.G., Raghunath G., Jagnath
M.K. andPrasad T.V.R. 1975. Herbicide
efciency index in sorghum. Indian Journal of
Weed Science 7(2): 75–79.
Mudalagiriyappa, D.C. Hanumanthappa, G.M. Sujith
and Subhas Sannappanavar. 2021. Bio-efcacy
57
of ready-mix sodium aciuorfen + clodinafop-
propargyl forweed management in groundnut.
Indian Journal of Weed Science 53(2)
Patel, V. M., Patel, V. S. And Thanki, J. D. 2011.Effect of
irrigation levels and weed management
practices on weed growth and yield of summer
blackgram under South Gujarat condition.
Green Farming. 2(2): 182-184.
Rao, A. S. 2011.Evaluation of pyrithiobac alone and in
combination with grassy herbicides on weed
control in cotton. World Cotton Research
Conference on Technologies for prosperity pp.
406-409.
SathyaPriya R and Chinnusamy C. 2020. Integrated
weedmanagement in altered crop geometry of
maize and residualeffects on succeeding Bengal
gram. Indian Journal of Weed Science. 52(1):
93–98.
Thakare, S. S., Deshmukh, J. P., Shingrup, P. V., Pawar,
P. M. and Ghlop, A. N. 2015.Efcacy of different
new herbicide against weed ora in soybean
(Glycine max L.) Plant Archives 15(1): 217-220.
Vivek, N. S. Rana,Raghuvir Singh and S. S. Tomar.
2008. Effect of Weed Interference on Weeds and
Productivity of Blackgram (Phaseolus mungo).
Indian Journal of Weed Science. 40 (1 & 2): 65-67
Walia US. 2003. Weed management, pp. 396. Kalyani
publishers,Ludhiana.
Younesabadi, M., Das, T. K. and Sharma, A. R.
2013.Effect of tillage and tank mix application on
weed management in soybean (Glycine max).
Indian Journal of Agronomy. 58(3): 372-378.
 Journal of Food Legumes 35(1): 58-64, 2022

Effect of weed management and sulphur levels on weed density,

nutrient depletion and productivity of cluster bean [Cyamopsis
tetragonoloba (L.) Taub]
RK Yadav1, SL Mundra2, Santosh Devi Samota3 and SL Yadav*4

1
Swami Keshwanand Rajasthan Agricultural
University, Bikaner, Rajasthan
2
Maharana Pratap University of Agriculture
& Technology, Udaipur, Rajasthan
3
KVK, Gonera, Kotputli, SKNAU, Jobner
4
Agricultural University, Kota, Rajasthan
*E mail: yadav.agro@gmail.com
Received: 04 January, 2022
Accepted: 11 April, 2022
Handling Editor:
Dr S.S. Rathore, ICAR Indian Agricultural
Research Institute, New Delhi
ABSTRACT
An experiment was conducted during kharif seasons of 2013 and 2014 at
Instructional Farm of Rajasthan college of Agriculture, Udaipur
(Rajasthan) to evaluate the effect of weed management and sulphur
nutrition on weed density, their biomass, nutrient uptake by weeds and
productivity of cluster bean [Cyamopsis tetragonoloba (L.) Taub].
Manual weeding twice at 20 and 40 days after sowing recorded
minimum weed count and weed dry matter at 25 DAS. The minimum
weed dry matter of narrow-leaved (129 kg ha-1) and broad-leaved (106 kg
ha-1) was recorded under two hand weeding treatment which was
closely followed by sequential application of pre-emergence
application of pendimethalin 0.75 kg ha-1 followed by post emergence
application of imazethapyr 0.075 kg ha-1. Weed control efciency (WCE)
was found highest in treatment in hand weeding twice treatment
(89.54%) followed by PE application of pendimethalin 0.75 kg ha-1
followed by post emergence application of imazethapyr 0.075 kg ha-1
(94.18 %). Minimum depletion of N by narrow (2.22 kg ha-1) and broad-
leaved weeds (2.24 kg ha-1) was recorded under two hand weeding.
Amongst herbicides pendimethalin fb imazethapyr was signicantly
superior over rest of the herbicidal treatments. The highest seed (1218 kg
ha-1), haulm (2440 kg ha-1) and biological yield (3657 kg ha-1) was in
hand weeded twice treatment. The extent of enhancement protein yield
due to two hand weeding, pendimethalin fb imazethapyr,
pendimethalin fb quizalofop-ethyl, imazethapyr and pendimethalin
was 202.25, 195.80, 160.62, 108.46, and 99.21 kg ha-1, respectively
compared to weedy check (101.12 kg ha-1).
Key words: Clusterbean, Imazethapyr, Pendimethalin, Sulphur, Weed
management, Yield

INTRODUCTION restored to exploit the yield potential of this crop.

Hand weeding is a traditional and effective method of
Clusterbean is a kharif legume grown for feed,
weed control in clusterbean in which a manual
fodder, guar gum and vegetable purpose. Among
weeding at 15-30 days after sowing is generally
leguminous crops it is comparatively more drought
recommended (Randhawa et al., 2002). Herbicides
hardy which is grown during rainy season in arid and
have revolutionized agriculture all over world and
semi-arid regions of India. Rajasthan is the largest
played key role in enhancing productivity apart from
producer followed by Haryana in India. There is an
being convenient to use (Rao and Nagamani, 2010).
acute crop-weed competition during early crop
The herbicides presently available are either pre-
growth stage due to slow initial crop growth and
emergence or pre-plant soil incorporated ones having
weeds grow at faster pace. Weeds infects vigorously
narrow spectrum of weed control. Studies of (Malik et
due to frequent rains and presence of weeds beyond
al., 2006) clearly indicate that sequential application of
critical period of crop weed competition results in
herbicides comprising pre followed by post
yield reduction to the tune of 45.46 per cent (Sangwan
emergence will provide more consistent weed control
et al., 2016). Therefore, weed control needs to be
 Yaday et al.: Effect of weed management and sulphur levels in cluster bean 59

than their single application. Besides application of N Common weed ora in cluster bean
and P in legumes sulphur is now required as fourth
Clusterbean was mainly infested with mixed
major plant nutrient (Tandon and Messick, 2007).
ora of narrow and broad-leaved weeds viz., Cynodon
Sulphur also improves nodulation in legumes
dactylon, Echinochloa colona, Cyperus rotundus,
(Shivran and Prakash, 2012). The properties of certain
Brachiaria reptans, Dinebra retroexa and
proteins and enzymes, which are concerned with
Dactyloctenium aegyptium among narrow-leaved
photosynthesis and nitrogen xation, are thought to
weeds and Amaranthus viridis, Commelina benghalensis,
be property to the type of sulphur linkage present.
Digera arvensis, Trianthema portulacastrum and Physalis
Therefore, sulphur is proven as “yield + quality
minima among broad-leaved weeds.
nutrient”.
Effect on weed density
MATERIALS AND METHODS
Hand weeding resulted in minimum weed
Field experiment was conducted during kharif
density which was signicantly lower than all other
seasons of 2013 and 2014 at Instructional Farm of
treatments. The superiority was followed by
Rajasthan college of Agriculture, MPUAT Udaipur.
application of pendimethalin as pre-emergence with
The soil was medium in available nitrogen (274.56 and
quizalofop-ethyl as post emergence which was at par
279.61 kg ha-1) and phosphorus (19.27 and 18.69 kg ha-
1 to pendimethalin fb imazethapyr. The data showed
) and high in available potassium (318.83 and 324.17
80.99-81.47, 73.88 and 73.01 per cent reduction in
kg ha-1), low in sulphur (9.7 and 9.6 ppm) during 2013
narrow-leaved weeds count due to hand weeding,
and 2014, respectively. The experiment consisted of
pendimethalin fb quizalofop-ethyl and
eight weed management treatments viz. weedy check,
pendimethalin fb imazethapyr, respectively (Table 1).
one hand weeding at 20 DAS, two hand weeding at 20
in case of broad-leaved weeds hand weeding proved
and 40 DAS, pre-emergence application of
signicantly effective, however its effect was at par
pendimethalin 1.0 kg ha-1, post-emergence application
with pendimethalin fb imazethapyr. Effect of all
of imazethapyr 0.1 kg ha - 1 , post-emergence
treatments except hand weeding and pendimethalin
application of quizalofop-ethyl 0.05 kg ha-1 , pre-
fb imazethapyr was differed signicantly with each
emergence application of pendimethalin 0.75 kg ha-1 fb
other with respect to their efcacy. The order of
post-emergence imazethapyr 0.075 kg ha-1 and pre-
reduction in density was 74.19, 75.18, 74.18 and 63.70
emergence pendimethalin 0.75 kg ha -1 fb post-
per cent for these weeds under hand weeding,
emergence quizalofop-ethyl 0.04 kg ha - 1 . All
pendimethalin fb imazethapyr and imazethapyr
herbicides were applied with knap-sack sprayer tted
alone, respectively (Table 1). Different doses of
with at fan nozzle with discharge rate of 600-liter
Sulphur did not inuence the population of narrow
water/ha. Four levels of sulphur (control, 15, 30 and
and broad-leaved weeds. The minimum weed count
45 kg ha-1) supplied through mineral gypsum, thereby
was recorded under two hand weeding followed by
making 32 treatments combinations. The experiment
application of pendimethalin with imazethapyr in
constituted in split plot design with weed
sequence at 50 DAS. Data analysis indicated that two
management treatments assigned in main plots and
hand weeding, pendimethalin fb imazethapyr,
sulphur in sub plots. All treatment combinations were
pendimethalin fb quizalofop-ethyl and imazethapyr
replicated thrice. Clusterbean variety RGC-1017 was
resulted in 86.57, 74.90, 70.44 and 64.39 per cent
used as test crop with seed rate of 20 kg ha -1 and crop
reduction in the narrow-leaved weeds count,
was raised by applying 20 kg N and 40 kg P2O5 kg ha-1.
respectively and Two hand weeding and
All fertilizers were applied at the time of sowing. In
pendimethalin fb imazethapyr resulted in 77.78 and
each plot two spots were randomly selected for
73.89 per cent reduction in density of broad-leaved
recording the data on weed density and dry matter at
weeds, respectively (Table 1). No signicant effect on
25 and 50 DAS using a quadrate measuring 0.5x0.5 m.
weed count of narrow-leaved weeds was observed
The mean data of weed count were subjected to
due to varying Sulphur levels Two hand weeding at
square-root transformation (x +0.5) to normalize their
20 and 40 DAS was found the most effective in order to
distribution (Gomez and Gomez, 1984). Different
reduce the density and dry matter of all categories of
parameters in the study were evaluated following
weeds at all stages compared to other treatments. This
standard procedures.
might be due to the fact that removal of weeds twice
RESULTS AND DISCUSSION weeds which emerged during early as well as later
60 Journal of Food Legumes 35 (1), 2022

