Water Research 144 (2018) 356e364

Contents lists available at ScienceDirect

Water Research
journal homepage: www.elsevier.com/locate/watres

Effects of irrigation with secondary treated wastewater on

physicochemical and microbial properties of soil and produce safety in
a semi-arid area
Marzieh Farhadkhani a, Mahnaz Nikaeen b, *, Ghasem Yadegarfar c,
Maryam Hatamzadeh b, Hanieh Pourmohammadbagher b, Zohreh Sahbaei d,
Hamid Reza Rahmani e
a
Student Research Committee, School of Health, Isfahan University of Medical Sciences, Isfahan, Iran
b
Department of Environmental Health Engineering, School of Health, Isfahan University of Medical Sciences, Isfahan, Iran
c
Department of Statistics & Epidemiology, School of Health, Isfahan University of Medical Sciences, Isfahan, Iran
d
Isfahan Water & Wastewater Company, Iran
e
Agricultural and Natural Resources Research Center, Isfahan, Iran

a r t i c l e i n f o a b s t r a c t

Article history: Water scarcity is becoming one of the largest problems worldwide. Agricultural reuse of wastewater has
Received 19 January 2018 been considered a valuable and reliable alternative, alleviating the pressure on freshwater resources in
Received in revised form arid and semi-arid regions such as the Middle East. Inadequate microbial quality of treated wastewater is
15 July 2018
a challenge for developing countries, which limits agricultural reuse of wastewater. This study assessed
Accepted 18 July 2018
Available online 19 July 2018
the impact of irrigation with secondary treated wastewater (STWW) on soil properties as well as the
safety of various types of crops as compared with tap water (TW) irrigation through a furrow system.
Total and fecal coliforms and Escherichia coli were monitored as indicator bacteria in STWW, irrigated soil
Keywords:
Wastewater
and harvested crops. The presence of pathogenic E. coli O157, Salmonella and Shigella was also monitored
Irrigation in all samples using a combination of culture and molecular methods. The microbial quality of waste-
Microbial quality water in terms of E. coli concentration (4.18 Log MPN/100 ml) failed to meet the world health organi-
Decay zation (WHO) recommendation for irrigation of root and leafy crops (
103 and
104 E. coli per 100 ml for
Physicochemical characteristics root and leafy crops, respectively). No significant effects on physicochemical properties of the soil irri-
Soil gated with STWW was found in comparison with control plots, except for electrical conductivity (EC) and
sodium adsorption ratio (SAR), which were slightly higher in STWW soil samples. Although the microbial
quality of soil was affected by STWW irrigation, a relatively low concentration of E. coli was detected in
soil. No microbial contamination in terms of E. coli was found on harvested maize and onion. E. coli
contamination of lettuce and spring onion was found for both irrigation schemes. No STWW, soil or crop
samples were found positive for pathogenic bacteria. According to the analyzed parameters, STWW
could be safely used as an alternative source for irrigation of root and leafy crops.
© 2018 Elsevier Ltd. All rights reserved.

1. Introduction humid (Becerra-Castro et al., 2015). Several factors including pop-

Fresh water scarcity is one of the greatest environmental chal-
lenges in the 21st century, and is caused in part by an uneven
distribution of available water resources around the world
(Becerra-Castro et al., 2015; Jasim et al., 2016). As a consequence,
40% of the total land area is classified as arid, semi-arid and dry sub-
* Corresponding author.
E-mail address: nikaeen@hlth.mui.ac.ir (M. Nikaeen).
ulation growth, surface water and groundwater pollution, droughts
and climate changes are expected to increase stress on water
sources in many regions of the world in the future decades. It is
estimated that more than 40% of the world's population will face
water stress or scarcity within the next few decades, with signifi-
cant impact on socio-economic, water and food security (Becerra-
Castro et al., 2015; Elgallal et al., 2016; WHO, 2006). Iran, with an
average annual precipitation less than one third of the global
average (250 mm), is located in one of the most arid regions in the

