INDIAN SOCIETY OF PULSES RESEARCH AND DEVELOPMENT

(Regn. No. 877)

The Indian Society of Pulses Research and The contribution to the Journal, except in case of
Development (ISPRD) was founded in April 1987 with the invited articles, is open to the members of the Society
following objectives:
only. Any non-member submitting a manuscript will be
 To advance the cause of pulses research
 To promote research and development, teaching and
required to become annual member. Members will be
extension activities in pulses entitled to receive the Journal and other communications
 To facilitate close association among pulse workers issued by the Society.
in India and abroad
 To publish “Journal of Food Legumes” which is the Renewal of subscription should be done in January
official publication of the Society, published four times each year. If the subscription is not received by February
a year. 15, the membership would stand cancelled. The
Membership : Any person in India and abroad interested membership can be revived by paying readmission fee of
in pulses research and development shall be eligible for
` 50/-. Membership fee drawn in favour of Treasurer,
membership of the Society by becoming ordinary, life or
corporate member by paying respective membership fee. Indian Society of Pulses Research and Development,
through D.D. may be sent to the Treasurer, Indian
Membership Fee Indian (`) Foreign (US $)
Ordinary (Annual) 500 40 Society of Pulses Research and Development, ICAR-
Life Member 5000 400 Indian Institute of Pulses Research, Kanpur
Admission Fee 50 10
Library/ Institution 5000 400 208 024, India. In case of outstation cheques, an extra
Corporate Member 7500 - amount of ` 50/- may be paid as clearance charges.

EXECUTIVE COUNCIL : 2017-2020

Chief Patron Patron
Dr Trilochan Mohapatra Dr A K Singh
Co-patron
Dr NP Singh
President Vice President
Dr NP Singh Dr Guriqbal Singh
Secretary
Dr PK Katiyar
Joint Secretary Treasurer
Dr Jitendra Kumar Dr RK Mishra

Councillors

Zone I : Dr Brij Nandan, SKUAST, Samba (J&K) Zone V : Dr DK Patil, Badnapur

Zone II : Dr C Bharadwaj, IARI, New Delhi Zone VI : Dr P Jagan Mohan Rao, RARS, Warangal
Zone III : Dr Rajib Nath, BCKV, Kalyani Zone VII : Dr P Jayamani, TNAU, Coimbatore
Zone IV : Dr Baldev Ram, AU, Kota Zone VIII: Dr AK Parihar, ICAR-IIPR, Kanpur

Editor-in-Chief
Dr CS Praharaj

Editors
Dr Puran Gaur, ICRISAT, Hyderabad Dr Aditya Pratap, ICAR-IIPR, Kanpur
Dr Shiv Kumar, ICARDA, Morocco Dr Narendra Kumar, ICAR-IIPR, Kanpur
Dr BB Singh, GBPUA&T, Pantnagar Dr Naimuddin, ICAR-IIPR, Kanpur
Dr DK Agarwal, ICAR-IISS, Mau Dr Meenaal Rathore, ICAR-IIPR, Kanpur
Dr Sarvajeet Singh, PAU, Ludhiana Dr Archana Singh, ICAR-IIPR Regional Station, Bhopal
Dr J Souframanian, BARC Dr Abhishek Bohra, ICAR-IIPR, Kanpur
 Journal of Food Legumes
(Formerly Indian Journal of Pulses Research)

Vol. 33 (1) January-March, 2020

CONTENTS
RESEARCH PAPERS

1. Genetic diversity studies in chickpea (Cicer arietinum L.) genotypes using SSR markers 1

S Mohan and T Kalaimagal

2. Molecular genetic diversity in cowpea {Vigna unguiculata (L.) Walp.} genotypes 6

Manju Devi S and Jayamani P

3. Genetic, character association and multivariate studies of seed yield with different traits in mungbean
{Vigna radiata (L.) Wilczek} 10

Nandigam Swathi Rekha, CS Mahto, Arun Kumar, HC Lal and Anita Pande

4. Effect of seasonal variations on yield and its attributes in mungbean {Vigna radiata (L.) Wilczek} 17

Chalapati Naga Sai Krishna, Sanjay Kumar, Suresh BG and Anand Kumar

5. Seed development and maturation behaviour of mungbean (Vigna radiata L. Wilczek) for quality seed production 23

RDS Yadav, Vineet Dheer, PK Katiyar and Pradeep Yadav

6. Improving chickpea productivity in rice-fallow of Indo-Gangetic Plain with soil moisture conservation and
cultivar selection 28

Narendra Kumar, SS Singh, PK Ghosh, KK Hazra, MS Venkatesh, CS Praharaj, MK Singh, M Senthil Kumar,
PS Basu, A Yadav, SL Yadav, S Singh and NP Singh

7. Performance of mungbean as influenced by organic practice and plant geometry on growth, yield and
economics under NEH region of India 36

N Khumdemo Ezung, M Ben Yanthan, DJ Rajkhowa and Tiatula Jamir

8. Enhancing farm income and system productivity in soybean-lentil through land configuration, conservation
tillage, seed priming and mulching under rainfed Central India 41

CS Praharaj, Ram Lal Jat, SS Singh and NP Singh

9. Assessment of biocontrol potential of Trichoderma isolates against wilt in pulses 48

RK Mishra, Sonika Pandey, Monika Mishra, US Rathore, Naimuddin, Krishna Kumar and Bansa Singh
SHORT COMMUNICATIONS

10. Salt tolerance in mungbean genotypes for MYMV and grain yield 53

Manoj Katiyar and Rahul Kumar Gupta

11. Development of extra early urdbean genotypes using intra-specific hybridization 56

Debjyoti Sen Gupta, PK Katiyar, Jitendra Kumar, Anurag Kumar, Sanjeev Gupta and Narendra Pratap Singh

12. Effect of drought mitigation strategies on growth, yield and economics of pigeonpea (Cajanus cajan L. Millsp) 58

VT Jadhav, NS Kute, VA Chavan and SN Bhalerao

13. Influence of seed fortification on growth and seed yield in urdbean (Vigna mungo L. Hepper) 61

Yogesh Thane, Vishwanath K, Mahadevu P, Shruthi K and Maruthi JB

14. Effect of growth retardant and detopping on growth and yield of summer mungbean (Vigna radiata L. Wilczek)
under vertisols of Punjab 64

Gurdeep Singh, Kamalesh Kumar and Amanpreet Singh

List of Referees for Vol. 33(1) 67

Journal of Food Legumes 33(1): 1-5, 2020
Genetic diversity studies in chickpea (Cicer arietinum L.) genotypes using SSR
markers
S MOHAN and T KALAIMAGAL
Tamil Nadu Agricultural University, Coimbatore, Tamil Nadu, India; E-mail: mail2mohanshanmugam@gmail.com
(Received : November 19, 2019; Accepted : January 7, 2020)
ABSTRACT
Thirty simple sequence repeat molecular markers were used
to study the genetic diversity among 50 chickpea genotypes.
Twenty seven markers revealed polymorphism, while three
were observed to show the monomorphic amplicons. The
polymorphic markers produced a total of 81 alleles with an
average of 3.0 alleles per locus. Polymorphism Information
Content (PIC) value ranged from 0.327 to 0.736; and the
markers TA 64, TA 46, TR 7 and TA 28 were suitable for
discriminating the genotypes owing to their high PIC values.
UPGMA cluster analysis based on matching similarity
indices grouped these 50 genotypes into twelve clusters. The
highest Jaccard’s similarity coefficient (0.94) was observed
between ICC 89228 and ICC 86466, whereas IG 593-1 and
ICC 88503 showed the lowest similarity coefficient (0.30)
between them. The clustering pattern indicated the presence
of wide genetic diversity between the genotypes. The present
study found that SSR markers were powerful tool in
revealing genetic diversity and relationships in chickpea
genotypes, thereby providing useful means for selection of
parents in breeding programmes.
Key words: Chickpea, Genetic diversity, Polymorphism, SSR
marker
Chickpea (Cicer arietinum L.) is a self-pollinated,
cool season crop with diploid 2n=2x=16 chromosomes and
genome size of 732 Mb (Arumuganathan and Earle 1991).
Chickpea is the third most important grain legume in the
world which is grown in almost all continents except
Antarctica. India is the largest chickpea producer (69%) as
well as consumer in the world. India grows chickpea in
about 96.26 lakh ha producing 93.78 lakh tonnes which
represents 35% and 46% of the national pulse acreage and
production, respectively (Annual Report of DPD 2017-18).
In India chickpea is cultivated mostly as a rainfed crop
(68% area) in all parts of the country. Exploitation of genetic
diversity among parental genotypes is one of the major
approaches to maximize the genetic gains in any breeding
programmes. Genetic diversity study helps in estimating
and establishing the genetic relationship in germplasm
collections for identifying diverse parental combinations
to create segregating progenies with maximum genetic
variability. It helps in the identification of superior
recombinant lines for further selection and introgressing
desirable genes from diverse germplasm.
Genetic diversity is commonly estimated by genetic
distance or similarity analyses, both of which entail that
there are either differences or similarities at the genetic level.
Genetic diversity can be evaluated using morphological
traits, biochemical and molecular markers. However, DNA
polymorphism based genetic variations are abundant and
independent of environmental factors. Among the various
types of molecular markers, simple sequence repeats were
the marker of choice because they are efficient in detecting
genetic polymorphisms and discriminating among
genotypes from germplasm of various sources. These
markers are abundant and dispersed throughout a genome,
polymorphic, co-dominant, suitable for detecting
heterozygotes, multi-allelic, reproducible and amplified from
low quality and low quantity of DNAs (Abdurakhmonov
2016). In the present study an attempt has been made to
classify and understand the nature and magnitude of
genetic diversity among various genotypes using SSR
markers.
MATERIALS AND METHODS
Plant materials and DNA isolation: Fifty genotypes of
chickpea maintained at Department of Pulses, Tamil Nadu
Agricultural University, Coimbatore were used for the study.
Plants were raised in paper cups and thirteen days old
young leaves were collected and used for DNA extraction.
The genotyping of all the 50 chickpea genotypes using
SSR markers was carried out at Molecular laboratory,
Department of Pulses, Tamil Nadu Agricultural University,
Coimbatore.
DNA isolation and quantification: Fresh leaves were
picked from plants and kept it icepacks and used for DNA
extraction by CTAB (mini-prep) method. The extracted DNA
was purified by treating with RNA ase to remove the RNA
contamination. The purified DNA was quantified and its
quality was assessed by 0.8 % agarose gel electrophoresis.
Based on the intensity of the bands, DNA was diluted for
using marker analysis.
SSR Markers: Thirty SSR (Microsatellite) primer pairs
selected from the chickpea SSR marker reference kit
developed by ICRISAT (Huttel et al. 1999, Sethy et al. 2003
and Winter et al. 1999) were used in this study. The details
of SSR primer-pairs are provided in Table 1 & 2.
PCR amplification and electrophoresis: The PCR was
carried out with the following conditions: 94°C for 3 minutes
for initial denaturation, 35 cycles of 94°C for 45 seconds for
denaturation, 56-60°C for 1 minute for annealing, and 72°C
2 Journal of Food Legumes 33(1), 2020

Table 1. Details of 30 SSR primers used for molecular characterization of 50 chickpea genotypes
S.No Primer Sequential Information (5’ to 3’) Motif bp size References
F ATTTTACTTTACTACTTTTTTCCTTTC
1 CaSTMS2 (TAT)25 234 Huttel et al. (1999)
R AATAAATGGAGTGTAAATTTCATGTA
F CTTGTGAATTCATATTTACTTATAGAT
2 CaSTMS15 (ATT)21 241 Huttel et al. (1999)
R ATCCGTAATTTAAGGTAGGTTAAAATA
F GATGCTCAAGACATCTGCCA
3 GA 26 (CT)28 234 Winter et al. (1999)
R TCATACTCAACAAATTCATTTCCC
F GATGCCCTTACATAATTCAAATAGC
4 H1B02 (TTA)43 425 Lichtenzveig et al. (2005)
R ATCCCTATTCAACCTTCCTTCTAGT
F ACGGTAGAAACTTGCGAGAAAAT
5 H3A03 (TA)4 165bp(TG)3 253 Lichtenzveig et al. (2005)
R TTATGAAAGCTTCAGGTGGGTAA
F AGTTGCGACGAGAGTAGTTATTTTT
6 H3B01 (TA)5 T(TA)3 254 Lichtenzveig et al. (2005)
R AATGTTTTTCTTTCACTCACACTTG
F GATTTAACGTGTCGCGTCTTC
7 H3E04 (TTA)36 (CTA)5 313 Lichtenzveig et al. (2005)
R GCCTTATGTGTTTTCCTTAGTGATT
F CCTTGTTAGTGTGTATAGGT
8 NCPGR12 (CT)35 251 Sethy et al. (2003)
R GTAATGACCAAGTGAACA
F AAAATAATCTCCACTTCACAAATTTTC
9 TA18 (TAA)24 147 Winter et al. (1999)
R ATAAGTGCGTTATTAGTTTGGTCTTGT
F TCTCCAACCCTTTAGATTGA
10 TA22 (ATT)40 228 Winter et al. (1999)
R TCGTGTTTACTGAATGTGGA
F GATAAAATCATTATTGGGTGTCCTTT
11 TA27 (TAA)21 241 Winter et al. (1999)
R TTCAAATAATCTTTCATCAGTCAAATG
F TAATTGATCATACTCTCACTATCTGCC
12 TA28 (TAA)37n (TA)30 300 Winter et al. (1999)
R TGGGAATGAATATATTTTTGAAGTAAA
F TTTATTGCAATAAAACTCATTTCTTATC
13 TA46 (TAA)22 152 Winter et al. (1999)
R TTCTTTTTGTGTGAAAAAAAAATATAGTGA
F ATATATCGTAACTCATTAATCATCCGC
14 TA64 (TAA)39 239 Winter et al. (1999)
R AAATTGTTGTCATCAAATGGAAAATA
F GAAAGATTTAAAAGATTTTCCACGTTA
15 TA72 (ATT)36 256 Winter et al. (1999)
R TTAGAAGCATATTGTTGGGATAAGAGT
F TCTGCAAAAACTATTACGTTAATACCA
16 TA113 (TAA)26 203 Winter et al. (1999)
R TTGTGTGTAATGGATTGAGTATCTCTT
F GAAAATCCCAAATTTTTCTTCTTCT
17 TA117 (ATT)52 248 Winter et al. (1999)
R AACCTTATTTAAGAATATGAGAAACACA
F TCTTTCTTTGCTTCCAATGT
18 TA130 (TAA)19 219 Winter et al. (1999)
R GTAAATCCCACGAGAAATCAA
F TGGTTGGAAATTGATGTTTT
19 TA135 (TAA)17 192 Winter et al. (1999)
R GTGGTGTGAGCATAATTCAA
F CAGAAGACGCAGTTTGAATAACTT
20 TA179 (TAA)40 (TAAA)8 218 Winter et al. (1999)
R CGAGAGAGAGAAAGGAAGAAGAG
F CATCGTGAATATTGAAGGGT
21 TA180 (TAA)30 205 Winter et al. (1999)
R CGGTAAATAAGTTTCCCTCC
F TTTCTCCTCTACTATTATGATCACCAG
22 TA200 (TTA)37 296 Winter et al. (1999)
R TTGAGAGGGTTAGAACTCATTATGTTT
F GTCCCACTTCCACTTATAAAGGTT
23 TA206 (TAA)25 373 Winter et al. (1999)
R TAACGTATCTTGCAGATTTCAAATAAA
F CATTGCTTAAGAACCAAAATGG
24 TAA58 (AAT)41 276 Winter et al. (1999)
R CAATTTTACATCGACGTGTGC
F GGTAGACGCAAAAGAGTGGG
25 TAASH (TAA)40 436 Winter et al. (1999)
R GCCACATTGACCAGGAATG
F GGCTTAGAGTTCAAAGAGAGAA
26 TR2 (TTA)36 210 Winter et al. (1999)
R AACCAAGATTGGAAGTTGTG
F GCATTATTCACCATTTGGAT
27 TR7 (TTA)25 204 Winter et al. (1999)
R TGTGATAATTTTCTAAGTGTTTT
F GCCCACTGAAAAATAAAAAG
28 TR29 (TAA)8n (TAA)32 220 Winter et al. (1999)
R ATTTGAACCTCAAGTTCTCG
F CTTAATCGCACATTTACTCTAAAATCA (TAA)20 n(A)5
29 TR31 217 Winter et al. (1999)
R ATCCATTAAAACACGGTTACCTATAAT (TAA)9
F AGGACGAAACTATTCAAGGTAAGTAGA
30 TR43 (TAA)24 297 Winter et al. (1999)
R AATTGAGATGGTATTAAATGGATAACG
 Mohan & Kalaimagal : Genetic diversity studies in chickpea genotypes using SSR markers 3

Table 2. SSR marker profile across the chickpea genotypes RESULTS AND DISCUSSION
Primer Tm (0C) Number of alleles PIC value
CaSTMS2 59 3 0.598
Fifty chickpea genotypes were analysed using thirty
CaSTMS15 59 2 0.510 SSR markers to assess genetic diversity. Out of thirty
GA 26 56 3 0.658 primers used, twenty seven produced reproducible and
H1B02 57 3 0.598 polymorphic DNA banding pattern, while three primers
H3A03 60 1 0.000
H3B01 60 1 0.000 (H3A03, H3B01 and TA200) were found to be monomorphic.
H3E04 58 3 0.518 The twenty seven polymorphic primers produced total of
NCPGR12 56 3 0.327 81 fragments, whose size varied from 140bp (marker TA46)
TA18 60 3 0.631
TA22 59 3 0.622
to 400bp (marker H1B02). Among the polymorphic markers,
TA27 59 3 0.678 3 revealed 2 alleles each, 22 showed 3 alleles each, 1
TA28 59 4 0.723 exhibited 4 alleles and one produced a maximum of 5 alleles.
TA46 60 3 0.729
TA64 59 4 0.736
Maximum of five fragments was produced by TA64 followed
TA72 59 2 0.593 TA28 which produced 4 fragments. An average of 3.0
TA113 56 3 0.663 fragments was produced by the primers showing
TA117 56 3 0.665 polymorphic amplification. Gel images showing SSR
TA130 60 3 0.486
TA135 56 3 0.615 banding profiles obtained by primers TA64, TR43, TA117
TA179 60 3 0.657 and NCPGR12 are presented in Plate. 1-4.
TA180 60 3 0.553
TA200 59 1 0.000
TA206 59 3 0.350
TAA58 56 3 0.656
TAASH 59 3 0.670
TR2 56 3 0.514
TR7 59 3 0.724
TR29 59 2 0.365
TR31 59 3 0.670
TR43 59 3 0.640

for 1 second for extension followed by 72°C for 10 minutes

for final extension in a Thermocyler (Eppendorf). Different
annealing temperatures were maintained depending upon
the requirement for a specific primer pair. The PCR products
were resolved in 3% agarose gel electrophoresis (GeNeiTM)
and the polymorphisms were observed under Gel
Documentation System (Gel Stan).
Scoring SSR data and data analysis: Clearly resolved,
unambiguous polymorphic bands were scored visually for
their presence or absence. The polymorphic SSR alleles
were scored as different characters such as 1, 2, 3 etc. The
scores were obtained in the form of a matrix ‘1’ and ‘0’,
which indicate the presence or absence of bands in each
species respectively. Polymorphic Information Content
(PIC) values for each SSR markers were calculated using
the formula 1-”pi2, where, pi is the frequency of the ‘i’th
allele (Nei, 1973). The similarity between the genotypes
was evaluated by calculating the Jaccard’s similarity
coefficient for pair wise comparisons based on the
proportions of shared bands produced by the primers
(Jaccard, 1908) using SIMQUAL programme of NTYSYSpc
2.02i (Rohlf, 1998). Cluster analysis and dendrogram was
constructed based on Jaccard’s similarity coefficient with
Unweighted Pair Group Method with Arithmetic Average
(UPGMA).
4 Journal of Food Legumes 33(1), 2020
Polymorphism information content (PIC) value of each
SSR marker is a measure of marker diversity. PIC value
provides an estimate of discriminatory power of a locus by
taking into account not only the number of alleles expressed,
but also relative frequency of those alleles. Higher the PIC
value of a locus, higher the number of alleles detected. PIC
values ranged from 0 (monomorphic) to 1 (very high
discriminative) with many alleles in equal frequencies. The
PIC value of SSR markers in present study ranged from
0.327 to 0.736 with an average value of 0.60. Markers TA64,
TA46, TR7 and TA28 were most informative on the basis of
high PIC value of 0.736, 0.729, 0.724 and 0.723, respectively.
SSR markers NCPGR12 showed least PIC value of 0.327.
The early studies on PIC values ranged from 0.467 to 0.974
with an average of 0.854 (Upadhyaya et al. 2008), 0.480 to
1.000 with an average of 0.687 (Bharadwaj et al. 2010), 0.155
to 0.783 with an average of 0.437 (Sachdeva et al. 2018),
which is relatively higher than that of the present study.
The markers TA64, TA46, TR7 and TA28 were found to be
highly informative and they might be effective and useful
Table 3. Clusters based on dendrogram with SSR markers
Cluster Number of Accessions/Genotypes
accessions
I 8 ICHRN 1, 892/3, ICC 89228, ICC 86466,
GCP 107, CO-3, TNAU 8902, ICC 4973
II 3 PLS 5425, CO 2, PLS 8818
III 8 ICC 1356, ICHRN 2, PHULE G 96008,
ICC 16603, BGD 112, ICC 10301, ICC
12237, ICC 88503
IV 9 ICC 867, ICC 16048, ICC 16089, ICC
16102, ICC 9677, ICC 11061, ICC 7653,
FG 712, ICC 506
V 6 PLS 5728, ICC 4958, PHULE G-5, ICC
3137, CO-G 85-2, PLS 8830
VI 2 157/3, CO-BE 29-1
VII 3 NDG 522, CO 1, ICC 86239
VIII 5 ICCC 42, ICC 16349, CO 4, ICC 15629,
KODAIKANAL LOCAL
IX 2 BG 1043, ICC 198737
X 1 ICC 11313
XI 2 ICC 1080, IG 593-1
XII 1 C 712
tool to determine the genetic difference among the chickpea
genotypes owing to their high PIC values.
Similarity index values arrived from the polymorphic
data gave the amount of relatedness between individuals.
The similarity matrix was computed using SSR marker based
on Jaccard’s coefficient following the UPGMA method using
SHAN programme of NTSYS-pc 2.02. The Jaccard’s
similarity coefficients in the present study ranged from 0.30
to 0.94.. The pairwise similarity indices revealed 94% genetic
similarity between the genotypes ICC 89228 and ICC 86466.
The lowest similarity (30%) was observed between IG 593-
1 and ICC 88503. Lower the similarity between the
genotypes, better the scope to include them for breeding
programme.
A UPGMA based clustering by using all the 81 alleles
(amplification products) generated by 27 polymorphic SSR
markers grouped the genotypes into 12 clusters at 66%
similarity level and the results are presented in Fig. 1. The
list of all the twelve clusters along with genotypes included
is presented in Table 3. The formation of 12 clusters through
SSR marker data revealed that the presence of genetic
diversity at molecular level was high among the genotypes
used in the study. Among the different clusters, the cluster
size varied from 9 (cluster IV) to 1 (cluster X and XII). The
cluster IV was highly heterogenous followed by cluster III
and I. The genotypes ICC 89228 and ICC 86466 having
highest similarity coefficient (94% similarity) where grouped
together, similarly the genotypes IG 593-1 and ICC 88503
have shown the highest dissimilarity between them were
grouped in two distinct clusters as shown in Fig. 1. Out of
twelve clusters, cluster X and XII were solitary clusters.
From the present investigation, it was found that
genotypes of different origin were grouped together in
different clusters. Four accessions (ICHRN 1, ICC 89228,
ICC 86466 and ICC 4973 from ICRISAT, two accession (CO
3 and TNAU 8902) from TNAU, Coimbatore, 892/3 from
IIPR, Kanpur and GCP 107 from RARS, Gulbarga were
grouped into cluster I. In cluster VIII the accessions ICCC
42 and Co 4 were grouped together since ICCC 42 is the
parental source for the development of Co 4. Apart from
cluster X and XII, all other clusters were observed to be
heterogenous which included accessions from different
geographic areas. This confirms that groupings were not
clearly divided in phylogenetic trees.
Among the twelve clusters the maximum number of
genotypes were grouped in cluster IV. The genotypes in
this cluster might have similar gene pool compared to other
genotypes. Though crossing between the most diverse
genotypes among this cluster would give out more adaptive
ones which could be directly used in breeding programme
compared to those obtained by crossing the genotype of
two different distinct cluster (I to XII) which could be more
of pre-breeding in nature.
 Mohan & Kalaimagal : Genetic diversity studies in chickpea genotypes using SSR markers
Figure 1. Dendrogram showing molecular diversity among chickpea genotypes based on SSR marker data
In conclusion, our study shows that few selected
polymorphic SSR markers are enough to discriminate among
the chickpea genotypes studied. The information regarding
genetic diversity by microsatellite markers provides greater
confidence for assessment of distinctiveness and
relationships among the various genotypes, which can be
exploited in chickpea breeding. With the help of
microsatellite markers and clustering data, various distinctly
related chickpea genotypes may be combined by
intercrossing to superior recombinants and to screen out
desirable genotypes from segregating generations.
REFERENCES
Abdurakhmonov IY. 2016. Introduction to Microsatellites). Basics,
Trends and Highlights http://dx.doi.org/10.5772/66446, Pp 9.
Annual Report DPD. 2017-18. Directorate of Pulses Development,
Ministry of Agriculture and Farmers Welfare, Government of
India, DPD/Pub./TR/29/2017-18
Arumuganathan K and Earle ED. 1991. Nuclear DNA content of
some important plant species. Plant Molecular Biology Reporter
9: 208-219.
Bharadwaj C, Chauhan SK, Gayatri R, Rachana S, Satyavathi CT,
Shubha Y, Rizvi AH, Kumar J and Solanki RK. 2010. Diversity
analysis of chickpea (Cicer arietinum) cultivars using STMS
markers. Indian Journal of Agricultural Sciences 80(11): 947-51.
Huttel B, Winter P, Weising K, Choumane W, Weigand F and Kahl
G. 1999. Sequence tagged microsatellite markers for chickpea
(Cicer arietinum L.). Genome 42: 210-217.
5
Jaccard P. 1908. Nouvelles rescerches sur la distribution, Bulletin de
la Société vaudoise des sciences naturelles 44: 233-270
Lichtenzveig J, Scheming C, Dodge J, Abbo S and Zhang HB. 2005.
Construction of BAC and BIBAC libraries and their applications
for generation of SSR markers for genome analysis of chickpea
(Cicer arietinum L.). Theoretical and Applied Genetics 110:
492-510.
Nei M. 1973. Analysis of gene diversity in subdivided populations.
In: Proceedings of the National Academy of Sciences, USA. 70:
3321-3323.
Rohlf FJ. 1998. NTSYS-pc, Numerical taxonomy and multivariate
analysis system, version 2.02. Exter Software, Setauket, NY.
Sachdeva S, Bharadwaj C, Sharma V, Patil BS, Soren KR, Roorkiwal
M, Varshney RK and Bhat KV. 2018. Molecular and phenotypic
diversity among chickpea (Cicer arietinum L.) genotypes as a
function of drought tolerance. Crop and Pasture Science 69(2):
142-153.
Sethy NK, Shokeen B and Bhatia S. 2003. Isolation and
characterization of sequence-tagged microsatellite sites markers
in chickpea (Cicer arietinum L.). Molecular Ecology Notes 3:
428-430.
Upadhyaya HD, Dwivedi SL, Baum M, Varshney RK, Udupa SM,
Gowda CL, Hoisington D and Singh S, 2008. Genetic structure,
diversity, and allelic richness in composite collection and
reference set in chickpea (Cicer arietinum L.). BMC plant
biology 8(1): 106.
Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Espinoza
RA, Weigand F and Kahl G. 1999. Characterization and mapping
of sequence-tagged microsatellite sites in the chickpea (Cicer
arietinum L.) genome. Molecular and General Genetics 262:
90-1 01.
Journal of Food Legumes 33(1): 6-9, 2020
Molecular genetic diversity in cowpea {Vigna unguiculata (L.) Walp.} genotypes
MANJU DEVI S and JAYAMANI P
Tamil Nadu Agricultural University, Coimbatore, Tamilnadu; E-mail: jayamani1108@gmail.com
(Received : December 2, 2019; Accepted : January 28, 2020)
ABSTRACT
Cowpea {Vigna unguiculata (L.) Walp.} is one of the most
important food legumes in the semi arid tropics which
encompass Asia and Africa. Thirty genotypes of cowpea were
used to study molecular genetic diversity using nineteen
cowpea specific SSR markers. Among 19 SSR markers, 13
markers exhibited polymorphism and two markers showed
monomorphic banding pattern. Four markers produced
multiple alleles. A total of 33 alleles were generated. The
number of alleles produced by different markers ranged
from one to three with an average of 2.2 alleles per marker.
Cowpea specific markers viz., VM 25, VM 35, VM 36, VM 5
and CP 1 produced the highest number of alleles (3).The
Polymorphism Information Content (PIC) ranged from 0.585
(VM 5) to 0.064 (VM 19) with an average of 0.368. SSR
marker data analysis showed high dissimilarity among the
30 cowpea genotypes. The genotypes VCP 9-009 with CP 2-1,
KB CP 39 and K 13 CP 25 had the highest dissimilarity
index value and showed the extent of genetic diversity existed
among the genotypes. A dendrogram constructed using
unweighted pair group method using arithmetic average
(UPGMA) analysis distinguished 30 genotypes into six
clusters. Among the six clusters, cluster II was the largest
with ten genotypes followed by cluster I with seven genotypes.
The neighbour- joining tree developed based on weighted
average for dissimilarity matrix grouped 30 genotypes into
five groups. Among the five groups, group II comprised of ten
genotypes followed by group I with eight genotypes. In both
UPGMA analysis and neighbourhood joining tree, the results
showed the potentiality of SSR markers in assessing the
genetic diversity among the cowpea genotypes.
Key words: Cowpea, Genetic resources, Molecular genetic
diversity, SSR markers
Cowpea {Vigna unguiculata (L.) Walp}, also called
as southern pea and black eyed pea, is well adapted to the
tropics. Genome size of cowpea is 620 Mbp. (Vavilov 1951)
recognised India and Africa as the centres of origin while,
China is considered as secondary centre of origin of
cowpea. The cowpea primary gene pool comprises of Vigna
unguiculata section catiang. It comprises of five
subspecies viz., unguiculata, cylindrica, sesquipedalis,
dekindtiana, and mensensis in phaseolae. Molecular
markers are used as a tool to detect the extent of genetic
variation, providing insights into the diversity of crop
varieties. Microsatellites or Simple Sequence Repeats have
been widely recognised as powerful and informative genetic
markers in both animals and plants (Jarne and Lagoda 1996).
The molecular markers based on differences in DNA
sequences between individuals generally detect more
polymorphisms than morphological and protein based
markers and constitutes a new generation of genetic
markers (Mignouna et al. 1998).
MATERIALS AND METHODS
The present study was undertaken with 30 genotypes
of cowpea in the Marker Assisted Selection Laboratory,
Department of Pulses, Centre for Plant Breeding and
Genetics, Tamil Nadu Agricultural University, Coimbatore.
A set of 19 cowpea specific markers were used for the
molecular analysis. The young leaves of ten days old plants
were collected and the DNA was extracted by CTAB (mini-
prep) method. The extracted DNA was purified for RNA
contamination by RNAase treatment. The quality of DNA
was checked by using 0.8 per cent agarose gel
electrophoresis. The DNA was then diluted to appropriate
concentration and used in molecular analysis. The list of
SSR primers used in the study is presented in Table 1.
Amplification reaction was done in a volume of 15 µl
containing 50 ng of genomic DNA and amplification was
performed in Master cycler gradient PCR (Biorad).
The PCR consist of initial denaturation which was
held at 95oC for 5 minutes, denaturation at 950C for 1 minute,
annealing temperature at 550C to 650C for 1 minute, extension
at 720C for 1 minute, final extension at 720C for 1 minute and
holding at 40C which consist totally of 40 cycles. PCR
amplified products were subjected to gel electrophoresis
in 3 per cent agarose gel in 1X TBE at 100 V for 3 hours
using gel electrophoresis unit. The Ethidium bromide
stained gels were documented using BIO-RAD Gel
documentation unit.
The SSR gels were scored and represented by their
allele sizes as allelic data. Using the DAR win 5.0 software
package (Perrier and Collet, 2005) a simple matching
dissimilarity index was calculated from the allele size data
set with 100 bootstraps, and this matrix was then subjected
to UPGMA and Neighbour-Joining analyses.
Polymorphic Information Content values were
calculated for SSR markers in order to characterize the
capacity of each primer to reveal or detect polymorphic loci
among the genotypes. It is the sum total of polymorphism
information content values of all the markers produced by
a particular primer. PIC value was calculated using the
formula PIC =1-©pi2, where, pi is the frequency of the ‘i’th
allele (Smith et al. 1997).
 Manju & Jayamani : Molecular genetic diversity in cowpea genotypes 7

Table 1. List of microsatellite markers used in the study

Annealing Number PIC
S.No Marker Forward and Reverse sequence 5’- 3’ Allele size (bp)
temperature (0C) of alleles value
1 VM 25 F: CCACAATCACCGATGTCCAA 55 100-120 3 0.360
R: CAATTCCACTGCGGGACATAA
2 VM 31 F: CGCTCTTCGTTGATGGTTATG 55 200-210 2 0.320
R: GTGTTCTAGAGGGTGTGATGGTA
3 VM 12 F: TTGTCAGCGAAATAAGCAGAGA 56 120-130 2 0.068
R: CAACAGACGCAGCCCAACT
4 VM 30 F: CTCTTTCGCGTTCCACACTT 56 195-215 2 0.465
R: GCAATGGGTTGTGGTCTGTG
5 VM 23 F: AGACATGTGGGCGCATCTG 59 Multiple bands - -
R: AGACGCGTGGTACCCATGTT
6 VM 5 F: AGCGACGGCAACAACGAT 54 375-390 3 0.585
R: TTCCCTGCAACAAAAATACA
7 VM 36 F: ACTTTCTGTTTTACTCGACAACTC 57 150-160 3 0.446
R: GTCGCTGGGGGTGGCTTATT
8 VM 19 F: TATTCATGCGCCGTAACACTA 57 170-190 2 0.064
R: TCGTGGCACCCCCTATC
9 VM 11 F: CGGGAATTAACGGAGTCACC 57 Multiple bands - -
R: CCCAGAGGCCGCTATTACAC
10 VM 14 F: AATTCGTGGCATAGTCACAAGAGA 57 210-220 2 0.278
R: ATAAAGGAGGGCATAGGGAGGTAT
11 VM 35 F: GGTCAATAGAATAATGGAAAGTGT 52 120-130 3 0.338
R: ATGGCTGAAATAGGTGTCTGA
12 VM 17 F: GGCCTATAAATTAACCCAGTCT 52 140-150 2 0.420
R: TGTGTCTTTGAGTTTTTGTTCTAC
13 CP 37 F: TGTCCGCGTTCTATAAATCAGC 63 290 1 0.000
R: CGAGGATGAAGTAACAGATGATC
14 CP 3 F: GAGCCGGGTTCAATAGGTA 63 Multiple bands - -
R: GAGCCAGGGCACAGGTAGT
15 CP 1 F: CACCCGTGATTGCTTGTTG 66 250-300 3 0.522
R: GTCCCCTCCCTCCCACTG
16 CP 7 F: CGCTGGGGGTGGCTTAT 61 110-120 2 0.445
R: AATTCGACTTTCTGTTTACTTG
17 CP 2 F: GTAAGGTTTGGAAGAGCAAAGAG 61 Multiple bands - -
R: GGCTATATCCATCCCTCACT
18 CP 5 F: AGCGACGGCAACAACGAT 64 110-130 2 0.483
R: TTCCCTGCAACAAAAATACA
19 CP 24 F: TCAACAACACCTAGGAGCCAA 65 160 1 0.000
R: ATCGTGACCTAGTGCCCACC