Table 1. Effect of weed management and sulphur nutrition on weed density at 25 and 50 DAS in clusterbean
(Pooled)

Treatments Weed density (No. m-2)

At 25 DAS At 50 DAS
NLW BLW NLW BLW
Weed management
Weedy check 10.09 8.24 12.28 10.73
(102.07) (67.66) (150.83) (114.86)
One hand weeding 4.40 4.15 8.91 7.93
(18.91) (16.79) (79.19) (62.56)
Two hand weeding 4.45 4.23 4.55 4.89
(19.40) (17.46) (20.26) (25.52)
Pendimethalin 6.44 6.27 8.35 8.75
(41.09) (38.97) (69.32) (76.28)
Imazethapyr 5.84 5.00 7.35 6.27
(34.05) (24.56) (53.71) (39.07)
Quizalofop-ethyl 6.46 7.52 7.96 9.79
(41.30) (56.18) (63.06) (95.40)
Pendimethalin fb imazethapyr 5.27 4.23 6.17 5.51
(27.55) (17.47) (37.86) (29.99)
Pendimethalin fb quizalofop-ethyl 5.20 6.03 6.71 7.03
(26.66) (34.55) (44.58) (49.17)
S.Em.± 0.06 0.06 0.08 0.09
C.D. (P = 0.05) 0.17 0.17 0.24 0.26
Sulphur (kg ha-1)
Control 5.98 5.67 7.74 7.58
(38.46) (33.90) (64.15) (60.86)
15 5.99 5.68 7.76 7.60
(38.57) (34.04) (64.47) (61.10)
30 6.04 5.70 7.80 7.62
(39.16) (34.36) (65.24) (61.58)
45 6.06 5.72 7.83 7.65
(38.31) (34.52) (65.55) (61.88)
S.Em.± 0.03 0.03 0.04 0.04
C.D. (P=0.05) NS NS NS NS

*Figures in parentheses are subjected to square-root transformation; NLW; narrow-leaved weeds, BLW; broad-leaved weeds, NS; non-
signicant

stages of crop growth resulted in excellent
performance compared to herbicides specially those
applied alone. Sequential application of pre and post-
emergence herbicides signicantly reduced weed
count most efciently during entire crop season
compared to weedy check and herbicide applied
alone. This might be due to the fact that pre-
emergence herbicides controlled early ushes of
weeds, while post-emergence destroyed late ushes
of weeds. Hence, crop remained weeds free for
comparatively longer duration in general and during
critical period of crop-weed competition in particular
than their application alone. The results obtained in
present study is in close agreement with the ndings
of Rawat et al. (2014) and Yadav et al. (2015).
Effect on weed dry biomass
Two hand weeding recorded the lowest dry
matter which was signicantly superior over other
treatments but at par with pendimethalin fb
imazethapyr. On pooled basis two hand weeding,
pendimethalin fb imazethapyr and pendimethalin fb
quizalofop-ethyl reduced the dry matter of narrow-
leaved weeds by 89.53, 86.77 and 74.59 per cent,
respectively and two hand weeding, pendimethalin fb
imazethapyr and imazethapyr alone brought about
94.2,1 92.84 and 72.08 per cent reduction in dry matter
of broad-leaved weeds, compared to weedy check,
respectively (Table 2). Sulphur application failed to
inuence the dry matter of weeds at 50 DAS during
both the years.
Weed control efciency
Based on weed dry matter uctuated to a great
extent under the inuence of various weed
management treatments at 50 DAS. WCE of narrow-
leaved weeds (89.54 per cent) and broad-leaved
weeds (94.18 per cent) at this stage was the highest
under two hand weeding followed by sequential
application of pendimethalin with imazethapyr on
mean over two years. In case of broad-leaved weeds
Imazethapyr found superior in comparison to
pendimethalin fb quizalofop-ethyl, pendimethalin
and quizalofop-ethyl with weed control efciency
71.87 per cent. (Table. 2.)
 Yaday et al.: Effect of weed management and sulphur levels in cluster bean 61

Table.2. Effect of Weed management and sulphur nutrition on dry biomass of weeds and nutrient depletion
at 50 DAS (pooled)
Treatments Weed dry matter Weed control Nutrient removal by weeds (kg ha-1)
(kg ha-1) Efciency (%)
NLW BLW NLW BLW Nitrogen Phosphorus Sulphur
Weed NLW BLW NLW BLW NLW BLW
Management
Weedy check 1232 1830 - - 20.60 37.08 2.93 5.66 0.82 3.01
One hand weeding 506 933 59.47 48.72 8.48 19.19 1.21 2.90 0.34 1.56
Two hand weeding 129 106 89.54 94.18 2.22 2.24 0.32 0.34 0.09 0.18
Pendimethalin 404 911 67.09 49.87 6.75 18.58 0.96 2.83 0.27 1.52
Imazethapyr 378 511 69.23 71.87 6.41 10.61 0.90 1.60 0.26 0.86
Quizalofop 423 1449 65.56 20.35 7.07 29.95 1.01 4.49 0.28 2.42
Pendimethalin fb 86.73
imazethapyr 163 131 92.83 2.80 2.73 0.40 0.42 0.11 0.22
Pendimethalin fb 74.55
Quizalofop 313 764 58.01 5.31 15.88 0.76 2.41 0.21 1.29
S.Em. ± 10 18 - - 0.16 0.65 0.02 0.06 0.01 0.03
LSD (P=0.05) 28 52 0.47 1.89 0.05 0.18 0.02 0.10
Sulphur (kg ha-1)
Control 442 821 - - 7.25 16.31 1.05 2.55 0.28 1.33
15 444 825 - - 7.44 16.88 1.06 2.57 0.30 1.37
30 444 834 - - 7.55 17.48 1.07 2.60 0.30 1.41
45 444 838 - - 7.58 17.46 1.07 2.62 0.31 1.42
S.Em. ± 4 8 - - 0.08 0.21 0.01 0.03 0.00 0.02
LSD (P=0.05) NS NS - - 0.22 0.60 NS NS 0.01 0.05
*NLW; narrow-leaved weeds, BLW; broad-leaved weeds, NS; non-signicant

Effect on Nutrient Uptake by weeds
Nitrogen uptake
In comparison to weedy check, application of
herbicides alone or their sequential use and manual
weeding brought about signicant reduction in N
uptake by weeds. Minimum depletion of N by narrow
(2.22 kg ha-1) and broad-leaved weeds (2.24 kg ha-1) was
recorded under two hand weeding. Amongst
herbicides pendimethalin fb imazethapyr was
signicantly superior over rest of the herbicidal
treatments. Application of 45 kg S ha - 1 was
signicantly superior over no Sulphur application but
at par to 15 and 30 kg S ha-1 however, application of 15
kg S ha-1 failed to exhibit signicant difference over
control. (Table.3)
Phosphorus uptake
On pooled basis, minimum uptake was
recorded in two hand weeding which was
signicantly superior over rest of the treatments
which accounted 2.61 kg ha-1 reduction in P uptake by
narrow-leaved weeds compared to weedy check. The
effect of pendimethalin with imazethapyr treatment
was next in order of superiority which reduced 2.53 kg
ha-1 P uptake by narrow-leaved weeds compared to
weedy check (2.93 kg ha-1). Manual weeding twice and
pendimethalin fb imazethapyr were signicantly
superior over other treatments in respect to P uptake
by broad-leaved weeds. The next in order of
superiority was imazethapyr in this aspect. The effect
of quizalofop was signicantly inferior to all other
treatments but statistically superior over weedy
check. Various sulphur levels under test did not differ
signicantly in respect to their effect on P uptake by
broad-leaved weeds.
Sulphur uptake
Hand weeding twice recorded minimum S
uptake by narrow-leaved weeds but its effect was at
par with that of pendimethalin fb imazethapyr.
Analysis of data further revealed that effect of
pendimethalin, imazethapyr and quizalofop-ethyl
were at par to each other. On pooled basis, two hand
weeding and pendimethalin fb imazethapyr showed
0.73 and 0.71 kg ha-1 reduction in S uptake by narrow-
leaved weeds, respectively compared to weedy check
(0.82 kg ha-1). The effect of pendimethalin fb
quizalofop-ethyl was next in order of superiority with
0.61 kg ha-1 decrease in S uptake by narrow-leaved
weeds compared to unweeded control. Application of
all the three levels of sulphur signicantly superior
over control but at par to each other. Two manual
weeding resulted in the lowest uptake of S by broad-
leaved weeds. This was closely followed by sequential
application of pendimethalin with imazethapyr.
Imazethapyr was next in order of superiority in this
regard. On pooled basis 2.83, 2.79 and 2.15 kg ha-1
reduction in S uptake by broad-leaved weeds was
observed through two hand weeding, pendimethalin
fb imazethapyr and imazethapyr, respectively at this
stage. on pooled basis application of sulphur 15 kg ha-
62 Journal of Food Legumes 35 (1), 2022

Table 3. Effect of weed management and Sulphur nutrition on yield, harvest index, protein and gum yield of
cluster bean (Pooled)

Seed yield (kg Haulm yield Biological Harvest Index Protein yield (kg ha- Gum yield (kg ha-
Treatments ha-1) (kg ha-1) yield (%) 1) 1)
(kg ha-1)

Weed Management
Weedy check 410
1170 1580 25.83 101.12 99.92
One hand weeding 774 1827 2601 29.82 191.77 200.45
Two hand weeding 1218
2440 3657 33.23 305.64 354.39
Pendimethalin 806
1899 2705 29.90 201.44 210.26
Imazethapyr 840 1919 2759 30.55 210.79 220.75
Quizalofop-ethyl 675
1626 2301 29.42 167.83 165.92
Pendimethalin fb imazethapyr 1188
2402 3590 33.16 299.11 343.99
Pendimethalin fb quizalofop-ethyl 1047
2253 3300 31.90 263.54 288.63
S.Em. ± 17
38 37 0.74 4.08 4.98
C.D. (P=0.05) 50
110 107 2.13 11.81 14.44
Sulphur (kg ha-1)
Control 752
1663 2416 30.61 182.49 193.88
15 847
1892 2738 30.33 209.00 227.77
30 917
2053 2970 30.48 232.24 252.48
45 963
2160 3123 30.49 246.88 268.03
S.Em. ± 10
21 24 0.30 2.68 3.03
C.D. (P=0.05) 29 58 68 NS 7.51 8.51