RESULTS AND DISCUSSION Polymorphic Information content reveals the amount

Microsatellite or Simple Sequence Repeats have been
widely recognized as powerful and informative genetic
markers as it consists of tandemly repeated units of short
nucleotide motifs that are 1-6 bp long. In the present study,
19 SSR markers were used for diversity analysis in cowpea
genotypes. Among the 19 SSR markers, 13 markers showed
polymorphism, two markers showed monomorphic and four
markers produced multiple bands. The number of alleles
ranged from one to three with an average of 2.2 alleles per
marker. (Mafakheri et al. 2017) reported that, 186 alleles
were generated with an average of 2 alleles per locus in
cowpea. (Sathya and Jayamani, 2013) assessed 83
microsatellite alleles were generated with an average of 2.96
alleles per locus in greengram genotypes. Cowpea marker
viz. VM 25, VM 35, VM 36, VM 5 and CP 1 recorded the
highest number of alleles (3). Allele size varied from 100-
390 bp which was in close agreement with allele size (80-
500 bp) assessed by Asare et al. 2010 among 141 cowpea
genotypes.
of information that can be obtained from a particular marker.
The PIC value of the SSR markers ranged from 0.064 to
0.585 with an average of 0.368 (Table 1). The higher PIC
value indicated the informativeness of the markers. In the
present study, markers VM 5, CP 1 and CP 5 recorded high
PIC value and could be used in the field of taxonomical and
genetic resource management.
The markers VM 12, VM 17, VM 19, VM 25, VM 35,
VM 14, VM 30, VM 31, VM 36, VM 5, CP 1, CP 7 and CP 5
showed polymorphism among the genotypes. The
polymorphic markers could be used to identify the
genotypes and also in finger printing of cowpea varieties.
The marker VM 35 and VM 30 showed polymorphism with
PIC value of 0.54 and 0.57 was also observed by Ali et al.
2015 in cowpea.
In the present study, SSR marker analysis showed
high dissimilarity among the 30 cowpea genotypes. The
genotypes VCP 9-009 with CP 2-1, KB-CP 39 and K-13-CP
25 had the highest dissimilarity index value which showed
 8
Table 2. Dissimilarity matrix for 30 cowpea genotypes based on simple matching co-efficient
Journal of Food Legumes 33(1), 2020
 Manju & Jayamani : Molecular genetic diversity in cowpea genotypes
Fig. 1. Dendrogram of 30 cowpea genotypes based on SSR
marker data
Fig. 2. Neighbour-joining tree of 30 cowpea genotypes based
on SSR marker data
the extent of genetic diversity exist among the genotypes
(Table 2). Higher the dissimilarity between the genotypes,
better the scope to include them for breeding programme.
Dendrogram based on Unweighted Pair Group
Method with Arithmetic mean, the 30 genotypes were
grouped into six clusters. Among the six clusters, cluster II
was the largest with ten genotypes (CO 7, PGCP 4, TY 40,
Vamban 1, K-13-CP 25, Vamban 2, TY 985, CP 17, Paiyur 1
and ACM 013) followed by cluster I with seven genotypes
(Fig. 1). Asare et al. 2010 by using SSR markers, 141
accessions of cowpea were grouped into five clusters. Chen
et al. 2017 by using SSR markers, 105 genotypes of cowpea
were grouped into four clusters. The neighbour-joining tree
developed based on weighted average for dissimilarity
matrix grouped the 30 genotypes into five groups (Fig. 2).
Among them, group II was the largest with ten genotypes
9
and group V was least with three genotypes. In both
analysis the genotypes viz., ACM 013, TY 985, Vamban 2,
K-13-CP 25, CP 17, Paiyur 1, Vamban 1, TY 40 and PGCP 4
shared same array I.
In both UPGMA analysis and neighbourhood joining
tree, the results shown the potentiality of SSR markers in
assessing the genetic diversity among the cowpea
genotypes. Hence, the diverse genotypes identified in this
study acts as a good starting point for the selection of
parental lines for genetic improvement programme.
REFERENCES
Ali ZB, Yao KN, Odeny DA, Kyalo M, Skilton R and Eltahir IM.
2015. Assessing the genetic diversity of cowpea (Vigna
unguiculata (L.) Walp.) accessions from Sudan using simple
sequence repeat (SSR) markers. African Journal of Plant Science
9(7): 293-304.
Asare AT, Gowda BS, Galyuon IKA, Aboagye LL, Takrama JF and
Timko MP. 2010. Assessment of the genetic diversity in cowpea
(Vigna unguiculata (L.) Walp.) germplasm from Ghana using
simple sequence repeat markers. Plant Genetic Resources 8(02):
142-150.
Chen H, Hu L, Wang L, Wang S, Wang ML and Cheng X. 2017.
Genetic diversity and a population structure analysis of accessions
in the Chinese cowpea (Vigna unguiculata (L.) Walp.) germplasm
collection. The Crop Journal 5(5): 363-372.
Cyrus A, Ishiyaku MF, Mansir Y and Abdullahi US. 2017. Assessment
of Genetic Diversity Among Achishuru Cowpea Type Land Races
Using Simple Sequence Repeat Markers. Report and Opinion
9(1): 17-22.
Jarne P and Lagoda PJL. 1996. Microsatellites from molecules to
populations and back. Trends Evolution and Ecology 11: 424-429.
Mafakheri K, Bihamta MR, Abbasi AR and Tejada Moral M. 2017.
Assessment of genetic diversity in cowpea (Vigna unguiculata
L.) germplasm using morphological and molecular
characterisation. Cogent Food and Agriculture 3(1): 334.
Mignouna HD, Ng NQ, Ikea J and Thottappilly G. 1998. Genetic
diversity in cowpea as revealed by Random Amplified Polymorphic
DNA. Journal of Genetics and Breeding 52: 151-159.
Perrier X and Collet JPJ. 2005. Darwin- 5.0 software; Dissimilarity
analysis and representation for windows. Equipe Mathematique
at Informatique, France.
Sathya M and Jayamani P. 2013. Cross species amplification of
Adzukibean derived Microsatellite Loci and Diversity analysis
in Greengram and related Vigna species. Molecular Plant Breeding
4(11): 89-95.
Smith JSC, Chin ECL, Shu H, Smith OS, Wall SJ, Senior ML and
Zeigle J. 1997. An evaluation of the utility of SSR loci as
molecular markers in maize (Zea mays L.): comparisons with
data from RFLPs and pedigree. Theoretical and Applied genetics
95: 163-173.
Vavilov NI. 1951. The origin, variation, immunity and breeding of
cultivated plant (Translated by K.S. Cheaster). Crop Botany
13(1): 364.
Journal of Food Legumes 33(1): 10-16, 2020
Genetic, character association and multivariate studies of seed yield with different
traits in mungbean {Vigna radiata (L.) Wilczek}
NANDIGAM SWATHI REKHA, CS MAHTO, ARUN KUMAR, HC LAL and ANITA PANDE
Birsa Agricultural University, Ranchi, Jharkhand, India; E-mail: swathikoundinya.1995@gmail.com
(Received : January 16, 2020; Accepted : February 18, 2020)
ABSTRACT
The present study was conducted during rainy season 2018
to evaluate 38 genotypes of mungbean [Vigna radiata (L.)
Wilczek] with 12 different traits using general statistics,
character association, principal component analysis and
cluster analysis. The basic descriptive statistics had showed
considerable variance for all the traits. The results of
character association studies revealed that Days to first
flowering, Days to 50% maturity, Days to pod initiation,
Number of primary branches per plant, Number of clusters
per plant, Number of pods per plant and seed yield per plant
exhibited highly significant positive correlation at both
genotypic and phenotypic levels. Through Principal
component analysis (PCA), a total cumulative variance of
about 73.59% was revealed within four principal components
with eigenvalues >1 among the twelve. PC1 with high values
contributed more towards the phenology and vegetative
growth whereas the PC2 with high values contributed more
towards the reproductive growth. All the 38 genotypes were
grouped into 6 clusters by Tochers method which will help
us in selecting promising genotypes which can be used as
parents in future breeding programmes.
Key words: Character association, Eigen, Mungbean, PCA,
Tocher's method
Pulses have been considered as an important
constituent of Indian diet, because of their high protein
content (22-25%). Out of all pulses Mungbean [Vigna
radiata (L.) Wilczek] also known as greengram, is an
important pulse crop cultivated round the year in almost all
parts of India. It is a self-pollinated, diploid (2n=22) legume
grown mainly as a kharif season crop. It is the native of
IndoBurma region of Hindustan center (Vavilov, 1926). It
spread, in early times, to other Asian countries and later to
Africa, Australia, America, and West Indies. India is the
largest producer, followed by China. It is also grown in
many tropical African countries.
India’s pulses imports are increasing drastically with
the growth rate of 6.06 per cent per annum. To cut down
this and move towards exports there should be an increase
in production in the country. The favourable weather
conditions and change in economic environment are found
to be the important factors in increasing the production to
meet the domestic as well as external demand (Gamanagatti,
et al. 2013).
In India, mungbean occupies an area of about 40.70
lakh hectares with an output of around 19.01 lakh tonnes
with a productivity of 467 kg/ha (Source: DES, Ministry of
Agri. And FW (DAC&FW), Govt. of India; 2017-18). The
projected pulses productivity required for growing
population by 2020 is 1200 kg/ha and Hence, for increasing
the production and productivity to meet the increasing
demand, there is a need to replace the low yielding, long
duration, local mungbean varieties with the high yielding,
bold seeded, early varieties tolerant to both biotic and
abiotic stresses which can be made possible by selecting
the diverse parents with the help of principal component
analysis, cluster analysis and other descriptive statistics.
Thus the selected parents can be used in our future breeding
programmes in order to develop a highly yielding and
resistant genotype which can help in doubling the farmers
income in future generations.
MATERIALS AND METHODS
The Mungbean germplasm used for the present
study consists of 38 genotypes, which were obtained from
different sources in India (Table 1) from AICRP MULLaRP.
Among these 38 genotypes there were 2 checks (‘Pant M4
and IPM 2-3’) and 4 mutants taken from advanced lines of
mutation of Pusa Vishal and SML 668. The experiment was
conducted during kharif , 2018 in Randomized Block Design
with three replications in Pulse Research Farm of Birsa
Agricultural University, Ranchi, Jharkhand. Each genotype
was sown in 4 rows of 4 m length with a spacing of 30 x 10
cm between and within rows. A basal dose of fertilizer was
applied at the rate of 20:40:20 NPK kg per hectare. All the
other recommended package of practices were followed
during the crop growth to raise a good crop. The genotypes
were harvested as and when pods matured.
The data had been collected from ten random plants
from each genotype and in each replication and
observations were recorded on days to first flowering, days
to 50% maturity, days to pod initiation, plant height (cm),
number of primary branches per plant, number of clusters
per plant, number of pods per plant, number of seeds per
pod, 100-seed weight, seed yield per plant (g), disease
incidence (%) (anthracnose and powdery mildew), total
protein content (%).
The data thus recorded was subjected to various
 Nandigam et al. : Genetic, character association and multivariate studies of seed yield in mungbean 11

statistical techniques which includes the descriptive
statistics, correlation (analyzed by using OPSTAT),
Heritability, PCV (Phenotypic Coefficient of variation)
(analysed by using Window STAT), principal component
analysis (analysed by using SPSS) and wards minimum
variance (analysed by using R software) inorder to analyze
the genotypes and identify the best performing ones among
the genotypes selected.
RESULTS AND DISCUSSION
All the 38 genotypes of mungbean for all the twelve
traits were analysed by using the basic descriptive statistics
like mean, SE, range, PCV, heritability and the results thus
obtained were represented in the Table 2.
Correlation coefficient analysis:
Information on the association of yield components
with yield and the relative contribution of component
characters towards yield will be very helpful for developing
of elite genotypes and in formulating a breeding strategy.
Selection solely on yield is not much effective, as seed
yield is a complex character and is influenced by number of
traits. Hence, selection of genotypes with desirable
characters could be greatly enhanced if significant
correlation between yield and its component characters
are established.
In the present study, correlation estimates were
obtained for 12 characters in 38 genotypes of mungbean at
both phenotypic and genotypic levels (Table 3) and the
results are discussed below. In general, phenotypic
correlation coefficients were higher than genotypic
correlation coefficients which indicates that the
environmental influence is also there in the expression of
characters (Jyothsna and Anuradha (2013)).
The association analysis revealed that seed yield per
plant had showed positive significant association with
primary branches per plant and clusters per plant with has
been reported by Raje and Rao 2000, Chandra et al. 2016,

Table 1: List of thirty eight genotypes of mungbean and their source of origin
S.No. ENTRY SOURCE PEDIGREE
1 SKNM 1504 SDAU, S.K. Nagar GM 9923 x GM 3
2 Pusa M 1771 IARI, New Delhi MH318 x Pusa 9531
3 Pusa M 1772 IARI, New Delhi IPM02-14 x Pusa Vishal
4 RMG 1097 RARI, Durgapura RMG 492 x MUM 2
5 COGG 13-39 TNAU, Coimbatore CO 6 x SML 668
6 MH 1323 CCS HAU, Hisar MH 318 x AKM 99-4
7 SML 1808 PAU, Ludhiana ML 1349 x Mash 1-1
8 IPM 512-1 IIPR, Kanpur IPM 99-125 x Co 5
9 VGG 16-055 NPRC, Vamban VBN ( Gg )2 x SM47
10 NVL 855 Nirmal Seeds Pvt Ltd., PACHORA NVS-242(1)x NVS-321s1
11 MDGVV-18 Mahodaya Hybrid Seeds Pvt. Ltd., Jalna Local sel. X BPMR-145
12 OBGG-56 OUAT, Berhampur OBGG 52 x Kendrapara Local
13 VGG-16-036 NPRC, Vamban IPM 03-01 x SPS 5 SPS 5
14 AKM 12-28 PDKV, Akola AKM 9911 x BM 2003-2
15 TMV 126 BARC, Mumbai Samrat x Kopergaon
16 NMK 15-08 NAU, Navsari Meha x GM 4
17 SVM-6133 SVHS, Hissar SML-668 x Pusa-9531
18 BM 2012-9 ARS, Badnapur Mutant of BPMR 145
19 KM 2355 CSUA&T, Kanpur KM 2241 x KM 2273
20 PM 14-3 GBPUA&T, Pantnagar PM 6 x PusaRatna
21 AKM 12-24 PDKV, Akola AKM 9911 x AKM 9904
22 IPM 410-9 IIPR, Kanpur IPM 03-1 x NM 1
23 DGG 7 ARS, Dharwad Mutant of sel. 4
24 IGKM 2016-1 IGKV, Raipur (Pairymung x Pushavishal)
25 SKNM 1502 SDAU, S.K. Nagar GM 9912 x GM 4
26 RMB 12-07 BAU, Ranchi PusaVaishal x DGG-1
27 JAUM 0936 SKUAST, Samba MH 96-1 x SML 668
28 OBGG 58 OUAT, Berhampur VC 1560 A x VA 6370-92
29 PM 14-11 GBPUA&T, Pantnagar COGG 912 x PM 5
30 MGG-387 ARS, Madhira Madhiarmung xAsha-1-7
31 ML 2479 PAU, Ludhiana Pusa 105 x ML 1354
32 KM 17-130 BAU, Ranchi Pusa Vishal x DGG-1
33 PRMB –15-70 BAU, Ranchi M4 Generations of SML 668 (70 KR)
34 SRMB -15-20 BAU, Ranchi M4 Generations of SML 668 (20 KR)
35 PRMB -15-40 BAU, Ranchi M4 Generations of Pusa Vishal (40 KR)
36 SRMB -15-60 BAU, Ranchi M4 Generations of Pusa Vishal (60 KR)
37 Pant M4 (C) GBPUA&T, Pantnagar T 44 x UPU 2
38 IPM 2-3 (C) IIPR, Kanpur IPM99-125 x Pusa Bold 2
12 Journal of Food Legumes 33(1), 2020

Sai et al. 2015 and negative significant association with
days to 50% maturity.
The trait days to first flowering recorded positive
and significant relationship with days to 50% maturity and
days to pod initiation which were an important component
in identifying the duration of the crop (Shweta 2011),
(Srivastava and Singh 2012, Begum et al. 2013). The trait
50% flowering had showed a negative relationship with
seed yield. The reason for this can be because of the
exposure of the crop to a large amount of time which can
subject it to huge amount of stresses. Hence the result
states us to go for a short duration crops and develop them
accordingly by selecting that trait. Number of primary
branches per plant recorded highly significant and positive
association with clusters per plant and pods per plant, seeds
per plant and seed yield per plant (Patel et al. 2012, Reddy
et al. 2011a, Lalinia and Khameneh 2014, Sai et al. 2015 and
Chandra et al. 2016) revealed that with an increase in
number of primary branches per plant we can improve the
remaining traits related to increase in production of our
crop like clusters per plant, seeds per plant, pods per plant
and seed yield per plant. Plant height, number of primary

Table 2: Basic statistics for 11 quantitative traits in mungbean genotypes

Character RANGE PCV (%) Heritability Mean ± S.E.
Min. Max. (Broad sense) (%)
Days to first flowering 29.33 46.33 13.08 97.00 35.85±0.96
Days to 50% maturity 31.00 66.01 6.00 95.40 58.17±1.51
Days to pod initiation 38.00 54.02 10.15 96.90 44.43±1.19
Plant Height (cm) 34.33 74.82 20.29 96.20 53.13±2.10
Number of primary branches per plant 1.53 4.53 35.27 98.00 2.21±0.11
Number of clusters per plant 5.27 14.77 22.55 89.61 6.68±0.49
Number of pods per plant 8.67 20.30 27.27 92.72 14.59±1.07
Number of seeds per pod 8.07 14.07 14.24 73.10 11.23±0.83
100-seed weight (g) 1.80 5.01 15.69 82.90 2.99±0.19
Seed yield per plant (g) 4.16 8.41 20.09 83.30 5.69±0.47
Total protein content (%) 16.69 28.14 13.73 98.90 21.11±0.30

Table 3: Estimates of Phenotypic and Genotypic correlation coefficients between yield and its components in mungbean
[Vigna radiata (L.) Wilczek]
Character Days to Days to Plant Primary Clusters Pods per Seeds 100- Seed Disease incidence (%) Total
50% pod height branches per plant per pod seed yield Anthracnose Powdery protein
maturity initiation (cm) per plant plant weight per Mildew content
(g) plant (%)
(g)
Days to first G 0.515** 0.942** 0.160 0.164 0.213 0.296 0.133 0.054 -0.069 -0.221 -0.122 0.082
flowering P 0.522** 0.938** 0.148 0.160 0.194 0.277 0.130 0.056 -0.057 -0.132 -0.121 0.081
Days to 50% G 0.554** 0.115 -0.296 -0.065 0.202 0.012 -0.245 -0.425* -0.263 -0.091 0.221
maturity P 0.559** 0.102 -0.289 -0.064 0.186 0.016 -0.208 -0.370* -0.242 -0.062 0.213
Days to pod G 0.228 0.148 0.203 0.226 0.154 0.049 -0.057 -0.162 -0.123 0.094
initiation P 0.213 0.145 0.176 0.207 0.135 0.051 -0.048 -0.141 -0.102 0.092
Plant height (cm) G -0.167 -0.025 0.023 -0.235 0.254 -0.075 -0.331* 0.152 0.173
P -0.165 -0.008 0.021 -0.214 0.225 -0.067 -0.302 0.132 0.159
Number of G 0.818** 0.408* 0.379* 0.121 0.463** -0.332* -0.234 -0.174
primary branches P 0.771** 0.394* 0.336* 0.114 0.422** -0.303 -0.213 -0.167
per plant
Number of G 0.714** 0.177 0.088 0.472** -0.391* -0.081 -0.083
clusters per plant P 0.682** 0.133 0.077 0.418** -0.362* -0.062 -0.081
Number of pods G 0.045 -0.144 0.100 -0.372* -0.142 -0.161
per plant P 0.039 -0.138 0.095 -0.351* -0.122 -0.157
Number of seeds G -0.052 0.130 0.163 -0.091 -0.271
per pod P -0.030 0.097 0.143 -0.073 -0.186
100-seed weight G 0.375* 0.062 0.152 0.273
(g) P 0.369* 0.043 0.132 0.270
Seed yield per G 0.031 -0.022 -0.094
plant (g) P 0.022 -0.013 -0.091
Disease incidence G -0.023 -0.234
(%) Anthracnose P -0.021 -0.198
Disease incidence G -0.352*
(%) Powdery P -0.323*
Mildew
P and G are phenotypic and genotypic correlation coefficients, respectively
Significant at 5% level - *Significant at 1% level - **
 Nandigam et al. : Genetic, character association and multivariate studies of seed yield in mungbean 13

branches per plant, clusters per plant and pods per plant
had showed a negative relationship with anthracnose which
depicts that with an increase in any of these traits along
with some good management practices there is a chance of
reducing this disease incidence which will indirectly helps
us in reducing the crop loss and increasing the production.

Principal Component Analysis (PCA):

Multivariate analysis especially principal component
analysis is generally used for compression, reduction and
transformation of data which helps in analysing the genetic
diversity of the genotypes thus considered. In the present
study, a total of four principal components which
contributed to a variance of about 73.59% out of all the
twelve components of 38 genotypes (Table 4. and Fig 1).
Populations with high PC1 values were with an eigen value
of about 3.39 and a variane of about 28.41% had been
explained by them. They mainly contributed towards the
phenology and vegetative growth traits like days to first
Fig. 2: Distribution of greengram genotypes across two
flowering , days to 50% maturity , days to pod initiation
components
and plant height whereas the populations with high PC2
contributed were with an eigen value of about 2.67, variance
explained was around 22.38% and they contributed more
towards the reproductive growth traits like primary branches
, clusters , pods and seed yield. The remaining two
components viz., PC3, PC4 were with an eigen value of 1.49
and 1.25 respectively and the variation revealed by them
was less when compared with the first two components
(which was around 50.69% , PC 1 and PC 2 combinedly)
which was around 12.4% (PC 3) and 10.4% (PC 4). The
distribution pattern of the genotypes was depicted in a 3D
plot which states how diverse the genotypes were (Fig 4).
Mehandi et al. (2015) studied twenty one greengram
genotypes and reported that PC1 was positively
contributed by less number of seeds per pod, major

Table 4: The eigen values, per cent variability, cumulative

per cent variability for four principal components
in mungbean [Vigna radiata (L.) Wilczek]
PC 1 PC 2 PC 3 PC 4
Eigen value 3.39 2.67 1.49 1.25
% of variance explained 28.41 22.38 12.4 10.4
Cumulative variance explained 0.28 0.50 0.63 0.74

Fig. 3: Diagram illustrating the clustering pattern of thirty

eight genotypes of mungbean by Tocher’s method of
classification

contribution of PC 2 through number of pods per plant,

Fig. 1: Scree plot showing eigen value variation for twelve
quantitative traits in mungbean
seeds per pod, number of clusters per plant.
Cluster analysis: To determine the genetic relationship
between the genotypes and make them get utilized in our
future breeding programmes we can opt for an analysis
technique like Cluster analysis. This technique had grouped
these 38 genotypes into 6 clusters among which cluster I
was the largest with 31 genotypes followed by cluster II
14 Journal of Food Legumes 33(1), 2020

Table 6: Clustering pattern of thirty eight genotypes of

mungbean based on Tocher’s method of
classification
Cluster No.of genotypes Name of genotypes
1 31 SKNM 1504, Pusa M 1771, Pusa M 1772,
RMG 1097, COGG 13-39, MH 1323, SML
1808,IPM 512-1,VGG 16-055, NVL 855,
MDGVV-18, OBGG-56, AKM 12-28, TMV
126, NMK 15-08, SVM-6133, KM 2355,
PM 14-3, AKM 12-24, IPM 410-9, DGG 7,
IGKM 2016-1, SKNM 1502, RMB 12-
07,JAUM 0936,OBGG 58, MGG-387, KM
17-130, IPM 2-3, PRMB-17-70 , Pant M4
2 3 BM 2012-9, PM 14-11, ML 2479
3 1 VGG-16-036
4 1 PRMB-15-40
5 1 SRMB-15-60
6 1 SRMB-15-20

Cluster VI comprising of only one genotype had

showed its highest value towards number of primary
branches (5.53), clusters (14.77), pods per plant (25.60) and
Fig. 4: Three dimensional view showing relative position of seed yield per plant (8.41g) which depicts its representation
genotypes of green gram [Vignaradiata (L.) Wilczek] based on towards more reproductive growth. Cluster V had
PCA scores represented its highest mean value towards the trait number
of seeds per pod (14.07) whereas cluster II had showed its
Table 5: Character loading of four principal components highest value towards the total protein content (26.47%)
for twelve characters of thirty eight genotypes of
mungbean [Vigna radiata (L.) Wilczek] and 100 seed weight (3.68g). Hence the genotype in this
cluster can be used for developing of bold sized seeds
Character PC 1 PC 2 PC 3 PC 4 there by the quality of the produce can be increased.
Days to first flowering 0.48 0.01 -0.01 0.29
Selecting the diverse genotypes basing on these
Days to 50% maturity 0.37 -0.21 -0.12 -0.19
Days to pod initiation 0.49 -0.02 0.01 0.28 component characters leads to better adaptation of the
Plant height(cm) 0.49 -0.15 0.06 0.06 crop. Researchers like Singh et al. (2014), Katiyar et al.
Number of primary branches per 0.11 0.53 0.01 0.01 (2009) and many others, gave emphasis on presence and
plant need of high or very high genetic diversity to create the
Number of clusters per plant 0.19 0.49 0.05 -0.34
high genetic variation and genetic gain under selection. In
Number of pods per plant 0.23 0.32 -0.22 -0.39
Number of seeds per pod 0.02 0.25 -0.21 0.51 the present study the only one genotype in cluster II, with
100 seed –weight (g) 0.004 0.11 0.66 0.26 more number of primary branches, clusters, pods and seed
Seed yield per plant (g) -0.02 0.36 0.42 -0.07 yield per plant can be considered as a potential donor in
Disease incidence (%) -0.12 0.11 -0.09 0.23 our future breeding programmes for improving the yield
Anthracnose
which was the ultimate motto of a plant breeder.
Disease incidence (%) Powdery -0.09 0.14 -0.07 0.18
Mildew Comparing both Tocher’s and principal component
Total protein content (%) 0.07 -0.21 0.49 -0.13 analysis and other descriptive statistical techniques, the
diverse mungbean promising genotypes for twelve different
(with 3 genotypes) (Table 6 and Fig 3). It is noted that
characters were represented in the table 9. The genotypes
genotypes collected from different geographical origins
‘SKNM 1504’ had showed earliness in flowering and pod
were grouped in same cluster which indicates the absence
initiation, ‘SRMB 15-60’ had showed had showed dwarf
of relationship between geographical diversity and genetic
stature with more number of seeds per pod and with low
diversity. The mean values of the clusters for 12 different
disease incidence , ‘SRMB 15-20’ had showed more number
morphological traits also depicts the presence of variability
of primary branches per plant, cluster per plant and high
(Table 8).
Table 7: Mean intra (bold) and inter-cluster distances among the clusters in mungbean [Vigna radiata (L.) Wilczek]
Cluster I Cluster II Cluster III Cluster IV Cluster V Cluster VI
Cluster I 11.42 17.14 17.49 16.79 19.11 23.03
Cluster II 13.11 20.82 25.67 19.42 26.87
Cluster III 0 16.05 19.61 18.71
Cluster IV 0 18.74 19.11
Cluster V 0 15.83
Cluster VI 0
 Nandigam et al. : Genetic, character association and multivariate studies of seed yield in mungbean 15

Table 8: Cluster means for twelve different characters in thirty eight genotypes of mungbean [Vigna radiata (L.)Wilczek]
Days to Days to Days to Plant Number of Number of Number of Number 100-seed Seed Total
first 50% pod height primary clusters pods per of seeds weight yield per protein
flowering maturity initiation (cm) branches per plant plant per pod (g) plant (g) content
per plant (%)
Cluster I 35.29 60.78 43.94 52.15 1.99 6.38 14.29 11.15 2.90 5.51 20.82
Cluster II 41.78 64.78 50.89 65.77 2.02 6.44 13.93 10.73 3.68 5.29 26.47
Cluster III 47.00 62.00 53.00 70.62 2.97 7.73 19.40 9.47 2.92 6.51 18.20
Cluster IV 31.33 48.67 40.00 49.14 3.08 6.31 11.55 12.00 3.12 7.81 16.69
Cluster V 41.00 57.33 48.00 34.33 4.53 7.80 12.87 14.07 3.12 6.94 24.07
Cluster VI 38.67 58.00 47.67 50.93 5.53 14.77 25.60 13.47 3.35 8.41 18.46

Table 9: Diverse mungbean promising genotypes for twelve different characters in Tocher’s and Principal component
analysis method
Character Cluster (Tocher’s) Cluster (PCA) Suitable Genotypes
1 Days to first flowering Early I I SKNM 1504
Late III IV VGG-16-036
2 Days to 50% maturity Early I I AKM 12-24
Late I I IPM 2-3
3 Days to pod initiation Early I I SKNM 1504
Late I I JAUM 0936
4 Plant height(cm) Dwarf V IV SRMB-15-60
Tall I I MGG-387
5 Number of primary branches per plant More V IV SRMB-15-20
Less RMG-1097
6 Number of clusters per plant More VI III SRMB-15-20
Less VGG 16-055
IGKM 2016-1
7 Number of pods per plant More I I MH 1323
Less SVM-6133
8 Number of seeds per pod More V IV SRMB-15-60
Less PM 14-11
9 100 seed –weight (g) Bold II V BM 2012-9
Small IGKM 2016-1
10 Seed yield per plant (g) High VI III SRMB-15-20
Low COGG 13-39
KM 2355
11 Disease incidence (%) Anthracnose High IGKM 2016-1
Low V IV SRMB-15-60
Disease incidence (%) Powdery Mildew High MDGVV-18
Low I I SML 1808
12 Total protein content (%) High II V PM 14-11
Low PRMB 15-40

seed yield. Along with these the genotype ‘BM 2012-9’,
had bold sized seeds. Hence, we can consider these
genotypes in our future breeding programmes.
REFERENCES
Begum S, Noor M, Rahman HU, Hassan G, Durrishahwar Ullah H,
Alia and Ali 2013. Heritability estimates and correlations among
flowering and yield related traits in mungbean genotypes. British
Journal of Applied Sciences and Technology 3(3): 472-481.
Chandra MS, Mishra SB and Anil Pandey 2016. A study on correlation
and regression analysis in mungbean [Vigna radiata (L.)
Wilczek]. Legume Research 39(1): 20-25.
Directorate of Economics and Statistics, Ministry of Agriculture
and Farmers Welfare, Government of India, 2017-18.
Gamanagatti PB, Mirajkar BC and Narayanaswamy T 2013. Pulses
are the basic ingredient in the diets of a vast majority of the
Indian population. International Research Journal of Agricultural
Economics and Statistics 4(1):104-108.
Jyothsna AM and Anuradha CH 2013. Genetic variability, correlation
and path analysis for yield and yield components in mungbean
(Vigna radiata). Journal of Research ANGRAU 41(3): 31-39.
Katiyar PK, Dixit GP, Singh BB, Ali H and Dubey MK 2009. Non-
hierarchical Euclidean cluster analysis for genetic divergence in
mungbean cultivars. Journal of Food Legumes 22: 34-36.
Lalinia AA and Khameneh MM. 2014. Multivariate Statistical
Method for Determining Interrelationships among Seed Yield
and Related Characters in Mungbean. Inernational Journal of
Farm and Allied Sciences 3(3): 274-281.
Mehandi S, Singh IP, Bohra A and Singh CM. 2015. Multivariate
analysis in green gram [Vigna radiata (L.) Wilczek]. Legume
Research 38(6): 758-762.
Patel AI, Mali SC, Intwala CG and Nizama JR. 2012. Genetic
variability, correlation, path coeffcient analysis and genetic
divergence in greengram (Vigna radiate (L.) Wilczek). Crop
Research 43(1, 2 & 3): 178-184.
16 Journal of Food Legumes 33(1), 2020
Raje RS and Rao SK. 2000. Genetic parameters of variation for yield
and its components in mungbean (Vigna radiate (L.) Wilczek)
over environments. Legume Research 23(4): 211-216.
Raje RS and Rao SK. 2000. Association analysis for yield and its
components in mungbean (Vigna radiata (L.) Wilczek.). Legume
Research 23(1): 42-48.
Reddy KRD, Venkateswarlu O, Obaiah MC and Jyothi SGL. 2011a.
Studies on genetic variability, character association and path
coefficient analysis in greengram (Vigna radiate (L.) Wilczek).
Legume Research 34(3): 202-206.
Sai Rekha K, Reddy DM, Ravindra Reddy B and Reddy KHP. 2015.
Effect of Water Stress on Associations of Drought Tolerance
and Yield Traits in Mungbean (Vigna radiate (L.) Wilczek).
International Journal of Food, Agriculture and Veterinary Sciences
5(2): 72-75.
Shweta 2011. Study of genetic variability and correlation in
mungbean. International Journal of Plant Sciences 6(1): 8-10.
Singh CM, Mishra SB and Pander A. 2014. Pattern of agro-
morphological trait relationship and genetic divergence in
greengram [Vigna radiata (L.) Wilczek]. Electronic Journal of
Plant Breeding 5(1): 97-106
Srivastava RL and Singh G. 2012. Genetic variability, correlation
and path analysis in mungbean (Vigna radiata (L.) Wilczek).
Indian Journal of Life Sciences 2(1): 61-65.
Srivastawa RL and Singh G. 2012. Heterosis for yield and its
contributing characters in mungbean (Vigna radiata (L.)
Wilczek). Indian Journal of Scientific Research 4(1): 131-134.
Vavilov NI. 1926. The origin, variation, immunity and breeding of
cultivated plants (Translated by K. Starr. Chestet.). Cronica
Botany 13: 364.
Journal of Food Legumes 33(1): 17-22, 2020
Effect of seasonal variations on yield and its attributes in mungbean {Vigna
radiata (L.) Wilczek}
1
CHALAPATI NAGA SAI KRISHNA, 2SANJAY KUMAR, 1SURESH BG and 2ANAND KUMAR
1
Sam Higginbottom University of Agriculture, Technology and Sciences, Prayagraj, Uttar Pradesh, 2Bihar
Agricultural University, Sabour, Bhagalpur, Bihar: Email: meetsanjaykumar@yahoo.com
(Received : August 13, 2019; Accepted : November 18, 2019)
ABSTRACT
Genetic variability, correlation and path coefficient were
studied in 40 mungbean genotypes during kharif, 2017 and
summer, 2018. High estimates of GCV, PCV, heritability and
genetic advance were recorded for number of clusters per
plant, number of pods per plant, harvest index and seed index
exhibited high estimates of GCV, PCV, heritability as well
as genetic advance as % of mean in both the season. Seed
yield per plant showed significant positive correlation with
harvest index, seed index and days to maturity during kharif
and seed yield per plant showed significant and positive
association with harvest index, number of pods per plant
and biological yield during summer season. Path coefficient
analysis revealed that harvest index had very high positive
direct effect on seed yield followed by days to maturity and
number of clusters per plant in kharif season while,
biological yield per plant, days to maturity, number of
primary branches had exhibited high positive direct effect
on grain yield during summer season. The above mention of
traits viz.,number of clusters per plant, number of pods per
plant, harvest index and seed index should be given due
emphasis for future wheat genetic improvement because
they possess high genetic variance, heritability coupled with
high genetic correlation among themselves which may yield
high genetic advance under proper selection pressure in a
greengram breeding programme. Strong association of these
traits revealed that the selection based on these traits would
ultimately improve the seed yield. Hence, the above
mentioned characters should be given topmost priority while
formulating a selection strategy for improvement of yield in
greengram.
Key words: Correlation, Greebgram, Genetic variability and
Path analysis
Greengram (Vigna radiata L. Wilczek) is the third
most important pulse crop after chickpea and pigeonpea
and grown extensively in tropical and sub-tropical regions
of the world. It is self pollinateddiplpoid legume with
chromosome number, 2n=2x= 22. It belongs to the family
Fabaceae and sub-family Papilionaceae. The center of
origin is India.
Majority of Indian population is vegetarian, pulses
are cheap and best source of protein for Indian diet. It
contains 20-25 percent protein, which is more than two
times that in cereals. Due to cheaper protein source, it is
designated as “poor man’s meat”. The total production of
pulses in the world was 14.76 billion tonnes from the area
of 14.25 billion hectares in the year 2015-16 while in India
total pulses production was 19.78 million tons from the
area of 23.63 million hectares in the year 2015-16. During
2017-18, the total areaunder mungbean in India was about
41.0 lakh ha with a production of 19.0 lakh tons.
India was importing about 3 million tonnes and future
demand of pulses by 2017 will be 27.0 million tonnes.
Considering the fact that India accounts for the major share
of world’s pulse area, the need was felt to strengthen
research to meet the requirement through enhanced
domestic production. One of the constraints listed for the
failure to achieve a major breakthrough in greengram
production has been the lack of genetic variability for high
yield potential and resistance to biotic and abiotic stresses.
Improvement in the grain yield of greengram is rather slow
in comparison with other cereal grains. As greengram is a
self-pollinated species considerable variation exists among
the greengram cultivars and also within its related species.
Selection of superior parents exhibiting better heritability
and genetic advance for various characters is an essential
prerequisite for any improvement programme (Khan et al.
2008). Yield in greengram is a complex character associated
with various contributing characters which are interrelated
among them. For developing selection strategy, the
knowledge of genetic variability present in the available
germplasm for yield and its associated character is very
important (Srivastava and Singh 2012). The present study
was undertaken to study the effects of seasonal variations
on the nature and magnitude of genetic variability and
associations among characters in mungbeangermplasm.
MATERIALS AND METHODS
Forty genotypes of mungbean were evaluated in a
randomized block with three replications during kharif, 2017
andsummer, 2018 at field experimentation centre, Department
of Genetics and Plant Breeding, San Higginbottom
University of Agriculture Technology and Sciences,
Prayagraj during kharif, 2017 and summer, 2018. Each plot
consisted of four rows of one-meter length with plant-to-
plant and row-to-row distances of 10 cm and 30 cm
respectively. Observations were recorded on twelve
quantitative characters. Data were recorded on five
randomly selected plants in each row for the characters
18 Journal of Food Legumes 33(1), 2020

viz.,days to 50% flowering, plant height, number of
branches per plant, number of clusters per plant, number of
pods per plant, days to maturity, pod length, number of
seeds per pod, seed index, biological yield, harvest yield
and seed yield per plant.Mean values were subjected to
analysis of variance to test the significance for each
character as per methodology advocated by Panse and
Sukhatme (1967). GCV and PCV were calculated by the
formula given by Burton (1952), heritability in broad sense
(h2) by Burton and De Vane (1953) and genetic advance i.e.
the expected genetic gain were calculated by using the
procedure given by Johnson et al. (1955). Correlation
coefficients were computed according to the method
suggested by Al-Jibourieet al. (1958). Dewey and Lu (1959)
was used to perform the path analysis for grain yield and
its components keeping grain yield as resultant variable
and its components as causal variables.To know the extent
of relationship between yield and its various components,
it is important for the plant breeder to select plants which
consists of desirable characteristics. Phenotypic correlation
coefficient was higher for all the important characters like
yield and yield related characters (Table 3a & 3b). Seed
yield per plant showed significant positive correlation with
harvest index, seed index and days to maturity during kharif
and seed yield per plant showed significant and positive
association with harvest index, number of pods per plant
and biological yield during summer season.Number of pods
per plant, number of seeds per pod, test weight exhibited
positive and significant association with seed yield per
plant (Rajanet al. 2000; Makeenet al. 2012; Srivastava and
Singh, 2012, Thippaniet al. 2013,Divya Ramakrishna etal.
2018).
To know the direct and indirect effects of seed yield
and yield related traits, correlation coefficient was further
partitioned into direct and indirect effects through path
coefficient analysis at phenotypic level by considering seed
yield per plant as a dependent character.Yield is the sum
total of the several component characters which directly or
indirectly contributed to it. The information derived from
the correlation studies indicated only mutual association
among the characters. Whereas, path coefficient analysis
helps in understanding the magnitude of direct and indirect
contribution of each character on the dependent character
like seed yield per plant. Among the twelve characters
studied harvest index had very high positive direct effect
on seed yield (Table 4a & 4b) followed by days to maturity
and number of clusters per plant in kharif season while,
biological yield per plant, days to maturity, number of
primary branches had exhibited high positive direct effect
on grain yield during Summer season. This result is in
agreement with the results obtained by Venkateshwarlu
(2001b), Haritha and Reddy Shekar (2002), Anuradha and
Suryakumari (2005) and Mallikarjuna Rao et al. (2006).
The present investigation indicated that there is a
wide range of genetic variability in greengramgermplasm.
There is large scope of simultaneous improvement in seed
yield through selection. However, it would be worthwhile
to study available germplasm over years and locations to
identify more diverse germplasm as well as to confirm the
importance of the traits identified as predictors of yield.
High heritability coupled with high genetic advance were
observed for number of clusters per plant, number of pods
per plant, harvest index and seed index during kharif season,
while, during summer number of clusters per plant and
number of pods per plant and harvest index exhibited high
heritability accompanied with high genetic advance,
suggests that genotypic variation in the present material
for these traits was due to high additive gene effect and
direct selection for these traits may be rewarding.
RESULTS AND DISCUSSION
The analysis of variance revealed highly significant
differences among all genotypes for all characters under
studied, which indicated that there is ample scope for
selection of promising genotypes from present germplasm
for yield improvement. The estimates of genetic parameters
of variability are presented in Table 1(a) & 1(b). Moderate
genotypic coefficient of variation and phenotypic
coefficient of variation during were observed for number
of cluster per plant, followed by number of pods per plant,
harvest index, seed index and biological yield per plant