1 could not bring about signicant effect over control,
however, further addition in sulphur doses
signicantly increases S uptake by broad-leaved over
control but found at par to each other. Nutrient uptake
by weeds almost followed the footstep of weed
biomass accumulation. It was found that all weed
management treatments signicantly reduced
nitrogen and phosphorus by both categories of weeds
Nutrient uptake by weeds is the function of per cent
nutrient content and biomass, thus similar trend in
uptake and total weed biomass production was an
expected outcome. Reduced nutrient uptake by weeds
under the inuence of different weed control
measures in clusterbean has also been reported by
Dhaker et al. (2009) Yadav et al. (2013) and Singh et al.
(2014) and Shruthi and Salakinkop (2015).
Effect on yield
All weed management treatment signicantly
increased seed, haulm and biological yields of
clusterbean over weedy check. Critical examination of
data reveal that two hand weeding recorded the
maximum seed (1218 kg ha-1) and haulm yield (2440
kg ha-1) closely followed by sequential application of
pendimethalin with imazethapyr and both of these
treatments were found signicantly superior over rest
of treatments under test. The increased seed and
haulm yield and thereby biological yield were
obviously the results of better weed management
which rendered favourable conditions like increased
availability of nutrients, moisture, light and other
factors to the crop and resulted in higher yield of
clusterbean. These ndings corroborate with Rao et al.
(2015). Soil enrichment with 45 kg sulphur ha-1 showed
a signicant result in terms of seed, haulm and
biological yields of clusterbean with the per cent
increase of 28.06, 29.89 and 29.26, respectively
compared to control.On pooled basis, the harvest
index under two hand weeding, pendimethalin fb
imazethapyr and pendimethalin fb quizalofop-ethyl
was 33.23, 33.16 and 31.90 per cent, respectively. Hand
weeding twice registered 28.65 per cent increase in
harvest index over weedy check. In general, increase
in yield parameters of clusterbean with sulphur
application could be ascribed to its role in improving
mineral nutrition of the crop (Nagar and Meena,2004).
Sulphur fertilization plays an important role to alter
physico-chemical properties of soil conductive for
growth and development of the crop. Viewing the
work done on effect of Sulphur application to a
variety of crops, it was inferred that its application
promoted root growth and yield of crops (Kuniya et
al.,2019). Similar results with sulphur were also
recorded by, Patel et al. (2011) and Ramawatar et al.
(2013).
Effect on protein and gum yield
Maximum protein yield was recorded through
 Yaday et al.: Effect of weed management and sulphur levels in cluster bean
two hand weeding however, it was at par with
sequential application of pendimethalin with
imazethapyr on pooled basis. Effect of imazethapyr
and pendimethalin was signicantly superior over
quizalofop-ethyl but differed non-signicant to each
other, the extent of enhancement protein yield due to
two hand weeding, pendimethalin fb imazethapyr,
pendimethalin fb quizalofop-ethyl, imazethapyr and
pendimethalin was 202.25, 195.80, 160.62, 108.46, and
99.21 kg ha-1, respectively compared to weedy check
(101.12 kg ha-1).Protein yield increased by 14.53, 27.26
and 35.28 per cent due to 15, 30 and 45 kg S ha-1,
respectively over control. 4.2.7.4 Sulphur is known to
increase the metabolic utilization of nitrogen by
keeping N:S ratio within optimum range (Dijkshoorn
and Van Wijk, 1967). Therefore, increasing S levels
could be expected to have worked a favorable N:S
ratio for better synthesis of protein in plant system.
The gum yield due to two hand weeding,
pendimethalin fb imazethapyr and pendimethalin fb
quizalofop-ethyl was 254.47, 244.07, and 188.71 kg ha-1
more than weedy check (Table 3). Gum yield of
clusterbean showed signicantly increasing trend in
both the years by raising Sulphur levels up to 45 kg ha-
1
. Pooled data indicate that application of 45 kg S ha-1
registered 6.16, 17.68 and 38.25 per cent higher gum
yield over 30, 15 kg S ha-1 and control, respectively.
The increase in gum content of seed might be due to
increased boldness of seed and endosperm thereby
more accumulation of carbohydrates (Sharma and
Singh, 2004). The gum yield is a resultant of gum
content and seed yield. Increase gum content and its
yield with increasing levels of Sulphur are in close
conformity with the ndings of Choudhary et al.
(2012) and Tiwari et al. (2014)
REFERENCES
Choudhary, V.K., Kumar., Suresh, P. and Bhagwati.
2012 . Integrated weed management in black
gram (Vigna mungo) under mid hill of
Arunachal Pradesh. Indian Journal of
Agronomy 57: 382-385.
Dhaker, H., Mundra, S.L. and Jain, N.K. 2009. Weed
management in clusterbean [Cyamopsis
tetragonoloba (L.) Taub.]. Indian Journal of Weed
Science 41: 224-227.
Dijkshoorn, W. and Van Wijk, A.L. 1967. The sulphur
requirement of plant as evidenced by sulphur
nitrogen ratio in organic matter: A review of
published data. Plant and Soil 26: 129-157.
63
Gomez, K.A. and Gomez. A.A.1984. Statistical
Procedures for agricultural research (2nded.)
John Willey and Sons. Singapore.
Kuniya, Neeta., Patel B.B. , Malav., J.K., Chaudhary.,
Neha, Pavaya., R.P. Patel., J.K. Kumar., S. Jat.,
J.R. Patel., D.M. Chaudhary., M.G. Patel., B.T.
and Patel., V.R. 2019. Yield and nutrient content
and uptake by clusterbean (Cyamopsis
tetragonoloba L.) as inuenced by different
levels of sulphur and zinc application under
light textured soil. Journal of Pharmacognosy
and Phytochemistry 8: 2160-2163.
Malik, R.S., Yadav, A. and Malik, R.K. 2006. Integrated
weed management in soybean. Indian Journal
of Weed Science 38: 65-68.
Nagar, K.C. and Meena, N.L. 2004. Effect of
phosphorus, sulphur and phosphate
solubilizing bacteria on yield components,
yield and quality of clusterbean [Cyamopsis
tetragonoloba (L.) Taub.]. Legume Research 27:
27-31.
Patel, B.M., Patel, J.C. and Patel, M.N. 2011. Effect of
phosphorus, sulphur and inoculation of
phosphobacter on yield and quality of
clusterbean (Cyamopsis tetragonoloba). Current
Advances in Agricultural Sciences 3: 141-142.
Ramawatar, Shivran, A.C. and Yadav, B.L. 2013. Effect
of N, P fertilizers, vermicompost and sulphur
on growth, yield and quality of clusterbean
[Cymposis tetragonaloba (L.) Taub.] and their
residual effect on grain yield of succeeding
wheat. Legume Research 36: 74-78.
Randhawa, J.S., Deol, J.S., Sardana, V. and Singh, J.
2002. Crop weed competition studies in
summer blackgram (Phaseolus mungo). Indian
Journal of Weed Science 34: 299-300.
Sangawan Meenakshi, Singh Samunder and Satayan.
2016. Efcacy of sequential application of
Imazethapyr+imazamox and propaquizafop in
clusterbean (Cyamopsis tetragonoloba) in two
texturally different soils. Indian Journal of
Agronomy 61: 519-52.
Sharma, O.P. and Singh, G.D. 2004. Effect of sulphur
and growth substances on yield, quality and
nutrient uptake of clusterbean. Crop Research
43: 52-54.
Sharma, O.P. and Singh, G.D. 2005. Effect of sulphur
64 Journal of Food Legumes 35 (1), 2022
in conjunction with growth substance on
productivity of Clusterbean [Cyamopsis
tetragonoloba] and their residual effect on barley
(Hordeum vulgare). Indian Journal of
Agronomy 50: 16-18.
Shivran, R.K. and Prakash, C. 2012. Productivity,
protability and protein content of chickpea
(Cicer arietinum) as inuenced by farm yard
manure, phosphorus and sulphur application.
Trends in Biosciences 5: 104-106.
Shruthi, G.K. and Salakinkop, S.R. 2015. Efcacy of
sequential application of pre and post-
emergent herbicides in kharif greengram
(Vigna radiata L.). Karnataka Journal of
Agriculture Sciences 28: 155.159.
Tandon, H.L.S. and Messick, D.L. 2007. Practical
sulphur guide, The Sulphur Institute, 1140
Connecticut avenue, N.W. Suite, 612
Washington D.C.
Tiwari, A.K., Dabhi, B.M., Chouksey, H. and Singh, A.
2014. Effect of fertility and sulphur levels on
quality parameter of summer clusterbean
(Cyamopsis tetragonoloba L.) under south
Saurastra region. International Journal of
Current Microbiology and Applied Science 3:
330-334.
Yadav L.R., Yadav, S.S., Kanwar, K., Sharma, O.P. and
Yadav, A. 2015. Efcacy of herbicidal weed
control in clusterbean at varying levels of
phosphorus. In: 25th Asian-Pacic Weed
Science Society Conference on “Weed Science
for Sustainable Agriculture, Environment and
Biodiversity” Hyderabad, pp.217.
Yadav, S.L., Kaushik, M.K. and Mundra, S.L. 2013 .
Effect of weed control practices on weed dry
weight, nutrient uptake and yield of
clusterbean (Cyamopsis tetragonoloba L.) under
rainfed condition. Indian Journal of Weed
Science 43: 81-84.
 Journal of Food Legumes 35(1): 65-67, 2022

Growth, instability and decomposition analysis of

lentil production in India
Hemant Kumar*, Devraj Mishra and Uma Sah

ICAR-IIPR, Kanpur, Uttar Pradesh ABSTRACT

*Email: rushtohemant@rediffmail.com
Received: 12 January, 2022
Accepted: 22 April, 2022
Handling Editor:
Dr Amarender Reddy, CRIDA, Hyderabad
Pulses are playing a major role in food basket of majority of Indian
population, they are not only source of cheap proteins but also balanced
diets and contributes to soil health. Lentil is one of the valuable pulses is
major source of protein, high ber content and provide vitamins and
minerals. In India, it is mostly consumed as 'Dhal' and also used as
'Namkeen'. Lentil production in the country has gone up from 0.37 to
1.62 million tons between 1970-71 and 2017-18, registering a modest
growth. During the period, the area has also gone up from 0.75 to 1.55
million ha, the yield has increased more than double from 497to 1047
kg/ha. The present study is an attempt to examine the trends growth
pattern, instability and decomposition analysis in lentil
productionthrough time series data for the period of 47 years (i.e. 1970-71
to 2017-18) which is divided into decade wise. The compound growth
rates of area, production and yield of lentil was found positive for almost
each decades as well as overall period during 1970-71 and 2017-18. The
area,production and yield instability were of low order. Decomposition
analysis reveals that overall the change in production is due to all the
three component yield, area and interaction of yield and area, however
in the recent years since 2000s contribution of yield is more and area
contribution is negligible.
Key words: Growth rate, Instability, Interaction, Lentil