Table 1 (a) Estimates of genetic parameters for twelve quantitative characters in forty genotypes of Greengram (Kharif, 2017)
Sl. No. Characters σ²g σ²p GCV PCV Heritability (h2bs) Genetic GA as % of
advance mean
1. Days to 50% flowering 0.52 3.21 1.47 3.65 16 0.60 1.22
2. Days to maturity 9.00 12.16 5.06 5.88 74 5.31 8.97
3. Plant height (cm) 6.03 8.92 5.35 6.51 67 4.15 9.07
4. No. of primary branches / plant 0.02 0.05 3.84 5.47 49 0.23 5.56
5. No. of Clusters per plant 0.96 0.98 18.07 18.24 98 2.00 36.88
6. No. of Pods per plant 7.79 8.95 17.81 19.09 87 5.36 34.24
7. Pod Length (cm) 0.31 0.31 7.53 7.56 99 1.14 15.45
8. No. of Seeds per Pod 0.95 0.97 8.93 9.03 97 1.99 18.20
9. Biological yield per plant (g) 3.33 4.37 10.32 11.82 76 3.28 18.58
10. Harvest Index (%) 23.12 26.55 16.44 17.62 87 9.24 31.62
11. Seed Index 0.17 0.18 12.99 13.44 93 0.82 25.89
12. Seed yield per plant (g) 0.19 0.24 7.43 8.28 80 0.81 13.74
 Chalapati et al. : Effect of seasonal variations on yield and its attributes in mungbean 19

Table 1 (b) Estimation of genetic parameters for twelve quantitative characters in forty genotypes of Greengram (summer, 2018)
Sl. No. Characters σ²g σ²p GCV PCV Heritability (h2bs) Genetic advance GA as % of mean
1. Days to 50% flowering 0.52 3.21 1.47 3.65 16 0.60 1.22
2. Plant height (cm) 4.17 8.98 4.36 6.39 46 2.86 6.12
3. No. of primary branches / plant 0.01 0.04 3.39 5.06 45 0.19 4.69
4. No. of Clusters per plant 0.78 0.81 16.73 17.02 96 1.79 33.87
5. No. of Pods per plant 5.10 5.50 15.35 15.94 92 4.48 30.46
6. Pod Length (cm) 0.12 0.16 5.03 5.63 79 0.65 9.26
7. No. of Seeds per Pod 0.42 0.54 6.18 7.02 77 1.17 11.21
8. Days to maturity 6.10 7.68 3.60 4.03 79 4.53 6.61
9. Biological yield per plant (g) 2.86 3.48 9.42 10.40 82 3.15 17.58
10. Harvest Index (%) 15.56 19.44 11.86 13.26 80 7.27 21.87
11. Seed Index 0.14 0.17 9.17 9.93 85 0.73 17.46
12. Seed yield per plant (g) 0.19 0.24 7.43 8.28 80 0.81 13.74

Table 2(a):Genotypic correlation coefficients between yield and its component characters in forty genotypes of Greengram
(Kharif, 2017)
Sl. Characters Days to Plant primary No. of No. of Pod No. of Seed Biological Harvest Seed
No. maturity height branches Clusters Pods / Length Seeds / Index yield / Index (%) yield per
(cm) / plant per plant plant (cm) Pod plant (g) plant (g)
1. Days to 50% flowering 1.0001 -0.0671 -0.0319 0.1071 0.0621 -0.0516 0.2157* -0.2935** 0.1064 -0.0605 0.0043
2. Days to maturity -0.0609 -0.1476 0.0023 0.0729 -0.0599 0.2830** -0.2111* 0.1951* 0.0262 0.1953*
3. Plant height (cm) 0.1322 -0.1182 -0.0442 -0.2285* -0.0038 -0.0338 0.0350 -0.0288 0.0171
4. No. of primary -0.1164 -0.1066 -0.0232 -0.2171* 0.2264* 0.5146** 0.1996* -0.2130*
branches / plant
5. No. of Clusters per 0.8824** 0.0678 0.3000** -0.1039 0.3008** -0.3118** -0.1568
plant
6. No. of Pods per plant 0.0554 0.3338** 0.0102 0.3198** -0.2599** -0.0765
7. Pod Length (cm) 0.4052** 0.4067** 0.0803 -0.1757 -0.1779*
8. No. of Seeds per Pod 0.0137 0.3755** -0.2707** -0.0136
9. Seed Index -0.1677 0.2458* 0.1996*
10. Biological yield per -0.7595** -0.0432
plant (g)
11. Harvest Index (%) 0.6813**
* , ** Significant at 5% and 1% levels of significance, respectively

Table 2(b): Genotypic correlation coefficients between yield and its component characters in forty genotypes of Greengram
(summer, 2018)
Sl. Characters Days to Plant primary No. of No. of Pod No. of Seed Biologica Harvest Seed
No. maturity height branches Clusters/ Pods / Length Seeds / Index l yield / Index yield per
(cm) / plant plant plant (cm) Pod plant (g) (%) plant (g)
1. Days to 50% 0.6182** -0.2445* 0.4123** -0.3688** -0.2667** 0.3686** -0.1112 -0.3083** -0.4122** 0.2037* -0.1919*
flowering
2. Days to maturity 0.4809** 0.0036 -0.1613 0.0276 0.2208* 0.1404 -0.1692 0.1388 -0.1294 -0.1093
3. Plant height (cm) 0.0950 0.0999 0.2980** -0.0055 0.0658 -0.0779 0.4875** -0.4491** -0.1150
4. No. of primary -0.1125 -0.1255 0.2862** 0.1015 0.0567 -0.4934** 0.5096** 0.0520
branches / plant
5. No. of Clusters per 0.7737** 0.0275 0.3127** -0.1600 0.2148* -0.2387* -0.0641
plant
6. No. of Pods per plant 0.1089 0.3779** -0.2145* 0.3524** -0.2057* 0.1649
7. Pod Length (cm) 0.3239** 0.4799** -0.0614 0.1180 0.0491
8. No. of Seeds per Pod 0.0210 0.2973** -0.1075 0.1836*
9. Seed Index -0.3186** 0.2533** -0.0132
10. Biological yield per -0.7790** 0.1469*
plant (g)
11. Harvest Index (%) 0.4939**
* , ** Significant at 5% and 1% levels of significance, respectively

during kharif while, for number of cluster per plant, number
of pods per plant and harvest index exhibited during Summer
recorded moderate GCV and PCV. Reddy et al. 2014 reported
moderate GCV and PCV for number of seeds and Lavanya
(2006) observed for number of clusters per plant.
High heritability wererecorded for pod length, number
of cluster per plantplant, number of seeds per pod, harvest
index, seed index,seed yield per plant and biological yield
per plant during both the season, Kharif and Summer. Similar
result was reported by Divya Ramakrishnan et al. 2018.
20 Journal of Food Legumes 33(1), 2020

High genetic advance as percent of mean was recorded for
number of clusters per plant, number of pods per plan and
harvest index during both seasons.High heritability coupled
with high genetic advance was recorded for number of
clusters per plant, number of pods per plant, harvest index
and seed index during kharif season, while, during summer
number of clusters per plant and number of pods per plant
and harvest index exhibited high heritability accompanied
with high genetic advance.
Burton (1952) has suggested that GCV together with
heritability would give best picture of amount of advance
to be expected from selection. Number of clusters per plant,
number of pods per plant, harvest index, seed index
exhibited high estimates of GCV, PCV, heritability as well as
genetic advance as percentage of mean. These traits can
be used for selection as they respond well because of their
high genetic variability. Venkateswarlu (2001) and Divya
Ramakrishnan et al. (2018) indicated that greengram seed
yield expressed high genetic advance coupled with high
heritability and genotypic coefficient of variation.
Number of clusters per plant, number of pods per
plant, harvest index, seed index exhibited high estimates of
GCV, PCV, heritability as well as genetic advance as
percentage of mean. These traits can be used for selection
as they respond well because of their high genetic variability.
Significant positive association and high direct effect were
exhibited byharvest index and days to maturity on seed
yield per plant in kharif and biological yield and days to
maturity in summer season. Strong association of these
traits revealed that the selection based on these traits would
ultimately improve the seed yield. Hence, the
abovementioned characters should be given topmost
priority while formulating a selection strategy for
improvement of yield in greengram.

Table 3(a): Phenotypic correlation coefficients between yield and its component characters in forty genotypes of Greengram
(Kharif, 2017)
Sl. Characters Days to Plant primary No. of No. of Pod No. of Seed Biological Harvest Seed
No. maturity height branches Clusters Pods / Length Seeds / Index yield / Index (%) yield per
(cm) / plant per plant plant (cm) Pod plant (g) plant (g)
1. Days to 50% 0.6220** -0.0406 0.0106 0.0780 0.0242 -0.0355 0.1639 -0.2112* 0.1363 -0.0988 0.0314
flowering
2. Days to maturity -0.0450 -0.1445 0.0138 0.0270 -0.0503 0.2629** -0.1778 0.0582 0.0838 0.1836*
3. Plant height (cm) 0.0363 -0.0946 -0.0192 -0.1854* -0.0056 -0.0258 0.0332 -0.0185 0.0181
4. No. of primary -0.0687 -0.0605 -0.0240 -0.1516 0.1243 -0.2470* 0.0873 -0.1568
branches / plant
5. No. of Clusters per 0.8156** 0.0649 0.2945** -0.1037 0.2612** -0.2885** -0.1485
plant
6. No. of Pods per plant 0.0523 0.3183** 0.0066 0.2472* -0.2120* -0.0660
7. Pod Length (cm) 0.3987** 0.3985** 0.0700 -0.1642 -0.1741
8. No. of Seeds per Pod 0.0122 0.3042** -0.2328* -0.0115
9. Seed Index -0.1518 0.2341* 0.1818*
10. Biological yield per -0.7793** -0.0519
plant (g)
11. Harvest Index (%) 0.6318*
*, **Significant at 5% and 1% levels of significance, respectively

Table 3(b): Phenotypic correlation coefficients between yield and its component characters in forty genotypes of Greengram
(Summer, 2018)
Sl. Characters Days to Plant primary No. of No. of Pod No. of Seed Biological Harvest Seed yield
No. maturity height branches Clusters Pods / Length Seeds / Index yield / Index per plant
(cm) / plant per plant plant (cm) Pod plant (g) (%) (g)
1. Days to 50% 0.2365* -0.0439 0.0781 -0.1502 -0.0906 0.1958* 0.0201 -0.0259 -0.1160 0.0844 -0.0105
flowering
2. Days to maturity 0.2480* -0.0179 -0.1394 0.0075 0.2247* 0.0968 -0.1585 0.0926 -0.0863 -0.0611
3. Plant height (cm) -0.0084 0.0387 0.1835* -0.0660 -0.0080 -0.1214 0.3157** -0.2566** -0.0460
4. No. of primary -0.0819 -0.0760 0.1327 0.0588 0.0774 -0.2397* 0.2523** 0.0112
branches / plant
5. No. of Clusters per 0.7481** 0.0436 0.2693** -0.1393 0.1913* -0.2084* -0.0642
plant
6. No. of Pods per plant 0.1043 0.3069* -0.1800* 0.2991** -0.1658 0.1488
7. Pod Length (cm) 0.2160* 0.4253** -0.0655 0.1179 0.0692
8. No. of Seeds per Pod 0.0148 0.2262* -0.1011 0.1137
9. Seed Index -0.2455* 0.1940* -0.0107
10. Biological yield per -0.7597** 0.1308
plant (g)
11. Harvest Index (%) 0.5130**
*, **Significant at 5% and 1% levels of significance, respectively
 Chalapati et al. : Effect of seasonal variations on yield and its attributes in mungbean 21

Table 4(a): Phenotypic Path coefficients analysis between seed yield and its related traits in forty genotypes of Greengram
(Kharif, 2017)
Sl. Characters Days to Days to Plant primary No. of No. of Pod No. of Seed Biological Harvest Seed yield
No. 50% maturity height branches Clusters Pods / Length Seeds / Index yield / Index per plant
flowering (cm) / plant per plant plant (cm) Pod plant (g) (%) (g)
1. Days to 50% 0.0568 0.0354 -0.0023 0.0006 0.0044 0.0014 -0.0020 0.0093 -0.0120 0.0077 -0.0056 0.0314
flowering
2. Days to maturity -0.0289 -0.0465 0.0021 0.0067 -0.0006 -0.0013 0.0023 -0.0122 0.0083 -0.0027 -0.0039 0.1836
3. Plant height (cm) -0.0004 -0.0005 0.0101 0.0004 -0.0010 -0.0002 -0.0019 -0.0001 -0.0003 0.0003 -0.0002 0.0181
4. No. of primary -0.0002 0.0031 -0.0008 -0.0212 0.0015 0.0013 0.0005 0.0032 -0.0026 0.0052 -0.0018 -0.1568
branches / plant
5. No. of Clusters per 0.0027 0.0005 -0.0032 -0.0023 0.0342 0.0279 0.0022 0.0101 -0.0035 0.0089 -0.0099 -0.1485
plant
6. No. of Pods per -0.0013 -0.0015 0.0010 0.0033 -0.0445 -0.0545 -0.0029 -0.0174 -0.0004 -0.0135 0.0116 -0.0660
plant
7. Pod Length (cm) 0.0004 0.0006 0.0023 0.0003 -0.0008 -0.0007 -0.0126 -0.0050 -0.0050 -0.0009 0.0021 -0.1741
8. No. of Seeds per 0.0019 0.0031 -0.0001 -0.0018 0.0035 0.0037 0.0047 0.0117 0.0001 0.0036 -0.0027 -0.0115
Pod
9. Seed Index -0.0028 -0.0024 -0.0003 0.0017 -0.0014 0.0001 0.0053 0.0002 0.0134 -0.0020 0.0031 0.1818
10. Biological yield per 0.1526 0.0651 0.0371 -0.2765 0.2923 0.2767 0.0783 0.3405 -0.1700 1.1193 -0.8723 -0.0519
plant (g)
11. Harvest Index (%) -0.1493 0.1267 -0.0279 0.1320 -0.4360 -0.3204 -0.2481 -0.3519 0.3538 -1.1779 1.5114 0.6318
The residual effect = 0.322
*, ** Significant at 5% and 1% levels of significance, respectively

Table 4(b): Phenotypic Path coefficients analysis between seed yield and its related traits in forty genotypes of Greengram
(summer, 2018)
Sl. Characters Days to Days to Plant primary Clusters Pods / Pod Seeds / Seed Biological Harvest Seed yield
No. 50% maturity height branches per plant plant Length Pod Index yield / Index per plant
flowering (cm) / plant (cm) plant (g) (%) (g)
1. Days to 50% 0.0265 0.0063 -0.0012 0.0021 -0.0040 -0.0024 0.0052 0.0005 -0.0007 -0.0031 0.0022 -0.0105
flowering
2. Days to maturity -0.0093 -0.0394 -0.0098 0.0007 0.0055 -0.0003 -0.0089 0.0038 0.0062 -0.0036 0.0034 -0.0611
3. Plant height (cm) 0.0030 -0.0168 -0.0678 0.0006 -0.0026 -0.0124 0.0045 0.0005 0.0082 0.0214 0.0174 -0.0460
4. No. of primary -0.0045 0.0010 0.0005 -0.0573 0.0047 0.0044 -0.0076 -0.0034 -0.0044 0.0137 -0.0145 0.0112
branches / plant
5. No. of Clusters per 0.0088 0.0081 -0.0023 0.0048 -0.0583 -0.0436 -0.0025 -0.0157 0.0081 -0.0111 0.0121 -0.0642
plant
6. No. of Pods per -0.0077 0.0006 0.0157 -0.0065 0.0639 0.0854 0.0089 0.0262 -0.0154 0.0256 -0.0142 0.1488
plant
7. Pod Length (cm) -0.0048 -0.0055 0.0016 -0.0032 -0.0011 -0.0025 -0.0243 -0.0053 -0.0104 0.0016 -0.0029 0.0692
8. No. of Seeds per -0.0004 -0.0018 0.0002 -0.0011 -0.0051 -0.0059 -0.0041 -0.0191 -0.0003 -0.0043 0.0019 0.1137
Pod
9. Seed Index -0.0005 -0.0034 -0.0026 0.0016 -0.0030 -0.0038 0.0090 0.0003 0.0212 -0.0052 0.0041 -0.0107
10. Biological yield per -0.1430 0.1141 0.3891 -0.2954 0.2357 0.3686 -0.0807 0.2788 -0.3025 1.2324 -0.9362 0.1308
plant (g)
11. Harvest Index (%) 0.1214 -0.1243 -0.3694 0.3649 -0.3000 -0.2387 0.1698 -0.1455 0.2792 -1.0936 1.4396 0.5130
The residual effect = 0.288
*, ** Significant at 5% and 1% levels of significance, respectively

REFERENCES Dewey JR and Lu KH. 1959. A correlation and path coefficient

Al-Jibourie HA, Miller PA and Robinson HF. 1958. Genotypic and
environmental variances and co-variances in upland cotton cross
of inter specific origin. Agronomy Journal 50: 633-636.
Anuradha T and Suryakumari S. 2005. Genetic parameters,
correlation and path analysis in greengram. Andhra Pradesh
Journal of Agriculture 52: 279-281.
Burton GW. 1952. Quantitative inheritance of grasses. Proc 6th
Int, Grassland Congress 1: 277-283.
Burton GW and De Vane EH. 1953. Estimating heritability in tall
fescue (Festucaarundinacea) from replicated clonal material.
Journal of Agronomy 45: 478-481.
analysis components of crested wheat grass seed production.
Journal of Agronomy 51: 515-518.
Divya Ramakrishnan CK, Savithramma DL and Vijayabharathi A.
2018. Studies on Genetic Variability, Correlation and Path
Analysis for Yield and Yield Related Traits in Greengram [Vigna
radiata (L.) Wilczek]. International Journal of Current
Microbiology and Applied Science 7(3): 2753-2761.
Haritha S and Reddy Shekhar M. 2002. Correlation and path
coefficient analysis in greengram [Vigna radiata (L.) Wilczek].
Legume Research 25: 180-183.
Johnson HW, Robinson HE and Comstock RE. 1955. Estimates of
genetic and environmental variability in soybean. Journal of
Agronomy 47: 314-318.
22 Journal of Food Legumes 33(1), 2020
Khan NH, Islam MA, Begum M and Shamsuzzaman SM. 2008.
Genetic variation for yield in mungbean (Vigna radiata).
International Journal of Sustainable Agricultural Technology
4(5): 40-43.
Lavanya GR. 2006. Evaluation of mungbeangermplasm for genetic
variability. Indian Journal of Plant Genetic Resources 19(1):
104-106.
Makeen K, Abrahim G, Jan A and Singh AK. 2012. Genetic variability
and correlations studies on yield and its components in greengram
(Vigna radiata (L.) Wilczek.). Journal of Agronomy 6(1): 216-
21 8.
Mallikarjuna Rao C, Koteswara Rao Y and Mohan Reddy. 2006.
Genetic variability and path analysis in greengram. Legume
Research 29: 216-218.
Panse VG and Sukhatme PV. 1967. Statistical Methods of agricultural
Workers. 2nd Edition, ICAR, pp: 381, New Delhi.
Rajan REB, Wilson D and Kumar V. 2000. Correlation and path
analysis in F2 segregating generation of greengram (Vigna radiata
L. Wilczek). Madras Journal of Agriculture 87: 10-12.
Srivastava RL and Singh G. 2012. Genetic variability, correlation
and path analysis in greengram (Vigna radiata (L.) Wilczek).
Indian Journal of Life Science 2(1): 61- 65.
Thippani S, Eswari KB and Brahmeswar Rao MV. 2013. Character
association between seed yield and its components in greengram
(Vigna radiata (L.) Wilczek). International Journal of Applied
Science and Pharma Technology 4(4): 295-297.
Venkateshwarlu O. 2001. Correlation and path analysis in greengram.
Legume Research 24: 115-117.
Journal of Food Legumes 33(1): 23-27, 2020
Seed development and maturation behaviour of mungbean (Vigna radiata L.
Wilczek) for quality seed production
1
RDS YADAV, 2VINEET DHEER, 3PK KATIYAR and 3PRADEEP YADAV
1
Acharya Narendra Deva University of Agriculture and Technology, Kumarganj, Ayodhya,Uttar Pradesh, India;
2
CSA University of Agriculture and Technology, Kanpur, Uttar Pradesh, India; 3ICAR-Indian Institute of Pulses
Research, Kanpur, Uttar Pradesh, India; Email: rdsnduat@gmail.com
(Received : August 9, 2019; Accepted : November 5, 2019)
ABSTRACT
The present investigation was carried out to study the seed
development and maturation in mungbean variety 'IPM 02-
3' to quantify the precise stage of harvesting at which its
maximum yield along with highest viability, vigour and
germination could be achieved. It was observed that the seed
development and maturation were completed within 17-21
days from anthesis depending on the season. The spring
season was more suitable for production of quality mungbean
seed in comparison to rainy and summer. The seed obtained
at either around 20 per cent seed moisture content or 19
days after anthesis showed highest seed weight along with
highest germination, seedling length, vigour index and field
emergence. Thereafter, ageing was noticed which led to
decline in germination, vigour and field emergence. These
findings could be utilized in quality seed production of
mungbean.
Key words: Maturation, Mungbean, Seed development, Vigour
Mungbean (Vigna radiata L. Wilczek), an important
pulse crop, is grown in tropical and sub-tropical parts of
the world. The global mungbean acreage is about 7.3 million
ha and output is about 5.3 million tonnes. India is the world’s
largest producer as well as consumer of mungbean. It
produces about 1.61 million tonnes annually from about
3.38 million hectares, with an average productivity of 474
kg per hectare which is quite low in comparison to average
global grain yield of 730 kg/ha. Mungbean is a potential
source of protein (20-25%) and iron for human nutrition,
fixes atmospheric nitrogen in soil as well green manuring to
supplement the fertility of the soil and also as feed to
animals. Besides, its split and/or whole grains are used to
patients as light and easily digestible diet. Major mungbean
growing states in India are Karnataka, Odisha, Maharashtra,
Andhra Pradesh, Telengana, Bihar, Rajasthan and Uttar
Pradesh. Seed development and maturation are important
because the seeds have to be harvested in time to ensure
good yield accompanied with high viability, vigour and
field performance. The development process during seed
growth and maturity interacts with the production
environments even at micro level to assess the planting
value of the seed (Yadav et al. 2014). It is well established
that seed quality would be highest at physiological maturity
which proceeds harvestable maturity (Harrington 1972).
Besides, there are a number of evidences that seed quality
attained maximum values at even some duration after
physiological maturity (Ellis et al. 1993; Yadav et al. 2019).
Because, the pre- harvest factor of degree of seed maturity
influences the viability and vigour which in turn affect the
potential longevity of seed (Delouche and Baskin 1973;
Yadav et al. 2019). Seed is an essential input for sustained
agriculture production. Use of quality seed alone could
increase productivity by 15-20% indicate the critical role of
seed in agriculture. Farmer’s access to quality seed of
superior varieties is key in increasing agricultural
productivity and production. For any successful quality
seed programme, it is mandatory to produce sufficient
quantity of seed with appropriate research backup on
various aspects of seed technology. Among them,
determining the proper harvest time is a critical aspect in
mungbean seed production owing to its indeterminate
growth habit (Yadav et al. 2014). If the crop is harvested
little bit early, some seed will be immature, light weight,
poor vigour or non viable. If harvest is delayed until all
seeds reach at optimal maturity, much of the earlier maturing
seed fall to the ground or shatter during cutting and
transport, etc. Mungbean is grown in Kharif, rabi and spring/
summer seasons keeping in view its necessity and
production management. Thus, there is a natural response
of crops/ variety to different seasons. Under such a varying
situation, the study on seed development and maturation
of a variety for making the decision to harvest at highest
yield and vigour in each season is important and necessary.
MATERIALS AND METHODS
The present investigation was taken up with
mungbean variety 'IPM 02-3'. The foundation seed of IPM
02-3 was sown in well prepared soil during (Kharif), March
(Spring) and April (Summer) 2019 following standard
package of practices to raise the certified seed. A large
number of flowers were tagged and pods were picked up
after 5, 7, 9, 11, 13, 15, 17, 19 and 21 days of anthesis in each
season. Seeds were separated out from respective pods
very carefully and subjected to determine their moisture
content on dry-wet basis. One thousand seeds with thrice
replicates from already collected seeds at each stage were
again randomly separated, weighed and averaged to record
the test weight. These thrice replicated seeds were
thoroughly mixed in Boerner type divider to ensure
homogeneity. Out of these, 50 seed were placed on moist
24 Journal of Food Legumes 33(1), 2020
blotter paper in 4 replications and placed in BOD incubator
at 22±10C to record the germination and seedling length as
per ISTA Rules (1999). Seedling vigour index was computed
as germination (%) x seedling length (cm). Besides, 100
seeds were placed in soil at 30 x 10 cm apart in 4 replications
and plants survived till 30 days were considered as field
emergence. Data pertaining to moisture content and seed
weight were subjected determine for their Stability
parameters according to Eberhart and Russell (1966).
RESULTS AND DISCUSSION
The seed development and maturation in the terms
of chronological seed moisture content (%) and seed dry
weight (1000-seed weight) at various stages viz., 5, 7, 9, 11,
13, 15, 17, 19 and 21 days after anthesis of mungbean variety
IPM 02-3 during Kharif (A), spring (B) and summer (C) are
Fig. 1. Seed moisture content (%) and dry weight (g) of
mungbean cv. IPM 02-3 at its development and maturation
after 5, 7, 9, 11, 13, 15, 17, 19 and 21 days of anthesis
during Kharif (A), spring (B) and summer (C) seasons, 2019.
depicted in Fig. 1. In general, the seed moisture content
decreased with progressing the stages. In contrary to this,
the seed weight increased with increased the days after
anthesis. The highest seed weight was observed around
19 days after anthesis having about 20-22 per cent moisture
content during Kharif season. During spring season, the
highest seed weight was recorded at around 17 days after
anthesis where moisture content was around 20 per cent.
In the case of summer season, the maximum seed weight
was obtained at about 15 days consisted around 20 per
cent moisture content. It was apparent from present study
that the highest seed weight (here in seed yield) was
attained when seed were reached around 20 per cent
moisture content. The pod maturation appeared from 15 to
19 days from anthesis depending upon the growing season.
During Kharif, the relative humidity and precipitation, etc.
were comparatively higher as compared to spring/summer
season which prolonged the crop duration (Table 4).
Mungbean is a short duration and C3 plant. The plants
utilize the C 3 carbon fixation mechanism as the sole
mechanism to convert CO2 in to an organic compound i.e.,
3-phosphoglycerate. The C3 plants must grow in areas
where CO2 concentration is high, temperature and light
intensity are moderate and soil water content is abundant.
Based on International Mungbean Nurseries, Poehlman
(1978) envisaged that a mean temperature of 20oC might be
minimum for productive growth, with mean temperature in
the range of 28oC to 30oC being optimum. The critical
temperature for mungbean as measured by changes in the
structure and function of cellular membranes was about
15oC (Raison and Chapman 1976). Below 15oC, a thermal
transition occurred in the membrane lipids of mitochondria
and chloroplasts. Another thermal transition occurred just
below 20oC which might be the optimum temperature for
growth. With temperature above 28 oC increases in
transpiration and respiration could offset benefits for
increases in photosynthesis and retard plant growth. The
temperature affects the length of the vegetative growth
phase and the initiation of flowering. Increasing the mean
temperature during the vegetative phase hastens flowering
(Aggarwal and Poehlman 1977; Rawson and Craven 1979).
This progressive acceleration in flowering when expressed
as a rate of progress towards flowering is a linear function
of mean diurnal temperatures (Summerfield and Lawn 1988).
Besides temperature, the flower initiation being delayed by
increases in the length of the photoperiod (Allard and
Zaumeyer 1944; Rawson and Craven 1979). The
photoperiod differs at different latitudes. Mungbean
genotypes differ in response to photoperiod. All the
genotypes usually flower in photoperiods of 12-13 hours.
In the field, photoperiod response cannot be dissociated
from other environmental responses including temperature.
Temperature affects the length of period needed for flower
development. Generally, a higher mean temperature will
hasten flowering, or a low mean temperature will delay
 Yadav et al. : Seed development and maturation behaviour of mungbean 25

flowering, at all photoperiods. Days to flowering increase
with an increasing photoperiod. Seed from summer season
develop comparatively rapidly than those from Kharif and
spring seasons. As expected, rate of progress from flowering
to the first ripe pod and crop maturity was dependent on
photoperiod, temperature and moisture availability (Yeates
et al. 2000). Further, soil drought stress reduced vegetative
growth and the initiation and retention of floral buds (Ali
and Alam 1973) and seed yield (Varma and Rao 1975).
Importance of avoiding drought stress immediately before
and during the flowering period if optimum yield is to be
obtained (Chiang and Hubbel 1978; Trung et al. 1985). Soil
water deficits hastened flowering, reduced the length of
flowering and pod filling periods, and reduced seed yield.
On the other hand, mungbean plants are readily damaged
by heavy rains and windstorms. The incidence of foliar
diseases is increased with high humidity. Prolonged rainy
periods during pod ripening may result in molding of the
seed, or even sprouting of the seed in the pods as mungbean
does not possess seed dormancy. The phenology of
mungbean is extremely plastic; responsiveness to
photoperiod, temperature and soil moisture stress. Thus, it
is apparent from present study that seed development and
maturation behaviour of mungbean is reflected over seasons
as the components of weather of each season were
considerably varied.
The germination percentage and field emergence
percentage of mungbean as obtained at its various stages
of development and maturation during Kharif, spring and
summer are presented in Table 1. It is obvious that the
germination is an important attribute of quality seed. If the
seed lot does not meet the minimum standard of germination,
the seed lot is not being treated under the category of
quality seed. As per Indian Minimum Seed Certification
Standard, the minimum seed germination standard of
mungbean seed is 75 per cent. If the germination percentage
in any seed of mungbean is less than 75 percent, the said
seed will not be considered as seed. As such the seed
obtained after 15 days anthesis only showed the
germination percentage above to 75 per cent. Though, the
maximum germination varied with respect to growing
season. The maximum germination percentage was
observed at 19 and 17 days after anthesis during Kharif
and spring/summer, respectively. Thereafter, the
germination was in reduction mode which might be due to
ageing effect (Delouche and Baskin 1973; Yadav et al. 2019).
Hamid et al. (1995) also reported that seed of most
mungbean genotypes exhibited over 90 per cent
germination between 15 and 19 days after anthesis and
germination rate declined at 21 days after anthesis as the
moisture content dropped to 8-9 per cent. The leakage of
solutes including electrolytes, from seed into water can be
detected by measurement of the electrical conductivity of
seed leachates. The level of leakage is influenced by the
stage of seed maturation at harvest, the degree of seed
ageing and the incidence of imbibitions damage. Leaching
of solutes from seed occurs naturally during the early stages
of germination (Powell 1986). The field emergence also
showed almost similar trend although, the magnitude of
field emergence was less in comparison to germination
percentage. These findings were further confirmed on the
basis of their seedling length and vigour index. It can be

Table 1. Germination and field emergence of seed developed and mature during kharif, spring and summer in mungbean
Days after Seed germination (%) Field emergence (%)
anthesis Kharif Spring Summer Mean Kharif Spring Summer Mean
5 Seedlings not developed as per ISTA
7 9.23 12.64 10.81 10.89 4.23 7.34 5.32 5.63
9 25.54 40.43 35.17 33.71 9.54 12.43 10.32 10.76
11 41.53 55.12 46.55 47.73 17.23 21.67 19.84 19.58
13 64.23 71.19 70.53 68.65 38.76 40.65 39.84 39.75
15 76.87 83.54 85.47 81.96 51.23 58.67 52.64 54.18
17 83.65 92.85 86.57 87.69 70.87 75.94 70.62 72.48
19 90.98 89.74 83.45 88.06 77.34 83.25 78.54 79.71
21 85.43 86.75 80.28 84.15 81.35 80.13 75.19 78.89
C.D. (0.05) 6.38 6.07 5.59 5.82 4.75 4.21 3.98 4.23

Table 2. Seedling length and vigour index of seed developed and mature during kharif, spring and summer in mungbean
Days after Seedling length (cm) Vigour Index
anthesis Kharif Spring Summer Mean Kharif Spring Summer Mean
5 Seedlings not developed as per ISTA
7 5.71 6.32 7.42 6.48 52.70 79.88 80.21 70.93
9 7.15 9.65 10.72 9.17 182.61 390.15 377.02 316.59
11 11.36 14.84 15.27 13.82 471.78 817.98 710.82 666.86
13 15.64 19.67 18.28 17.86 1004.56 1478.99 1289.29 1257.61
15 18.54 22.34 22.48 21.12 1425.17 1866.28 1921.37 1737.60
17 21.94 24.90 21.65 22.83 1835.28 2311.97 1874.24 2007.16
19 24.54 23.98 21.94 23.49 2303.63 2151.97 1830.89 2095.49
21 22.76 21.23 19.83 21.27 1944.39 1841.70 1591.95 1792.68
C.D. (0.05) 2.84 2.63 2.47 2.53 253.45 231.49 215.37 212.42
26 Journal of Food Legumes 33(1), 2020

Table 3. Stability parameters of seed development and maturation in mungbean

Days after anthesis Seed moisture content (%) 1000 seed weight (g)
b S2d b S2d
5 78.34 1.04 0.97 6.51 0.97 1.54
7 67.69 0.92 1.53 8.33 0.96 1.72
9 56.09 0.91 1.17 13.31 1.57 0.54
11 44.10 1.22 0.64 21.95 0.88 0.49
13 35.11 1.15 0.21 27.82 0.87 0.23
15 25.57 0.98 0.07 34.92 1.02 0.16
17 20.94 1.01 0.09 35.64 1.05 0.05
19 18.81 0.91 0.12 34.30 0.98 0.12
21 16.54 0.89 0.23 34.16 0.88 0.34

Table 4. Mean temperature, relative humidity and rainfall during spring (March-May), summer (April-June) and Kharif
(July-September) crop season 2019
Month Average Temperature Average Relative Average
(oC) Humidity (%) Rainfall (mm)
Range Mean Range Mean Range Mean
March 15.00-29.50 21.60 53.00-81.50 64.4 0.00-5.00 0.16
April 23.50-33.25 28.67 42.50-75.50 59.15 0.00-2.00 0.06
May 30.75-34.50 32.90 36.00-60.50 46.95 0.00-0.00 0.00
June 28.25-35.75 32.86 40.00-77.00 55.42 0.00-11.00 0.80
July 25.50-33.25 29.89 56.00-99.00 80.27 0.00-120.70 12.79
August 26.25-31.50 29.70 72.00-97.00 80.32 0.00-39.20 3.97
September 23.25-31.00 28.13 78.00-94.50 86.90 0.00-65.00 13.20

seen from the results presented in Table 2 that these ACKNOWLEDGEMENT

parameters varied with respect to season and the crop be
harvested accordingly in order to obtain highest yield with
vigourous seed in mungbean.
In order to confirm the stable or in other word to
analyze the more precise stage of development and
maturation of mungbean at which more vigourous seed
could be obtained over season, the stability parameters of
seed moisture content and seed weight were also attempted
(Table 3). The Eberhart and Russell (1966) model has been
applied in identifying the most important characteristics of
seedling (Yadav 2015). According to Eberhart and Russell
(1966), a stable variety/entity is one which shows a high
mean value ( X ), regression coefficient (b) around unity
and mean square deviation from regression (S2d) nearly
zero. Thus, the seed obtained at either 19 days after anthesis
or around 20 per cent moisture content indicated their
stability over environments.
Keeping above findings in view, it is imperative to
conclude that the spring season was more suitable
environment for production of high quality of mungbean
seed in comparison to its Kharif and summer. The seeds
obtained at either around 20 per cent seed moisture content
or 19 days after anthesis showed maximum physiological
potential in the terms of seed weight, germination, seedling
length, vigour index and field emergence. Thereafter, ageing
was also noticed which led to decline in germination, vigour
and field emergence. These findings can be utilized in
quality seed production of mungbean.
Authors are grateful to the Indian Council of
Agricultural Research, New Delhi for financial assistance
during the course of study.
REFERENCES
Aggarwal VD and Poehlman JM. 1977. Effects of photoperiod and
temperature on flowering in mungbean (Vigna radiata (L.)
Wilczek). Euphytica 26: 207-219.
Allard HA and Zaumeyer WJ. 1944. Response of beans (Phaseolus)
and other legumes to length of day. Technical Bulletin 169622.
United States Department of Agriculture, Economic Research
Service.
Ali A and Alam K. 1973. Effect of soil moisture stress on some
growth characters of mung (P. vulgaris). Pakistan Journal of
Science Research 25: 255.
Chiang MY and Hubbel JN. 1978. Effect of irrigation on mungbean.
Proceedings 1 st International Mungbean Symposium. Asian
Vegetables Research and Development Center, Shanhua, Taiwan.
Delouche JC and Baskin CC. 1973. Accelerated aging techniques for
predicting the relative storability of seed lots. Seed Science and
Technology 1: 427-452.
Eberhart SA and Russell WA. 1966. Stability parameters for
comparing varieties. Crop Science 6: 36-40.
Ellis RH, Hong TD and Jacson MT. 1993. Seed production
environment, time of harvest and potential longevity of seeds
of three cultivars of rice (Oryza sativa L.). Annals of Botany
72: 583-590.
Hamid A, Hashem A, Miah A and Nag BL. 1995. Seed development,
quality, maturity synchrony and yield of selected mungbean
genotypes. Seed Science and Technology 23(3): 32-35.
 Yadav et al. : Seed development and maturation behaviour of mungbean
Harrington JF. 1972. Seed storage longevity. In: Seed Biology (ed.)
TT Kozlowski, New York, Academic Press 3: 142-245.
ISTA. 1999. International Rules for seed testing. Seed Science and
Technology 27: 285-297.
Poehlman JM. 1978. What we have learnt from the International
Mungbean Nurseries. Proceedings 1 st International Mungbean
Symposium. Asian Vegetables Research and Development Center,
Shanhua, Taiwan.
Powell AA. 1986. Cell membranes and seed leachate conductivity in
relation to the quality of seed for sowing. Journal of Seed
Technology 10: 81-100.
Raison JK and Chapman EA. 1976. Membrane phage changes in
chilling-sensitive Vigna radiata and their significance to growth.
Australian Journal Plant Physiology 3: 291-299.
Rawson HM and Craven CL. 1979. Variation between short duration
mungbean cultivars (Vigna radiata (L.) Wilczek) in response to
temperature and photoperiod. Indian Journal of Plant
Physiology 22: 127-136.
Summerfield RJ and Lawn RJ. 1988. Environmental modulation of
flowering in mungbean (Vigna radiata): further reappraisal for
diverse genotypes and photo thermal regimes. Experimental
Agricultural 24: 75-88.
Trung BC, Yoshida S and Kobayashi Y. 1985. Influence of soil
moisture stress on the nitrogen nutrition and grain productivity
of mungbean. Japanese Journal of Crop Science 54(1): 72-78.
27
Varma AK and Rao NSS. 1975. Effect of different levels of soil
moisture on growth yield and some physiological aspects of
nodulation in green gram. Indian Journal of Agricultural Sciences
45: 11-16.
Yadav RDS. 2015. Studies on stability of seedling characteristics in
rice. International Journal of Applied and Pure Science and
Agriculture 1(11): 19-21.
Yadav RDS, Chaudhary, RK and Kushwaha GD. 2024. Effect of
sowing time, spacing and seed treatments with rhizobium and
phosphate solubilizing bacteria on seed yield, its contributing
traits and seed quality parameters in mungbean (Vigna radiata)
(L.) Wilczek). Journal of Research in Agriculture and Animal
Science 2(8): 01-05.
Yadav RDS, Singh RK, Dheer Vineet and Tripathi RM. 2020. Effect
of harvest stages on seed yield and its quality in chickpea (Cicer
arietinum L.). International Journal of Chemical Studies 8 (In
Press).
Yadav RDS, Singh RK, Purshottam Giri SP and Rai M. 2019. Studies
on seed development and harvesting stages and their impact for
maintenance of seed vigour in rice (Oryza sativa L.).
International Journal of Chemical Studies 7(4): 1135-1138.
Yeates SJ, Lawn RJ and Adkins SW. 2000. Prediction of weather
damage of mungbean seed in tropical Australia. 1. Relation
between seed quality, weather and reproductive development.
Australian Journal of Agricultural Research 51(5): 637-648.
Journal of Food Legumes 33(1): 28-35, 2020

Improving chickpea productivity in rice-fallow of Indo-Gangetic Plain with soil

moisture conservation and cultivar selection
NARENDRA KUMAR, SS SINGH1, PK GHOSH2, KK HAZRA, MS VENKATESH3, CS PRAHARAJ,
MK SINGH4, M SENTHIL KUMAR, PS BASU, A YADAV, SL YADAV, S SINGH and NP SINGH
ICAR-Indian Institute of Pulses Research, Kanpur – 208 024, Uttar Pradesh, India; 1Rani Lakshmi Bai Central
Agricultural University, Jhansi-284 003, Uttar Pradesh, India; 2ICAR-National Institute of Biotic Stresses
Management, Raipur-493 225, Chhattisgarh, India; 3Regional Station, ICAR-Indian Institute of Pulses Research,
Dharwad-580 005, Karnataka, India; 4ICAR-Indian Institute of Sugarcane Research, Lucknow-226 002, India;
Email: narendra.kumar1@icar.gov.in
(Received : December 8, 2019; Accepted : February 8, 2020)
ABSTRACT
Rice fallows offer an extensive scope for cropping
intensification in the country. Presently, the grain legumes
or pulses are recommended for sustainable intensification
of rice-fallows. An experiment was carried out (2011-2013)
to evaluate the effect of preceding rice cultivars and soil
moisture conservation practices on chickpea productivity in
rice-fallow condition. The treatments comprised of two levels
of rice cultivars [Pant Dhan 12, local tall cultivar), three
levels of residue management treatments (residue removal,
rice straw mulching, and retention of (~ 20 cm) rice stubbles),
and two levels of chickpea cultivars (JAKI 92-18, DCP 92-3),
fitted in split-split plot design with three replications. Rapid
depletion soil moisture was observed in the surface soil (0-
15 cm) after rice harvest. Rice straw mulching increased the
chickpea grain yield by 6-14% (p < 0.05) over residue removal,
whereas the effect of stranding stubble was marginal. The
increased chickpea yield with straw mulching was primarily
attributed to the higher soil moisture, favorable soil
temperature, and reduced crop-weed competition. The early
harvesting of rice variety Pant Dhan 12 had advanced the
chickpea crop establishment (15-18 days) over the late local
rice cultivar that facilitated efficient use of the residual soil
moisture, leading to the higher chickpea yield by 11-16% (p
< 0.05). Higher relative water content was observed in
chickpea following rice variety Pant Dhan 12 and straw
mulching. Increased chickpea yield was primarily attributed
to an increase in shoot and root biomass, nodulation, and
number of pods plant-1. The performance of early and high
biomass chickpea variety JAKI 92-18 was superior over DCP
92-3 under rice-fallow condition. Thus, the early maturing
rice cultivar followed by early and high biomass producing
chickpea cultivar with rice straw mulching in chickpea could
improve the chickpea its system productivity, and thereby
improve the farmers’ income in rice-fallows.
Key words: Chickpea, Economics, Energy budgeting, Relative
water content, Rice straw mulching, Rice fallow
Now days, rice-fallow areas are targeted for cropping
intensification in south Asia (Kumar et al. 2019a). In India,
approximately 30% of rice growing areas (11.7 m ha) remains
fallow during the post-rainy seasons (DAC 2011; Hazra
and Bohra 2020). Hence, there is an extensive scope to
include a winter crop in rice-fallows through right selection
of crop/cultivar and soil moisture conservation practices
(Ghosh et al. 2014; Kumar et al. 2016a). However, inclusion
of winter crop in rice-fallows is largely challenged by several
biotic and abiotic factors (Kumar et al. 2016b). Non-
availability of irrigation sources, fast depletion of soil
residual moisture, uncertainty in rainfall, and soil related
constraints are major stumbling blocks including a post-
rainy season crop in the rice-fallows (NAAS 2013).
Pulses or grain legumes, with their unique
characteristics such as low-input requirement, deep roots
and higher soil moisture extraction potential, ability to
establish with surface seeding, could be the key crops for
cropping intensification in rice-fallows (Ali et al. 2014; Kumar
et al. 2018). Nevertheless, the productivity potential of post-
rainy crops in rice-fallows is essentially depends on residual
soil moisture availability and water use efficiency of the
crop, and tolerance to biotic stresses (Ghosh et al. 2016).
So, conservation of the residual soil moisture likely to
improve the productivity of winter crop in rice-fallows (Kar
et al. 2004). Zero-tillage with crop residue retention increases
the soil moisture storage and increase the winter crop
productivity (Kumar et al. 2019b; Nandan et al. 2019). In
rice-fallow areas, farmers mostly grow the long duration
rice cultivars that delay the sowing of winter crop/s; thus,
the crop often expose to the terminal moisture stress.
Therefore, advancing the sowing of winter crop taking early
maturing rice cultivars could be a strategic intervention in
rice-fallow areas. Further, early biomass accumulating
cultivars of legume may have an advantage over low
biomass cultivar.
Therefore, an experiment was designed and executed
during the year 2011-2013 to evaluate the effect of crop
residue management as soil moisture conservation practices
and cultivar combination of component crops on soil
moisture storage and performance of chickpea crop in rice-
fallows. Comparative assessment of two maturity group
rice cultivars (early and late cultivars) and two chickpea
cultivars (high and medium biomass) was made to
characterize appropriate cultivar combination option for
rice-fallow conditions. Hence, the information of the study
will be useful in promoting pulses in rice-fallows.
 Kumar et al. : Improving chickpea productivity in rice-fallow of Indo-Gangetic Plain
MATERIALS AND METHODS
Site characteristics: A Field experiment was conducted at
main experimental farm of ICAR-Indian Institute of Pulse
Research (ICAR-IIPR), Kanpur, India during 2011-2013. The
climate of experimental site is tropical sub-humid; receives
722 mm rainfall annually, and the mean annual maximum
and minimum temperature is 33.0oC and 20.0oC, respectively.
The weather variables during the cropping seasons are
presented in Figure 1. The soil of experimental farm is sandy-
loam in texture and belongs to the taxonomical class Typic
Ustochrept (Inceptisol) (Table 1), bulk density 1.39 g cc-1,
soil pH 8.2.
2011-12
2012-13
Fig 1. Weekly rainfall (mm), minimum and maximum ambient
temperature (0C) during the rice-chickpea cropping season of
2011-12 and 2012-13.
(a)
Fig 2. Field view chickpea crop with mulching (a) and standing rice stubble retention (b)
29
Treatment details: Treatments comprised of three main
factors (rice cultivars, rice residue management, and
chickpea cultivars) fitted in split-split plot design (2×3×2)
with three replications. Main plots consisted of two rice
cultivars [long duration local rice cultivar and early maturing
Pant Dhan-12 (PD 12)], three residue management practices
as sub-plot treatment viz., residue removal, rice straw mulch
and standing rice stubbles (~ 20 cm) and two chickpea
cultivars as sub-sub plot treatment viz. JAKI 92-18 (early
high biomass producing cultivar) and DCP 92-3 (medium
biomass producing cultivar). The dimension of the each
sub-sub plot was 7 m ×10 m (70 m2). In residue removal and
mulch treatment, the rice crop was harvested at ~ 5 cm
above ground as commonly practiced by farmers. For
standing stubbles treatment, rice crop was harvested at ~
20 cm above ground. Under rice mulch treatment, the total
rice straw was uniformly spread over soil after sowing of
the winter crop (Fig 2).
Crop management: For rice crop, the field was prepared
by two passes of harrow followed by one wet-tillage
(puddling with rotavator). Both the rice cultivars were sown
the same time, and 21-25 days rice seedlings were
transplanted in the main field. Two seedlings per hill were
transplanted following a planting geometry of 20 cm × 20
cm. The recommended fertilizer rate (120:60:40 kg N: P2O5:
K2O ha-1) were applied to rice crop. Rice cultivar PD 12 was
harvested during 3 rd week of October. Subsequently,
chickpea after PD-12 was sown during third week of October.
Local rice was harvested during 8-12 November and
chickpea after local rice was sown during second to third
week of November. Chickpea was sown by manual Zero-till
Seed Drill developed by ICAR-IIPR. Chickpea was grown
completely on residual soil moisture and no supplemental
irrigation was given. At pod development stage of chickpea,
foliar spray of 2% urea solution was applied using Knap-
sack sprayer.
(b)
30 Journal of Food Legumes 33(1), 2020

Fig. 3: Soil moisture [log (% v/v)] dynamics under different residue management practices during chickpea growing seasons (2011-
2012 and 2012-13)
 Kumar et al. : Improving chickpea productivity in rice-fallow of Indo-Gangetic Plain 31

Fig 4. Soil temperature ( 0C) in morning (8:30 am) and

evening (4:30 pm) as influenced by different residue
management practices during chickpea growing
season.
Table 1. Physico-chemical properties of surface soil (0-20 cm) at
the initiation of the experiment a Fig 5. Effect of preceding rice cultivar and residue
management on relative water content (RWC) of
Parameter Value
chickpea.
Soil texture Sandy-loam
Bulk density (Mg/m3) 1.39
pH (1:2.5 soil: water) 8.22 cm to estimate soil moisture at corresponding depth
EC (dS/m) 0.25 simultaneously. Soil thermometers were installed to measure
Soil organic C (g/kg) 2.90 the soil temperature of 0-30 cm under different residue
Available-N (kg/ha) 243.0 management treatments. In a day, the soil temperature data
Olsen-P (kg/ha) 17.5
were recorded twice at morning (8:30 am) and evening (4:30
Available-K (kg/ha) 199.1
pm) time.
Determination of soil moisture: In the year 2011-2012, the Relative water content (RWC): Five fully developed leaves
soil moisture was determined by gravimetric method. Soil from top of the chickpea plant were collected at 12:00 h for
samples from different soil depth (0-15, 15-30, 30-45, and measuring the RWC. The RWC was calculated taking the
45-60 cm) were collected in aluminium moisture boxes from fresh, turgid, and oven dry weights of leaves according to
each plot at fifteen days interval. The soil samples were the method given by Jiang and Huang (2001) as follows:
dried in oven at 105oC for 72 h. Based on soil fresh and Fresh weight of leaves − Oven dry weight of leaves
RWC (%) = × 100
oven dry weights, moisture content was calculated and Fully turgid weight of leaves − Oven dry weight of leaves
expressed in percentage (eq. 1). - eq. 2
ℎ ℎ − ℎ
(%) = ⨯ 100 Economics and energy budgeting: The economics of the
ℎ
variable production systems was computed on the basis of
- eq. 1 prevailing market price of inputs and outputs in Indian
During the second year of study (2012-2013), soil rupees (INR). The total cost of cultivation of component
moisture was recorded using the TDR soil moisture meter crops was calculated on the basis of different operations
(model Delta-T Devices Ltd; Cambridge, UK). In PR2 probe, performed and input used for raising the crop including the
soil moisture sensor was fitted at 10, 20, 30, 40, 60 and 100 cost of tillage, sowing, labours, fertilizers, seeds, crop
32 Journal of Food Legumes 33(1), 2020

Table 2. Effect of preceding rice cultivar, residue management, and chickpea cultivar on crop growth and yield attributes of
chickpea in rice-fallow (pooled data)

Treatment pH NL NDW AGDW RDW DMA PPP TGW

30DAS 60 DAS 90 DAS 30DAS 60 DAS 90 DAS 30DAS 60 DAS 90 DAS
Rice cultivar
Local rice 39.8 79.4 0.17 0.34 0.61 0.52 1.46 2.09 0.15 0.31 0.36 21.6 43.3 168
Pant Dhan 12 45.2 102.2 0.20 0.38 0.69 0.84 2.61 3.36 0.19 0.36 0.47 29.4 45.2 170
LSD (p = 0.05) 3.3 13.1 0.03 ns 0.07 0.18 0.43 0.41 ns 0.04 0.06 3.7 1.9 ns

Residue management
Residue removal 41.2 85.8 0.17 0.33 0.56 0.59 1.85 2.53 0.15 0.26 0.37 22.3 41.4 192
Mulch 45.3 98.6 0.19 0.38 0.70 0.77 2.33 2.93 0.20 0.43 0.46 28.3 48.9 193
Standing stubble 41.5 87.8 0.19 0.37 0.68 0.67 1.93 2.72 0.17 0.35 0.43 26.0 42.5 193
LSD (p = 0.05) 3.6 6.3 ns 0.04 0.07 0.10 0.24 0.26 0.05 0.11 0.07 3.2 2.3 3.5

Chickpea cultivar
Jaki 92-18 42.5 94.4 0.22 0.43 0.73 0.71 2.22 2.89 0.20 0.38 0.45 27.1 42.5 192.9
DCP 92-3 42.0 87.3 0.15 0.29 0.55 0.64 1.85 2.58 0.17 0.29 0.39 23.9 47.0 145.0
LSD (p = 0.05) ns 6.2 0.04 0.09 0.08 ns 0.34 0.21 ns 0.08 0.06 2.1 3.5 12.6
pH-plant height (cm); NL-number of leaves; NDW-nodule dry weight (g plant -1 ); AGDW-aboveground dry weight (g plant -1 ); RDW- root dry
weight (g plant-1 ); DMA-above ground dry matter accumulation (unit); PPP-number of pod per pant; TWG-thousand grain weight † DAS

Table 3. Grain yield of rice, chickpea and system productivity (rice equivalent yield) as influenced by cultivars and residue
management practices
Treatment 2011-2012 2012-2013
Rice Chickpea REY Rice Chickpea REY
Rice cultivar
Local rice 47.0 20.2 92.6 43.1 13.7 73.9
Pant Dhan 12 49.4 22.4 99.8 44.7 15.9 80.4
LSD (p = 0.05) 2.0 1.1 3.4 1.1 1.1 4.1

Residue management
Residue removal 47.8 20.0 92.7 43.9 14.3 76.2
Mulch 48.6 22.7 99.6 44.3 15.1 78.4
Standing stubble (30 cm) 48.2 21.3 96.1 43.4 14.8 76.8
LSD (p = 0.05) NS 1.5 4.7 NS 0.7 2.1

Chickpea cultivar
Jaki 92-18 47.9 22.1 97.5 44.2 12.2 71.7
DCP 92-3 48.5 20.5 94.7 43.7 17.3 82.7
LSD (p = 0.05) NS 1.4 2.3 NS 1.8 4.3
RCY: Rice Equivalent Yield

Table 4. Total weed counts and weed biomass in chickpea crop at 40 DAS as influenced by different treatments (pooled data)
Treatment Weeds Number (Numbers m-2) Weed dry weight (g m-2)
Rice cultivar
Local rice 281 52.9
Pant Dhan 12 234 37.4
LSD (p = 0.05) 31 9.2

Residue management
Residue removal 492 106.6
Mulch 532 75.9
Standing stubble (30 cm) 522 88.5
LSD (p = 0.05) 19 7.9

Chickpea cultivar
Jaki 92-18 549 81.4
DCP 92-3 481 99.3
LSD (p = 0.05) 33 11.3
 Kumar et al. : Improving chickpea productivity in rice-fallow of Indo-Gangetic Plain 33

Table 5. Economics and energy productivity as influences by different crop management practices (calculated on mean values)
Treatment Net Return (INR) B: C ratio Energy productivity Energy use
2011-12 2012-13 2011-12 2012-13 Rice Chickpea efficiency
Rice cultivar
Local rice 76552 50215 2.42 1.93 0.255 0.182 8.22
Pant Dhan 12 86927 59342 2.61 2.10 0.287 0.195 8.84

Residue management
No-residue 76148 49431 2.41 1.92 0.251 0.179 8.34
Mulch 88335 59616 2.64 2.10 0.292 0.196 8.70
Stubble 80165 55399 2.48 2.03 0.271 0.185 8.49

Chickpea cultivar
Jaki 92-18 83601 47129 2.55 1.87 0.264 0.187 8.54
DCP 92-3 79488 62515 2.47 2.16 0.278 0.188 8.48

residues etc (Nandan et al. 2018). The net return was due to standing stubbles helps in protecting the soil
calculated as: moisture loss (Kumar et al. 2006; Patil et al. 2013), which
Net return (INR) = Gross return - Cost of cultivation - eq.3 was not evident in this study.

Energy budgeting was calculated considering the
energy input through fertilizers, seeds, plant protection
chemicals, fuels, human labor and machinery power and
whereas output consists of both main and by-products of
the crops. Inputs and outputs were converted from physical
to energy unit measures through published conversion
coefficients (Singh et al. 2008).
Statistical analysis: The significant of treatment effect was
determined using F-test. Analysis of variance was
performed using online statistical program OPSTAT.
Comparisons of treatment mean values were performed
using least significant difference (LSD, p = 0.05).
RESULTS AND DISCUSSION
Soil moisture and temperature dynamics: The residual
soil moisture is the most important factor that strongly
influences the performance of winter crop in rainfed agro-
ecosystems. During both the years, soil moisture content
after rice harvest was fairly good (16-20%), which was ~ ¾
of the field capacity (23.4 ± 0.2%). The soil moisture
depleted sharply at initial growth period of chickpea (Fig
3). In the surface soil (0-15 cm), 33-50% depletion in soil
moisture was observed within 45 days to sowing. However,
the deeper soil depths had sufficiently higher soil moisture
content. Notably, the chickpea sowing after medium duration
cv. PD 12 was advanced the chickpea sowing by 15-18 days
as compared to local rice cultivar. The early sowing of
chickpea following cv. PD 12 had 10-13% higher soil moisture
in the surface soil during the initial growth stages. Rice
straw mulching conserved the higher soil moisture over
residue removal; while, moisture conservation potential of
standing rice stubble in this study was comparatively
marginal. Indeed, the re-growth of standing rice stubbles
led to significant amount of moisture loss and thus, the
advantage of residue retention for moisture conservation
was not likely to be observed in this study. Generally, the
shading effect and restricted air movement near soil surface
Up to 60 days after sowing (DAS) of chickpea, the
soil moisture content was found in the treatment order of
mulching > standing stubble > residue removal. At the time
of chickpea harvest, straw mulching treatment had
maintained the higher soil moisture over residue removal
and stubble retention treatments, confirmed the potential
of mulching for soil moisture conservation. The rainfall
event during the study period was unexpectedly differed
from the normal. During 2011-2012, a higher amount of
rainfall received during January (49 mm in the 1st week and
7.4 mm in the 2nd week). Similarly, during 2012-2013, 6.4 mm
rainfall was received during the 3rd week of January and
rainfall was received during the month of February also
(115 mm during 6th, 7th and 8th meteorological week) (Fig 1).
Therefore, we failed to get the terminal soil moisture stress
at later stages of chickpea. Despite this, if we extrapolate
the initial soil moisture trend (up to 60 DAS), surely the
crop might have faced severe soil moisture stress at later
stages with normal rainfall events. Interestingly, it was
observed that the soil temperature during the initial crop
growth stages is substantially improved with straw mulching
and standing stubble over residue removal (Figure 4),
indicating that the mulching or residue retention could
modify the soil micro-environment by modifying the soil
temperate regime and growth of winter crops in rice-fallows.
Relative water content (RWC): Relative water content was
estimated as an indicator of plant moisture status with
response to variable soil moisture content (Kalariya et al.
2015). The RWC data was recorded at three crop stages viz.
30, 60 and 90 DAS of chickpea, which coincides with the
critical crop growth stages viz., branching, flowering and
pod development stages, respectively. The data
demonstrated that chickpea after PD 12 had relatively higher
RWC over the chickpea plant sown after local rice cultivar
(Fig 5). Likewise, higher RWC values were registered in the
straw mulch treatment and least was measured in residue
removal treatment. Plant water content has direct relation
with soil moisture (Kumari and Sairam 2013). The higher
34 Journal of Food Legumes 33(1), 2020
RWC in chickpea with mulch was primarily attributed to the
higher soil moisture content in mulch treatment. The
findings are also in consistence with Rahimia et al. (2010).
Chickpea crop growth and yield attributes: Early sowing
of chickpea after cv. PD 12 resulted in higher shoot dry
weight (61- 79%), leaf numbers (24-40%) and root dry weight
(13-31%) and pod plant-1 (Table 2). The higher nodule
number and nodule biomass were also recorded in the
chickpea crop following cultivar PD 12 over local rice
cultivar. Improvement in chickpea growth attributes
possibly has a direct relation with soil moisture and plant
water balance under early planting of chickpea after cultivar
PD 12 and the results are in accordance with the findings of
Singh et al. (2002).
Irrespective of the cultivar effect, the higher above
ground biomass of chickpea was recorded in straw mulch
plots, which was 31%, 22% and 16% higher over residue
removal at 30, 60, and 90 DAS, respectively. Straw mulching
and rice stubble treatments increased the chickpea
nodulation over residue removal. The increased nodulation
might be associated to better root development and higher
soil moisture over residue removal. Besides this, the straw
mulching resulted in the higher number of pods plant-1,
which was 18% higher over residue removal. Thus, the
results demonstrate that the straw mulching is much
effective in conserving the soil moisture over standing
stubble treatment. In rice fallow condition, the performance
of chickpea cultivar JAKI 92-18 was superior over cultivar
DCP 92-3 during 2011-2012. The higher shoot (9-11%) and
root weight (15-31%), was observed in cultivar JAKI 92-18
over cultivar DCP 92-3. Likewise, the nodule number and
biomass was also recorded higher (p < 0.05) in cultivar
JAKI 92-18 over cultivar DCP 92-3.
Grain yields, production economics and energy
productivity: Early crop establishment of chickpea after
rice cultivar PD 12 increased the chickpea grain yield by 11-
16% as compared to chickpea after local rice cultivar (Table
3). The increased yield of chickpea was attributed to the
higher soil moisture and thus the crop might have effectively
utilized the carry over soil moisture leading to higher initial
biomass accumulation and yield at the end. Results revealed
that only mulching treatment increased the chickpea grain
yield (p < 0.05). However, the effect of standing rice stubble
on chickpea grain yield was non-significant when compared
with residue removal. Our results demonstrated that the
combined effect of the higher soil moisture, favourable soil
temperature, and reduced crop-weed competition (Table 4)
in the straw mulching treatment effectively translated to
higher grain yield in chickpea. The higher productivity of
cultivar JAKI 92-18 was associated with early biomass
accumulation. In contrast, during the 2nd year of experiment,
the performance of cultivar JAKI 92-18 was far lower
compared to DCP 92-3. In second year (2012-2013), the
abnormal rainfall events strongly influenced the productivity
of cultivar JAKI 92-18 as the rainfall coincided with
flowering time of cultivar JAKI 92-18.
Results further demonstrated that rice straw mulching
and early maturing rice cultivar followed by high biomass
chickpea cultivar could upscale the profit margin in rice-
fallow condition. The data on net return and benefit cost
ratio was found much higher for these treatments (Table 5).
The higher energy use efficiency was observed with residue
retention (straw mulch in particular) and growing of early
rice cultivar PD 12 over local rice cultivar. Thus, the study
recommended that the combination of early duration rice
cultivar followed by early high biomass chickpea cultivar
with rice straw mulching could improve chickpea
productivity and farmers profitability in rice-fallows. There
is need to assess more combinations of rice and chickpea
cultivars to optimize the system productivity and to upscale
the performance of chickpea in rice-fallows.
ACKNOWLEDGEMENT
The work was funded by ICAR National Agricultural
Science Fund (NASF).
REFERENCES
Ali M, Ghosh PK and Hazra KK. 2014. Resource conservation
technologies in rice fallow. Resource Conservation Technology
in Pulses, (Eds: Ghosh PK, Kumar N, Venkatesh MS, Hazra KK,
Nadarajan N). Scientific Publishers, New Delhi, India. Pp 83-
88 .
DAC. 2011. Fourth advance estimates of food grain production in
India. Deptt. of Agriculture and Cooperation, Ministry of agricul-
ture, GOI.
Ghosh PK and Hazra KK. 2014. Constraints, issues and opportunities
of RCT in pulse based cropping systems. Resource Conservation
Technology in Pulses, (Eds: Ghosh PK, Kumar N, Venkatesh
MS, Hazra KK, Nadarajan N). Scientific Publishers, New Delhi,
India. Pp 18-30.
Ghosh PK, Hazra KK, Nath CP, Das A and Acharya CL. 2016.
Scope, constraints and challenges of intensifying rice (Oryza
sativa) fallows through pulses. Indian Journal of Agronomy, 61
(4th IAC Special Issue): S122-S128.
Hazra KK and Bohra A. 2020. Increasing Relevance of Pulse Crops
to Sustainable Intensification of Indian Agriculture. National
Academy of Science Letters, India (in Press).
Jiang Y and Huang B. 2001. Physiological Responses to Heat Stress
Alone or in Combination with Drought: A Comparison between
Tall Fescue and Perennail Ryegrass. Horticultural Science 36:
682-686.
Kalariya KA, Singh AL, Chakraborty K, Patel CB and Zala PV.
2015. Relative water content as an index of permanent wilting
in groundnut under progressive water deficit stress. Electronic
Journal of Environmental Science 8(1): 17-22.
Kar G, Singh R and Verma HN. 2004. Productive and profitable
management of rainfed lowland rice through intensive cropping
and efficient water use. WTCER Bhubaneswar Res Bulletin 17: 56.
Kumar N, Chandra S and Srivastva AK. 2006. Mulching: An effective
tool for sustainable agriculture in rainfed farming. Indian Farmers’
Digest 39(6): 30-33.
 Kumar et al. : Improving chickpea productivity in rice-fallow of Indo-Gangetic Plain
Kumar N, Hazra KK, Nath CP, Praharaj CS and Singh U. 2018.
Grain legumes for resource conservation and agricultural
sustainability in south Asia. In: Legumes for soil health and
sustainable management, Pp 77-107, Springer, Singapore.
Kumar N, Hazra KK, Singh S and Nadarajan N. 2016b. Constraints
and prospects of growing pulses in rice fallows of India. Indian
Farming 66(6): 13-16.
Kumar N, Singh SS, Ghosh PK, Praharaj CS, Basu PS, Hazra KK,
Senthilkumar M and Singh MK. 2016a. Mitigating abiotic stresses
in pulses under rice fallows in India (Extended summaries) 1: 22-26.
Kumar R, Mishra JS, Rao KK, Bhatt BP, Hazra KK, Hans H and
Mondal S. 2019a. Sustainable intensification of rice fallows of
Eastern India with suitable winter crop and appropriate crop
establishment technique. Environmental Science and Pollution
Research 26(28): 29409-29423.
Kumari A and Sairam RK. 2013. Moisture stress induced increases in
the activity of enzymes of osmolytes biosynthesis are associated
with stress tolerance in wheat genotypes. Indian Journal of Plant
Physiology 18(3): 223-230.
Kumar N, Nath CP, Hazra KK, Das K, Venkatesh MS, Singh MK,
Singh SS, Praharaj CS and Singh NP. 2019b. Impact of zero-till
residue management and crop diversification with legumes on
soil aggregation and carbon sequestration. Soil and Tillage
Research 189: 158-167.
35
NAAS. 2013. Improving productivity of rice fallows. Policy Paper
No. 64, National Academy of Agricultural Sciences, New Delhi:
pp 16.
Nandan R, Singh SS, Kumar V, Singh V, Hazra KK, Nath CP, Malik
RK, Poonia SP and Solanki CH. 2018. Crop establishment with
conservation tillage and crop residue retention in rice-based
cropping systems of Eastern India: yield advantage and economic
benefit. Paddy and Water Environment, 16(3): 477-492.
Nandan R, Singh V, Singh SS, Kumar V, Hazra KK, Nath CP, Poonia
SP, Malik RK, Bhattacharyya R and McDonald A. 2019. Impact
of conservation tillage in rice–based cropping systems on soil
aggregation, carbon pools and nutrients. Geoderma 340: 104-114.
Patil SS, Kelkar TS and Bhalerao SA. 2013. Mulching: A soil and
water conservation practice. Research Journal of Agriculture
and Forest Science 1: 26-29.
Rahimia A, Madah Hosseinib S, Pooryoosefc M and Fatehd I. 2010.
Variation of leaf water potential, relative water content and
SPAD under gradual drought stress and stress recovery in two
medicinal species of Plantago ovata and P. psyllium. Plant
Ecophysiology 2: 53-60.
Singh KP, Prakash V, Srinivas K and Srivastva AK. 2008. Effect of
tillage management on energy-use efficiency and economics of
soybean (Glycine max) based cropping systems under the rainfed
conditions in North-West Himalayan region. Soil and Tillage
Research 100: 78-82.
Journal of Food Legumes 33(1): 36-40, 2020
Performance of mungbean as influenced by organic practice and plant geometry
on growth, yield and economics under NEH region of India
N KHUMDEMO EZUNG, M BEN YANTHAN1, DJ RAJKHOWA and TIATULA JAMIR2
Krishi Vigyan Kendra, Kiphire, ICAR Research Complex for NEH Region, Nagaland Centre, Medziphema,
Nagaland, India; 1Department of Agriculture, Government of Nagaland, Kohima, Nagaland, India; 2Agriculture
Technology Management Agency, Government of Nagaland, Wokha, Nagaland, India; Email:
kvkkiphire2017@gmail.com
(Received : November 21, 2019; Accepted : January 28, 2019)
ABSTRACT
The experiment was carried out in the experimental farm of
Krishi Vigyan Kendra (KVK), Kiphire, ICAR for NEH
Region, Nagaland, India during winter 2019. The experiment
was laid out in Factorial Randomized Block Design with
three replications. Application of three tonnes of
vermicompost + rhizobium had significant effect on the
growth and yield parameters as compared with the rest of
the treatments. Similarly, row-spacing 40 x 10 cm was better
compared to 30 x 10 cm in terms of growth as well as yield
parameters such as number of pods/plant, number of seeds/
pod and test weight. Soil organic C, pH, available N, P2O5,
K2O and N, P, K content and uptake by plant and grains
were also recorded higher with the application of three
tonnes of vermicompost + rhizobium and 40x10 cm spacing.
However, in terms of grain yield, stover yield and harvest
index, 30x10 cm outperformed compared to 40x10 cm. The
economic analysis revealed that the combination of three
tonnes of vermicompost + rhizobium with 40x10 cm and
30x10cm spacing had highest grain yield and gross return,
however, the highest net return and B:C ratio were recorded
with the combination of two tonnes of vermicompost +
rhizobium with 30 x 10 spacing. Therefore, application of
two tonnes of vermicompost + rhizobium and 30 x 10cm
spacing were optimum under the existing condition.
Key words: Economics, Maize, Organic, Spacing, Vermi
compost, Yield
Greengram locally called as moog or mug (Vigna
radiata L. Wilczek) belongs to the family Leguminoceae,
which fixes atmospheric nitrogen and improves soil fertility
by adding 20-25 kg N ha-1. Being a short duration crop and
having wider adaptability, it can be grown in summer as
well as in kharif season. The yield of summer greengram is
comparatively more than that of kharif crop, mainly because
the controlled moisture conditions through irrigation,
abundant sunshine and less pest and disease infestation.
The greengram foliage left over after picking of mature pods
can either be fed to livestock or it may ploughed in situ as
a green manure to enrich soil with organic matter. Greengram
is a very short duration crop so it can be grown as catch
crop.
In India, it occupied an area of 3.24 million hectares
having total production of 1.39 million tons of grain with
productivity of 346 kg/ha (Anon. 2015a). In India, major
greengram producing states are Orissa, Madhya Pradesh,
Rajasthan, Maharashtra, Gujarat and Bihar. Greengram crop
have direct effect of spacing due to availability of moisture
and nutrient depend on spacing. Greengram [Vigna radiata
(L.) Wilczek] gives low seed yield and poor growth
performance mainly due to poor management and low soil
fertility. The crop needs more nitrogen at the reproductive
phase, and the nutrient uptake after flowering either
becomes slow or stops due to inactivation of roots. The
optimum supply of nitrogen and phosphorus significantly
influenced on growth and yield of greengram. Current trend
in agriculture focus on reducing the use of chemical
fertilizers by the application of biofertilizers such as
vermicompost (Haj Seyed Hadi 2011). The management
practices and use of organic materials influence agricultural
sustainability by improving physical, chemical and
biological properties of soils (Saha et al. 2008). Organic
agriculture provides a constant increase of biological
fertility and release of nutrients to the plants (Sofia et al.
2006). Vermicomposting process is the biological
degradation of organic waste by earthworms and other
microorganisms to form vermicompost (Edwards and
Burrows 1988) which is important for organic agriculture.
The leisurely and progressively released nutrients by
vermicompost into the rhizosphere provide the appropriate
conditions for plant uptake (Ansari and Sukhraj 2010). It
has been confirmed that vermicompost has the capacity to
supply both macro and micronutrients in the soil for
optimum plant growth (Harris et al. 1990).
Keeping these in view, the present investigation was
undertaken to evaluate the optimum level of vermicompost
coupled with rhizobium and spacing on growth, yield and
economics of greengram.
MATERIALS AND METHODS
The experiment was carried out in the experimental
farm of KVK, Kiphire, ICAR for NEH Region, Nagaland
Centre during the rabi season of the year 2019. The
experimental farm is located at an altitude of 896.42 MSL
with humid and hot during summer and cold during winter
 Ezung et al. : Performance of mungbean as influenced by organic practice and plant geometry under NEH region 37