INTRODUCTION The Indian states Madhya Pradesh, Uttar

Pradesh, West Bengal, Bihar, Jharkhand where lentil
Pulses are rich source of dietary protein and have
is grown on a large extent of area and production.
high nutritive value for and are important for soil
There are a number of varieties that are grown in India
health maintenance by enriching soil nitrogen status.
depending on the suitability of the climate and soil.
Due to their high protein, dietary bers and
The area, production and yield of lentil cultivation is
micronutrient contents, pulses constitute an
subjected to uctuate in response to policies of the
important part of a balanced healthy diet. Therefore,
government and also conditions of cultivation. The
pulse crops are central to sustainable agriculture, and
Lentil production in the country has gone up from 0.37
food and nutritional security of humans. Realizing
to 1.62 million tons between 1970-71 and 2017-18,
importance of pulses for human health, the United
registering a modest growth. During the period
Nation declared 2016 as International Year of Pulses.
ofstudy the area has increased from 0.75 to 1.55
Amongst the major pulses in India lentil is one of the
million ha, while the yield has steadily increased from
valuable pulse crop, is a major source of protein, high
497 kg/ha to 1047 kg/ha.The recent liberalization has
ber content and provide vitamins and minerals. It is
expanded the demand for lentil in Indian markets in
mostly consumed as 'Dhal' by removal of outer skin
addition to the growing domestic demand as a value-
and separation of cotyledons and 'Namkeen' in the
added product.In this article, an attempt has been
country. It is easy to cook and easily digestible with
made to analyze the trends, growth pattern, instability
high biological value, hence also referred to patient.
of lentil production in India and study the
Dry leaves, stems, empty and broken pods are used as
contribution of area, yield and yield-area interaction
valuable cattle feed.
66 Journal of Food Legumes 35 (1), 2022

to the change in total production during the last 47 There fore, Pn = An x Yn

years (1970-71 to 2017-18).
= (Ao + A )( Yo + Y)
MATERIALS AND METHODS
= AoYo + AoY + A Yo + AY
The time series secondary data on area,
= Po + AoY + A Yo + AY
production and yield of lentil during the period 1970-
71 to 2017-18 were collected from “Agricultural or P = Pn - Po = AoY + YoA + AY
Statistics at a Glance”, a publication of the government
The rst term on the right hand side can be
of India. The present data were partitioned in decade
considered as the yield effect, the second term as the
wise in order to demonstrate the trend and growth
area effect and the third term as the interaction effect.
pattern of lentil production in the country.
Where,
The compound growth rate has been determined
by using the following exponential function adopted Ao = area in the base year
by Maurya (2016)
An = area in nth year
t
Y= ab
Po = yield in base year
Where
Pn = yield in nth year
Y = the variable for which growth rate is
Yo = yield in base year
calculated (Area/Production/Yield)
Yn = yield in nth year
t= time variable in years (1,2,3,…n)
A = Change in area (An - Ao)
b= the regression coefcient
P = Change in production (Pn - Po)
a= intercept
Y = Change in yield (Yn - Yo)
The log form of the above exponential equation is
expressed as RESULTS AND DISCUSSION
Log (Y)= Log (a) + t Log (b) Decadewise area, production and yield of lentil
has given in Table 1. The area under lentil crop was
The compound growth rate percentage (r %) can
0.75 m ha in 1970-71 which showed increasing trend
be expressed as
and recorded more than double (1.55 m ha) in 2017-18.
r % = (Antilog(Log (b))-1) x 100 It was highest (1.60 m ha) in 2010-11. Similarly, the
production and yield of the lentil crop in the country
The coefcients of variation in percent (CV %)
also witnessed on increasing trend during the period
were computed using the formula
under study. The highest production of the crop was
CV (%)= (Standard deviation / Mean) x 100 1.62 m tones in 2017-18 as compared to 0.37 m tones in
(Moorti, 1991 and Devraj , 2019 ) the base year 1970-71. The yield of the lentil showed an
increasing trends and recorded highest and more than
To study the contribution of area, yield and the
double 1047 kg/ha in 2017-18 as against 497 kg/ha in
interaction of area and yield towards increasing the
1970-71. The area, production and yield of lentil
lentil production in India, a decomposition analysis
observed upward tendency in almost all the decades
(Kumar, 2010) has been performed and is expressed as
as well as overall period. The farmer of the country
Production in the base year is given by
could achieve this increase in production and yield
Po= Ao x Yo mainly due to the development of high yielding
varieties, shorter duration with of wilt resistant
Similarly, the production in the nth year is given
varieties; better management practices with improved
by
production and protection techniques and
Pn= An x Yn government policy mainly increase in minimum
support price.
AlsoPn = Po + P, An = Ao + A and Yn = Yo + Y
 Kumar et al.: Growth, instability and decomposition analysis in lentil 67

Table 1. Area, production and yield of lentil during 1970-71 (-0.32% and -0.92%). It was highest (2.73%) during
to 2017-18 seventies followed by in nineties (2.34%). However,
Period Area (m.ha) Production (m.tons) Yield (kg/ha) the growth rate in lentil production was estimated
1970-71 0.75 0.37 497 positive in all the decades as well as overall period.
1980-81 0.93 0.47 498 The highest growth rate in lentil production was
1990-91 1.19 0.85 717 observed during eighties (5.41%). Critical perusal of
2000-01 1.48 0.92 619 Table 3 indicated that the lentil registered highest
2010-11 1.60 0.94 591
growth rates in yield (5.96%) during the period 2010-
2017-18 1.55 1.62 1047
11 to 2017-18. However the crop observed negative
Table 2 presents the percentage contribution of growth rates in yield (-1.81%) during seventies. As per
the area, yield and their interaction in increasing or decade-wise analysis of area instability ranges from
decreasing the production of lentil for each decade 4.20 to 12.08 and it indicate stable area under lentil
from 1970-71 to 2017-18 and overall period. The yield with reduced variability over the decades, despite
effect has a greater contribution in each decade lentil crop being grown predominately under no
separately except nineties as well as for overall period. irrigation conditions in the country. Overall
The interaction of area and yield is more in seventies instability is higher in production than area and yield
followed by eighties. Response to increase in for almost all the decades as well as overall period.
production due to yield effect during each decades
Table 3. Coefcient of variation (CV%) and compound
and overall the change in production is due to all three
growth rate (r%) of Lentil in different period
component yield, area and yield-area interaction. In
order to give much importance of lentil production in Period Area Production Yield
the country the government has included lentil in CV r CV r CV r
National Food Security Mission and has been 1970-71 to 1979-80 12.08 2.73 13.46 0.92 7.40 -1.81
signicantly increasing Minimum Support Price for 1980-81 to 1989-90 6.44 1.98 15.56 5.41 10.30 3.43
the from from Rs.2250/quintal in 2010-11 to 1990-91 to 99-2000 7.84 2.34 12.73 2.45 7.02 0.09
2000-01 to 2009-10 4.20 -0.32 7.08 0.04 6.04 0.04
Rs.5100/quintal in 2020-21. This has resulted in an
2010-11 to 2017-18 7.11 -0.92 18.08 5.01 16.29 5.96
above normal growth in lentil production in recent
1970-71 to 2017-18 20.77 1.48 36.33 2.70 19.76 1.21
years taking country towards achieving self
sufciency in pulses. REFERENCES
Table 2. Percentage contribution of yield, area and Devraj, Kumar H., Bhatt S. and Kumar R. 2019. Pulses
their interaction in change in production of lentil in production in India during last three plan
different period periods- A growth analysis. Journal of Food
Period Yield Area Interaction
Legumes 32(4): 261-263.
1970-71 to 1979-80 175 -99 24 Omprakash Maurya, A. Amarender Reddy and
1980-81 to 1989-90 53 37 10 Hemant Kumar. 2016.Growth and
1990-91 to 99-2000 13 84 3
decomposition analysis of pigeonpea in India.
2000-01 to 2009-10 100 0 0
International Journal of Agricultural and
2010-11 to 2017-18 107 -4 -3
1970-71 to 2017-18 33 32 35 statistics Science 12(1)189-191.
Hemant Kumar and Devraj 2010. Growth rates of
The compound growth rate and coefcient of eld pea in India-A decomposition analysis.
variation in area and production and yield of lentil in Agricultural situation in India, 67(3), 127-129.
different decades and for whole period under study
Moorti, T.V., Sharma, K.D., and Thakur, D.R.(1991.
are given in Table 3. The compound growth rate of
Trends in the production of Pulses and Oilseeds
area was found positive in each decades and overall
in Himachal Pradesh. Agricultural Situation in
period except rst and second decades of this century
India, 303-308.
 Journal of Food Legumes 35(1): 68-70, 2022

Short Communication

Identication of transgressive segregants for yield and earliness in

blackgram [Vigna mungo (L.) Hepper]
1,*
A Kavitha Reddy, DM Reddy2, Lakshminarayana R Vemireddy1, P Sudhakar3
Dept. of Genetics & Plant Breeding; 1Dept.
of Molecular Biology and Biotechnology
S.V. Agricultural College, Tirupati; 2Dept.
of Genetics & Plant Breeding; 3Dept. of
Crop Physiology; 4Dept. of Plant
Pathology, IFT, Regional Agricultural
Research Station, Tirupati
*Email: appagari@gmail.com
Received: 12 January, 2022
Accepted: 23 April, 2022
Handling Editor:
Dr Awnindra Singh, ICAR-Indian Institute
of Pulses Research, Kanpur
and BV Bhaskara Reddy4
ABSTRACT
Transgressive segregation is a phenomenon where the progenies of a
cross combination will possess the values exceeding both the parents for
one or more characters. The present investigation was carried out to
identify desirable transgressive segregants for maturity and yield in ve
blackgram crosses viz., LBG-752 x TBG-104, LBG-752 x PU-31, LBG-752 x
TU-40, TU-40 x TBG-104 and IPU-2-43 x TBG-104. The highest frequency
of desirable segregants for both yield and maturity were observed in the
cross LBG-752 x TBG-104 (13.75%). High frequency of such favorable
transgressive segregants indicates that the parents possess diverse
alleles and genes governing respective characters from which it could be
inferred that there is an ample scope to bring in benecial alleles into a
single genetic background through careful selection in further
generations. Meticulous selection schemes along with proper pedigree
maintenance can aid in successful development of short duration and
high yielding blackgram varieties from these segregants.
Key words: Blackgram, Early maturity, High yield, Transgressive
segregants