with winter temperature touching a low of 270C and a high
of 37.00C during summer. Monsoon period extends from
June to September and sometimes up to October. The
average rain fall for the last three years is 876mm. Undulating
topography with sandy loam to fine rich humus soil
constitutes the main soil condition. The experiment was
laid out in “Factorial Randomized Block Design” with three
replications. The treatments for the experiment consisted
of control (N0), 1 ton vermicompost + rhizobium (N1), 2 ton
vermicompost+ rhizobium (N2), 3 ton vermicompost +
rhizobium (N3) and two spacing, 30x10 cm (S1) and 40x10cm
(S2). Seed treatment method was adopted for application of
rhizobium, however, vermicompost was applied during the
final land preparation. The quantities of vermicompost were
calculated based on its N content (1.5%) and moisture
content (40%) which were determined prior to application.
Experimental site: The experiment was carried out in a
plain, well-drained upland at the farm of KVK, Kiphire
experimental farm. Representative soil samples were
collected from 15 cm depth randomly following the
procedure laid down by Basak (2010) before laying out the
experiment for studying the initial soil physico-chemical
properties. The initial soil analysis indicates a pH of 4.8,
OC (%) 0.47, available N (kg ha-1)147.39 kg ha-1, available
P2O5 (kg ha-1) 19.04, available K2O (kg ha-1) at 170.02 which
were observed to be in medium to low range.
RESULTS AND DISCUSSION
The effect of different levels of vermicompost
application and rhizobium at 30 DAS, 60 DAS and at
harvest on plant height and dry weight of plant was evident.
It was observed that the application of 3 ton vermicompost
+ rhizobium showed significant effect over rest of the
treatments.The highest plant height of 27.47 cm, 72.96 cm
and 71.56 cm was recorded at 30 DAS, 60 DAS and at
harvest with the lowest plant height being recorded from
control plot whereas a dry weight of 2.98 g, 8.98 g and 8.85
g was recorded at 30 DAS, 60 DAS and at harvest where
control recorded the least. Similar finding was also observed
by Jat et al. (2012) Romel et at. (2014) and Sitaram et al.
(2013) where they reported that the increase in the levels of
vermicompost, corresponding increase in plant height and
dry weight was reported.
The effect of spacing on plant height and dry weight
was also observed to be significant where it was recorded
that a wider spacing of 40x10 cm produced higher plant
height and dry weight which may be due to lesser
competition for nutrients and moisture between the crops.
Kalsaria et al. (2017) also reported similar finding.
Data pertaining to Table 1 depicts the effect of
different levels of vermicompost application with rhizobium
on number of pods/plant where it was observed that the
application of 3 ton vermicompost + rhizobium showed
significant effect over rest of the treatments. The highest
number of pods/plant was recorded at 28.85 was recorded
from the application of 3 ton vermicompost + rhizobium
and the lowest 25.32 was recorded from control. This finding
finds in close conformity with the findings reported by
Arsalan et al. (2016) where they reported that the highest
number of pods per plant was recorded with the application
of highest level of vermicompost (2 ton/ha).
The effect of spacing number of pods/plant was also
observed to be significant where it was recorded that a
wider spacing of 40x10 cm produced higher number of pods/
plant as compared to 30x10 cm which may be due to lesser
inter crop competition.This finding confirms the finding
reported by Kalsaria et al. (2017).
Seeds/pod: Data pertaining to Table 1 depicts the effect of
different levels of vermicompost application with rhizobium
on number of seeds/pod where it was observed that the
application of 3 ton vermicompost + rhizobium showed
significant effect over rest of the treatments. The highest
number of seeds/pod (9.75) was recorded from the
application of 3 ton vermicompost + rhizobium with the
lowest (7.49) recorded from control. This finding finds in

Table 1. Effect of different levels of vermicompost + rhizobium and spacing on dry weight(g) of greengram (DWP) and other
yield and its traits.
DWP Pods/ Seeds/ Test weight Yield Stover yield Harvest
Treatment
30 days 60 days Harvest plant pod (g) (q/ha) (q/ha) Index
Vermicompost + rhizobium (N)
N0-Control 2.37 7.61 7.59 25.32 7.49 29.69 4.23 18.31 18.77
N1-1 ton vermicompost +rhizobium 2.47 7.84 7.71 26.38 8.25 31.77 7.19 18.80 27.63
N2-2 ton vermicompost +rhizobium 2.75 8.41 8.28 27.43 9.00 33.30 9.85 20.01 32.98
N3-3 ton vermicompost +rhizobium 2.98 8.98 8.85 28.85 9.75 34.85 10.71 21.23 34.73
SEm (±) 0.10 0.26 0.26 0.42 0.35 0.55 0.34 0.38 0.78
CD(P=0.05) 0.22 0.56 0.55 0.90 0.74 1.17 0.73 0.81 1.67
Spacing (S)
S1- 30 x20 cm 2.53 8.12 7.89 26.34 8.34 32.18 8.32 19.62 28.99
S2-40x20 cm 2.70 8.73 8.34 27.14 9.11 336.62 7.67 18.55 27.46
SEm (±) 0.07 0.18 0.18 0.30 0.24 0.39 0.24 0.27 0.55
CD(P=0.05) 0.15 0.39 0.39 0.64 0.52 0.83 0.51 0.57 1.18
Interactions NS NS NS NS NS NS NS NS NS
CV (%) 1.09 1.55 1.57 1.41 2.02 1.66 2.07 1.47 2.54
* NS-Not significant
38 Journal of Food Legumes 33(1), 2020

Table 2. Effect of different levels of vermicompost + rhizobium and spacing soil organic C (%) and pH at 60 DAS and at
harvest
Treatment Organic C(%) pH 60 DAS At harvest
60 DAS At harvest 60 DAS At harvest N P2O5 K2O N P2O5 K2O
Vermicompost + rhizobium (N)
N0-Control 0.52 0.57 5.20 5.20 249.65 22.05 130.32 258.76 22.37 130.62
N1-1 ton vermicompost + rhizobium 0.54 0.60 5.26 5.37 256.82 23.83 135.33 264.23 24.66 159.86
N2-2 ton vermicompost + rhizobium 0.56 0.63 5.32 5.42 260.83 26.06 141.64 267.75 26.89 167.38
N3-3 ton vermicompost + rhizobium 0.58 0.66 5.41 5.61 265.02 28.28 147.47 274.47 29.22 173.11
SEm (±) 0.01 0.01 0.03 0.11 2.36 0.72 2.09 1.79 0.71 2.59
CD (P=0.05) 0.02 0.03 0.07 0.24 5.07 1.54 4.48 3.84 1.54 5.56
Spacing (S)
S1- 30x20 cm 0.54 0.60 5.27 5.31 256.21 24.50 137.10 264.93 25.24 155.78
S2-40x20 cm 0.56 0.63 5.33 5.49 259.95 25.60 140.27 267.67 26.34 159.71
SEm (±) 0.01 0.01 0.02 0.08 1.67 0.51 1.48 1.26 0.50 1.83
CD (P=0.05) 0.02 0.02 0.05 0.17 3.58 1.09 3.17 2.71 1.08 3.93
Interactions NS NS NS NS NS NS NS NS NS NS
CV (%) 0.26 0.35 0.25 0.83 2.55 2.49 3.07 1.90 2.43 3.57
NS: Non- significant

Table 3. Effect of different levels of vermicompost + rhizobium and spacing on N, P and K uptake by plant and grains at 60
DAS and at harvest
60 DAS At harvest Grain Cost of Net
Interaction B:C
Treatment cultivation return
N P K N P K N P K ratio
(INR) (INR)
Vermicompost + rhizobium (N)
N0-Control 35.18 8.72 29.49 38.95 8.75 44.20 25.50 5.98 20.80 S1N0 25000 41750 2.67
N1-1 ton vermicompost +rhizobium 42.24 10.11 36.55 45.62 10.11 49.11 28.61 6.98 23.43 S1N1 41000 71550 2.75
N2-2 ton vermicompost +rhizobium 51.89 12.66 45.26 50.32 12.27 54.02 32.93 7.84 25.74 S1N2 53000 98600 2.86
N3-3 ton vermicompost +rhizobium 63.35 16.01 59.05 57.53 14.11 59.89 38.22 9.06 28.43 S1N3 75000 93000 2.24
SEm (±) 1.70 0.42 1.83 1.99 0.40 1.77 1.57 0.19 0.99 S2N0 25000 35050 2.40
CD(P=0.05) 3.65 0.91 3.93 4.27 0.86 3.80 3.37 0.41 2.13 S2N1 40000 63200 2.58
Spacing (S) S2N2 53000 90850 2.71
S1- 30 x20 cm 46.19 11.46 39.86 46.53 10.97 50.44 29.84 7.20 23.71 S2N3 75000 78250 2.04
S2-40x20 cm 50.14 12.29 45.31 49.67 11.65 53.17 32.79 7.73 25.49
SEm (±) 1.20 0.30 1.29 1.41 0.28 1.25 1.11 0.13 0.70
CD(P=0.05) 2.58 0.64 2.78 3.02 0.61 2.69 2.38 0.29 1.51
Interactions NS NS NS NS NS NS NS NS NS
CV (%) 4.25 2.12 4.86 4.97 2.06 4.27 4.86 1.21 3.47
NS: Non-significant Price (INR) Greengram: INR 150/kg

close conformity with the findings reported by Romel et al.
(2014) where they reported that the highest number of seeds/
pod was recorded with the application of highest level of
vermicompost (8 ton/ha).
The effect of spacing on number of seeds/pod was
also observed to be significant where it was recorded that
a wider spacing of 40x10 cm produced higher number of
pods/plant as compared to 30x10 cm which may be attributed
to lesser resource between the crops. This finding confirms
the finding reported by Chaudhary et al. (2015) where they
reported that wider spacing resulted in higher number of
pods/plant.
Test weight: Data pertaining to Table 1 depicts the effect of
different levels of vermicompost application with rhizobium
on test weight where it was observed that the application
of 3 ton vermicompost + rhizobium showed significant effect
over rest of the treatments. The highest test weight was
recorded at 34.85 was recorded from the application of 3
ton vermicompost+rhizobium with the lowest 29.69 being
recorded from control. This finding finds in close conformity
with the findings reported by Romel et al. (2014) where
they reported that the highest test weight was recorded
with the application of highest level of vermicompost (8
ton/ha).
Significant effect due to spacing was also observed
where it was found that a wider spacing of 40x10 cm
produced highest test weight as compared to 30x10. This
finding confirms the finding reported by Vakeswaran et al.
(2016).
Grain yield: Data pertaining to Table 1 depicts the effect of
different levels of vermicompost application with rhizobium
on grain yield, stover yield and harvest index where it was
observed that the application of 3 ton vermicompost +
rhizobium showed significant effect over rest of the
treatments. The highest grain yield (10.71 q/ha), stover
 Ezung et al. : Performance of mungbean as influenced by organic practice and plant geometry under NEH region
yield (21.23 a/ha) and harvest index (34.73) was recorded
from the application of 3 ton vermicompost+rhizobium with
the lowest 4.23 q/ha, 18.31 q/ha and 18.77 being recorded
from control. This finding finds in close conformity with
the findings reported by Arsalan et al. (2016) where they
reported that the highest test weight was recorded with the
application of highest level of vermicompost (2 ton/ha).
Significant effect of spacing on grain yield, stover
yield and harvest index was also observed in which a
spacing of 30x10 cm recorded the highest grain yield (8.32
q/ha), stover yield (19.62) and harvest index (28.99) as
compared to 40x10 cm which may be due to higher plant
population resulting in higher yield and stover yield.
Kalsaria et al. (2017) also reported similar finding where 30
cm row to row spacing resulted in the highest grain yield
and stover yield as compared with 45 cm row to row spacing.
Soil status at 60 DAS and after harvest: Data pertaining to
Table 2 shows the effect of different levels of vermicompost
application with rhizobium on organic carbon content, pH,
N, P 2O 5 and K 2 O where the application of 3 ton
vermicompost+rhizobium showed significant effect over
rest of the treatments. The highest organic C 0.59% and
0.67% was observed with the application of 3 ton
vermicompost + rhizobium both at 60 DAS and at harvest
which is significantly superior over rest of the treatment.
Similar finding was also observed incase of pH, N, P2O5 and
K2O where application of 3 ton vermicompost + rhizobium
out-performed rest of the treatments.
Spacing also exhibited significant effect on organic
C, pH, N. P2O5 and K2O where 40x10 cm spacing recorded
higher as compared with 30x10 cm.This may be attributed
to lesser competition among the crops due to wider spacing
thereby increasing their content in the soil.
N, P and K content and uptake: The effect of treatments
on N, P, K content and uptake by plants 60 DAS, at harvest
and by grains was evident where it was where it was
observed that application of 3 ton vermicompost +
rhizobium showed significant effect over rest of the
treatments. Increased N and P uptake due to manuring has
also been reported by Rajkhowa et al. (2003). Romel et al.
(2014) reported that N, P and K content and uptake
significantly increased with increase in level of
vermicompost application.
It was observed that spacing showed significant
effect on N, P, K content and uptake by plant at 60 DAS, at
harvest and by grains where 40x10cm recorded higher
content and uptake as compared with 30x10 cm.
Economic analysis: The economics for the different
treatment were worked out inorder to enable us to decide
the suitable treatment combinations for more profitable
greengram cultivation. Among the different treatment
combinations, the maximum net return was recorded from
the application of 2 ton vermicompost+ rhizobiumand
39
30x10cm spacing (Rs.98600) recording a B:C ratio of 2.86
as compared with the rest of the treatment combination
(Table 9).
From the result of the above investigation, it may be
concluded that application of vermicompost and spacing
in greengram results in significant positive effect on the
growth and yield of. It was observed that by increasing the
levels of vermicompost, it increased the growth and yield
which may be due to higher availability of nutrients. The
result shows that the application of 3 ton vermicompost +
rhizobium has significant effect on the growth and yield
parameters as compared with the rest of the treatments.
The effect of spacing was also observed to be significant
where it was found that 40x10cm cm performed better as
compared with 30x10cm cm spacing in terms of growth as
well as yield parameters such as number of pods/plant,
number of seeds/pod and test weight. However, a spacing
of 30x10 cm spacing outperformed 40x10 cm in terms of
grain yield, stover yield and harvest index.Theeconomic
analysis revealed that though the combination of 3 tons
vermicompost+rhizobiumwith 40x10 cm and 30x10cm
spacing obtained highestgrain yield and gross return, the
highest net return and B:C ratio was recorded from the
combination of 3 ton vermicompost+rhizobium with 30x10
spacing. Therefore, it may be concluded that application of
two tonnes of vermicompost + rhizobium and 30x10cm
spacing may be considered for adoption by the farmers.
REFERENCES
Anonymous. 2014-15. Directorate of Economics and Statistics,
Department of Agriculture & Cooperation and Department of
Commerce, 2015a. Available at http://www.eands.dacnet.nic.in
> accessed 29 December, 2015.
Ansari AA and Sukhraj K. 2010. Effect of vermiwash and
vermicompost on soil parameters and productivity of okra
(Abelmoschusesculentus) in Guyana. African Journal of
Agriculture Research 5: 1794-1798.
Arsalan M, ShoaibA, Junaid N, Chauhdary and Sarwar M. 2016.
Effect of vermicompost and phosphorus on crop growth and
nutrient uptake in mung bean. Journal of Applied Agriculture
and Biotechnology 1(2): 38-46.
Chaudhary AN, Vihol KJ, Chaudhary JH, Mor VB and Desai LJ.
2015. Influence of spacing and scheduling of irrigation on growth,
yield, yield attributes and economics of summer greengram (Vigna
radiata L.). Ecology, Environmentand Conservation 21 pp.
S357-S361.
Romel B, Wasal R, Haque M, Sharmin M and Barua R. 2014. Effect
of potassium and vermicompost on the growth, yield and nutrient
contents of mungbean (BARI Mung 5). Open Science Journal of
Bioscience and Bioengineering 1(3): 33-39.
Sitaram TAK, Sharma SK and Reager ML. 2013. Growth attributes
and nutrient uptake of green gram as influenced by vermicompost
and zinc in arid western Rajasthan. Advance Research Journal of
Crop Improvement 4(1): 65-69.
Saha S, Mina BL, Gopinath KL, Kundu S and Gupta HS. 2008.
Relative changes in phosphatase activities as influenced by source
40 Journal of Food Legumes 33(1), 2020
and application rate of organic composts in field crops.
Biological Resource Technology 99: 1750-1757.
Hadi HS, Darzi MT, Ghandehari Z and Riazi GH. 2011. Effects of
vermicompost and amino acids on the flower yield and essential
oil production from Matricaria chamomile L. Journal of
Medicinal and Plant Research 5: 5611-5617.
Harris GD, Platt WL andPrice BC. 1990. Vermicomposting in a
rural community. International Research Journal and Plant
Science 2: 94-98.
Jat SL, Prasad K and Parihar CM. 2012. Effect of organic manuring
on productivity and economics of summer mungbean. Annals of
Agricultural Research 33(1&3): 17-20.
Kalsaria RN, Vekariya PD, Hadiyal JG and Ichchhuda PK. 2017.
Effect of spacing, fertility levels and bio-fertilizers on growth
and yield of summer greengram (Vigna radiata L. Wilczek).
Journal of Pharmacognosy and Phytochemistry 6(5): 934-937.
Rajkhowa DJ, Saikia M and Rajkhowa KM. 2003. Effect of
vermicompost and levels of fertilizer on greengram. Legume
Research 26(1): 63-65.
Vakeswaran V, Jerlin R, Selvaraju P and Bhaskaranm. 2016. Effect
of time of sowing, spacing between plants and different fertilizer
levels on green gram (Vigna radiata L Wilczek) in seed yield
attributing characters. International Journal of Agriculture
Sciences 8(57): 3147-3150.
Journal of Food Legumes 33(1): 41-47, 2020
Enhancing farm income and system productivity in soybean-lentil through land
configuration, conservation tillage, seed priming and mulching under rainfed
Central India
CS PRAHARAJ, RAM LAL JAT, SS SINGH and NP SINGH
ICAR-Indian Institute of Pulses Research, Regional Station, Bhopal, India; E-mail:cspraharaj@hotmail.com
(Received : December 22, 2019; Accepted : February 11, 2020)
ABSTRACT
Soybean {Glycine max (L.) Merr.} is adapted to Central India
because of congenial growing conditions attuned to climate
and soil condition of the region. However, the crop is losing
its sheen due to low productivity of crop, biotic and abiotic
stresses, non-availability of critical inputs especially quality
seeds besides others. Therefore, besides a good genotype,
improved agronomy is pre-requisite for bridging the existing
yield gaps considerably. Better land configuration under
heavy clayey soils during rainy season and conservation
tillage enabled microclimate associated with suitable agro-
technologies during winter season could serve as a boon to
exploit genetic potential of dominant crops grown in the
rainfed situation here. Therefore, improved crop
management practice such as broad bed furrow (BBF),
conservation tillage especially during winter season along
with seed priming and mulching could go a long way to
harness better land and crop productivity of popular crop/
cropping system adapted in this agro-ecology. Thus, field
studies were carried out during 2015-17 at ICAR-Indian
Institute of Pulses Research, Regional Station, Bhopal on a
clay loam vertisol to evaluate the effect of these agro-
technologies individually and in combination on crop
productivity and farm income in soybean-lentil cropping
system. It revealed that BBF plots had higher productivity
during rainy (soybean with 12.9%), winter (lentil with 17.9%)
and both the seasons together (with 15.3% increase in system
productivity of soybean-lentil) in these heavy soils of Central
India as evident during 2015-16. Similar values (20.3, 6.8
and 14.2%, respectively) in respect of superiority of BBF
plots were observed during 2016-17 also. Grain yield of lentil
(27.7 and 25.1%) and total productivity of soybean-lentil (13.1
and 16.0% ) were improved significantly following seed
priming along with mulching of soybean crop residues in
lentil over that in control (without seed priming) during
2015-16 and 2016-17, respectively. Net returns accrued for
both lentil (19.3 and 33.1%) and total system productivity
(17.3 and 16.8%) were also in favour of these (BBF and
priming with mulching) treatments during 2015-16. Similar
trend was observed during 2016-17 (with corresponding
values of 8.6 and 6.2% for BBF, and 28.8 and 36.6% for priming
combined with mulching, respectively). Crop response to
conservation tillage (zero versus reduced) was also influenced
by climatic condition including rainfall events, soil type/
condition and cropping history/season. The study suggested
that in soybean-lentil, appropriate land configuration (BBF)
in soybean during rainy season followed by seed priming
(for 4 hours) of lentil amalgamated with mulching of soybean
crop residues (with additional advantages of moisture
conservation/extended water availability) during winter
could be useful for scaling up both crop productivity and
farm income in the heavy soils of Central India under rainfed
condition.
Key words: Economics, Land configuration, Mulching, Priming,
Rainfed, Soybean-lentil, Tillage
Soybean (Glycine max L. Merr.) in rainy season and
short duration wheat or pulses, like lentil (Lens
culinaris Medic) and chickpea in winter season are popular
cropping system in central India (Praharaj and Dhingra 2001;
Jat and Praharaj 2018). Since the nutrient and water
requirement of pulses (soybean and lentil) is relatively low,
there is great scope to grow these crops exclusively with
little agronomic manipulation amalgamated with improved
agronomy (Ramesh et al. 2010). Crop management for
nutrients within the crop rotation can have large effects on
yields and its economics (Singh et al. 2018). Thus, there is
a need for efficient management of existing agro-
technologies to reap greater benefits out of prevailing
situation(s).
In this context, the Indian state of Madhya Pradesh
(MP) has a unique distinction of having more than 87%
soybean (Glycine max) area of the country and is rightly
designated as Soya State. The crop is usually grown as
rainfed in heavy soils (Singh et al. 2014) ranged from medium
black to deep black soils (vertisols). In spite of technological
advances and annual rainfall (800 to 1600 mm), sustainable
farm production and success of agriculture in rainfed areas
continues to be governed by vagaries of rains with respect
to space & time. In these soils, soybean is a principal crop
which is cultivated in 10 million ha with grain production of
about 11 million tonnes now. Following its introduction as
a commercially viable crop in India, it led to development of
its cropping systems on vertisols and associated soils.
However, over the years, the crop is losing its sheen due to
low productivity, recurrent biotic and abiotic stresses, non-
availability of critical inputs especially quality seed and
others (Praharaj et al. 2015). Thus, in presence of an
improved variety, certain important interventions of
improved agronomy become imperative and pre-requisite
for bridging the existing yield gaps considerably. Following
better soil management through appropriate land
configuration under heavy clayey soils during rainy season
and zero or reduced tillage enabled microclimate associated
42 Journal of Food Legumes 33(1), 2020

with suitable agro-technologies during winter season could MATERIALS AND METHODS
serve as a boon to exploit genetic potential of dominant
An experiment was conducted at ICAR-Indian
crops grown in the rainfed situation (Jat and Praharaj 2018).
Institute of Pulses Research, Regional Station, Bhopal,
In this context, suitable management technologies to offset
Madhya Pradesh, India during 2015-17 by utilizing known
adverse effects of abiotic stresses, like waterlogging,
agro-technologies to asses/evaluate their performance on
moisture deficit, temperature related stresses etc need to
soybean-lentil under rainfed condition. Thus, the objective
be addressed, developed and refined regularly on a
of the experiment was to enhance per hectare crop
sustainable basis. Thus, resource conservation
productivity, input use efficiency & farm economy without
technologies such as broad bed furrow (BBF), conservation
exclusion of the risky and non-remunerative but the popular
tillage and residue retention are some of the new
and farmers’ choice soybean crop (Jat and Praharaj 2018;
technologies/options deserving immediate focus along with
Praharaj et al. 2015). Thus, to address the issues of scaling
their integration with crop rotation/intercropping based on
crop performance against abiotic stress in presence of
sound principle of nutrient/pests management (Gangwar
ponding of water during monsoon season and heavy clayey
and Prasad 2005).Therefore, improved crop management
soil condition, the present investigation was carried out in
practice such as BBF, conservation tillage especially during
soybean-lentil cropping system in aid of higher crop
winter season along with seed priming and mulching could
productivity and sustainability.
facilitate in harnessing better land and crop productivity of
existing soybean-lentil cropping system (Praharaj et al. The experiments involved treatments or constraints
2018). such as land configuration, tillage, and seed priming (to
winter crop) in soybean-lentil system during 2015-17. In
As the main factor for low productivity of soybean
this study, two land configurations (flat versus BBF) were
or its cropping system in India is mainly based on the abiotic
taken during rainy season. During winter season, fifteen
stresses involving moisture and soil quality related
treatment combinations comprising of two conservation
constraints, thus, the effect of suitable land alteration,
tillage (zero versus reduced tillage) in main plot and five
optimum tillage, residue retention etc are important
priming treatments viz., Control i.e., placing seed at 10 cm
considering water surplus condition during rainy season
soil depth without priming (1), seed priming with water
and water deficit situation in winter season under Indian
soaking for 4 hours and placement of seed at 10 cm soil
conditions (Praharaj et al. 2017a) which scale up input use
depth (2), seed priming as in above and placement of seed
efficiency besides raising crop productivity. In addition,
at 10 cm soil depth under mulch (3), seed priming as in
this could further reduce the stress on soil, crop and
above and placement of seed in furrows with fertilizers (4),
environment further besides hastening crop/cropping
and seed priming as in above and placement of seed at 10
system productivity. Therefore, the current investigation
cm soil depth along with foliar spray of urea at 2% at pod
was undertaken to ascertain the effect of different agro-
development (5) in sub plots, were undertaken in split plot
technologies (land configuration, conservation tillage,
with three replications. In BBF with 120 cm between two
mulches and priming of seed) on soybean-lentil cropping
adjacent furrows, 4 rows of crops on beds (105 cm) with
system covering dual seasons (both rainy and winter
row to row distance of 35 cm were adjusted, while 30 cm
seasons) under rainfed agro-ecology of central India.
row to row spacing between 2 rows of crops was maintained

Fig. 1: Typical meteorological situation at the location during 2015-16 (left graph for rainy while, right graph for winter)
 Praharaj et al. : Enhancing farm income and system productivity in soybean-lentil under rainfed Central India 43

under flat. Soybean ‘JS 20-29’ during rainy seasons was RESULTS AND DISCUSSION
followed by lentil ‘IPL 316’ during winter seasons without
Land configuration: In the existing agro-ecolgical situation,
supplementary irrigation (rainfed).
broad bed furrow (BBF) had discrete advantages as it
The soil of experimental site was clay loam (vertisols) worked both for drainage (during continuous rainfall
in texture (with FC at 30% w/w and PWP at 14% w/w) and events) and conservation furrows (in the event of rainless
7.87 pH with low in N (198 kg/ha) and SOC (0.42%), medium periods, rainfall breaks or withdrawal of South-West
in P (15.5 kg/ha) and high in K (368 kg/ha) at the surface monsoon) during experimental year 2015-16. A continuous
depth (0-15 cm). The soil is having EC of 0.33 dS/m and soil rainfall event especially during three months of monsoon
depth is around 1.5 metres. Both soybean and lentil were (739.6 mm) was beyond adequate enough for conservation
supplied with the recommended dose of fertilizers. The in situ or deep percolation. This caused widespread runoff
source of fertilizers was Urea, DAP and MOP for N,P and of excess water lost from the plot especially in the flat soil
K, respectively. Besides these, normal dose of Zn and S during entire rainy season right from sowing to maturity of
were also applied at sowing. Fertilizers and other agro- soybean crop. On the contrary, a large part of rain water
chemicals including pesticides have also been applied to was stored in the furrows of the BBF plots, which continued
crops as per recommendations for the region. Standard to partially fulfill water requirements of the succeeding crop
package of practices has been followed for raising a good of lentil during winter season (as evident from soil moisture
crop(s) under the existing rainfed condition (single irrigation content). Water conserved/stored in conservation furrows
applied as life-saving at pod development of lentil during was thus, available to lentil during winter season. It was
rabi, 2016-17 only as 6.6 mm rainfall received against 15.4 confirmed from higher crop growth and yield. In addition,
mm in 2015-16). The experimental site was double cropped crop (soybean) loss due to ponding could not be arisen
rainfed upland with mostly soybean-wheat cropping during rainy season as evident from higher crop growth,
system. Grain yield, yield attributes and other biometrics its attributes and grain yield following planting on BBFs
observations were undertaken as per requirements for (Table 1).
validation of findings. Other soil and plant analysis were
The above study carried out under rainfed condition
made following standard procedures. Under Bhopal
showed that BBF had the edge in terms of crop growth and
condition, normal temperature and rainfall regimes during
yield attributes during 2015-16. As a result, the beneficial
2015-16 were observed during both kharif/rainy season (left)
increases in plant height, straw yield (12.7%), biomass at
and rabi/winter season (right) (Fig 1). A similar weather
harvest (12.8%), branches/plant (15.9%), pods/plant
condition also prevailed during both rainy and winter
(14.7%), and seeds/pod (15.8%) in soybean during rainy
season of 2016-17.
Table 1. Effect of land configuration on soybean and its harvest attributes during 2015-16
Treatments Seed yield Straw yield Biomass at Seeds/ Plant height Branches/ Pods/ Seeds/
(kg/ha) (kg/ha) harvest (kg/ha) plant (cm) plant plant pod
Land configuration
Flat 962 1537 2499 63.0 31.5 2.64 25.2 2.78
BBF 1086 1732 2818 72.8 33.9 3.06 28.9 3.22
SE(m±) 18.6 26.0 44.9 2.54 0.7 0.10 1.0 0.10
CD (0.05) 122 170 294 7.39 2.0 0.29 2.8 0.28

Table 2. Effect of Land configuration, tillage and seed priming on lentil biometrics and yield (2015-16)
Treatments Plant height Branches/ Pods/ Seed wt. 100 seed Grain Straw yield Biomass Rabi Kharif +
(cm) plant plant /Plant(g) weight Yield (kg/ha) (kg/ha) (SEY) Rabi
(kg/ha) (SEY)
Land configuration
Flat 31.7 3.20 56.9 3.78 2.63 783 1064 1847 942 1904
BBF 33.6 3.45 65.2 4.38 2.99 923 1245 2168 1110 2196
CD (P=0.05) NS NS NS 0.45 0.32 117 167 282 140 177
Conservation Tillage
Zero Tillage 32.4 3.27 56.4 3.91 2.74 768 1044 1812 924 1947
Reduced Tillage 33.0 3.39 65.7 4.25 2.88 938 1265 2203 1128 2152
CD (P=0.05) NS NS 8.5 0.13 0.11 61.5 88.1 148 73.9 73.9
Priming
No Priming 30.7 2.95 51.8 3.91 2.59 763 1036 1799 917 1941
Priming 34 3.50 57.1 3.93 2.71 858 1167 2025 1033 2057
Priming+Mulch 34 3.63 70.7 4.51 3.07 974 1323 2296 1171 2195
Priming+ Fertilizers 32.9 3.38 64.2 4.05 2.75 841 1147 1987 1012 2035
Priming+Urea (FS) 31.8 3.18 61.6 3.99 2.95 828 1101 1930 997 2021
CD(P=0.05) 2.2 0.36 11.9 0.43 0.29 105 150 253 127 127
Interaction (TxP) CD (0.05) NS
44 Journal of Food Legumes 33(1), 2020

season; and plant height, straw yield (17.0%), biomass at
harvest (17.4%), branches/plant, pods/plant, seed weight/
plant (15.9%), and 100-seed weight (13.7%) in lentil during
winter season were recorded (Table 1,2). Consequently,
there was significant increase in crop productivity during
both the seasons/crops. Enhancement in productivity of
soybean to the tune of 12.9% and that of lentil by 17.9%
were observed under the BBF plots alone compared to flat
planted plots (Table 4). Further, system productivity for
soybean-lentil (soybean equivalent yield, SEY) scaled up
by 15.3% during 2015-16 under BBF compared to flat
planting on the land (Table 2).
Similar was the trend during 2016-17 also where only
reshaping of BBF was made (Table 4). The corresponding
(increased) values recorded for growth and yield attributes
viz., biomass at harvest, straw yield, pods/plant, and seeds/
plant in soybean were 14.9, 12.0, 22.3, and 26.5%,
respectively during rainy season; and those for branches/
plant, dry weight/plant, biomass per hectare, straw yield,
pods/plant, and seeds/plant at harvest in lentil were 8.8,
13.2, 8.7, 10.1 and 11.0%, respectively (Table 5). As a result,
there was significant increase in crop productivity for both
the crops (to the tune of 20.3% in soybean and 6.8% in
lentil) observed under the BBF plots alone compared to flat
planted plots (Table 4). Further, system productivity for
soybean-lentil in terms of SEY scaled up by 14.2% during
2016-17 under BBF compared to flat planting on the land
(Table 5).
Further study on efficiency factor on a system mode
(soybean -lentil) through economic advantages of BBF over
flat planting during 2015-16 revealed that net return was
improved considerably for soybean (15.0%), lentil (19.3%)
and system productivity (17.3% in soybean-lentil) (Table
3). Similar trend was observed during 2016-17 resulting in
increase in net return to the tune of 6.2% for system
productivity (soybean-lentil). Higher increases in net returns
caused similar alterations for BCR as it was favourably
improved in soybean although it did not reach to the level
of significance for lentil and total system productivity (TSP)
during 2015-16 and TSP during 2016-17 (Table 2, 5). Thus,
the study carried out for both the years (2015-17) suggested
that both the crops in soybean-lentil system could be taken
up in BBF as it had several advantages in terms of
favourable crop growth, growth attributes, yield traits, grain
yield, and economics (net return and BCR) under the existing
rainfed agro-ecological condition of central India (Singh et
al. 2016).
Conservation tillage : Reduced tillage (reshaping of BBFs
only, while one cultivator followed by plank under flat
configuration only at sowing of lentil during winter season),
in contrast to zero tillage (no tillage to either BBF or Flat),
had benefitted the crop in terms of crop growth and yield
attributes during 2015-16. Reduced tillage helped in aeration
for root proliferation as higher rainfall events in preceding
crop of soybean had made surface soil more compact and
impervious for rainfalls to penetrate deeper into the soil
strata. As a result, these beneficial effect resulted in higher
increases in plant height, branches/plant, straw yield
(21.2%), biomass at harvest (21.6%), pods/plant (16.5%),
seed weight/plant (8.7%), and 100-seed weight (5.1%) in
the growing crop of lentil during winter season compared
to zero tillage were apparent (Table 1,2). Subsequently, there
was significant increase in overall productivity of the crop
(Table 2). Thus, enhancement in productivity of lentil to
the tune of 22.1% and that of SEY by 10.5% were observed
under reduced tillage compared to zero tilled plots (Table
2). Further, increase in system productivity for soybean-
lentil scaled up net return of both lentil and soybean-lentil
system by 31.9 and 16.0%, respectively during 2015-16
under reduced tillage treatments (Table 3). The

Table 3. Economics of agro-technologies applied to the soybean-lentil system (2015-16)

Treatments Net Return (INR/ha) BCR
Kharif Rabi Total* Kharif Rabi Total*
Land configuration
Flat 15812 18091 33904 1.53 2.57 1.95
Raised bed 18177 21579 39756 1.60 2.68 2.05
CD (P=0.05) 386 NS 4763 0.03 NS NS
Conservation Tillage
Zero Tillage - 17106 34100 - 2.28 1.85
Reduced Tillage - 22566 39560 - 2.98 2.15
CD (P=0.05) 1975 1975 0.27 0.11
Priming
No Priming - 17483 34477 - 2.48 1.93
Priming - 20361 37355 - 2.83 2.07
Priming+Mulch - 23262 40256 2.90 2.13
Priming+ Fertilizers - 19499 36493 - 2.60 1.99
Priming+Urea (FS) - 18574 35568 - 2.32 1.88
CD(P=0.05) 3379 3378 NS NS
Interaction NS NS NS NS
CD (0.05) (T x P)
* Mean values are taken for tillage and priming to arrive at total net return and BCR
 Praharaj et al. : Enhancing farm income and system productivity in soybean-lentil under rainfed Central India 45

corresponding values for improvement in BCR following compared to reduced tilled plots (Table 6). The
reduced tillage compared to zero tillage were 30.7 and 16.2%, corresponding values for improvement in BCR following
respectively (Table 3). zero tillage compared to reduced tillage were 14.6, 9.9 and
On the contrary, reverse trend (zero tillage being 11.3%, respectively (Table 6). Thus, the study carried out
better) was evident during 2016-17 also (Table 5). This might for both the years (2015-17) suggested that both soybean
be due to more or less stability of the soybean-wheat and lentil in soybean-lentil could be taken up with
cropping system over the years and the preceding soybean- conservation tillage depending on suitability site (here, zero
lentil-soybean crop growth during the last and current year tillage under clayey soils on reshaped BBFs) as it had
(2015-17). As earlier discussed, reshaping of BBF during several advantages in terms of favourable crop growth,
rainy season for soybean sowing made during 2016-17 had growth attributes, yield traits, grain yield, and economics
also advantages of higher crop growth and development. (net return and BCR) under the existing rainfed agro-
As a result of successive and subsequent crop management ecological condition of central India (Singh et al. 2016, Singh
during preceding season, there was also better weed control 2018) .
in the experimental plots. Further, there was higher moisture Seed priming and mulch: Here, several agrotechniques of
content in soil profile in the undisturbed soil following zero placing seed in soil were tried to evaluate the effect of the
tillage practice compared to reduced tillage. As a result of same on plant stand and further on crop growth and
all these effects, the performance of lentil was superior in development including yield formation (Singh et al. 2016).
terms of its growth and yield parameters. Consequently, These include innovative treatment combination such as
higher straw yield (27.2%), biomass at harvest (18.6%), and priming of lentil seeds with water for 4 hours such as placing
dry weight/plant (5.5%) in lentil were observed under zero seed at 10 cm soil depth (PSD), seed priming and PSD (PPSD),
tillage during winter season of 2016-17 compared to reduced seed priming and placing seed under mulch (PPSDm), seed
tillage (Table 4,5). In addition, there was significant increase priming and placing seed in furrows with fertilizer (PPSDf),
in overall productivity of lentil to the tune of 7.5% and that and seed priming and placing seed at 10 cm soil depth with
of SEY by 9.2% observed under zero tillage compared to foliar spray of 2% urea at pod development.
reduced tilled plots (Table 5). Further, increase in the system Seed priming (for 4 hours) was useful under rainfed
productivity for soybean-lentil scaled up net return for condition as was evident from Table 2, 3, 5 and 6. However,
soybean, lentil and soybean-lentil system by 14.9, 9.8 and when it was combined with mulch it had additional
11.4%, respectively during 2016-17 under zero tilled plots
Table 4. Effect of land configuration on soybean and its harvest attributes during 2016-17
Treatments Seed yield Straw Biomass at Seeds/ Plant Branches/ Pods/ Seeds/
(kg/ha) yield harvest plant height plant plant pod
(kg/ha) (kg/ha) (cm)
Land configuration
Flat 1574 2937 4511 57.3 32.1 2.64 52.3 1.84
BBF 1894 3289 5182 72.5 32.6 2.73 59.5 1.86
SE(m±) 53.8 113 129 3.21 0.54 0.07 1.23 0.02
CD (0.05) 156 329 374 9.33 NS NS 3.58 NS
Table 5. Effect of land configuration, tillage and seed priming on lentil biometrics and yield (2016-17)
Treatment Lentil yield Straw yield Biomass Plant Branches/ Pods/ Dry wt./ Seeds/ 100- SEY Total yield
(kg/ha) (kg/ha) (kg/ha) height plant plant plant (g) pod seed of lentil (SEY,
(cm) wt. (g) (kg/ha) kg/ha)
Land configuration
FLAT 887 1223 2110 38.9 3.31 31.7 7.31 1.28 2.82 1263 2837
BBF 947 1347 2294 41.1 3.60 35.2 7.60 1.30 2.76 1348 3241
CD (0.05) 39.4 71.4 106 NS NS NS 0.20 NS NS 56.3 386
Conservation Tillage
Zero Tillage 950 1439 2390 40.8 2.57 33.5 7.70 1.30 2.75 1353 3173
Reduced Tillage 884 1131 2015 39.3 3.35 33.3 7.30 1.28 2.82 1258 2905
CD (0.05) 42.2 264 291 NS 0.18 NS NS NS NS 60.2 215
Priming
No priming 801 1052 1853 38.5 3.23 28.8 7.22 1.27 2.77 1140 2816
Priming (P) 936 1216 2150 39.2 3.50 32.5 7.59 1.30 2.79 1330 3051
P + Mulch 1002 1632 2634 42.5 3.90 37.3 7.81 1.31 2.79 1426 3266
P+ Fertilizer 928 1326 2255 39.6 3.33 34.9 7.29 1.29 2.78 1321 3023
P+ Urea (FS) 921 1200 2121 40.4 3.33 33.6 7.36 1.28 2.80 1310 3038
CD (0.05) 83.2 332 366 NS 0.34 5.10 0.43 NS NS 118 230
Interaction effect is not significant; SEY: Soybean Equivalent yield
46 Journal of Food Legumes 33(1), 2020

Table 6. Economics of treatments applied to the soybean-lentil system (2016-17)

Treatments Net Return (INR/ha) BCR
Rainy season Winter season Total Rainy season Winter season Total
Land configuration
Flat 13280 27019 40299 1.17 3.36 2.08
BBF 13422 29356 42778 1.05 3.65 2.05
CD (P=0.05) NS 1563 NS 0.10 0.18 NS
Conservation Tillage
Zero Tillage 14275 29503 43778 1.18 3.67 2.17
Reduced Tillage 12427 26872 39299 1.03 3.34 1.95
CD (P=0.05) 1171 1666 2837 0.10 0.20 0.14
Priming
No Priming 10120 24129 34249 0.84 3.22 1.75
Priming 13831 29211 43041 1.15 3.79 2.18
Priming + Mulch 15699 31070 46770 1.30 3.66 2.27
Priming+ Fertilizers 13657 28664 42331 1.13 3.58 2.11
Priming+ Urea (FS) 13447 27864 41311 1.12 3.28 2.00
CD(P=0.05) 2307 3284 5592 0.20 0.40 0.28
Interaction (P=0.05) T x P NS NS NS NS NS NS

Table 7. Crop (kg/ha) response to different treatments (pooled data) in soybean-lentil (2015-17)
Treatments Soybean Lentil Soybean-lentil Net return BCR
Grain yield* (SEY) (SEY) (INR)
Land configuration
Flat 1268 1102 2370 37101 2.01
BBF 1490 1228 2718 41267 2.05
C.D. (0.05) 190 62.6 214 2405 NS
Conservation Tillage
Zero Tillage - 1138 2560 38939 2.01
Reduced Tillage - 1193 2529 39429 2.05
CD (P=0.05) - NS NS NS NS
Priming
No Priming - 1029 2379 34364 1.84
Priming - 1181 2554 40198 2.12
Priming+ Mulch - 1299 2731 43513 2.20
Priming+ Fertilizers - 1166 2529 39407 2.05
Priming+ Urea (FS) - 1153 2530 38439 1.95
CD(P=0.05) - 80.9 122 3089 0.16
** Mean values are taken for tillage and priming to arrive at soybean grain yields (realized during rainy season).

advantages. As there was scanty rainfall during winter
season (15.4 mm), it resulted in better germination and
proper plant stand under rainfed agroecology of the region.
The study indicated that seed priming with soaking in water
for 4 hours and placement of seed under mulch at 10 cm soil
depth resulted in significantly higher yield (974 kg/ha) of
lentil over the rest of the priming treatments including
control during 2015-16 (Table 2). As a result, significantly
higher total yield (soybean-lentil) was obtained under the
treatment (2195 kg/ha in terms of SEY). Similar benefits were
also obtained in other plant growth and development
attributes (Table 3) including plant height (10.7%), branches/
plant (23.1%), straw yield (27.7%), biomass at harvest
(27.6%), pods/plant (36.5%), seed weight/plant (15.3%), and
100-seed weight (15.5%) in lentil under PPSDm compared
to PSD during winter season (Table 2,3). These further raised
lentil and system productivity by 27.7 and 13.1% under
PPSDm over the control (PSD). The corresponding values
for improvement in net return and BCR following PPSDm
compared to PSD in soybean-lentil system were 16.8 and
10.4%, respectively (Table 3). This was in fact due to
increase in net returns accrued for both lentil (19.3 and
33.1%) and total system productivity (17.3 and 16.8%)
following imposition of treatments (viz., BBF and priming
with mulching) during 2015-16.
Similar was the trend during 2016-17 also where
PPSDm had an edge over others in terms of growth and
yield attributes of soybean (2 nd year crop), lentil and
soybean-lentil system as a whole. As a consequence of
this, increase in lentil biomass at harvest (42.1%), straw
yield (55.1%), pods/plant (29.5%), and dry weight/plant
(8.2%) during winter season were also evident.
Consequently, there was significant increase in crop
productivity for both lentil and soybean-lentil system to
the tune of 25.1 and 16.0%, respectively observed under
PPSDm over that in PSD (Table 4, 5). Further, economics
and BCR of the soybean-lentil system improved
considerably to the extent of 36.6 and 29.7% during 2016-
17 under the former compared to the latter (Table 6). This
was affected in fact due to higher net return obtained under
PPSDm to the tune of 55.1 and 28.8 in soybean and lentil,
respectively (Praharaj and Blaise 2016). Similar values in
case of BCR (54.8 and 13.7 in soybean and lentil,
 Praharaj et al. : Enhancing farm income and system productivity in soybean-lentil under rainfed Central India
respectively) were obtained (Praharaj et al. 2017b). Similarly,
pooled data for two years (2015-17) indicated and confirmed
that significantly higher crop productivity could be realised
under BBF over flat planting during both season in
soybean- lentil system (Table 7). This had resulted in
significantly higher system productivity obtained in
soybean-lentil under BBF. Thus, conservation tillage (zero
or reduced tillage) was found to be advantageous as evident
from yield and economics (Table 7). Therefore, seed priming
in water (for 4 hours) was useful under rainfed condition;
and its combination with mulch, further, had additional
advantages (water saving, yield and economics).
Thus, it is inferred from the above study that there
was ample possibility for sustainability of soybean-lentil
cropping system in rainfed Central India through improved
agro-technologies, such as BBF, conservation tillage, and
soaking lentil seeds in water for four hours and placing the
seeds in 10 cm soil under the mulch of soybean crop
residues retained in situ.
REFERENCES
Gangwar B and Prasad Kamta 2005. Cropping system management
for mitigation of second-generation problems in agriculture.
Indian Journal of Agricultura1 Sciences 75(2): 65-78.
Jat Ram Lal and Praharaj CS. 2018.Impact of zinc and molybdenum
with manure in soybean-chickpea system in vertisols of Central
India. Journal of Food Legumes 28(3): 147-153.
Praharaj CS, Kumar Rajesh, Akram M, Jha UC, Singh Ummed, Kumar
Narendra, Singh SS and Singh SK. 2015. Dissemination of pulses
production technologies for enhancing profitability of farmers
in Uttar Pradesh. Journal of Food Legumes 28(2): 157-61.
47
Praharaj CS, Singh Ummed, Singh SS and Kumar N. 2017a. Micro-
irrigation in rainfed pigeonpea-Upscaling productivity under
Eastern Gangetic Plains with suitable land configuration,
population management and supplementary fertigation at critical
stages. Current Science 112(1): 95-107.
Praharaj CS, Singh Ummed, Singh SS and Kumar N. 2018. Tactical
water management in field crops: the key to resource
conservation. Current Science 115(7): 1262-1269.
Praharaj CS and Blaise D. 2016. Intercropping: An approach for
area expansion of pulses. Indian Journal of Agronomy (4th IAC
Special issue) 61: S113-S121.
Praharaj CS, Singh SS, Jat RL, Singh Ummed, Singh NP, Elanchezhian
R and Singh RP 2017b. Pulses based systems for sustaining
soybean in Central India. Indian Farming 67(05): 02-05.
Ramesh P, Panwar NR and Singh AB. 2010. Crop productivity, soil
fertility and economics of soybean (Glycine max), chickpea
(Cicer arietinum) and blond psyllium (Plantago ovata) under
organic nutrient management practices. Indian Journal of
Agricultural Sciences 80(11): 965–9.
Singh NP, Praharaj CS, Singh SS, Jat Ram Lal, Singh Ummed, Singh
RP and Elanchezhian R. 2016.Sustaining soybean system in
Central India with Pulses. ICAR NEWS 22(3): 1-3.
Singh Ramadhar, Singh Karan and Bhandarkar, DM. 2014. Estimation
of water requirement for soybean (Glycine max) and wheat
(Triticum aestivum) under vertisols of Madhya Pradesh. Indian
Journal of Agricultural Sciences 84(2): 190–7.
Singh Ummed, Praharaj CS, Singh SS, Hazra KK and Kumar N.
2018. Up-scaling nutrient, energy and system productivity of
pigeonpea-wheat cropping system in Indo-Gangetic plains of
India. Journal of Environmental Biology 39: 647-658.
Praharaj CS and Dhingra KK. 2001. Growth, productivity and BNF
in soybean (Glycine max L. Merr.) under Bradyrhizobium
inoculation, pendimethalin and nitrogen schedules and their
residual effect on succeeding wheat (Triticum aestivum L.) crop.
Indian Journal of Agronomy 46(4): 635-642.
Journal of Food Legumes 33(1): 48-52, 2020
Assessment of biocontrol potential of Trichoderma isolates against wilt in pulses
RK MISHRA, SONIKA PANDEY, MONIKA MISHRA, US RATHORE, NAIMUDDIN,
KRISHNA KUMAR and BANSA SINGH
ICAR-Indian Institute of Pulses Research, Kanpur-208024, India; E-mail: rajpathologist@yahoo.com
(Received : December 1, 2019; Accepted : February 14, 2020)
ABSTRACT
Potentiality of Trichoderma isolates was assessed against
wilt pathogen of pulse crops. Trichoderma spp. were identified
by DNA bar-coding based on the sequences of internal
transcribed spacers regions; and characterization of ech-42
and xyn-2 gene was also done for the Trichoderma spp. Among
the 14 tested Trichoderma isolates, IIPRTh-33, IIPRRTas-8
and IIPRTas-13 showed the presence of xyn-2 genes. While
the seven isolates (IIPRTh-33, IIPRTas-8, IIPRTas-13,
IIPRTh-31, IIPRTg-3, IIPRTh-38, IIPRTh-20) showed the
presence of ech-42 gene. The highest chitinase and xylanase
activity was observed in IIPRTh-33 and IIPRTh-31. All the
isolates were also screened for siderophore and IAA
production. Ethyl acetate extract of two Trichoderma isolates
(IIPRTh-31 and IIPR.Tg-3) yielded more than 43 metaboilites
out of which 2H-Pyran-2- one and 1,2-benzenedioxylic acid
esters, Benzaldehyde, 4-nitro- tetradecanoic acid3-methyl-
heptadecanol, methyl cyclohexane, 6-nonylene alcohol,
methyl-cyclopentane, 2-methyl heptadecanol, N-methyl
pyrollidine, dermadin, ketotriol, koningin-A, palmitic acid,
3-(2’-hydroxypropyl)-4-(hexa-2’-4- dineyl)-2-(5H)-furanone,
Phenylethyl Alcohol and 3-(propenone)-4-(hexa- 2’-4’-
dineyl)-2-(5H)-furanone were reported to have antifungal
activity of Trichoderma isolate. Trichoderma isolates IIPRTh-
31 was tolerant to heat shock of 50°C and observed to be
superior salt-tolerant among all the tested isolates.
Key words: Antibiosis, Biocontrol, Metabolites,
Mycoparasitism, Trichoderma, Wilt disease
Trichoderma is known as well-established promising
biological control agents worldwide and they also produced
several secondary metabolites with potential applications
as novel antibiotics. They are well known producers of
chitinolytic enzymes and are used commercially as a source
of these enzymes. Additional interest in these enzymes is
stimulated by the fact that chitinolytic strains
of Trichoderma are  among  the  most  effective  biological
control agents of many plant pathogens (Harman et al. 1993,
Vinale et al. 2009, Agrawal & Kotasthane 2009, Karlsson et
al. 2010,  Singh  et al. 2016). More than 100 species of
Trichoderma have been phylogenetically characterized.
There are different formulations which are available in
market commercially for crop production worldwide
(Harman 2000). Trichoderma have been widely used for
the management of several phytopathogens. Wilt is the
most difficult and challenging soilborne disease in terms of
management. Chemicals are widely used for the control of
this disease but they cause a great loss to the environment
also. So, there is a need to explore Trichoderma species
effective against Fusarium wilt. Among various biocontrol
agents (BCAs) Trichoderma spp. has been widely exploited
for their biocontrol ability in different crop to manage the
different pathogens (Abd El-Khair et al. 2010, Mohiddin et
al. 2010, Papavizas et al. 1984, Papavizas 1985, Harmon
2006, Harman et al. 2004, Verma 2007, Mishra and Gupta
2012, Mukherjee et al. 2013, Mishra et al. 2016, 2017, 2018a,
2018b). Trichoderma isolates trigger induce resistance in
plants and protect the plant from pathogens. During the
induced systemic resistance plants produce and accumulate
metabolites and enzymes which play important role in
defense mechanisms such as PAL, SOD, PR-Protein etc.
The indigenous strains of Trichoderma spp. seems to
function better as they are widely adapted to local
environmental conditions. No significant studies pertaining
to identification of indigenous potential Trichoderma spp
from pulses rhizosphere and their exploitation. Therefore,
the aim of the present manuscript was to identify and
characterize the potential Trichoderma species and to check
their efficacy against wilt pathogen of chickpea, pigeonpea
and lentil.
MATERIALS AND METHODS
A total 13 isolates of Trichoderma (Table 1) collected
from the pulse rhizosphere of different locations of Uttar
Pradesh and stored in the Crop Protection Division of ICAR-
IIPR Kanpur. Fusarium oxysporum f. sp. ciceri, Fusarium
udum and Fusarium oxysporum f. sp. lentis were isolated
from the research farm of ICAR-IIPR Kanpur. Molecular
strain identification was done on the basis of ITS region of
ribosomal RNA gene cluster amplification (Hassan et al.,
2014). The ITS region was amplified using the following
programme 3 min at 94 °C followed by 35 cycles each of 30
s at 94 °C, 30 s at 55 °C, 1 min at 72 °C and, finally extension
of 10 min at 72°C. The PCR products were checked on 1%
agarose gel, sequencing of the PCR products was done
from Chromus Biotech Pvt. Ltd. Isolated Trichoderma
species along with standard Trichoderma strains were
checked for their antagonistic potential against the
pathogen by binary culture test. For the test we take a 7mm
disc of actively growing Trichoderma from the culture plate
and inoculate it on a fresh and sterile PDA plate and on the
opposite end we inoculate the test pathogen (Upadhyay
and Rai, 1987). The main aim of this study was to check the
 Mishra et al. : Assessment of biocontrol potential of Trichoderma isolates against wilt in pulses
mycelial growth inhibition of Fusarium spp. by Trichoderma
isolates. The experiment was replicated thrice and percent
growth inhibition was calculated.
The endochitinase gene was amplified using the
primer 5’- CTTGTAGTCCCAAATACCGTTCTCCCA -3’and
R: 5’- GCAAACGCCGTCTACTT CACCAACTGG -3’. The
PCR cycle was as follows: 5 min at 94°C,1 min 95 °C ,2 min
at 50°C, and 2 min at 72°C for 30 rounds. The extension
period was 7 min at 72°C (Carolina Carsolio et al 1994) and
xyn-2 gene using the primer 5’-GTAGGTTACGTCTGACGG-
3’ and R: 5’-CCGTGAGGAAGCCCAGTC-3. The PCR
conditions was as follows: 5 min at 94°C,1 min 94 °C,2 min
at 51°C, and 1 min at 72°C and The extension period was 7
min at 72°C for 30 rounds. The raw sequence reads of ITS,
ech42 and xyn-2 were checked for quality, trimmed, manually
edited and assembled using CLC Genomics Workbench 7.5
(CLCBio, Aarhus, Denmark). To conduct taxonomic
identification, publicly available sequences deposited at
NCBI (www.ncbi.nlm.nih.gov) by using a basic local
alignment search tool (BLAST) (Altschul et al. 1997).
Trichoderma sp isolated from the chickpea
rhizosphere were maintained on agar. For enzyme
production test the TLE medium containing 1% of either
chitin, potato starch, cellulose, xylan (pH 5) was inoculated
with spore conc. of 3 x 107 spores (in one mL of saline).
Cultures were then incubated for 7 days at rotatory shaker
(120rmp) at 28°C. After 7 days culture supernatant was
filtered with what man filter paper and centrifuged to remove
spores and stored at -21°C until the use. Chitinase activity
was assayed at 37°C by monitoring the amount of reducing
sugar N-acetyl glucosamine using p-nitro phenol. -1,3
glucanase activity was determined based on the release of
reducing sugar laminarin. One unit of enzyme was defined
as the amount of enzyme necessary to produce 1 µmol of
reducing sugar in one minute (chitinase and -1,3-
glucanase). Total cellulase activity was determined by
measuring the amount of reducing sugar formed from filter
paper (Ximenes et al. 1995). One unit of total cellulase
activity correspond to the amount of reducing sugar
produced in one minute. Endoglucanase activity was
determined using the method of Janice et al. 2003. One unit
of endoglucanase activity was defined as the amount of
protein necessary to produce one mmol of reducing sugar
in one minute. -glucosidase activity (cellobiosidase) was
assayed by measuring production of glucose from
cellobiose (Ximenes et al. 1995). One unit of cellobiosidase
or aryl- -glucosidase activity was defined as the amount
of protein necessary to produce 1 mmol of glucose or p-
nitrophenol respectively, in one minute. Xylanase activities
were assayed by measuring the amount of reducing sugars
released from xylan, respectively, using dinitro salicylic acid
(DNS) assay as described by Bailey et al. 1992. Briefly,
0.5 mL of culture supernatant was added to 1 mL of 0.05 M
citrate buffer of pH 4.8. To this mixture, 0.5 mL of 1% w/v
beech wood xylan was added as a substrate for xylanase
49
assay. All the samples were incubated at 50°C for 30 min.
To this, 2 mL of DNS reagent was added, heated in water
bath at 90°C for 10 min and cooled immediately and the
absorbance was measured in a spectrophotometer at
550 nm.
The IAA production ability of Trichoderma was
assayed supplementing the basal media with 0.5 mgmL-1of
L–tryptophan and incubating at 28ºC for 3 days under
shaking conditions (120 rpm). After 3 days culture broth
was obtained and centrifuged for the removal of spores.
Sopre free supernatant was used for the IAA test as
described by Nathan Vinod Kumar et al. 2017.
Quantification of siderophore enzyme was done by CAS
shuttle assay (S. M. Pyne 1995). 0.5 mL of culture
supernatant was mixed with 0.5 mL of CAS reagent and
absorbance was measured at 630 nm against a reference
consisting of 0.5 mL of uninoculated broth and 0.5 mL of
CAS reagent. Siderophore content was calculated by using
following formula:
% Siderophore content = AC–AT/AC × 100
Where AC=Absorbance value of Control and AT=
Absorbance value of treatment
For the extraction of volatile compounds two most
effective Trichoderma species (IIPRTg-3 and IIPRTh-31)
were inoculated into 500 ml of PDB medium and incubated
28°C for 25 days. After incubation period completed
contents of the flasks were filter through muslin clothes.
The liquid phase obtained after filtrations was used for
extraction. Extraction was done with ethyl acetate (1:1).
Upper phase of the solvent which contain volatile
compounds was collected through the separating funnel.
Solvent was removed from the collected phase and obtained
residue is dissolved in acetone. This sample was then used
for GC-MS analysis. To identify the thermo tolerant
Trichoderma isolate conidial thermotolerance test was used.
A conidial suspension containing 1×1010 conidia per ml
was prepared and inoculated into the culture vials
containing PDB. This inoculated PDB was exposed to heat
shock for 1, 2 and 4 h at 48,50 and 52ºC (Sowmya Poosapati
et al. 2014). Three replicates for each treatment were used.
After heat shock treatment 1ml from each culture vial was
serially diluted and plated on the PDA plates.
RESULTS AND DISCUSSION
Bio-control agent Trichoderma has gained
importance as a substitute of chemical pesticides and hence
an attempt was intended to corroborate the positive
relatedness of molecular and morphological characters.
Molecular identification of Trichoderma isolates was done
using ITS primers (Anderson and Stasovski, 1992).
Obtained Nucleotide sequences were used for the species
level identification (Table 1). All 13 isolates belong to
species T. harzianum, T. longibrachiatum, T. asperellum
and T. afroharzianum.
50 Journal of Food Legumes 33(1), 2020

Table 1. Origin of the Trichoderma strains used in this Table 2. In vitro antifungal activity of Trichoderma isolates
study and sequences from NCBI GenBank against Fusarium spp.
accession numbers
Sl Trichoderma Inhibition in Inhibition in Inhibition in
Isolates Name Name of SpeciesNCBI GenBank accession No isolate mycelial mycelial mycelial
number growth of Fu growth of growth of Fol
ITS Isolation through Foc through through
sources binary binary binary
culture assay culture assay culture assay
IIPRTh-33 T. afroharzianum MN186847 Chickpea
IIPRTas-8 T. asperellum KX681721 Pigeonpea 1 IIPRTh-31 80.6 82.3 83.75
IIPRTas-13 T. asperellum KX681731 Pigeonppea 2 IIPRTh-33 75.89 83.56 85.67
IIPRTh-31 T. asperellum MK968811 Chickpea 3 IIPRTh-38 75.90 74.90 72.15
IIPRTg-3 T.longibrachiatum MH511661 Pigeonpea 4 IIPRTg-3 68.90 70.16 76.34
IIPRTh-38 T. harzianum MK970735 Chickpea 5 IIPRTas-13 69.00 65.89 73.45
IIPRTh-20 T. harzianum MH511669 Pigeonpea 6 IIPRTas-8 61.32 66.75 65.40
IIPRTh-3 T. harzianum KX681710 Fieldpea 7 IIPRTh-3 68.79 68.90 73.67
IIPRTh-23 T. harzianum MH511673 Pigeonpea 8 IIPRTh-23 72.30 73.21 69.80
IIPRTas-1 T. asperellum KX681709 Lentil 9 IIPRTh-20 71.45 74.40 70.78
IIPR-59 T.longibrachiatum MK849898 Chickpea 10 IIPRTas-1 76.21 74.89 72.67
IIPR-72 T.longibrachiatum MK849904 Chickpea 11 IIPR-59 64.44 62.44 71.11
IIPR-74 T. asperellum MK849905 Chickpea 12 IIPR-72 68.89 64.44 66.67
TH-10 NBAIR - - - 13 IIPR-74 73.32 61.63 62.79
14 TH-10 NBAIR 60.15 64.33 69.60
Most of the Trichoderma isolates studied in this work Trichoderma species have been reported for the
were able to control the growth of tested pathogen. The biostimulation of plant growth and development of a wide
mycelial inhibition percentage was found maximum for Th- variety of plants (Harman et al. 2004; Bhardwaj et al. 2014;
31 (80%, 82.30 and 83.75), for remaining isolates it was found Kumar et al. 2020). There are several mechanisms which
between 65 to 75% (Table 2). The differences observed in are involved in the growth promotion like mineral
vitro assays might be due to the variability in genotypes. solubilzation and uptake and increasing plant nutrient
In vitro antagonistic activity of Trichoderma isolates uptake (Altomare et al. 1999), secretion of phytohorrmones
indicates their potential to inhibit pathogen growth in field. like IAA and enzymes leading to stronger root and shoot
However, the in vitro activity of Trichoderma isolates does development. (Vinale et al. 2008a; 2012) in the present study
not correlate directly with the in vivo ability to control isolated Trichoderma species shows the production of
pathogens since many other factors influence the activity siderophore and IAA (Table 2).
of pathogens (Anees et al. 2010).
Among the 13 tested Trichoderma isolates with one
Trichoderma species are well known for their check, 7 isolates (IIPRTh-33, IIPR.Tas-8 and IIPR.Tas-13)
biocontrol potential. In the present study tested showed the presence of ech-42 and xyn-2 genes. While the
Trichoderma species shows the production of chitinase remaining three isolates (IIPRTh-33, IIPRTas-8 and IIPRTas-
and xylanase enzyme. Chitinase and xylanase enzyme are 13) showed the presence of only xyn-2 gene. The
thought to play an important role in mycoparasitism Trichoderma chitinase and xylanase enzyme activity was
between phytopathogens and Trichoderma. In the present monitored for all isolates under study. The highest chitinase
study isolated Trichoderma species found to produce the and xylanase activity was observed in IIPRTh-33 and
substantial amount of these enzymes (Table 3). Chitin and IIPRTh-31. All the isolates were also screened for plant
xylan are the main components of fungal cell walls and growth promotion enzyme production (Siderophore and
Trichoderma species are the potent producer of these IAA) Table 3. In Trichoderma there are many volatile
enzymes. metabolites which have been reported to play an important
role in the mycoparasitic action there are around more than
40 metabolites in Trichoderma which help in mycoparasitism
(Sivasithamsaran and Ghiberti in 1998). The GC-MS
analysis of partially purified crude extract of Th-.31.IIPR
and IIPR.Tg3 yields around 43 compounds out of which 1,
2- benzenedicarboxylic acid reported in this study is well
known for its antimicrobial activity and 2H-Pyran-3-ol,
which act as plant growth regulator and helpful in mycotoxin
detoxification also identified from culture filtrate of
Trichoderma strain. Results of conidial thermo tolerant
test clearly indicate that IIPRTh-31 and IIPRTas-1 are
Fig. 1: Growth pattern of Trichoderma colonies in PDA different from all the other tested isolates IIPRTh-31 was
medium able to grow after the heat shock treatment at 50ºC for 4
 Mishra et al. : Assessment of biocontrol potential of Trichoderma isolates against wilt in pulses 51

Table 3. Plant growth promoting enzymes and Mycoparasitic enzyme quantification of Trichoderma isolates
Isolate Name Growth promoting enzyme Mycoparasitic enzyme
Sidrophore IAA Xylanase Chitinase Endoglucanase FPAase Β-glucosidase Β-1,3 glucanase
(%) (ug/ml) (IU/ml/min) (mg/ml) (IU/ml/min) (IU/ml/min) (IU/ml/min) activity
(IU/ml/min)
IIPRTh-33 6.54 2.8 1.813 110 1.168 2.594 0.578 0.867
IIPRTas-8 22.55 2.8 1.013 50 0.827 2.057 0.620 0.743
IIPRTas-13 4.00 2.03 1.253 50 0.0651 2.16 0.651 2.52
IIPRTh-31 24.168 3.2 2.344 98 0.640 2.057 0.661 0.671
IIPRTg-3 14.55 2.6 1.529 45 0.671 2.170 0.609 0.836
IIPRTh-38 19.17 3.6 1.469 50 1.064 5.68 0.630 1.41
IIPRTh-3 28.84 4.0 0.999 50 0.827 1.943 0.630 0.960
IIPRTh-23 19.54 1.6 1.410 40 0.713 2.067 0.584 0.836
IIPRTh-20 27.82 2.8 1.43 45 0.651 2.046 0.568 1.260
IIPRTas-1 22.40 3.2 1.328 40 0.992 2.057 0.568 1.01
IIPR-59 14.96 4.6 0.121 38 0.568 2.098 0.532 1.177
IIPR-72 11.01 2.8 0.061 45 0.889 2.86 0.558 1.446
IIPR-74 13.04 3.2 0.087 60 0.723 1.974 0.568 0.775
TH-10 NBAIR 8.10 1.6 1.678 42 0.068 1.343 0.558 0.360