Blackgram is one of the extensively cultivated
grain legumes in arid and semi arid areas as a catch
crop, mulch crop, inter crop, mixed crop and green
crop, underscoring the success of this crop as a best t
into multiple and inter cropping systems which forms
the basis of sustainable farming system. Blackgram
accounts for 13 per cent of total pulse area and 10 per
cent of total pulse production in India with an area of
about 5.60 million hectares, production of 3.06 million
tonnes and productivity of 546 kg ha-1 (Anonymous,
2018-19). Andhra Pradesh is one of the leading
blackgram growing states of India with an area of 3.81
lakh hectares, production of 3.13 lakh tonnes and
productivity of 821.5 kg ha-1 (Anonymous, 2018-19).
During the last few years, domestic production has
been lagging behind consumption requirements and
moreover imports are not adequate to bridge this
supply and demand gap. This shortfall has serious
implications on our county's food and nutritional
security. The pulse requirement in the country is
projected at 32 million tonnes by 2030 and 39 million
tonnes by 2050 at an annual growth rate of 2.2%
requiring an all round efforts and strategic steps for
enhancing pulses production (Ahlawat et al., 2016).
Globally, more preference towards non-meat protein
sources than animal-based foods is observed
indicating the need to enhance yield levels of pulses
for a sustainable future.
Apart from yield, crop phenology plays a crucial
role in crop adaptation to different environments
particularly in rain fed regions where growth is
restricted by water availability and by seasonal
temperature prole. Early owering and maturity not
only provide an escape mechanism to biotic and
abiotic stresses but also makes the varieties to t well
in different ecological niches that in turn brings
additional area under cultivation. Hence,
development of short duration and high yielding
varieties that t well into different cropping windows
is the need of the hour.
However it is assumed that selection for high
yield, may lead to prolonged crop duration. Hence,
breeders have to nd effective ways to simultaneously
select for high yield and earliness. Transgressive
segregants are the progenies from a hybrid, which
exceed either of the two parents with respect to one or
more traits. Such segregants are produced by
 Reddy et al.: Transgressive segregants for yield and earliness in blackgram
accumulation of favorable genes from both the
parents as a consequence of segregation and
recombination. Success in obtaining the desired
transgressive segregants depends on obtaining
genetic recombination between both linked and
unlinked alleles (Briggs and Allard, 1953). Unlike
heterosis, extreme phenotypes caused by
transgressive segregation are heritably stable
(Mackay et al., 2021). Maximum genetic variation in F2
generation provides the rst opportunity for selection
of individual plants, any one of which may end up
into a new cultivar. Hence the present study was
planned to identify desirable segregants for yield and
earliness in ve blackgram crosses.
F2 population of ve crosses viz., LBG-752 x TBG-
104, LBG-752 x PU-31, LBG-752 x TU-40, TU-40 x TBG-
104 and IPU-2-43 x TBG-104, along with their parents
were sown in a compact family block design with
three replications during rabi, 2020 at Dry land farm, S.
V. Agricultural College, Tirupati. Data on seed yield
plant-1 and days to maturity was collected from 240
randomly selected F2 plants in each cross and 30 plants
among parents. Early maturing segregants were
tagged and labeled individually in each cross.
Transgressive segregants were identied by nding
the number of plants exceeding mean value of the
higher parent or lagging behind the mean value of the
lower parent by critical difference at 5 percent level.
Blackgram is third widely grown pulse crop of
India after chickpea and redgram. Despite being the
largest producer, India is also the largest importer and
consumer of pulses. Hence, there is an immediate
need to enhance production levels of blackgram. Short
duration and high yielding varieties with stable
performance would help in horizontal expansion of
the crop and contribute to enhanced yields. Unlike
heterosis, transgressive segregants can be xed and
moreover, many plant breeders have reported that
Table 1. Transgressive segregants for days to maturity observed in F2 generation of ve crosses in blackgram
S. Cross F2 Max. Min.
No. mean value value
1. LBG-752 x TBG-104 73.25 81.00 63.00
2. LBG-752 x PU-31 75.40 82.00 70.00
3. LBG-752 x TU-40 73.98 79.00 66.00
4. TU-40 x TBG-104 72.99 78.00 65.00
5. IPU-2-43 x TBG-104 76.59 80.00 68.00
69
transgressive segregation may be used as an effective
tool to enhance yield levels of various crops through
identication of desirable segregants. Therefore, the
present investigation was aimed at identication of
desirable segregants for yield and early maturity.
Transgressive segregants with lower values than
the early parent are desirable for days to maturity,
whereas for seed yield per plant, segregants with
higher values than their respective better yielding
parent were desirable. For days to maturity (Table 1),
the cross LBG-752 x TBG-104 (52.50%) registered the
highest number of early maturing segregants
followed by LBG-752 x PU-31 (17.08%), TU-40 x TBG-
104 (3.33 %), IPU-2-43 x TBG-104 (2.92 %) and LBG-752
x TU-40 (1.66%). The late maturing segregants (Table
1) can be utilized to develop long duration varieties.
As high yield is the ultimate goal of any breeding
program, transgressive segregants which exceed the
respective better parent in each cross were only
considered. The cross LBG-752 x TBG-104 recorded
29.78 per cent of desirable segregants (Table 2) for
seed yield plant-1 followed by LBG-752 x PU-31 (22.91
%), LBG-752 x TU-40 (20.00%), TU-40 x TBG-104
(14.58%) and IPU-2-43 x TBG-104 (13.33%). Similarly,
Reddy and Singh (1989), Chand and Jagadeshwar
(2002) and Chauhan et al. (2018) also reported high
yielding transgressive segregants in blackgram. The
appearance of F2 segregants surpassing the parental
means suggests that the parents had diverse alleles
and genes governing yield and its component traits.
The cross that noted the highest number of
simultaneous desirable segregants for both maturity
and yield (Table 3) was LBG-752 x TBG-104 (13.75%)
followed by LBG-752 x PU-31 (6.66 %), IPU-2-43 x
TBG-104 (2.91 %), LBG-752 x TU-40 (1.66 %) and TU-
40 x TBG-104 (1.25 %). Occurrence of such
transgressions is possibly due to accumulation of
complementary alleles from both the parents at
P1 P2 Number of transgressive segregants in
F2 generation (Population size = 240)
< lesser > Higher
parent value parent value
77.70 75.20 126 (52.50 %) 6 (2.50 %)
76.93 72.20 41 (17.08 %) 89 (37.08 %)
76.53 68.67 4 (1.66 %) 26 (10.83 %)
69.53 75.80 8 (3.33%) 17 (7.08 %)
71.13 75.80 7 (2.92 %) 73 (30.41 %)
70 Journal of Food Legumes 35 (1), 2022

Table 2. Transgressive segregants for seed yield plant-1 (g) observed in F2 generation of ve crosses in blackgram

S. Cross F2 Max. Min. P1 P2 Number of transgressive segregants in

No. mean value value F2 generation (Population size = 240)
> Higher parent value
1. LBG-752 x TBG-104 13.69 15.82 3.88 5.67 7.54 71 (29.58 %)
2. LBG-752 x PU-31 10.44 15.34 3.11 6.79 5.29 55 (22.91%)
3. LBG-752 x TU-40 10.78 15.52 2.12 6.19 5.36 48 (20.00 %)
4. TU-40 x TBG-104 9.24 14.87 1.42 5.32 7.10 35 (14.58 %)
5. IPU-2-43 x TBG-104 8.50 15.04 2.38 6.93 7.82 32 (13.33 %)

Table 3. Transgressive segregants for early maturity
and yield observed in F2 population of ve crosses in
blackgram
S. Cross Number of transgressive
No. segregants in F2 generation
(Population size = 240)
1. LBG-752 x TBG-104 33 (13.75 %)
2. LBG-752 x PU-31 16 (6.66%)
3. LBG-752 x TU-40 4 (1.66%)
4. TU-40 x TBG-104 3 (1.25 %)
5. IPU-2-43 x TBG-104 7 (2.91 %)
multiple loci (Tanksley, 1993) and unmasking of
recessive deleterious alleles due to inbreeding (Rick
and Smith, 1953). From this investigation, it can be
suggested that the most promising transgressive
segregants identied for maturity and yield need to be
evaluated further. A proper record on these
segregants should be maintained and cautiously
advanced to further generations till they reach
homozygosity. If they conrm their superiority in
further generations may be advanced to further
generations that would result in short duration and
high yielding blackgram variety that ts well into
different ecological niches.
As both maturity and yield showed
transgressive segregation in all the ve crosses it can
be inferred that the parents possess different alleles
and genes governing respective characters from
which it could be inferred that there is a lot of scope to
bring in benecial alleles into a single genotype
through rigorous selection and evaluating the
segregants to arrive at a desirable plant type through
selection in later generations.
ACKNOWLEDGEMENT
Author is thankful to DST Inspire (Department of
Science & Technology, Ministry of Science &
Technology, Government of India) for nancial under
Inspire fellowship program during the course of
study and S.V. Agricultural College, Tirupati,
ANGRAU for providing resources for carrying out
doctoral research work.
REFERENCES
Ahlawat, I.P.S., Sharma, P and Singh, U. 2016.
Production, demand and import of pulses in
India. Indian Journal of Agronomy. 61 (4): 33-41.
Anonymous, 2018-19. Annual report. Ministry of
Agriculture and Farmers Welfare, Govt. of India.
Krishi Bhawan, New Delhi. (agriculture.gov.in).
Briggs, F.N and Allard, R.W. The current status of the
backcross method of plant breeding. Agronomy
Journal. 1953; 45:131-138.
Chand, P and Jagadeshwar, K. 2002. Breeding
methods for transgressive segregation for yield
and its components in blackgram. Progressive
Agriculture. 2(1): 68-69.
Chauhan, S., Mittal, R.K., Sood, V.K and Patial, R.
2018. Identication and isolation of
transgressive segregants in F3 generation of
blackgram (Vigna mungo (L.) Hepper).
Himachal Journal of Agricultural Sciences.
44(1&2): 1-9.
Mackay, J.I., Cockram, J., Howell, P and Powell, W.
2021. Understanding the classics: the unifying
concepts of transgressive segregation,
inbreeding depression and heterosis and their
central relevance for crop breeding. Plant
Biotechnology Journal. 9:26-34.
Reddy, K.R and Singh, D. P.1989. Transgressive
segregation in the wide and varietal crosses of
blackgram (Vigna mungo (L.) Hepper). Indian
Journal of Genetics. 49(1): 131-134.
Rick, C.M and Smith, P.G. 1953. Novel variation in
tomato species hybrids. The American
Naturalist. 88.
Tanksley, S. D. 1993. Mapping Polygenes. Annual
Review of Genetics. 27(1), 205–233.
 Journal of Food Legumes 35(1): 71-75, 2022

Short Communication

Tillage and weed management effects on yield performance of

chickpea (Cicer arietinum) grown after sorghum (Sorghum bicolor)
1
Tony Manoj Kumar N* and 2AR Sharma

Rani Lakshmi Bai Central Agricultural ABSTRACT

University, Jhansi, Uttar Pradesh 284003
*Email: tonymanoj98@gmail.com
Received: 15 December, 2021
Accepted: 18 April, 2022
Handling Editor:
Dr Narendra Kumar, ICAR- Indian Institute
of Pulses Research, Kanpur
A eld experiment was conducted at research farm of Rani Lakshmi Bai
Central Agricultural University, Jhansi, Uttar Pradesh during rabi2019-
20 to nd out the effect of three tillage practices viz. zero tillage (ZT), zero
tillage with residue (ZT+R), conventional tillage (CT), and weed
management practices viz. pre-emergence (PE) pendimethalin,
pendimethalin PE fb post-emergence (PoE) application of clodinafop-
propargyl + Na-aciuorfen, pendimethalin PE fb hand weeding (HW)
and unweeded check on yield performance of chickpea grown after
sorghum. The experiment was laid out in a split-plot design, with tillage
in main plots and weed management practices in sub plots. The crop
biomass, primary and secondary branches, no. of root nodules, nodule
dry weight, no. of pods/plant were signicantly higher under ZT+R
compared to CT. Among the weed management practices,
pendimethalin PE fb clodinafop-propargyl + Na-aciuorfen PoE
performed signicantly better than other weed management
practices.The grain yield under ZT+R was 11.0 and 21.1% over the ZT
and CT, while the PE application of pendimethalin fb PoE application of
clodinafop-propargyl + Na-aciuorfen provided complete control of
weeds and resulted in 8.6 and 19.4% higher grain yield of chickpea than
pendimethalin PE fb hand weeding and pendimethalin alone,
respectively.
Key words: Chickpea, Clodinafop-propargyl + Na-aciuorfen,
Pendimethalin, Sorghum residue, Weed management, Zero tillage

Chickpea (Cicer arietinum L.) is a major rabi pulse
grown over an area of 9.70 million hectares (Mha) with
a production of 11.1 million tonnes (Mt) and 1.14 t/ha
productivity (Indiastat, 2021). It is grown in winter
season in sequence with different crops like rice,
maize, soybean, sorghum, pearlmillet in the states of
Madhya Pradesh, Maharashtra, Rajasthan, Andhra
Pradesh, Tamil Nadu, Karnataka, Uttar Pradesh, and
Gujarat. Being a relatively low-water requiring crop,
sorghum-chickpea system is followed in some areas of
Madhya Pradesh and Maharashtra. Fodder
sorghum–chickpea is one of the major cropping
systems of Bundelkhand region (Singh and Praharaj,
2020). Such cereal–legume cropping systems help in
economizing N and breaking monocropping
sequences, preventing soil erosion and improving soil
health.
Being a bold-seeded crop, chickpea does not
require ne tilth and can be grown with limited
ploughings after the harvest of previous crop (Roy et
al., 2014). Accordingly, zero-tillage practice can be
followed for sowing provided weeds are controlled
effectively. Pendimethalin is a popular pre-
emergence herbicide but no post-emergence herbicide
is available for controlling broadleaved weeds in
chickpea. Retention of previous crop residue is
essential to conserve soil moisture for improving
hydro-thermal regime (Acharya et al., 2018), better
weed control (Chauhan et al., 2012), and soil fertility
(Busari et al., 2015). Scanty information was available
on cultivating chickpea under zero-till system with
efcient weed management practices in the
Bundelkhand region, hence the present experiment
was conducted.
72 Journal of Food Legumes 35 (1), 2022

The experiment was carried out on sandy clay-
loam soil at the research farm of RLBCAU, Jhansi,
Uttar Pradesh during 2019-20. Twelve treatment
combinations comprised of three tillage practices in
main-plot, viz. zero tillage (ZT), zero tillage with
residue (ZT+R), conventional tillage (CT); and four
weed management practices in sub-plot, viz.
pendimethalin 1 kg a.i/ha as pre-emergence,
pendimethalin PE fb clodinafop-propargyl + Na-
aciuorfen 122.5 g a.i/ha PoE at 30 DAS,
pendimethalin PE fb hand weeding at 30 DAS, and
unweeded check in a split-plot design with three
replications. Sowing of chickpea was done with
happy seeder, with basal application of 100 kg
DAP/ha, the chickpea variety used was 'RVG-202'.
Sorghum residue @ 5 t/ha of the previous crop was
retained on the soil surface in the respective
treatments. Glyphosate was applied at 0.5 kg/ha
before sowing in ZT plots. The determine the chickpea
biomass the plants from a 0.25 m2 area were taken and
kept in an oven at 65°C for 48 hours, later the weight of
dry biomass was calculated and converted in to a
hectare area. Similarly, chickpea roots were removed
carefully along with nodules and washed gently with
water and kept in oven at 65°C for 48 hours to record
the nodule dry weight.
Impact on weed biomass
Conventional tillage encouraged weed
germination, resulting in more weed dry weight as
compared to other tillage practices (Table 1).
Signicantly lower weed dry weight at 60 DAS was
recorded under ZT+R as the presence of sorghum
residue helped in delaying the weed germination and
emergence. Pre-emergence application of
pendimethalin effectively reduced the grassy weeds
in the initial stages, while post-emergence application
of clodinafop + Na-aciuorfen provided efcient
weed control of all weed species, and resulted in
signicantly lower weed dry weight than other
treatments. Pendimethalin fb hand weeding at only 30
DAS recorded relatively more weed dry weight than
pendimethalin fb clodinafop + Na-aciuorfen, but
lower than pendimethalin alone and unweeded
check. This was due to the fact that pre-emergence
pendimethalin application prevented initial ush of
weeds followed by hand weeding at 30 DAS. But the
weeds started to emerge out after few days of hand
weeding at 30 DAS, which resulted in poor weed
control at later stages in contrast to the post-
emergence application of clodinafop + Na-aciuorfen
at 30 DAS, which has provided prolonged weed
control at lateral stages.
Impact on chickpea biomass
Dry matter accumulation of chickpea increased
with crop age. There was no signicant effect of tillage
on dry matter accumulation of chickpea at 30 DAS, but
at 60 DAS and subsequent stages, ZT+R was
signicantly superior to CT but at par with ZT. Dixit et

Table 1. Effect of tillage and weed management on weeds, and growth and yield of chickpea
Crop biomass Primary Secondary Root Nodule Pods Stover
(g/m2) branches branches nodules/ dry /plant yield
**Weed
/plant /plant plant weight (no.) (t/ha)
biomass
Treatment 60 90 (no.) (no.) at (no.) at (mg/pla
(g/m2) at
60 DAS DAS DAS at 90 90 DAS 85 DAS nt) at 85
DAS DAS
Tillage
ZT 29.4 179.8 339.2 8.76 25.4 16.4 62.2 49.5 1.78
ZT+R 21.0 181.9 346.1 8.79 28.7 16.9 64.8 51.7 1.91
CT 76.0 172.1 321.7 7.88 21.6 15.2 54.0 47.6 1.61
SEm+ 1.2 1.3 2.3 0.18 0.5 0.3 0.9 0.7 0.04
CD (0.05) 4.5 5.1 9.1 0.70 2.0 1.0 3.6 2.8 0.14
Weed management*
Pendimethalin PE 27.8 191.0 341.6 8.61 26.4 16.2 62.1 51.9 1.82
Pendimethalin PE fb
Clodinafop +Na- 10.2 167.2 352.7 9.19 30.6 16.9 65.1 57.6 2.11
aciuorfenPoE
Pendimethalin PE fb HW 14.6 195.9 348.4 8.90 28.4 17.5 67.0 55.6 1.96
Unweeded control 115.9 157.3 300.0 7.21 15.6 13.8 47.1 33.3 1.18
SEm+ 1.0 1.1 1.6 0.09 0.5 0.1 0.7 0.4 0.02
CD (0.05) 3.0 3.3 4.8 0.27 1.4 0.2 2.1 1.2 0.05
*PE= Pre-emergence application; PoE=Post-emergence application; HW= hand weeding; fb= followed by;
** Weed biomass data not transformed
 Kumer N et al.: Tillage and weed management effects on chickpea grown after sorghum
al. (2015) also recorded signicantly lower weed
density under ZT chickpea grown after fodder
sorghum. Presence of sorghum residue under ZT had
benecial effect on dry matter accumulation as
compared to ZT and CT, which modied the hydro-
thermal regime and reduced weed pressure (Acharya
et al., 2018). Weed management practices did not have
any effect on the plant dry matter accumulation at 30
DAS, but at 60 DAS, dry matter of chickpea under
pendimethalin fb clodinafop propargyl + Na-
aciuorfen was signicantly lower as compared to
other pendimethalin-applied practices. Application
of clodinafop + Na aciuorfen at 30 DAS resulted in a
scorching effect on chickpea foliage (Figure 1), which
suppressed the crop growth for about 20 days after
application, and resulted in lower dry matter
accumulation. However, the adverse effect was only
temporary and the plants almost fully recovered from
the phyto-toxicity effect of clodinafop-propargyl +
Na-aciuorfen at 90 DAS.
Fig. 1. Phyto-toxic effect of clodinafop-propargyl + Na-
aciuorfen on chickpea after 30 DAS
Primary and secondary branches
The primary branches recorded at 90 DAS of
chickpea were signicantly higher under ZT+R
compared to CT, but was at par with ZT. In contrast,
the secondary branches under ZT+R were 13 and
32.9% more compared to ZT and CT. The residue
retention under ZT+R created mulch effect which
73
reduced the weeds and provided weed free
conditions, which resulted in better crop growth and
development. Among the weed management
practices, pendimethalin PE fb clodinafop-propargyl
+ Na-aciuorfen PoE recorded more no. of primary
and secondary branches at 90 DAS (Table 1). The
growth and development of chickpea plants was
suppressed due to phyto-toxic effect of clodinafop-
propargyl + Na-aciuorfen (PoE), but upon recovery
the plants showed enhanced growth and
development by producing more no. of branches and
crop biomass (Nath et al., 2021).
Root nodulation and yield attributes
Tillage practices signicantly affected the root
nodulation of chickpea. CT had 7.9 and 11.2% less root
nodules than ZT and ZT+R, respectively at 85 DAS
(Table 1). ZT and ZT+R had no difference in the
number of root nodules. Pendimethalin PE fb hand
weeding recorded signicantly more nodules (8.0%)
over pendimethalin alone, but was at par with
pendimethalin PE fb clodinafop-propargyl + Na-
aciuorfen PoE.
Number of pods per plant was almost similar
under ZT+R and ZT, but there was a signicant
difference between ZT+R and CT. More number of
pods were recorded with pendimethalin PE fb
clodinafop-propargyl + Na-aciuorfen PoE and
pendimethalin PE fb hand weeding. Weeds under
uncontrolled conditions caused damage to the
chickpea, which led to the decrease in pods per plant.
Chickpea yield
Grain yield of chickpea under ZT+R was
signicantly higher (11.0 and 21.1%) as compared to
ZT and CT. These ndings corroborate with the 21.1%
increase in zero-till chickpea pooled grain yield
reported by Quddus et al. (2020) in the rst two years
compared to conventional tillage. Parihar et al. (2019)
also reported better performance of chickpea under
ZT grown after maize () and fodder sorghum (Dixit et
al., 2015). Post-emergence application of clodinafop +
Na-aciuorfen resulted in signicantly higher grain
yield (8.6 and 19.4%) compared with pendimethalin
PE fb hand weeding and pendimethalin alone,
respectively. Application of pendimethalin alone or
along with hand weeding resulted in relatively lower
yield as compared to pendimethalin PE fb clodinafop-
propargyl + Na-aciuorfen PoE. Interaction revealed
that similar grain yield was obtained under ZT and
ZT+R with pendimethalin alone and along with
74 Journal of Food Legumes 35 (1), 2022