Bhardwaj D, Ansari MW, Sahoo RK and Tuteja N. 2014. Biofertilizers

Fig. 2: Microscopic variability between control (A) and heat
treated Trichoderma isolate (B)
hours while IIPRTas-1 was able to sustain heat shock at
50ºC for 2 hours. The heat tolerant colonies when culture
on PDA plates it shows morphological features different
from the wild type reduced sporulation, and decreased
hyphal growth were also observed in the heat tolerant
isolate after heat shock (Fig. 1).
REFERENCES
Altomare C, Norvell WA, bjorkman T and Harman GE. 1999.
Solubilization of phosphates and micronutrients by the plant-
growth-promoting and biocontrol fungus Trichoderma
harzianum rifai Applied Environmental Microbiology 65: 2926-
2933.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W
and Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids
Research 25: 3389–3402.
Anderson JB and Stasovski E. 1992. Molecular phylogeny of Northern
hemisphere species of Armillaria. Mycologia 84: 505–516.
Anees M, Tronsmo A, Hermann VD, Hjeljord LG, Héraud C and
Steinberg C. 2010. Characterization of field isolates of
Trichoderma antagonistic against Rhizoctonia solani. Fungal
Biology 114: 691-701.
Bailey MJ, Biely P and Poutanen K. 1992. Inter laboratory testing
of methods for assay of xylanase activity. Journal of
Biotechnology 23: 257-270.
function as key player in sustainable agriculture by improving
soil fertility, plant tolerance and crop productivity. Microbiology
Cell Facter 13: 1-10.
Carolina C, Ana G, Beatriz J, Marc VM and Alfredo HE. 1994.
Characterization of ech42, a Trichoderma harzianum
endochitinase gene expressed during mycoparasitism. Proceeding
of National Academy of Science, USA 91:10903-10907.
Chet I and Inbar J. 1994. Biological control of fungal pathogens.
Applied Biochemistry and Biotechnology 48: 37-43.
Cook RJ. 1993. Making greater use of introduced micro-organisms
for biological control of plant pathogens. Annual Review of
Phytopathology 31: 53-80.
Gary H. 2000. Myths and Dogmas of Biocontrol Changes in
Perceptions Derived from Research on Trichoderma harzinum
T-22. Plant Disease 84: 377-393.
Harman GE, Howell CR, Viterbo A, Chet I and Lorito M. 2004.
Trichoderma species-opportunistic, avirulent plant symbiont.
Nature Review of Microbiology 2: 43-56.
Hassan MM, Gaber A and El-Hallous EI. 2014. Molecular and
morphological characterization of Trichoderma harzianum from
different Egyptian soils. Wulfenia 21: 80-96.
Janice L, De M, Maria C, Valadares I and Carlos RF. 2003. Production
of hydrolytic enzymes by Trichoderma isolates with antagonistic
activity against Crinipellis perniciosa, the causal agent of witches’
broom of cocoa. Brazilian Journal of Microbiology 34: 33-38.
Larkin RP and Fravel DR. 1998. Efficacy of various fungal and
bacterial biocontrol organisms for control of Fusarium wilt of
tomato. Plant Disease 82: 1022-1028.
Mishra RK, Monika Mishra, Naimuddin and Krishna Kumar.
2018a.Trichoderma asperellum: A potential biocontrol agents
against wilt of pigeonpea caused by Fusarium udum Butler.
Journal of Food Legumes 31(1): 50-53.
Mishra, RK and Gupta RP. 2012. In vitro evaluation of plant extracts,
bio-agents and Fungicides against purple blotch and Stemphylium
blight of onion. Journal of Medicinal Plants Research 6(48):
5840-5843.
Mishra RK, Bohra A, Naimuddin, Krishna Kumar, Sujayanand GK,
PR Saabale, Satheesh Naik SJ, BK Sarma, D Kumar, Monika
Mishra, DK Srivastava and NP Singh. 2018b. Utilization of
biopesticides as sustainable solutions for management of pests
52 Journal of Food Legumes 33(1), 2020
in legume crops: achievements and prospects. Egyptian Journal.
Biological Pest Control (DOI 10.1186/41938-017-0004-1).
Mishra, RK, Naimuddin, Monika Mishra and Sandeep Sharma. 2017.
Trichoderma: Potential biocontrol agents for pulses. Dalhan
Alok 14: 80-86.
Mishra, RK, Naumuddin, Mohd. Akram, DK Sachan, Monika Mishra
and Krishna Kumar 2016. Characterization of Indigenous
Trichoderma spp through ITS based sequences. Pulses News Letter
27(2): 5.
Monte E. 2001. Understanding Trichoderma, between biotechnology
and microbial ecology. International Microbiology 4: 1-4.
Nathan VKK, Subha R and Mary ER. 2017. Plant Growth Promotion
efficacy of Indole Acetic Acid (IAA) produced by a mangrove
associated fungi-Trichoderma viride VKF3. International Journal
of Current and Applied Microbiology 6: 2692-2701.
Pyne SM. 1993. Iron acquisition in microbial pathogenesis. Trends
in Microbiology 1: 66-69.
Sowmya P, Prasad DR, Dinesh KV and Sarada C. 2014. Selection of
high temperature and salinity tolerant Trichoderma isolates with
antagonistic activity against Sclerotium rolfsii. Springer plus 3:
1-1 1.
Upadhyay R, Rai B. 1987. Studies on antagonism between Fusarium
udum Butler and root region microflora of pigeonpea. Plant
Soil 101: 79-93.
Vinale F, Sivasithamparam K, Ghisalberti EL, Ruocco M, Wood S
and Lorito M. 2012. Trichoderma secondary metabolites that
affect plant metabolism. National Product Communication 7:
1545-155.
Vinale F, Sivasithamparamb K, Ghisalberti EL, Marra R, Barbetti
MJ, Li H, Woo SL and Lorito M. 2008a. A novel role for
Trichoderma secondary metabolites in the interactions with
plants. Physiology and Molecular Plant Pathology 72: 80-86.
Vincent JM. 1927. Distortion of Fungal hyphae in presence of certain
inhibitors. Nature 159: 850.
Vivek A, Jitendra K, Virendra SR, Om PS and Walia S. 2015.
Comparative evaluation of two Trichoderma Harzianum Strains
for major secondary metabolite production and antifungal
activity. National Product Research 29: 914-920.
Ximenes EA, Felix CR and Ulhoa CJ. 1996. Production of Cellulases
by Aspergillus fumigatus and characterization of one  -
glucosidase. Current Microbiology 33: 119-123.
Journal of Food Legumes 33(1): 53-55, 2020
Short Communication
Salt tolerance in mungbean genotypes for MYMV and grain yield
MANOJ KATIYAR and RAHUL KUMAR GUPTA
Chandra Shekhar Azad University of Agriculture & Technology, Kanpur, U.P., India; E-mail:
katiyar_manoj@yahoo.com
(Received : September 4, 2019; Accepted : December 12, 2019)
ABSTRACT
Eight genotypes of mungbean [Vigna radiata (L.) Wilczek] of
diverse genetic origin along with 3 farmers’ preferred
varieties were screened for salt tolerance with respect to
incidence of mungbean yellow mosaic virus (MYMV) and
grain yield at 4 pH levels (8.0, 8.5, 9.0 and 9.5) during rainy,
2018 and summer, 2019. Observations on MYMV were
recorded on 1-5 scale, 1 being resistant and 5 being
susceptible. The genotypes exhibited significantly variable
response towards salt tolerance. Salt stress along with high
temperature and osmotic stress severely limited the yield
during summer, but the average reduction in the measured
and observed traits was less during rainy season. The
reduction in the traits was observed at higher pH levels.
Moreover, this reduction was highly substantial at pH 9.5 as
compared to pH 8.5. Genotype EC 88 had significantly higher
yield along with resistance to MYMV in both the seasons.
Observations further suggested that screening of genotypes
for salt tolerance during summer season was more effective
than rainy season.
Key words: Grain yield, MYMV, Salinity stress
Mungbean is one of the most important pulse crops
of Vigna group cultivated across seasons (kharif, rabi,
spring/summer), cropping systems and a wide range of
agro-climatic regions of the country. It is grown in an area
of 4.24 million ha with total production of 2.41 million ton
and average productivity being 567 kg per ha. The stagnant
and unstable yield of this crop for several decades has
largely been accounted to its susceptibility to various biotic
and a biotic stresses at different growth stages. Among
biotic stresses, yellow mosaic disease caused by mungbean
yellow mosaic virus (MYMV) is the most destructive
disease and is widely prevalent in the entire country. The
extent of losses depends on severity of the disease and
genotype in question. In severely infected crop, MYMV
caused as high as 52.6 per cent yield loss. In highly
susceptible genotypes MYMV infection renders the crop
unproductive. Mungbean varieties when subjected to
multilocation testing did not show uniform reaction to
MYMV. The varieties found resistant or tolerant at one
location were susceptible at other locations and vice-versa.
This indicates the possibility of existence of strains in
MYMV. The disease is caused by several begomo-viruses
which are transmitted by white fly, Bemisia tabaci. The
variation in white fly biotype has been reported in India
wherein indigenous B. tabaci cryptic species Asia II 1 is
predominant in North India whereas Asia II 8 is predominant
in Southern India (Nair et al. 2020).
Among abiotic stresses, salinity stress is more
atrocious limiting growth and grain yield worldwide. Due
to natural salinity and human interference the arable land is
continuously transforming into saline that is expected to
have overwhelming global effect. Evaluation of crop plants
in saline environment will certainty provide suitable material
as a source of genes that can be integrated in salt sensitive
genotypes through breeding (Nair et al. 2012). The
understanding of salt stresses, however, still remains
incomplete because of the complexity of the process
presenting an ionic component on one hand and an osmotic
component on the other, which involves morphological,
physiological and metabolic changes. Due to complex
nature of salinity stress, little progress has been made in
developing salt tolerant mungbean varieties (Singh and
Singh 2011).
Keeping in view the above aspects, the present study
aimed to identify the most salt tolerant genotype(s)
possessing resistance to MYMV that can be used as parents
to introduce genes possessing salt and MYMV resistance/
tolerance in mungbean through breeding.
The experimental materials comprised of 8 genotypes
of mungbean (Vigna radiata L. Wilczek ) along with 3
farmers’ preferred varieties of diverse genetic origin viz.
PDM 139 (Samrat ), KM 2241 (Shweta) and IPM 02-3 were
grown in randomized block design (RBD) with 4 replications
during kharif, 2018 and summer, 2019 in fields with pH 8.0
(control), 8.5, 9.0 and 9.5 at Soil Salinity Farm , Dileep Nagar,
Kanpur. The sowing was done in July 2018 in all the four
fields during kharif season and in March 2019 in all the
fields during summer season. Each genotype comprised 3
rows with 3 m length keeping inter and intra-row spacing of
30 cm and 10 cm, respectively. Recommended package of
practices were adopted to grow a healthy crop. Incidence
of yellow mosaic virus (MYMV) was recorded when the
crop was in full bloom adopting a rating scales of 1-5
(1=resistant, 2= tolerant, 3=moderately tolerant, 4=
moderately susceptible and 5=susceptible). The grain yield
per plant (g) was recorded after the harvest of the crop.
The data were subjected to analysis of variance (ANOVA),
SE (m), CD and percent reduction in the observed trait with
increasing level of salinity over the control were worked out.
54 Journal of Food Legumes 33(1), 2020

Table 1. Reaction to MYMV (scale 1-5) of different genotypes at different salinity levels during kharif 2018 and summer 2019
Genotype pH 8.0 Kharif 2018 pH 8.0 Summer 2019
(Control) pH 8.5 pH 9.0 pH 9.5 (Control) pH 8.5 pH 9.0 pH 9.5
Pusa Vishal 2.00 3.00 4.00 4.00 2.00 3.00 3.00 3.75
EC 88 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00
SML 668 2.75 2.25 3.00 4.50 3.00 3.25 3.25 3.50
Jalgaon 4.75 4.75 4.75 4.75 4.75 3.25 4.75 5.00
I 51 1.00 1.00 1.00 1.75 1.00 1.00 1.00 1.00
IPM 99-125 2.50 2.75 3.75 4.75 3.50 3.25 4.25 4.25
I 10 1.00 1.00 1.00 1.75 1.00 1.00 1.00 1.00
Kopergaon 1.00 1.00 1.50 1.50 1.25 1.00 1.00 1.00
PDM 139 (ch) 2.50 3.00 3.50 4.25 3.25 3.25 3.75 4.25
KM 2241 (ch) 1.00 1.75 2.00 2.00 1.00 2.00 2.00 1.00
IPM 02-3 (ch) 1.75 2.00 2.50 3.50 2.25 2.75 3.75 3.25
SEm(+/-) 0.230 0.135 0.200 0.220 0.302 0.146 0.211 0.253
C.D. (0.05) 0.668 0.391 0.582 0.639 0.773 0.326 0.505 0.676

Table 2. Percentage reduction in grain yield per plant of different genotypes at different salinity levels during kharif 2018
and summer 2019
Genotype Grain yield at pH Percent reduction, Kharif 2018 Grain yield at pH Percent reduction, Summer 2019
8.0 (Control) pH 8.5 pH 9.0 pH 9.5 8.0 (Control) pH 8.5 pH 9.0 pH 9.5
Pusa Vishal 6.35 -31.50 -52.44 -54.02 5.85 -31.28 -34.19 -50.43
EC 88 10.37 -1.45 -1.26 -3.38 10.00 -7.02 -7.30 -8.50
SML 668 8.70 -24.14 -39.66 -53.79 8.12 -7.30 -14.16 -24.01
Jalgaon 3.85 -22.86 -47.35 -49.35 3.77 -9.81 -22.55 -36.34
I 51 10.35 -1.93 -2.12 -59.71 10.02 -7.68 -8.99 -14.97
IPM 99-125 8.67 -11.60 -15.89 -18.56 8.40 -9.88 -16.67 -26.79
I 10 11.60 1.98 -3.88 -12.50 11.17 -7.61 -11.19 -17.64
Kopergaon 9.00 -1.67 -2.37 -1.44 8.42 -8.16 -10.33 -15.68
PDM 139 (ch) 5.37 -8.38 -24.58 -40.41 5.07 -8.38 -22.09 -40.43
KM 2241 (ch) 6.72 -1.04 -17.41 -31.25 6.47 -10.36 -20.09 -33.23
IPM 02-3 (ch) 10.37 -21.70 -23.63 -34.23 9.77 -17.40 -32.45 -37.56
SEm(+/-) 0.183 0.192 0.102 0.666 0.204 0.210 0.193 1.113
C.D. (0.05) 0.439 0.467 0.497 1.933 0.546 0.513 0.436 0.921

The analysis of variance (ANOVA) for the design of
the experiment revealed highly significant differences
among the genotypes for all the traits studied at all pH
levels during both the years which indicated the existence
of sufficient variability among the genotypes studied.
Mungbean yellow mosaic virus (MYMV) is the most
devastating disease in mungbean and damage varies from
10 per cent to 100 per cent depending on severity of the
disease. The disease is caused by several begomoviruses
which are transmitted by white fly (Bemisia tabaci). During
kharif season the vector white fly is more active that summer
season. The symptoms of MYMV were observed
enormously in salt stressed plants with significant variation
in all the genotypes. The score varied from 1.0 (resistant)
to 4.75 (highly susceptible) at all pH levels during both the
seasons (Table 1). Similar findings have also been reported
by Sehrawat et al. (2013) in mungbean. During kharif season,
EC 88 showed resistance at all pH levels. I 51 and I 10 were
resistant only up to pH 9.0. Among the checks, KM 2241
was comparatively better. During summer season, EC 88, I
51 and I 10 exhibited resistant reaction at all pH levels (Fig.
1 and 2). Pusa Vishal, SML 668, Jalgaon, IPM 99-125, PDM
139 and IPM 02-3 were highly sensitive to disease
incidence. Among the checks, none of the varieties showed
resistant reaction. EC 88 demonstrated persistent
performance during both the seasons at all pH levels.
The range of grain yield was 3.85 g to 11.60 g per
plant at pH 8.0; 2.97 g to 11.37 g at pH 8.5; 2.02 g to 11.15 g
at pH 9.0 and 1.95 g to 10.15 g at pH 9.5 during kharif season
and 3.77 g to 11.17 g at pH 8.0; 3.40 g to 10.32 g at pH 8.5;
2.92 g to 9.92g at pH 9.0 and 2.40 g to 9.15 g at pH 9.5 during
summer season (Table 2). As the pH level progressed, there
had been reduction in yield per plant in all the genotypes
and varied from 1.04 per cent to 59.71 per cent during kharif
season and 7.02 per cent to 50.43 per cent during summer
season. This reduction was highly substantial at pH 9.5 as
compared to pH 8.5. Some genotypes maintained the yield
level upto pH 9.0 with minor reduction. Similar findings
have also been reported by Sehrawat et al., (2013c, 2013d,
2015). EC 88 showed consistent performance at all pH levels
during both the seasons depicting that this genotypes had
better performance under salinity (Fig. 3 and 4). Reduced
yield in mungbean under salt stress may be due to more
flower shedding, reduced photosynthetic efficiency and
shattering of pods (Ahmed, 2009; Sunil et al. 2012; Katiyar
et al. 2019). The other expected cause of reduction in yield
could be the shrinkage of cell contents, reduced
development and differentiation of tissues, imbalanced
nutrition, damage of membrane and disturbed avoidance
mechanism.
The results of the investigation indicated that
reduction in both the traits was observed as we proceeded
 Katiyar & Gupta : Salt tolerance in mungbean genotypes for MYMV and grain yield
Fig. 1. MYMV reaction during kharif 2018
Fig. 2. MYMV reaction during Summer 2019
Fig. 3. Grain yield per plant during kharif 2018
Fig. 4. Grain yield per plant during summer 2019
55
to higher pH levels. This reduction was pronounced during
late vegetative and reproductive phase as compared to early
vegetative phase. Salt stress alongwith high temperature
stress and salinity induced osmotic stress severely limited
the plant growth and yield during summer, but the average
reduction in the measured and observed features was less
during kharif season crop EC 88 depicted significant high
yield alongwith resistance to MYMV in both the seasons.
Observations further suggest that screening of genotypes
for salt tolerance during summer season is more efficient.
The genetically diverse accessions resistant to salt stress
may help to study the salt tolerant mechanism as well. The
identified accession EC 88 can be used as a source of
resistant gene to MYMV which can be introgressed in salt
sensitive mungbean genotype through breeding.
ACKNOWLEDGEMENT
The first author gratefully acknowledge the financial
support provided by Council of Science and Technology,
U.P., Lucknow, India for carrying out this study.
REFERENCES
Ahmed S. 2009. Effect of soil salinity on the yield and yield
components of mungbean. Pakistan Journal of Botany 41: 263-
26 8.
Katiyar M, Srivastava DK, Tomar R, Kumar R and Nitesh SD. 2019.
Salt stress restraining genotypes of mungbean : Gateway for
genetic amelioration. International Journal of Current Microbilogy
and Applied Science 8(12): 1-8.
Nair RM, Schafleimer R, Kenyon L, Srivastava R, Easdown W,
Ebert RW, Hanson P. 2012. Genetic Improvements of mungbean.
SABRAO. Journal of Breeding and Genetics 44: 177-190.
Nair RM, Pandey AK, Bindumadhova H, Shwe T, Alam AKMM,
Pratap A, Malik SR, Karimi R, Mbeyagola EK, Douglas C and
Schafleitner R. 2020. Breeding better mungbean through the
International mungbean, improvement network. Paper presented
at Intr. Conf. Pulses as Climate Smart Crops : Challenges and
opportunities, Feb 10-12,2020, Souvenier p 41.
Sehrawat N, Bhat KV, Sairam RK and Jaiswal PK. 2013d.
Identification of salt resistant wild relative of mungbean (Vigna
radiata L. Wilczek). Asia Journal of Plant Science Research
3(5): 41-49.
Sehrawat N, Bhat KV, Sairam RK, Tomooka N, Kaga A, Shu V and
Jaiswal PK. 2013c. Diversity analysis and confirmation of intra-
specific hybrids of salt tolerance in mungbean, International
Journal of Integrated Biology 16: 65-73.
Sehrawat N, Yadav M, Bhat KV, Sairam RK and Jaiswal PK. 2015.
Effect of salinity stress on mungbean during consecutive summer
and spring seasons. Journal of Agriculture Science 60(1): 23-32.
Sunil KR, Prakash M, Sathiya N and Gokulakrishnan J. 2012. Breeding
for salinity tolerance in mungbean In 2 nd Intr. Conf. on Asia
Agriculture and Animal (ECAAA2012). APCBEE Procedia Vol.
4: 30-35.
Journal of Food Legumes 33(1): 56-57, 2020
Short Communication
Development of extra early urdbean genotypes using intra-specific hybridization
DEBJYOTI SEN GUPTA, PK KATIYAR, JITENDRA KUMAR, ANURAG KUMAR, SANJEEV GUPTA
and NARENDRA PRATAP SINGH
ICAR-Indian Institute of Pulses Research, Kanpur 208 024, Uttar Pradesh, India; E-mail:
debjyoti.gupta@icar.gov.in
(Received : January 7, 2020; Accepted : March 14, 2020)
ABSTRACT
Urdbean is an important pulse crop in Indian sub-continent.
Breeding for earliness is a priority trait in urdbean. In the
present study, a set of urdbean advanced breeding lines
derived from intra-specific hybridization were tested
multiple years over multiple seasons. A few genotypes were
identified as early maturity (60-65 days). However, IPU 19-
27 was promising early maturing urdbean genotype with
desirable plant type and yellow mosaic disease resistance.
Key words: Genotypes, Intra-specific hybridization,
Morphological traits, Urdbean
Urdbean or blackgram [Vigna mungo (L.) Hepper] is
a popular food legume in India. India is the largest producer
as well as consumer of this crop species. It produces about
3.36 million tonnes of urdbean annually from about 4.83
million hectares of area with an average productivity of 696
kg per hectare during 2018-19. It is a warm season pulse
crop and grown under different ecologies which are present
in the country. It is grown in North-Eastern Plain Zone
(NEPZ), North-Western Plain Zone (NWPZ), Central Zone
(CZ) as well as Southern zone (SZ) of the country. In northern
and eastern part of the country it is mostly grown during
Spring or Monsoon seasons, whereas in Southern zone it
is cultivated during Monsoon and Winter season, which is
off course very mild in Southern Peninsula. Urdbean is
mostly consumed as ‘dal’ either in splitted or whole grain
form. It is also widely used in preparation of various food
items where urdbean flour is used. Urdbean breeding in the
region has the main objectives of developing high-yielding,
and two major diseases-yellow mosaic and powdery mildew
resistant varieties. Under the All India Co-ordinated
Research Project (AICRP) several varieties have been
released which are meeting the national and local needs.
Initially, semi-determinate to indeterminate plant types along
with longer duration (90-120 days) were desirable for rainy
season (Pratap et al. 2013; Gupta et al. 2001; Saxena and
Yadav 1975). However, due to recent changes in climatic
conditions which includes shifting of monsoon arrival as
well as departure schedule, multiple cropping systems and
need for mechanical harvesting breeding for early duration,
determinate and erect plant type urdbean varieties becomes
necessary. In many food legumes like mungbean (V. radiata)
and cowpea (V. unguiculata) sixty to sixty-five days high-
yielding varieties are today available in the farmers’ fields.
Likewise, less than 65 days maturing urdbean varieties are
required to compete these crops in different niches including
rice fallow areas. At IIPR, Gupta et al. (2001) evaluated
entire urdbean germplasm collection of 670 accessions and
found only five genotypes with less than ninety days
maturity duration. According to Gupta et al. (2001) a plant
type combining determinate growth habit, 30 cm plant height
and early maturity will be appropriate for spring, summer
and winter seasons. Similarly, there were reports of early
maturing urdbean genotypes detected within either
breeding lines or germplasm accessions maintained by
various other research stations however, in public domain
report of urdbean breeding line with maturity duration of
65 days or less could not be found. Systematic breeding
effort was undertaken in IIPR to hybridize early duration
germplasm lines with high-yielding breeding lines and to
recover in segregating generations desirable segregants.
Ultimately a set of newly developed urdbean genotypes
were developed. Objectives of present experiment was to
evaluate this set of newly developed urdbean advanced
breeding lines for early maturity.
A set of 56 urdbean advanced breeding lines were
grown in preliminary yield trial during Kharif season in
2018 in IIPR, Kanpur, main farm. After this twenty-one
urdbean (Vigna mungo L. Hepper) genotypes (14-advanced
breeding lines, 7-released varieties) (IPU19-27, IPU19-11,
IPU19-5, IPU19-6, IPU19-7, IPU19-8, IPU19-20, IPU19-24,
IPU19-31, IPU19-44, IPU19-46, IPU19-51, IPU19-53, IPU19-
55, IPU02-43, IPU11-02, IPU94-1, KUG479, WBU 108,
Shekhar 3, WBU 109) were grown following Randomized
Complete Block Design with three replications at the New
Research Farm, during Spring, 2018 and in Main Farm of
ICAR-Indian Institute of Pulses Research in 2019 in Kharif
season. Starting from the germination upto maturity stage
17 quantitative and 19 qualitative traits were recorded. All
the data were subjected to analysis using Microsoft excel
software.
Days to unfolding of first trifoliate (DUT) ranged from
10-16 days with mean of 13 days. Number of pods/plant
 Gupta et al. : Development of extra early urdbean genotypes using intra-specific hybridization 57

Table 1. Descriptive statistics of 17 morphological traits for 21 urdbean genotypes

Genotype DUT Pods Pod length Cluster/ plant Seeds PH30 PH45 Branch length Side branches Total leaf Total stem Seed yield Days to FF Days to50%F DFB DFP Maturity
/plant /pods
IPU19-27 10 34 4 13 7 38 46 29 3 63 1 9 31 37 19 39 60
IPU19-11 11 30 4 13 6 37 46 27 3 51 1 10 34 39 19 43 61
IPU19-5 12 26 4 11 6 35 59 29 2 46 1 7 39 43 18 50 73
IPU19-6 12 38 4 17 6 35 50 25 4 72 1 11 37 42 22 47 66
IPU19-7 11 48 4 17 6 36 52 38 5 90 1 12 37 41 17 46 65
IPU19-8 13 32 4 16 6 36 50 29 3 63 1 7 40 44 18 48 67
IPU19-20 11 24 4 12 7 35 52 22 2 35 1 9 36 41 19 45 66
IPU19-24 10 24 4 13 6 32 52 25 3 42 1 8 35 41 19 44 65
IPU19-31 11 29 4 14 5 31 51 29 3 62 1 11 35 40 19 45 61
IPU19-44 12 30 4 13 6 32 51 32 4 60 1 8 38 43 18 47 72
IPU19-46 12 23 4 11 7 33 51 23 2 52 1 7 37 41 21 46 68
IPU19-51 16 39 4 16 7 32 60 29 3 59 1 9 53 58 22 60 86
IPU19-53 16 37 4 18 7 33 60 24 2 66 1 10 52 58 23 59 76
IPU19-55 15 30 4 11 6 32 47 22 2 59 1 7 45 48 21 52 60
IPU2-43 13 33 4 15 6 31 44 26 4 61 1 12 42 45 19 49 67
IPU11-02 12 35 4 14 6 34 49 31 4 55 1 10 38 42 18 46 65
IPU94-1 13 29 4 14 6 35 53 29 3 59 1 14 42 45 18 48 67
KUG479 11 32 4 13 7 35 49 28 3 63 1 11 37 41 22 45 68
WBU108 12 36 5 14 7 34 52 30 3 78 1 14 36 41 21 45 68
Shekhar3 12 30 4 13 6 34 49 31 3 72 1 11 38 42 24 47 70
WBU109 13 36 5 20 7 31 49 31 4 84 1 8 40 43 22 47 76
Mean 12.47 32.16 4.10 14.31 6.32 33.47 51.57 28.05 3.10 62 1 9.79 39.84 44.15 20.05 48.21 68.31
SE 0.38 1.41 0.07 0.57 0.13 0.39 0.95 0.91 0.20 3.11 0 0.52 1.18 1.20 0.47 1.01 1.40
Range 10-16 23-48 4-5 11-20 5-7 31-36 44-60 22-38 2-5 35-90 1-1 7-14 35-53 40-58 17-24 44-60 60-86
#DUT-Days to Unfolding of trifoliate; PH30-Plant height at 30 days; PH45-Plant height at 45 days; Days to FF-Days to first flowering

ranged from 23-48 with mean of 32 pods. Pod length ranged

from 4-5 cm with mean of 4 cm. Number of cluster/plant
ranged from 11-20 with mean of 14. Number of seeds/pod
ranged from 5-7 with mean of 6. Plant height at 30 days
(PH30) ranged from 31-36 with mean of 33 cm. Seed yield
for five plants ranged from 7-14 gm with mean of 9 gm.
Physiological maturity duration ranged from 60-86 days
with mean of 68 days. Please see the Table 1 for traits
including days to first pod (DFP), days to first branch (DFB),
days to first flower (DFF) and days to 50% flowering (Days
to 50%F). Urdbean is an important pulse crop among Vigna Fig. 1: Field view of extra early urdbean genotype IPU19-27.
pulses including mungbean and cowpea in India. Under
varying climate change scenario short duration pulses are
in demand in different growing regions. Sixty days maturing newly developed genotype are medium height and erect
pulses including urdbean can fit in any cropping system plant type, light green lanceolate leaves, bright yellow
thereby increase the cropping intensity. It can seen from flowers, medium length black pods on maturity with
Table 1 that a number of urdbean genotypes have been pubescence, and dull black seeds. This genotype has the
developed which matured in 60-65 days, however due to potential to be released as a cultivar after multi-location
desirable plant type and attractive pod bearing habit IPU19- testing and can also be a useful donor for earliness and
27 (Fig. 1) is the best genotype among the tested advanced MYMIV resistance.
breeding lines. Urdbean genotype, IPU19-27, developed at
ICAR- Indian Institute of Pulses Research, Kanpur which REFERENCES
mature significantly early (60-65 days) during spring as
Gupta S, Gupta SR, Dikshit H and Singh RA. 2001. Variability and its
well as rainy seasons as compared to other released urdbean characterization in Indian collections of blackgram. Plant genetic
varieties (70-80 days) in North-Eastern Plain Zone (NEPZ). resources newsletter (Rome, Italy: 1979) 127: 20-24.
This genotype was developed from the cross ‘SPS 5 x IPU02- Pratap A, Gupta DS, Singh BB and Kumar S. 2013. Development of
33’ following the pedigree method of selection. This super early genotypes in greengram [Vigna radiata (L.) Wilczek].
urdbean genotype showed resistance to mungbean yellow Legume Research 36(2): 105-110.
mosaic India virus (MYMIV) under high natural disease Saxena MC and Yadav DS. 1975. Multiple cropping with short
pressure conditions as evidenced in susceptible genotypes duration pulses. Indian Journal of Genetics and Plant Breeding
of urdbean. The major morphological characteristics of this 35: 194-208.
Journal of Food Legumes 33(1): 58-60, 2020
Short Communication
Effect of drought mitigation strategies on growth, yield and economics of
pigeonpea (Cajanus cajan L. Millsp)
VT JADHAV, NS KUTE, VA CHAVAN and SN BHALERAO
Mahatma Phule Krishi Vidyapeth, Rahuri. Dist. Ahmednagar- 413 722 (MS); E-mail: vtj2009@rediffmail.com
(Received : August 1, 2019; Accepted : November 14, 2019)
ABSTRACT
A field experiment was conducted over three years (Kharif –
2016-17, 2017-18 and 2018-19) at Pulses Improvement
Project, M ahatma Phule Krishi Vidyapeeth, Rahuri
Maharashtra, India to evaluate the impact of various drought
mitigation strategies on growth, yield attributes and
economics of pigeonpea 'Vipula'. Altogether ten drought
mitigation practices involving seed hardening with CaCl 2
(2%), vermicompost @ 2.5 ha-1, FYM @ 5 ha-1 + 2% KH2PO4
spray at flowering, + 2% KNO3 spray at pod development
stage, mulching with organic residues @ 5 ha -1 and pusa
hydrogel @ 2.5 kg ha -1 control were taken under rainfed
condition with three replications in RBD. On the basis of
pooled results of three years, it revealed that Pusa hydrogel
@ 2.5 kg ha-1 + mulching with organic residues @ 5 ha -1,
recorded maximum grain yield (2135.7 kg ha -1) and stalk
yield (9396 kg ha-1), with highest net returns (INR 59560/-
ha-1) and B:C ratio (2.2) also. Pusa hydrogel @ 2.5 kg ha-1+
mulching with organic residues @ 5 ha-1 enhanced yield to
a great extant (36.5%) over control. Thus application of
Pusa hydrogel @ 2.5 kg ha-1 + mulching with organic residues
@ 5 ha -1 may be useful for mitigating of drought in
pigeonpea.
Key words: Drought mitigation, Economics, Growth, Organic
mulching, Pusa hydrogel, Yield
Pigeonpea (Cajanus cajan L. Millsp) is one of the
most important pulse crop of India grown in an area of 4.43
m.ha with production of 4.25 m tones and productivity of
960 kg ha-1.In Maharashtra state it is grown on an area of
12.29 lakh ha with production of 10.73 lakh tones and
productivity of 873 kg ha-1 (Anonyomus 2018). Pigeonpea
is a versatile deep rooted legume crop well known for its
drought tolerance under kharif rainfed upland ecosystem
and very often affected with vagaries of monsoon. The low
productivity of pigeonpea is due to erratic and scanty
rainfall and prolonged dryspells during the critical growth
stages especially during flowering to pod development
stages (terminal drought). Similarly aberrant weather
conditions coupled with onset and cessation of monsoon
is one of the most important factor responsible for yield
reduction. Pulses are indispensible for both human and
soil health. The major break through in pulse production
will have to be in rainfed areas as about 93% of the total
duration, this crop is prone to drought during vegetative
and reproductive stages. Under such conditions,
management practices like seed treatment with chemicals,
foliar application of nutrients, in situ soil moisture
conservation practices play an important role in crop
establishment and production. Hence, the present study
was carried out to know the effect drought mitigation
practices on growth and yield of pigeonpea.
A Coordinated trial was conducted under AICRP on
pigeonpea over three years (Kharif 2016-17, 2017-18 and
2018-19) at the Pulses Improvement Project, Mahatma Phule
Krishi Vidyapeeth , Rahuri , Maharashtra. This comes under
central zone of India to evaluate the impact of various
drought mitigation strategies on growth, yield and
economics of pigeonpea under rainfed condition.The ten
moisture conservation technologies, i.e.T1-Seed hardening
with CaCl2 (2%), T2-Vermicompost @ 2.5ha-1, T3-FYM @ 5
ha-1 + 2% KH2PO4 spray at flowering + 2% KNO3 spray at
pod development stage, T4-Mulching with organic residues
@ 5 ha-1, T5-Pusa hydrogel @ 2.5 kg ha-1,T6-Seed hardening
with Cacl 2 (2%) + Pusa hydrogel @ 2.5 kg ha -1, T 7-
Vermicompost @ 2.5 ha-1 + Pusa hydrogel @ 2.5 kg ha-1,T8-
FYM @ 5 ha-1+ Pusa hydrogel @ 2.5 kg ha-1+ 2% KH2PO4
spray at flowering + 2% KNO3 spray at pod development
stage.T9- Pusa hydrogel @ 2.5 kg ha-1 + mulching with
organic residues @ 5ha-1, T10-Control were taken with three
replications in RBD design. The pigeonpea variety Vipula
was sown at 90 x 30 cm spacing in each years .The soil was
clay loam with pH 8.2 organic carbon (0.53%), available
nitrogen (177 kg ha-1), available phosphorus (14.0 kg ha-1)
and available potassium (263 kg ha-1).The rain received
917.4, 628.0 and 289.6 mm (38, 29 and 15 rainy days,
respectively) during the experimental years. All the
treatments are given recommended dose of fertilizer and
followed the recommended package of practices. The
economics of different treatments was computed on the
basis of prevailing market prices.
The pooled data of three years revealed that
application of Pusa hydrogel @ 2.5 kg ha-1 + mulching with
organic residues @ 5 ha-1 (T9) recorded maximum plant
height (191.4 cm) which was significantly superior over
other treatment except T.No.8 which were at par. Drought
mitigation treatment T9 recorded 12% more height as
compared to the control (Table 1). The highest plant spread
(73.8 cm), primary branches (3.6) and secondary fruiting
branches (18.9), number of pods per plant (327.5), seeds
per five pods (20.8) and 100 seeds weight (10.21 g) was also
 Jadhav et al. : Effect of drought mitigation strategies on pigeonpea 59

recorded by T9 i.e. Pusa hydrogel @ 2.5 kg ha-1 + mulching
with organic residues @ 5 ha-1. This might be due to
conservation of soil moisture as well as improvement in
soil fertility status with mulching of organic residue during
critical stages might have contributed for growth and yield
attributes of pigeonpea.Control plot recorded significantly
lower values of growth and yield attributes (Table 1 and 2).
Tumbhare and Bhoite (2003) reported enhanced growth
and yield parameters in crops grown under moisture
conservation techniques.
The pooled data of three years depicted in Table 3
revealed that application of Pusa hydrogel @ 2.5 kg ha-1 +
mulching with organic residues @ 5 ha-1 (T9) treatment
recorded significantly higher grain yield (2135.7 kg ha-1),
which computed 36.5% higher than control plot (1565.0 kg
ha -1). Adoption of the drought mitigation strategies
enhanced grain yield in all other treatments over control.
Stalk yield also followed almost same trend. Maximum stalk
yield was obtained in treatment T9 (9396 kg ha-1). Pusa
hydrogel have positive impact on drought mitigation when
applied with organics. All drought mitigation strategies
have positive effect on soil moisture conservation and yield
enhancement over control. These results confirm the
findings of Panda et al. (2017), Kausik and Gautam (1991),
Makkhan Lal et al. who also reported enhanced yield in
crops grown under moisture conservation techniques.
Economics of adoption of drought mitigation
strategies was calculated on grain yield of of three years
and pooled data has been presented in Table 3. Profit
maximization is the most important factor form the farmers
point of view. The recommendation should be cost effective
and replicable. Highest net returns was obtained from
application of Pusa hydrogel @ 2.5 kg ha-1 + mulching with
organic residues @ 5 ha-1 (T9) treatment i.e. INR 59560 per
ha. with higher B: C ratio of 2.2. These results recorded 96.3
% more net returns over control.
From the above findings, it can be concluded that
application of Pusa hydrogel @ 2.5 kgha-1 + mulching with
organic residues @ 5 tha-1 is economically viable for
realizing higher production of pigeonpea under rainfed
situations.