clodinafop + Na aciuorfen, but it varied signicantly
with pendimethalin PE fb hand weeding and the
unweeded check (Table 2). The same trend was
observed with ZT+R and CT, when CT recorded
almost similar grain yield with pendimethalin alone
and along with clodinafop + Na-aciuorfen, which
signicantly varied with the pendimethalin alone and
the unweeded check. Poor canopy development and
initial slow growth made the chickpea susceptible to
weed competition. Post-emergence application of
clodinafop-propargyl inhibited the plant growth for
around 20 days but the plants recovered from the
phyto-toxic effect and showed normal growth
producing more number of secondary branches and
pods per plant (Nath et al, 2018). The loss in the grain
yield was directly related to the loss or reduction in the
yield attributes, which were signicantly affected by
the weed competition.
A similar trend in stover yield was recorded
which was also signicantly lower under CT as
compared to ZT+R and ZT. The increase in the stover
yield under ZT+R was 18.6% as compared to CT. Zero
tillage with residue resulted in higher stover yield due
to the better growth and development of plants under
relatively less weed competition when compared with
CT. Application of pendimethalin fb clodinafop + Na-
aciuorfen recorded signicantly higher stover yield
as compared to other weed management practices,
despite some inhibitory effect on dry matter
production at 30-50 days stage.
Regression analysis showed that grain yield of
chickpea decreased linearly with increasing weed dry
weight at 60 DAS (Figure 2). The decrease in yield was
0.004 t/ha with unit increase (1 g/m2) in weed dry
weight. On the other hand, the increase in yield was
0.013 t/ha with a unit increase in crop dry weight
(Figure 3). These results suggest that weed and crop
dry matter follow opposite trends, and minimizing
weed biomass is essential for improving crop dry
matter and yield of chickpea.

Table 2. Interaction effect of tillage and weed management on grain yield of chickpea (t/ha)
Weed management
Pendimethalin Pendimethalin PE fb Pendimethalin Unweeded
Tillage Mean
PE clodinafop propargyl + PE fb hand control
Na-aciuorfen PoE weeding
ZT 1.48 1.83 1.71 1.04 1.51
ZT + R 1.65 2.02 1.91 1.26 1.71
CT 1.37 1.71 1.50 0.84 1.35
Mean 1.50 1.86 1.70 1.05
SEm+ CD (0.05)
Tillage 0.03 0.14
Weed management 0.01 0.04
Weed management at same tillage 0.02 0.06
Tillage at same or different weed management 0.04 0.15

2.50 2.50
y = - 0.004x + 1.86; R² = 0.80 y = 0.013x - 2.96; R² = 0.90
2.00 2.00
Grain yield (t/ha) (Y)
Grain yield (t/ha) (Y)

1.50 1.50

1.00 1.00

0.50 0.50

0.00 0.00
0 50 100 150 200 250 300 350 260 280 300 320 340 360 380
Weed dry weight (g/m 2) (X) Plant dry matter (g/m2) (X)

Fig. 2. Relationship between chickpea grain yield and weed Fig. 3. Relationship between chickpea grain yield and plant
dry weight at 60 DAS dry matter at 60 DAS
 Kumer N et al.: Tillage and weed management effects on chickpea grown after sorghum 75

It was concluded that zero tillage with sorghum 60(2):205–211.

residue was benecial for improving growth and
Nath CP, Kumar N, Hazra KK, Praharaj CS, Singh SS,
yield attributes, leading to higher grain yield of
Dubey RP and Sharma AR. 2021. Topramezone:
chickpea when compared with ZT and CT. Post-
A selective post-emergence herbicide in
emergence application of clodinafop-propargyl + Na-
chickpea for higher weed control efciency and
aciuorfen at 30 DAS showed initial phyto-toxicity on
crop productivity. Crop Protection, 150: 105814.
chickpea leaves, but the crop recovered after 20 days.
Thus, pre-emergence application of pendimethalin fb Nath CP, Dubey RP, Sharma AR, Hazra KK, Kumar N
clodinafop-propargyl + Na-aciuorfen PoE provided and Singh SS. 2018. Evaluation of new
complete control of weeds and proved better for generation post-emergence herbicides in
improving chickpea productivity. chickpea (Cicer arietinum L.). National Academy
Science Letters, 41(1): 1–5.
REFERENCES
Roy R, Singh A and Kang JS. 2014. Yield and quality of
Acharya CL, Bandyopadhyay KK and Hati KM. 2018.
chickpea (Cicer arietinum) varieties as inuenced
Mulches: role in climate resilient agriculture.
by different planting techniques. Legume
Reference Module in Earth Systems and
Research-An International Journal, 37(3):
Environmental Sciences. Elsevier.
294–299.
Busari MA, Kukal SS, Kaur A, Bhatt R and Dulazi AA.
Singh NP and Praharaj CS. (2020). Scenario of pulses
2015. Conservation tillage impacts on soil, crop
production in India, Abstracts of International
and the environment. International Soil and
Conference on Pulses as the Climate Smart
Water Conservation Research, 3(2): 119–129.
Crops: Challenges and Opportunities, Bhopal,
Chauhan BS, Singh RG and Mahajan G. 2012. Ecology India, pp. 3–9.
and management of weeds under conservation
Singh S, Walia US and Singh B. 2008.Effective control
agriculture: A review. Crop Protection, 38:
of weeds in chickpea (Cicer arietinum). Indian
57–65.
Journal of Weed Science, 40(1-2): 51–55.
Dixit AK, Kumar S, Rai AK and Kumar TK.
Quddus MA, Naser HM, Siddiky MA, Ali MR,
2015.System productivity, protability, nutrient
Mondol A and Islam MA. 2020. Impact of zero
uptake and soil health under tillage, nutrient and
tillage and tillage practice in chickpea
weed management in rainfed chickpea (Cicer
production. Journal of Agricultural Science,
arietinum)–fodder sorghum (Sorghum bicolor)
12(4): 106–118.
cropping system. Indian Journal of Agronomy,
 Journal of Food Legumes 35(1): 76-77, 2022

Commentary

Innovative approach to further genetic gain in pulses

PS Basu
Former Head & Principal Scientist With more than 25 years of research experience in
Division of Basic Sciences
ICAR-Indian Institute of Pulses abiotic stress physiology in thermal
Research, Kanpur microorganisms such as cyanobacteria and higher
plants including legumes and vegetables, Dr PS
Email: psbsu59@gmail.com
Basu has made signicant contributions in
evolving varieties and donors tolerant to heat and
drought in legumes and vegetables and deciphered
the mechanisms of adaptation of pulses to diverse
climatic conditions.
He is member of International Society of Drought
Mitigation and Climate Change and has established active collaboration
with CSIRO, Australia and JIRCAS Japan in .the eld of stress
physiology and evaluation of diverse legume germplasm through
advanced molecular and physiological tools. His research interests
include long term projections of climate change on agricultural
productivity, developing varieties resilient to adverse climates and crop
modeling.

Global production of grain legumes has the
potential to provide a sustainable solution to food and
protein security. The crops are indispensable for
global food security and agricultural sustainability,
however genetic improvement in these crops lagged
behind cereals due to lack of genomic resources
essential for deploying advanced breeding
technologies. Recognizing the importance of grain
legumes in human and soil health, some efforts were
made to improve the yield and nutritional quality of
legume crops by employing improved agronomy and
crop rotation approaches. Several hundreds of
varieties and a few hybrids have been developed in
the legume crops using conventional breeding
methods for traits like drought, heat, herbicide, low
phosphorus tolerance, early maturity, insect
resistance, machine harvestability and high nitrogen
xation. Nevertheless, the rate of genetic gains using
the conventional approaches could not bridge the gap
between the growing demands which is evident from
only 60% increase in pulse production in last 50 years.
Efforts are currently being made to increase genomic
resources and adopt innovative breeding techniques
to improve the yield and nutritional quality of legume
crops along with enhanced climate resilience.
Development of genetic resources will unleash
untapped potential for genetic improvement. The
development of effective phenotyping and breeding
approaches is a challenge for the grain legumes.
Modern breeding efforts are constrained by a low
level of genetic diversity in breeding programmes.
Large genetic diversity in seeds of grain legumes
preserved in gene banks is not fully utilized in active
breeding programmes. Therefore concept emerged
towards evolving gene banks, applying optimal
contribution selection to manage long-term genetic
gain and genetic diversity in pre-breeding
populations. The plant breeding method should be
applied that captures valuable genes from wild
relatives and moves them into the breeding
programme by crossing the genetically diverse exotic
lines with elite lines, creating evolving gene banks.
The new rapid-cycle plant breeding method will have
long-term benets for all plant breeders, and could
help to adapt and develop climate-ready pulse crops.
The current genomic resources from functional
sequences to epigenomics provided scope for
improving the soybean resilience to different climate
change. High-throughput genomic technologies
including genome sequencing, genome re-sequencing
(DNA-seq) and transcriptome sequencing (RNA-seq)
are being applied to a range of legumes. The genetic
and biotechnology resources are currently being
applied to drought and water-logging using QTLs

and breeding approaches. The crucial importance of
root trait variability and its role in facilitating stress
tolerance in chickpea has been well demonstrated.
The mechanisms that underpin drought tolerance in
legumes are further elaborated by an innovative
analysis of root xylem plasticity and its role in
improving water use efciency in soybean plants
subjected to water stress.
The mungbean is characterized for its small
genome size, short life-cycle, selfpollinating, and close
genetic relationship to other legumes. There have
been several efforts to develop molecular markers and
linkage maps associated with agronomic traits for the
genetic improvement of mungbean and breeding for
cultivar development to increase the average yields of
mungbean. The recent release of a reference genome
of the cultivated mungbean (V. radiata var. radiata
VC1973A) and an additional de novo sequencing of a
wild relative mungbean (V. radiata var. sublobata)
has provided a framework for mungbean genetic and
genome research, that can further be used for genome-
wide association and functional studies to identify
genes related to specic agronomic traits. Moreover,
the diverse gene pool of wild mungbean comprises
valuable genetic resources of benecial genes that
may be helpful in widening the genetic diversity of
cultivated mungbean.
The availability of the draft genome sequences
and re-sequencing of elite genotypes for several
important legume crops have made it possible to
identify structural variations at large scale.
Availability of large-scale genomic resources and low-
cost and high-throughput genotyping technologies
are enhancing the efciency and resolution of genetic
mapping and marker-trait association studies. Most
importantly, deployment of molecular breeding
approaches has resulted in development of improved
77
lines in some legume crops such as chickpea and
groundnut. In order to support genomics-driven crop
improvement at a fast pace, the deployment of
breeder-friendly genomics and decision support tools
seems appear to be critical in breeding programs in
developing countries.
Although conventional breeding approaches
have been successful to address the issue of low
productivity in some legumes, but the desired success
rate is not yet achieved. Therefore, it is very essential
to intensify the legume genetic enhancement
programs using advanced breeding approaches
wherein the potential of genomics needs to be
exploited for accelerated development of improved
cultivars possessing high yield, genetic resilience
against stresses, and enhanced nutritional quality.
The next-generation sequencing (NGS) and
genotyping technologies need to be used for precise
marker-trait association, gene discovery, functional
marker development, and their deployment in
routine breeding programs. Efciency of breeding
programs of legume crops such as chickpea,
pigeonpea and groundnut has been considerably
improved over the past decade through deployment
of modern genomic tools and technologies. For
instance, next-generation sequencing technologies
have facilitated availability of genome sequence
assemblies, re-sequencing of several hundred lines,
development of HapMaps, high-density genetic
maps, a range of marker genotyping platforms and
identication of markers associated with a number of
agronomic traits in these legume crops. Although
marker-assisted backcrossing and marker-assisted
selection approaches have been used to develop
superior lines in several cases, it is the need of the hour
for continuous population improvement after every
breeding cycle to accelerate genetic gain in the
 Journal of Food Legumes 35(1): 78, 2022

List of Referees for Vol. 35 (1)

The Editorial Board gratefully acknowledges the help rendered by following referees for reviewing
manuscripts for Volume 35 (1): 2022
1. Dr. Ashok Parihar, ICAR-IIPR, Kanpur
2. Dr. Om Gupta, JNKVV, Jabalpur
3. Dr. Guarav K Taggar, PAU, Ludhiana
4. Dr. A Amarender Reddy, ICAR-CRIDA, Hyderabad
5. Dr. Rajan Katoch, CSKHPKV, Palampur
6. Dr. SS Rathore, ICAR-IARI, New Delhi
7. Dr. P.Jayamani, TNAU,Coimbatore
8. Dr. K.N.Ganeshan, TNAU, Coimbatore
9. Dr. Dinesh Yadav, PDDGU, Gorakhpur
10. Dr. Awinindra Singh, ICAR-IIPR, Kanpur
11. Dr. Asik Dutta, ICAR-IIPR, Kanpur
 Instructions to Authors
Journal of Food Legumes (formerly Indian Journal of Pulses
Research) publishes original papers, short communications
and review articles by renowned scientists, covering all
areas of food legumes research. The paper should not have
been published or communicated elsewhere. Authors will
be solely responsible for the factual accuracy of their
contribution. Language of publication is English (British).
Please send your manuscript to following address:
Secretary
ISPRD
Indian Institute of Pulses Research
Kalyanpur, Kanpur 208 024, India
Email: secretary.isprd@gmail.com
Manuscript must be submitted through e-mail. Authors
are required to submit a certicate that the paper is exclusive
for Journal of Food Legumes. Manuscripts must conform
to the Journal style (see the latest issue). Correct language
is the responsibility of the author. After having received
your contribution (date of submission), there will be a
review process before the editorial board takes decision
regarding acceptance for publication. One copy of the
revision together with the original manuscript must be
returned to the subject editor or Secretary. The submitted
paper must be one complete word document  le
comprising a title page, abstract, text, references, tables,
gure legends and gures. When preparing your text le,
please use only Times New Roman for text (12 point,
double spacing) and Symbol font for Greek letters to avoid
inadvertent character substitutions.
F or ma t
Every original paper should be divided into the following
ve sections: ABSTRACT, Key words, INTRODUCTION,
MATERIALS AND METHODS, RESULTS AND
DISCUSSION, and REFERENCES. The manuscript should
be double spaced, and with 4-cm margins with page and
line numbers. The main title must be capital bold.
Subheading must be bold italic and Sub-sub heading
normal italic.
At the head of the manuscript, following information
should be given: title of paper, name(s) of author(s),
institute where the research was carried out, present
addresses of authors (foot note) and of the corresponding
author (if different from above Institute). Authors are
required to provide running title of the paper. You must
supply an E-mail address for the corresponding author.
The abstract should contain at least one sentence on each
of the following: objective of investigation (hypothesis,
purpose, a im), experimental material, method of
investigation, data collection, result and conclusions.
Maximum length of abstract is 175 words. Up to 10 key
words should be added at the end of the abstract and
separated by comma . Key words must be arranged
alphabatically (e.g., EMS, Gamma ray, Mun gbean,
Mutations, Path coefcient, ......).
Each gure, table, and bibliographic entry must have a
reference in the text. Any correction requested by the
reviewer should also be integrated into the le.
Manuscript le including tables must be in MS Word and
Windows-compatible and must not contain any les other
than those for the current manuscript. Please do not import
the gures into the text le. The text should be prepared
using standard software (Microsoft Word); do not use
automated or manual hyphenation.
Length
Manuscripts should not exceed a nal length of 15 printed
pages, i.e., 5,000 words, including spaces required for
gures, tables and list of references. Manuscripts for short
communications should not exceed 3000 words printed
pages, with not more than a total of 2 gures or tables.
Units, abbreviations and nomenclature
For physical units, unit names and symbols, the SI-system
should be employed. Biological names should be given
according to the latest international nomenclature.
Botanical and zoological names, gene designations and
gene symbols are italicised. Yield data should be reported
in kg/ha. The name of varieties or genotypes must start
and end with single inverted comma (e.g., ‘Priya’, ‘IPA
204’, ......).
Tables and Figures
Tables and gures should be limited to the necessary
minimum. Please submit reproducible artwork. For
printing of coloured photograph, authors will be charged ` 4000/
- per photograph. It is essential that gures are submitted as
high-resolution scans.
References
The list of references should only include publications
cited in the text. They should be cited in alphabetical order
under the rst author’s name, listing all authors, the year
of publication and the complete title, according to the
following examples:
Becker HC, Lin SC and Leon J. 1988. Stability analysis in
plant breeding. Plant Breeding 101: 1-23.
Sokal RR and Rholf FJ. 1981. Biometry, 2nd Ed. Freeman,
San Francisco.
Tandon HLS. 1993. Methods of Analysis of Soils, Plants,
Water and Fertilizers (ed). Fertilizer Development and
Consultation Organization, New Delhi, India. 143 pp.
Singh DP. 1989. Mutation breeding in blackgram. In: SA
Farook and IA Khan (Eds), Breeding Food Legumes.
Premier Publishing House, Hyderabad, India. Pp 103-109.
Takkar PN and Randhawa NS. 1980. Zinc deciency in
Indian soils and plants. In: Proceedings of Seminar on
Zinc Wastes and their Utilization, 15-16 October 1980,
Indian Lead-Zinc Information Centre, Fertilizer
Association of India, New Delhi, India. Pp 13-15.
Satyanarayan Y. 1953. Photosociological studies on
calcarious plants of Bombay. Ph.D. Thesis, Bombay
University, Mumbai, India.
In the text, the bibliographical reference is made by giving
the name of the author(s) with the year of publication. If
there are two references, then it should be separated by
placing ‘comma’ (e.g., Becker et al. 1988, Tandon 1993). If
references are of the same year, arrange them in alphabatic
order, otherwise arrange them in ascending order of the
years.
While preparing manuscripts, authors are requested to
go through the latest issue of the journal. Authors are
also required to send the names & E-mail address of at
least 3-4 reviewers appropriate to their articles.
9. Effect of weed management and sulphur levels on weed density, nutrient depletion and 58
productivity of cluster bean [Cyamopsis tetragonoloba (l.) Taub]
RK Yadav, SL Mundra, Santosh Devi Samota and SL Yadav
10. Growth, instability and decomposition analysis of lentil production in India 65
Hemant Kumar, Devraj Mishra and Uma Sah

SHORT COMMUNICATION
11. Identication of transgressive segregants for yield and earliness in blackgram 68
[Vigna mungo (l) Hepper]
A Kavitha Reddy, DM Reddy, Lakshminarayana R Vemireddy, P Sudhakar and BV Bhaskara Reddy
12. Tillage and weed management effects on yield performance of chickpea (Cicer arietinum) 71
grown after sorghum (Sorghum bicolor)
Tony Manoj Kumar N and AR Sharma

COMMENTARY
13. Innovative approach to further genetic gain in pulses 76
PS Basu

List of Referees for Vol. 35 (1) 78

 Volume 35 Number 1 January-March, 2022

CURRENT AFFAIRS
1. Elucidating Diversity of Transcription Factors to Develop Stress-Tolerant Crops: 1
An Overview
Dinesh Yadav

RESEARCH PAPERS
2. Trait associations and diversity analysis based on quantitative traits under moisture stress 3
conditions in chickpea (Cicer arietinum L.)
S K Jain, Gayacharan, LD Sharma, KC Gupta, RS Sharma, Vipin Kumar, Neeta Singh,
Sushil Pandey, Girish P Dixit, Ashok Kumar
3. Assessment of traits association and genetic divergence in a diverse panel of eldpea 11
(Pisum sativum L.) genotypes
Theint Theint Tun, Ravika, Rajesh Yadav and Seema Kamboj
4. A combined selection approach using modied multivariate analysis for identication of 17
fast cooking beans (Phaseolus vulgaris L.) based on seed physical parameters
Parvaze A. So, Sajad Majeed Zargar, Sujeela Rani, Samreen Fatima, Sadiah Sha, Aaqif Zaffar and
Ramsha Khalid
5. Identication and characterization of oxalyl-CoA synthetase gene (LsAAE3) in grasspea 27
(Lathyrus sativus L.)
Neetu Singh Kushwah, Shanmugavadivel P.S., Alok Das, Meenal Rathore, Archana Singh and
Narendra Pratap Singh
6. Identication and validation of new sources of resistance for Mungbean Yellow Mosaic India 41
Virus in urdbean [Vigna mungo (L.) Hepper]
Mohammad Akram, Naimuddin, Debjyoti Sen Gupta, Sanjeev Gupta, PK Katiyar, AK Singh and
NP Singh
7. Population dynamics of major insect-pests of lentil and correlation with abiotic factors 47
Dilbag Singh Ahlawat, Tarun Verma and Rajesh Yadav
8. Biologically effective dose of sodium aciuorfen + clodinofop-propargyl applied as post 51
emergent for weed management in greengram
Mudalagiriyappa, KR Shyamasundar, Pratima Ningaraddi Morab and Subhash Sannappanavar

Published by The Secretary on behalf of

Indian Society of Pulses Research and Development (www.isprd.in)
ICAR-Indian Institute of Pulses Research, Kanpur-208 024
Phone : 9452060055
E-mail: secretary.isprd@gmail.com
at Maheshwari & Sons, 289/214, Motinagar, Lucknow-226 004 Ph. : 9721505010
For free download of JFL articles, please also visit: www.indianjournals.com