Table 1: Pooled data of growth attributes of pigeonpea as influenced by different treatments

Height Spread Primary Secondary
Treatment details (cm) (cm) branches branches
Plant-1 Plant-1
Seed hardening with CaCl2 172.2 64.2 2.5 16.6
Vermicompost @ 2.5 tha-1 175.8 66.4 2.9 17.6
FYM @ 5 tha-1 + 2% KH2PO4 spray at flowering + 2 % KNO3 spray at pod 181.5 67.2 3.3 18.2
development stage
Mulching with organic residues @ 5 tha-1 183.6 69.7 3.4 18.0
Pusa hydrogel @ 2.5 kgha-1 176.9 63.8 2.9 16.9
Seed hardening with Cacl2 + Pusa hydrogel @ 2.5 kgha-1 176.4 64.8 2.8 17.3
Vermicompost @ 2.5 tha-1 + Pusa hydrogel @ 2.5 kgha-1 176.3 65.7 3.0 18.2
FYM @ 5 tha-1 + Pusa hydrogel @ 2.5 kgha-1 + 2% KH2PO4 spray at flowering 186.3 69.5 3.4 18.5
+ 2 % KNO3 spray at pod development stage
Pusa hydrogel @ 2.5 kgha-1 + Mulching with organic residues @ 5 tha-1 191.4 73.8 3.6 18.9
Control 169.7 57.5 2.3 16.4
SE(+/-) 2.33 1.91 2.5 0.25
CD (0.05) 6.92 5.68 2.9 0.73

Table 2: Pooled data of yield attributes of pigeon pea as influenced by different treatments
Treatment details Pods / Seed / Seed wt/ 100 seed
plant 5pods 5 plants (g) wt. (g)
Seed hardening with CaCl2 224.2 19.8 368.6 9.79
Vermicompost @ 2.5 tha-1 268.7 20.6 399.7 9.99
FYM @ 5 tha-1 + 2% KH2PO4 spray at flowering + 2 % KNO3 spray at pod 269.7 20.6 454.9 10.18
development stage
Mulching with organic residues @ 5 tha-1 275.6 20.3 509.9 10.14
Pusa hydrogel @ 2.5 kgha-1 259.1 20.2 373.3 9.96
Seed hardening with Cacl2 + Pusa hydrogel @ 2.5 kgha-1 248.9 20.2 377.3 10.04
Vermicompost @ 2.5 tha-1 + Pusa hydrogel @ 2.5 kgha-1 261.0 20.5 461.7 9.88
FYM @ 5 tha-1 + Pusa hydrogel @ 2.5 kgha-1 + 2% KH2PO4 spray at flowering + 2 % 300.2 20.7 496.2 10.06
KNO3 spray at pod development stage
Pusa hydrogel @ 2.5 kgha-1 + Mulching with organic residues @ 5 tha-1 327.5 20.8 607.3 10.21
Control 207.4 19.2 334.3 9.57
SE(+/-) 9.82 0.20 23.3 0.06
CD (0.05) 29.19 0.59 69.4 0.19
60 Journal of Food Legumes 33(1), 2020

Table 3: Pooled data of yield and economics of pigeon pea as influenced by different treatments
Treatment details Grain yield Stalk yield GMR COC NMR B:C
Kg ha-1 Kg ha-1 (INR ha-1) (INR ha-1) (INR ha-1) Ratio
Seed hardening with CaCl2 1565.0 6456 80515 48285 32230 1.7
Vermicompost @ 2.5 tha-1 1673.7 6779 86174 54115 32059 1.6
FYM @ 5 tha-1 + 2% KH2PO4 spray at flowering + 2 % KNO3 spray at pod 1771.3 7270 91277 53055 38222 1.7
development stage
Mulching with organic residues @ 5 tha-1 1877.0 7731 97060 48639 48422 2.0
Pusa hydrogel @ 2.5 kgha-1 1636.7 7030 84451 48815 35636 1.7
Seed hardening with Cacl2 + Pusa hydrogel @ 2.5 kgha-1 1680.7 7449 86941 50759 36183 1.7
Vermicompost @ 2.5 tha-1 + Pusa hydrogel @ 2.5 kgha-1 1755.0 7064 90017 56589 33428 1.6
FYM @ 5 tha-1 + Pusa hydrogel @ 2.5 kgha-1 + 2% KH2PO4 spray at flowering 1843.7 7254 94849 55529 39320 1.7
+ 2 % KNO3 spray at pod development stage
Pusa hydrogel @ 2.5 kgha-1 + Mulching with organic residues @ 5 tha-1 2135.7 9396 110848 51289 59560 2.2
Control 1478.0 6324 76503 46165 30338 1.7
SE(+/-) 46.3 379.7 2651 -- 2651 0.06
CD (0.05) 137.5 1128.0 7878 -- 7878 0.18

REFERENCES
Anonymous. 2018. FAO. Statistics agriculture report (world). Panda PK, Mahapatra PM, Kar A. 2017. Effect of drought mitigation
strategies on yield and economics of pigeon pea (Cajanus cajan)
Kaushik SK and Gautam RC. 1991. Effect of dryland practices and
in Odisha. Agriculture Reviews 19(4): 264-269.
plant population on productivity and moisture use efficiency of
pearl millet. Indian Journal of Agronomy 36: 229-234. Tumbhare AD and Bhoite SU. 2003. Effect of moisture conservation
techniques on growth and yield of pearl millet- gram sequence in
Makkhan Lal, Bora KK, Singh I, Verma Ramesh, Yadav PC. 2003.
watershed. Indian Journal of Dryland Agricultural Research and
Productivity of pearl millet as influenced by in situ moisture
Development 15: 94-95.
conservation practices and integrated nutrient management in
arid region of Rajasthan. Current Agriculture 27: 77-80.
Journal of Food Legumes 33(1): 61-63, 2020
Short Communication
Influence of seed fortification on growth and seed yield in urdbean (Vigna mungo
L. Hepper)
YOGESH THANE, VISHWANATH K, MAHADEVU P, SHRUTHI K and MARUTHI JB
University of Agricultural Sciences, GKVK, Bangalore, Karnataka, India; E-mail: vishwakoti@gmail.com
(Received : June 26, 2019; Accepted : October 5, 2019)
ABSTRACT
A field experiment was conducted during Rabi-2016 to study
the effect of seed fortification on growth and seed yield in
urbean {Vigna mungo (L.) Hepper}. The experiment consisted
of fourteen treatments which were replicated thrice in RCBD
design. Micro- and macronutrients mixture of Borax, CaCl2,
FeSO 4, ZnSO 4 , MgSO 4, water soluble Di-ammonium
phosphate fertilizer 12:61:0, Water soluble 19:19:19, water
soluble 13:0:45 @1% significantly increased growth
attributes, seed yield and benefit cost ratio in urdbean seed
production over control.
Key words: Grain yield, Seed fortification, Urdbean
Urbean {Vigna mungo (L.) Hepper} is one of the
most important pulse crops among the various grain legumes
in India. This crop is cultivated mostly on marginal lands in
mono/ mixed cropping system without any fertilizers under
rainfed conditions.In crop plants, nutrients may be applied
through soil and foliar spray or added as seed treatments.
Soil application of fertilizers is considered to be the most
common and easily manageable way, but because of
nutrients availability being influenced by soil chemical and
physical properties, the plant roots are unable to absorb
these nutrients adequately from dry topsoil. Similarly, foliar
sprays have been more effective in yield improvement and
grain enrichment, but timely and precise application
restricted its wider adaption. Moreover, foliar application
is done at later growth stages when crop stands are already
established. Soil and foliar applications are the most
prevalent methods of nutrient addition. At the initial phases
of seed germination, nutrients are mobilized from endosperm
or cotyledon, while further phases required nutrients from
soil or from some other means. At initial stages seedling
can’t absorb nutrient from soil. Nutrient seed treatments,
which include seed fortification and seed coating or
pelleting, are an attractive and easy alternative.
Seed fortification is a physiological method of
impregnation of the needy substance into the seed through
the imbibition phase and enriches the endogenous level of
the needy bioactive substances that aids in improving the
initial stamina of the seed that helps in improving the initial
field stand and that of the final yield (Hegarty 1970). In
seed fortification, seeds are partially hydrated to allow
metabolic events to occur without actual germination, and
then re-dried (near to their original weight) to permit routine
handling. Such seeds germinate faster than non-fortified
seeds.
The field experiment was conducted during Rabi 2016
at Zonal Agricultural Research Station, VC Farm, Mandya.
The experiment was laid out in Randomized Complete Block
Design with 14 treatments and three replications using
popular variety Rashmi. Treatments constituted of T0:
Control (hydropriming), T1: Borax (1.0%), T2: CaCl2 (1.0%),
T3: FeSO4 (1.0%), T4: ZnSO4 (1.0%), T5: MgSO4 (1.0%), T6:
Water soluble DAP 12:61:0 (1.0%), T7: Water soluble 19:19:19
(1.0%), T8: Water soluble 13:0:45 (1.0%), T9: Micronutrient
mixture (0.5%), T10: Micronutrient mixture (1.0%), T11:
Macronutrient mixture (0.5%), T 12 : Micro and
Macronutrients mixture (0.5%), T 13 : Micro and
Macronutrients mixture (1.0%).
The graded seeds were subjected to soaking in micro
and macronutrients (Borax, CaCl2, FeSO4, ZnSO4, MgSO4,
Water soluble DAP12:61:0, Water soluble 19:19:19, Water
soluble 13:0:45) at one per cent and their combinations as
micronutrient mixture (Borax CaCl2, FeSO4, ZnSO4, MgSO4
@ 0.5 and 1%), macronutrient mixture (Water soluble DAP
12:61:0, Water soluble 19:19:19, Water soluble 13:0:45 @
1%) and combination of both micro and macronutrients at
@ 0.5 and 1% for 3 hours adopting the seed to solution
ratio of 1:3. Then the seeds were shade dried for one day in
lab condition to bring back to their original moisture content
and used for sowing, keeping hydroprimed seeds as
control. Five plants per plot were selected randomly in the
net plot area and tagged for recording growth and yield
parameters. The results were analyzed statistically to draw
suitable inference as per standard ANOVA technique.
Significant differences were noticed on growth, seed
yield and yield attributing characteristics of black gram
among the seed fortification treatments. Seeds fortified with
micro and macronutrient mixture @1% recorded higher plant
height (27.07), number of branches per plant (4.57) and
number of leaves (9.87) at harvest compared to rest of the
treatments at harvest of recording observation (Table 1).
Increase in plant height was possibly attributed to internodal
elongation by cell division by enhanced carbohydrate
metabolism and metabolic and physiological processes by
plants (Ashour and Reda 1972) and increased cell division.
The micro and macro elements are involved in biosynthesis
62 Journal of Food Legumes 33(1), 2020

of plant harmones, indole acetic acid, auxin metabolism
(Krishnasamy 2003). The increase in number of leaves and
branches might be due to better nutrient availability at early
stage of plant might have ascribed to their pivotal role in
several physiological and biochemical processes, viz., root
development, photosynthesis, energy transfer reaction and
symbiotic biological N fixation process (Rathinavel
andDharmalingam 1999).
A perusal of data (Table 1-2) revealed that yield
attributes viz., number of pods plant-1 (17.03), number of
pods cluster-1 (2.94), pod weight plant-1 (5.66 g), pod length
(5.08 cm), number of seeds pod-1 (6.18), seed yield plant-1
(4.30 g), seed yield hectare-1 (13.14 q), graded seed yield
(12.11 q), shelling % (86.11) increased significantly with
the seed fortified with micro and macronutrient mixture @
1% in blackgram over control.
The increased seed yield attributes might be due to
early emergence of fortified seeds resulted in increased
number of leaves which increased supply nutrients to sink
through translocation and accumulation of photosynthates
in the economic sinks (Rathinavel and Dharmalingam 1999)
and enhanced vegetative growth and synergistic effect of
use of micro and macronutrients involved in improvement
in crop performance. The multi nutrients treatment improved
the growth of the plant during early stages of the crop
which increased the vigour and associated stronger root
system, in turn derived the available soil moisture and
nutrients enabling better growth, resulting in higher yield
(Jagathambal 1996).
Micronutrients are constituent of several
dehydrogenase enzymes and also an activator of other
enzymes. The increased pod yield might also due to
unaborted reproductive structures that could have resulted
due to higher photosynthetic activity. As far as the increase
in the seed yield per plant is concerned, the physio-chemical
treatments could have triggered the biosynthesis of nucleic
acids, proteins and the consequential enhancement of cell
division, besides, the enhanced metabolic activity of the
plants resulting on the increased uptake and more
availability of nutrients which enhanced pod setting, pod
formation and responsible for increased pod and grain yield
of blackgram (Poongothai and Chitdeshwari 2003, Vanitha
and Kathiravan 2016, Suman 2002).
Significantly higher maximum net return (INR 65245
ha-1) and B:C ratio (2.58) was recorded with seed fortified
with micro and macronutrient mixture @ 1% over rest of the
treatments and control (Table 2) which was followed by
micro and macronutrient mixture @ 0.5% (64605, 2.56).
Significantly increased net return and benefit cost ratio
could be explained on the basis of increased yield under
the influence of sources of inorganic nutrients in the present
investigation.
The study revealed that seed fortification with 1 per
cent micro and macronutrients mixture could be adopted as
a pre-sowing seed treatment for black gram seed production
for enhanced seed yield, quality and net returns.

Table 1. Growth and yield parameters of blackgram as influenced by seed fortification

Treatments Plant height Number of Number of Number of Number of Number of Pod Number of
(cm) at leaves branches clusters/plant pods/plant pods/cluster length seeds/pod
harvest (cm)
Control 20.07 7.13 3.59 4.30 13.03 1.88 4.00 4.96
Borax (1.0 %) 21.17 8.20 4.00 5.13 13.80 2.24 4.31 5.08
CaCl2 (1.0 %) 21.80 8.33 4.07 5.27 13.87 2.35 4.37 5.13
FeSO4 (1.0 %) 21.53 8.00 4.10 5.33 14.20 2.36 4.38 5.17
ZnSO4 (1.0 %) 21.20 8.33 4.20 5.60 14.30 2.37 4.50 5.23
MgSO4 (1.0 %) 21.40 8.13 4.27 5.80 14.43 2.41 4.50 5.32
Water soluble DAP- 21.40 8.27 4.37 5.60 15.23 2.42 4.53 5.34
12:61:0 (1.0 %)
Water soluble 19:19:19 21.73 8.07 4.33 5.87 14.73 2.49 4.57 5.39
(1.0 %)
Water soluble 13:0:45 22.03 7.80 4.37 5.73 14.97 2.55 4.63 5.54
(1.0 %)
Micronutrient mixture 22.00 8.07 4.23 6.33 15.20 2.60 4.68 5.59
(0.5 %)
Micronutrient mixture 22.67 7.93 4.27 6.43 15.37 2.63 4.69 5.71
(1.0 %)
Macronutrient mixture 24.53 8.60 4.40 6.50 15.53 2.66 4.77 5.73
(0.5 %)
Micro and 25.50 9.47 4.53 6.70 16.53 2.69 5.01 6.02
Macronutrients (0.5 %)
Micro and 27.07 9.87 4.57 6.97 17.03 2.94 5.08 6.18
Macronutrients (1.0 %)
Mean 22.44 8.30 4.24 5.83 14.87 2.47 4.57 5.46
SEm (+/-) 1.30 0.45 0.20 0.43 0.81 0.17 0.19 0.25
C.D. (P= 0.05) 3.77 1.31 0.58 1.25 2.34 0.49 0.55 0.71
CV (%) 10.02 9.43 8.21 12.73 9.38 11.73 7.15 7.80
 Thane et al. : Influence of seed fortification on growth and seed yield in urdbean 63

Table 2. Yield parameters, seed yield and economics of black gram seed production as influenced by seed fortification
treatments1
Treatment Pod Seed Shelling Seed yield Graded Cost of Gross Net B:C
weight yield/ (%) (q/ha) seed yield cultivation return return Ratio
/plant plant (g) (q/ha) (INR ha-1) (INR ha-1) (INR ha-1)
Control 4.11 3.62 51.51 11.07 10.04 40889 88352 47565 2.160
Borax (1.0 %) 4.44 3.63 64.82 11.10 10.08 40980 88704 47723 2.164
CaCl2 (1.0 % ) 4.51 3.65 65.54 11.16 10.14 40989 89232 48242 2.176
FeSO4 (1.0 %) 4.57 3.64 66.08 11.12 10.10 40989 88880 47891 2.168
ZnSO4 (1.0 %) 4.59 3.66 68.47 11.18 10.16 40986 89408 48422 2.180
MgSO4 (1.0 %) 4.63 3.66 66.93 11.18 10.16 40991 89408 48416 2.181
Water soluble DAP- 12:61:0 4.64 3.76 70.04 11.50 10.47 40984 92136 51152 2.248
(1.0 %)
Water soluble 19:19:19 (1.0 %) 4.70 3.66 70.46 11.18 10.16 41027 89408 48381 2.179
Water soluble 13:0:45 (1.0 %) 4.74 4.04 73.67 12.33 11.31 40985 99528 58543 2.428
Micronutrient mixture (0.5 %) 4.73 4.11 79.17 12.53 11.54 41174 101552 60378 2.466
Micronutrient mixture (1.0 %) 4.82 4.23 80.30 12.91 11.89 41140 104632 63491 2.543
Macronutrient mixture (0.5 %) 4.87 4.22 80.54 12.89 11.87 41233 104456 63222 2.533
Micro and Macronutrients (0.5 %) 5.41 4.27 81.34 13.06 12.03 41258 105864 64605 2.565
Micro and Macronutrients (1.0 %) 5.66 4.30 86.11 13.14 12.11 41323 106568 65245 2.578
Mean 4.74 3.89 71.78 11.88 10.86 - - - -
SEm (+/-) 0.23 0.19 5.05 0.59 0.59 - - - -
C.D. (P= 0.05) 0.68 0.56 14.68 1.72 1.71 - - - -
CV (%) 8.49 8.58 12.18 8.61 9.39 - - - -
1
One q = 0.1 tonne

REFERENCES
Ashour NI and Reda F. 1972. Effect of foliar application of some
micro-elements on growth and some physio-chemical properties
of sugar beet growth in winter season. Current Science 41(4):
146-47.
Hegarty TW. 1970. The possibilities of increasing field establishment
by seed hardening. Horticulture Research 10: 59-64.
Jagathambal R. 1996. Pre-sowing seed treatment to augment
productivity of sorghum. Cv. CO-26. Madras Agriculture Journal
83: 585-590.
Krishnasamy V. 2003. Seed pelleting principles and practices. ICAR
Short Course on Seed Hardening and Pelleting Technologies for
Rainfed/Garden Land Ecosystems: May 27 to June 5, Tamil
Nadu Agricultural University, Coimbatore, 96 pp.
Poongothai S. and Chitdeshwari T. 2003. Response of blackgram to
multi-micronutrients. Madras Agriculture Journal 90: 442-443.
Rathinavel K and Dharmalingam C. 1999. Effect of seed pelleting
on elite seedling production in cotton cv. McV7 (Gossypium
hirsutum L.). Crop Research 18(1): 137-141.
Suman N. 2002. Influence of seed pelleting on storability, crop
growth, seed yield and quality in sunflower (Helianthus annuus
L.) cv. Morden. M. Sc. (Agri.) Thesis, Universty of Agriculture
Science, Dharwad.
Vanitha C and Kathiravan M. 2016. Response of black gram (Vigna
mungo L.) to seed bio-fortification and foliar nutrition
intervention in relation to seed quality and yield potential.
International Journal of Applied and Natural Science 5(6): 69-
78 .
Vavilov NI. 1951. The Origin, Variation, Immunity and Breeding of
Cultivated Plants. Current Botany 13: 1-364.
Journal of Food Legumes 33(1): 64-66, 2020
Short Communication
Effect of growth retardant and detopping on growth and yield of summer
mungbean (Vigna radiata L. Wilczek) under vertisols of Punjab
GURDEEP SINGH, KAMALESH KUMAR and AMANPREET SINGH1
GSSDGS Khalsa College, Patiala, Punjab, India; 1Department of Agriculture, Khalsa College Amritsar, Panjab,
India; E-mail: singhguriqbal@pau.edu
(Received : June 6, 2019; Accepted : August 10, 2019)
ABSTRACT
The study on the effect of growth retardant and detopping
on growth and yield of summer mungbean (Vigna radiata L.
Wilczek) under vertisols of Punjab was conducted during
summer season of 2017 at the Agricultural Campus for
Research and Advanced Studies Dhablan, Punjab. The result
revealed that the grain yield obtained with application of
Mepiquat chloride (MC) @ 250 ppm at 35 and 45 DAS (10.22
q ha-1) was significantly higher than control (6.35 q ha-1).
Various growth and yield attributes viz., dry weight, number
of pods plant-1 (8.12) number of branches plant-1 (9.00) were
also significantly higher with MC @ 250 ppm (35 and 45
DAS) as compared to control. All treatments resulted in
significant reduction in plant height as compared to control.
The study revealed that application of plant growth regulator
(MC) is an effective management strategy to increase the
yield of green gram crop.
Key words: Detopping, Mepiquat chloride, Regulation, Yield
Green gram (Vigna radiata L. Wilczek) is one of the
most important crop in all pluses and is a good source of
protein. Green gram is also known golden gram, moong,
botanically belongs to family leguminosae and sub family
papilionaceae. This crop being largely self pollinated has
hardly any genetic self incompatibility and there is no
evidence on record to suggest even the poor availability of
fertile pollen grains. Green gram contains 26% protein, 60-
65% carbohydrates, 1.5 % fat, and 3.5-4.5% ash. Grain husk
of green gram are used to animals fed. Further, it also enriches
soil through symbiotic nitrogen fixation besides meeting
more than 70 percent of its own nitrogen requirement. The
production of pulses in India has undergoes improvement
and widespread changes. The better achievement in the
pulse crop production within the last twenty years mainly
in the short duration varieties. One of such greater impact
has come from green gram cultivation during summer in
irrigated areas. Green gram is considered a valuable crop is
relative to drought tolerant, early maturing, and quick
growing with minimum fertilizer required. The green gram
crop is fit between the harvesting of Rabi and sowing of
the Kharif crops for the period of three months, when the
land are follow. Plant growth regulators are being used as
aids to increase yield of different crops. Plant growth
regulator application help to modify the physiological
processes in crops in the form of growth and development.
These are chemicals which are used in the low concentration
to effect the growth and development of the plant cells,
tissues, and organs of the crop. The different growth
regulators use in different crops generally inform of the
plant growth promoters, plant growth retardants and
defoliants. Plant growth retardants are helps to decrease
the excessive vegetative growth and increase the
photosynthetic efficiency, improve source-sink relation and
also help in to increase the yield of the crop. The chemical
Mepiquat chloride is a plant growth retardant which helps
to slow down the process of biosynthesis of giberellic acid
hormone in plants (Arteca 1996). In this method it shut out
the elongation of cell, decrease plant height and increases
the content of chlorophyll in plants. Mepiquat chloride
chemical in such conditions decrease the plant height and
length. Between nodes, transfer the plant metabolites from
the leaves and stem into developing of fruits which helps
to increase the yield of the crop. Pod number per unit area
is directly related to the yield. The effect of plant growth
retardants is different in plant species, cultivar of crops,
concentration of chemical, time of application of chemical
and other practices. Mepiquat chloride reduces the plant
height and dry matter accumulation. It increase pod per
plant, grain per pod, Grain yield, and protein content in
Green gram. Detopping (removing apical bud) is another
important agronomic practice which helps to overcome
apical dominance and therefore increasing the number of
lateral branches and pod setting. In summer green gram,
detopping is known to alter the source-sink relationship
by arresting the vegetative growth and hastening the
reproductive phase. It also helps in production of more
pod bearing branches with luxuriant foliage thus resulting
in increased photosynthetic activity, accumulation of more
photosynthetic, ultimately resulting in better seed quality
with higher seed yield. In reported that, in chickpea nipping
resulted in significant increase in number of productive
branches, pods, seeds, 100 seed weight and seed yield per
plant as compared to control treatment.
The experiment was undertaken at field of Campus
for research and advance studies in Dhablan village,
Department of agronomy, G.S.S.D.G.S. Khalsa collage Patiala
during summer seasons, 2017 to study the effect of growth
retardant and detopping on growth and yield of summer
 Singh et al. : Effect of growth retardant and detopping on growth and yield of summer mungbean 65

green gram (Vigna radiata L.) crop using the variety. The
experiment was laid out in randomized complete block design
with 8 treatments and 3 replications. The treatment were:
T1: Mepiquat chloride 200 ppm (35 DAS), T2: Mepiquat
chloride 200 ppm (35 and 45 DAS), T3: Mepiquat chloride
250 ppm (35 DAS), T4: Mepiquat chloride 250 ppm (35 and
45 DAS), T5: Mepiquat chloride 300 ppm (35 DAS), T6:
Mepiquat chloride 300 ppm (35 and 45 DAS), T7: Detopping
(35 DAS), T8: Control. The physicochemical properties of
surface soil were: textural class clay, soil pH 7.8, organic
carbon 0.62 percent, available nitrogen 350 kg ha-1, with
available P205 24 kg ha-1 and available K20 184 kg ha-1. The
crop was sprayed thoroughly, in such a way so that all
portion of the leaves (adaxial and abasial surfaces) and
plant parts moistened with respective solution. Spraying
was done at morning hours of bright sunny days.
Observations on the growth characters and yield
components and yield were taken and analyses were done.
Plant height (cm) is one of the indices for determining
the plant stand. The data on plant height of green gram
recorded at harvesting are presented in Table 1. The
decrease in height may be due to the fact that Mepiquat
chloride being growth retardant suppresses the vegetative
growth. At harvest highest plant height recorded in the
treatment T8. The decrease in height may be due to the fact
that Mepiquat chloride being growth retardant suppresses
the vegetative growth. Detopping means removal of tip of
main vegetative shoot is useful in suppressing the apical
dominance and thus promoting the lateral branching
ultimately leading to decrease in plant height. Brar et al.
(1988) also reported similar results of growth regulators.
Dry weight is one of the indices for determining the
growth and metabolic efficiency. The data on Dry weight
of green gram recorded at harvesting are presented in the
Table 1. MC significantly influenced the total dry weight at
harvest stage. MC @ 250 ppm at 35 and 45 DAS higher dry
weight as compare to control which is 19.35 g per plant at
harvest stage. The increase in Dry weight in the MC treated
plots could be due to increased photosynthetic ability of
leaves and thus assisting in accumulation of more
photosynthesis by plants and ultimately resulting in higher
dry weight per unit area. Similar observations earlier made
by Saisankar (2001).
Number of branches is one of the indices for
determining the growth of plant. The data on Number of
branches of green gram recorded at harvesting are
presented in the Table 1 and reveals that the growth
regulation MC @ 250 ppm (35 and 45 DAS) recorded highest
number of branches per plant (9.00). However control
recorded least number of branches (6.30). Detopping also
produce the significant effect on the number of branches.
However Detopping gave at par value to the MC @ 250
ppm (35 and 45 DAS).
Number of pod per plant is one of the indices for
determining the growth of plant. The data on Number of
pod per plant of green gram recorded at harvesting are
presented in the Table 1. Number of pods is an important
yield component of summer moong bean. Data reveal that
growth regulation practices effect on total number of pods
per plant. This increase may be outcome of increased
number of flowers and improved setting percentage.
Different growth regulation practices were significantly
better than control in producing more number of pods. Two
sprays of MC @ 250 ppm recorded the highest number of
pods per plant (21.87) and least value at control (16.40).
The results lend support to the views expressed by earlier
researcher (Singh 2002).
Number of seed per pod is one of the indices for
determining the yield of plant. The data on Number of seed
per pod of green gram recorded at harvesting are presented
in the Table 1. Number of seeds per pod is a main yield
component character crop. Much number of grains in one
pod will increase the total grains per plant and due to this
higher seed yield could be obtained resulting in higher
economic output by applied treatments. MC @ 250 ppm
(35 and 45 DAS) gave maximum number of seed per pod
(9.45) and less number of seed per pod in control treatment.
There MC @ 300 and 250 ppm gave the at par value to the
best treatment.
Grain yield is one of the indices for determining the
growth attribute of plant. The data on Grain yield of green
gram recorded at harvesting are presented in the Table 1
and grain yield is the most important parameter for judging
the effectiveness of any applied treatment. Different growth
regulation practices had a significant influence on grain

Table 1. Effect of different growth regulators on growth and yield parameters

Treatment Plant height Dry weight No. of No. of pod No. of Test Grain Straw yield
(cm) per plant branches plant-1 seed pod-1 weight yield (q/ha)
T1 52.05 17.67 7.15 7.22 6.8 32.8 7.42 39.80
T2 50.20 17.30 6.60 7.42 7.3 32.9 7.65 38.12
T3 50.77 18.87 7.50 7.57 7.4 33.4 7.87 37.57
T4 48.95 19.35 9.00 8.12 8.5 36.6 10.22 40.12
T5 48.32 18.6 7.45 7.37 7.4 34.8 9.40 38.05
T6 47.50 16.25 7.65 7.17 7.2 33.1 8.52 39.10
T7 47.32 15.50 8.32 7.05 7.5 33.0 7.20 36.97
T8 53.82 14.65 6.30 6.67 6.1 32.0 6.35 35.52
CD (0.05) 1.19 1.08 1.09 1.37 1.46 1.6 1.16 1.15
66 Journal of Food Legumes 33(1), 2020
yield in summer moong bean. Two sprays of MC @ 250
ppm applied at 35 and 45 DAS recorded highest grain yield
(10.22 q ha1 ) which was 37.8 per cent higher than control
plot (6.35 q ha-1) and 29.5 per cent higher than detopping
treatment (7.2 q ha-1). The increase in grain yield may be
due to diversion of photosynthesis from vegetative parts
to the reproductive parts i.e. a pod which ultimately leads
to increase in grain yield. Higher number of pods per plant
increased the grain yield of summer moong bean.
Thavaprakash et al. (2006) reported similar results in moong
bean that with application of putrescine and spermine an
additional yield of 42 and 39 percent respectively over
control.
Straw yield is one of the indices for determining the
economic viability of plant. The data on Straw yield of green
gram recorded at harvesting are presented in the Table 1.
Straw yield gives the estimate about the Dry weight and
partitioning by the crop plant. It helps to calculate the
harvest index and thus economic viability of the treatments
applied. As evident from data presented in Table 1. Highest
straw yield was recorded high in double application MC @
250 ppm at 35 and 45 DAS (40.12) and least straw yield was
recorded in control (35.52). Straw yield at par when double
spray MC @ 300 ppm (35 and 45 DAS) and single spray of
MC @ 200 ppm (35 DAS).
The results revealed that MC had a significant
influence on growth and seed yield of the crop. Hence, the
importance of plant growth regulator may be realized for
efficient utilization of natural resources in a sustainable
manner. Application of plant growth regulator may be a
better option, particularly in case of a short duration pulse
crop like summer moong.
REFERENCES
Arteca RN. 1996. Plant Growth Substances, Principles and
Applications. Pp 41. CBS Publisher and Distributors, New Delhi.
Brar ZS, Singh M and Singh G. 1988. Effect of plant growth regulators
on production of moongbean. Journal of Research Punjab
Agriculture University 25: 515-20.
Saisankar S. 2001. Influence of plant growth regulators, chemicals
and nutrients on productivity potential in green gram [Vigna
radiate (L.)] Pp 41-48. M.Sc. Thesis, University of Agriculture
Science, Dharwad, Karnataka, India.
Singh G, Aggarwal N, Ram H and Randhawa. 2012. Drying of foliage
summer and kharif mung bean at maturity with paraquat for
facilitating combine harvest. Journal of Research in Punjab
Agriculture University 49: 216-218.
Thavaprakash N, Velayudham K, Djanaguiraman M and Prabakaran
C. 2006. Influence of plant growth promoters on assimilate
partitioning and seed yield of green gram. Legume Research 29:
18-24.
Journal of Food Legumes 33(1): 67, 2020

List of Referees for Vol. 33(1)

The Editorial Board gratefully acknowledges the help rendered by following referees in reviewing manuscripts for the
Vol. 33(1): 2020.

Dr IP Singh, ICAR-IIPR, Kanpur Dr RK Mishra, ICAR-IIPR, Kanpur

Dr CS Praharaj, ICAR-IIPR, Kanpur Dr Debjyoti Sen Gupta, ICAR-IIPR, Kanpur

Dr PK Katiyar, ICAR-IIPR, Kanpur Dr CP Nath, ICAR-IIPR, Kanpur

Dr Narendra Kumar, ICAR-IIPR, Kanpur Mr KK Hazra, ICAR-IIPR, Kanpur

Dr Jitendra Kumar, ICAR-IIPR, Kanpur Dr Rajesh Kumar, ICAR-IIPR, Kanpur

Dr Dinesh Kumar Agarwal, ICAR-IISS, Mau Dr RDS Yadav, NDUAT, Faizabad

 Instructions to Authors
Journal of Food Legumes (formerly Indian Journal of Pulses
Research) publishes original papers, short communications
and review articles by renowned scientists, covering all areas
of food legumes research. The paper should not have been
published or communicated elsewhere. Authors will be solely
responsible for the factual accuracy of their contribution.
Language of publication is English (British).
Please send your manuscript to following address:
Secretary
ISPRD
Indian Institute of Pulses Research
Kalyanpur, Kanpur 208 024, India
Email: secretary.isprd@gmail.com
Manuscript must be submitted through e-mail. You should
also submit a hard copy of your manuscript for our official
record. Besides author(s) is required to submit a certificate
that the paper is exclusive for Journal of Food Legumes.
Manuscripts must conform to the Journal style (see the latest
issue). Correct language is the responsibility of the author.
After having received your contribution (date of submission),
there will be a review process before the editorial board takes
decision regarding acceptance for publication. One copy of
the revision together with the original manuscript must be
returned to the subject editor or Secretary. The submitted
paper must be one complete word document file comprising a
title page, abstract, text, references, tables, figure legends and
figures. When preparing your text file, please use only Times
New Roman for text (12 point, double spacing) and Symbol
font for Greek letters to avoid inadvertent character
substitutions.
Format
Every original paper should be divided into the following five
sections: ABSTRACT, Key words, INTRODUCTION,
MATERIALS AND METHODS, RESULTS AND
DISCUSSION, and REFERENCES. The manuscript should be
typed on one side of the paper only, double spaced, and with
4-cm margins with page and line numbers. The main title must
be capital bold. Subheading must be bold italic and Sub-sub
heading normal italic.
At the head of the manuscript, the following information
should be given: the title of the paper, the name(s) of the
author(s), the institute where the research was carried out,
the present addresses of the authors (foot note) and of the
corresponding author (if different from above Institute).
Authors are required to provide running title of the paper.
You must supply an E-mail address for the corresponding
author.
The abstract should contain at least one sentence on each of
the following: objective of investigation (hypothesis, purpose,
aim), experimental material, method of investigation, data
collection, result and conclusions. Maximum length of abstract
is 175 words. Up to 10 key words should be added at the end
of the abstract and separated by comma. Key words must be
arranged alphabatically (e.g., EMS, Gamma ray, Mungbean,
Mutations, Path coefficient, ......).
Each figure, table, and bibliographic entry must have a
reference in the text. Any correction requested by the reviewer
should also be integrated into the file.
Manuscript file including tables must be in MS Word and
Windows-compatible and must not contain any files other
than those for the current manuscript. Please do not import
the figures into the text file. The text should be prepared using
standard software (Microsoft Word); do not use automated
or manual hyphenation.
Length
Manuscripts should not exceed a final length of 15 printed
pages, i.e., 5,000 words, including spaces required for figures,
tables and list of references. Manuscripts for short
communications should not exceed 3000 words (3 printed
pages, with not more than a total of 2 figures or tables).
Units, abbreviations and nomenclature
For physical units, unit names and symbols, the SI-system
should be employed. Biological names should be given
according to the latest international nomenclature. Botanical
and zoological names, gene designations and gene symbols
are italicised. Yield data should be reported in kg/ha. The name
of varieties or genotypes must start and end with single
inverted comma (e.g., ‘Priya’, ‘IPA 204’, ......).
Tables and Figures
Tables and figures should be limited to the necessary minimum.
Please submit reproducible artwork. For printing of coloured
photograph, authors will be charged ` 4000/- per
photograph. It is essential that figures are submitted as high-
resolution scans.
References
The list of references should only include publications cited
in the text. They should be cited in alphabetical order under
the first author’s name, listing all authors, the year of
publication and the complete title, according to the following
examples:
Becker HC, Lin SC and Leon J. 1988. Stability analysis in plant
breeding. Plant Breeding 101: 1-23.
Sokal RR and Rholf FJ. 1981. Biometry, 2nd Ed. Freeman, San
Francisco.
Tandon HLS. 1993. Methods of Analysis of Soils, Plants, Water
and Fertilizers (ed). Fertilizer Development and Consultation
Organization, New Delhi, India. 143 pp.
Singh DP. 1989. Mutation breeding in blackgram. In: SA Farook
and IA Khan (Eds), Breeding Food Legumes. Premier
Publishing House, Hyderabad, India. Pp 103-109.
Takkar PN and Randhawa NS. 1980. Zinc deficiency in Indian
soils and plants. In: Proceedings of Seminar on Zinc Wastes
and their Utilization, 15-16 October 1980, Indian Lead-Zinc
Information Centre, Fertilizer Association of India, New Delhi,
India. Pp 13-15.
Satyanarayan Y. 1953. Photosociological studies on calcarious
plants of Bombay. Ph.D. Thesis, Bombay University, Mumbai,
India.
In the text, the bibliographical reference is made by giving the
name of the author(s) with the year of publication. If there are
two references, then it should be separated by placing ‘comma’
(e.g., Becker et al. 1988, Tandon 1993). If references are of the
same year, arrange them in alphabatic order, otherwise arrange
them in ascending order of the years.
While preparing manuscripts, authors are requested to go
through the latest issue of the journal. Authors are also
required to send the names & E-mail address of at least 3-4
reviewers appropriate to their articles.