https://doi.org/10.1016/j.watres.2018.07.047
0043-1354/© 2018 Elsevier Ltd. All rights reserved.
 M. Farhadkhani et al. / Water Research 144 (2018) 356e364
world, is facing a serious and protracted water crisis. It is antici-
pated that the level of water resources in Iran will decrease from
2025 to 816 m3 per capita from 1990 to 2025 (Jasim et al., 2016;
Lehane, 2014). The agricultural sector, with about 70% of the total
water usage, is the largest user of freshwater worldwide (Becerra-
Castro et al., 2015; Elgallal et al., 2016; Jasim et al., 2016). In some
of the countries in the Middle East such as Iran, more than 90% of
the total water withdrawal is used for agricultural activities (Jasim
et al., 2016; Lehane, 2014). As the communities are increasingly
facing water scarcity, wastewater reuse is becoming an essential
and reliable component of integrated and sustainable water
resource management worldwide, especially in arid and semi-arid
areas. In other words, the growing water shortage and its impact on
water and food security emphasize the necessity for wastewater
reuse as a valuable water resource for agricultural activities
(Becerra-Castro et al., 2015; Elgallal et al., 2016). Irrigation with
wastewater has many economic and environmental benefits such
as reduction of utilization of natural water resources, reduction of
chemical fertilizer usage, protection of aquatic ecosystems from
contamination and improvement of crop yield due to nutrient de-
livery; however, it may also result in environmental and health
problems. Irrigation with wastewater may alter the physicochem-
ical properties of soil and promote soil salinization. Salinization
increases the osmotic pressure in the root zone, constituting a
limiting factor for the use of land for cultivation and plant growth
and productivity (Elgallal et al., 2016). Salinity is evaluated via
electrical conductivity (EC) and sodium adsorption ratio (SAR),
which refers to infiltration problems and degree of saturation of the
soil with sodium (Gharaibeh et al., 2016). Furthermore, wastewater
may contain pathogens that pose a threat to human health and
increase the risk for bacterial, parasitic and viral infections in
consumers of wastewater-irrigated crops (Bahri et al., 2009; Elgallal
et al., 2016; WHO, 2006).
Several studies have assessed the microbial health risks of
wastewater reuse in agricultural activities. Most of these studies
have estimated the risk of infection based on the microbial con-
centration of reused wastewater without investigation into the fate
of pathogenic or indicator microorganisms in the field (Bahri et al.,
2009; Moazeni et al., 2017; Mok et al., 2014; WHO, 2006). Although,
the microbiological characteristics of wastewater for crop irrigation
is important from a public health point of view; several factors
potentially influence the microbial load of wastewater-irrigated soil
and crops and associated health risks. Ambient temperature and
humidity, rate of ultraviolet radiation, soil moisture and pH,
antagonism with indigenous soil microorganisms, method of irri-
gation, and finally the type of plant could impact the fate and
population of microorganisms in soil and on crop surfaces (Becerra-
Castro et al., 2015; WHO, 2006). In the environment, in particular in
arid and semi-arid areas, UV radiation from natural sunlight could
be an important factor in the process of inactivation of microor-
ganisms (Bichai et al., 2012). Therefore, for appropriate manage-
ment of wastewater reuse and in order to assess the health risks
associated with agricultural application of wastewater; it is
essential to track the fate of indicator and pathogenic microor-
ganisms through in-field experiments; especially in arid and semi-
arid regions facing water scarcity. Some studies have already been
published on the effect of agricultural reuse of treated municipal
wastewater on the physicochemical and microbial characteristics of
soil and microbial safety of the produce based on field experiments.
These studies reported no significant microbial effect of wastewater
irrigation on crops and indicated that irrigation with treated
wastewater presents no microbial risk for consumers (Christou
et al., 2014, 2016; Cirelli et al., 2012; Gatta et al., 2016; Li and
Wen, 2016; Lonigro et al., 2016; Orlofsky et al., 2016; Shock et al.,
2016; Urbano et al., 2017). However, in most of the studies,
357
tertiary wastewater or wastewater with good microbial quality
according to the world health organization (WHO) guideline (
103
E. coli per 100 ml) (WHO, 2006) has been used through surface or
subsurface drip system for crop irrigation, which may be different
from real-field conditions in developing countries. Based on our
knowledge, very few studies have applied furrow irrigation as well
as various types of crops for impact assessment of wastewater reuse
(Lonigro et al., 2016; Shock et al., 2016; Song et al., 2006). Since the
microbial safety of produce is affected by the type and concentra-
tion of microorganisms in wastewater, climate condition, irrigation
method and type of plant; it is crucial that the impact of wastewater
reuse on soil and irrigated crops be properly evaluated through
field experiments.
The present study was undertaken to investigate 1) the effect of
irrigation with secondary treated municipal wastewater in com-
parison with tap water on the microbial quality of soil and crops
based on in-field experiments, 2) the influence of environmental
factors including ultraviolet index, ambient temperature, soil
moisture and pH on E. coli die-off in soil, 3) the effect of application
of wastewater on the physicochemical properties of soil, and 4) the
microbial quality and safety of four types of crops including spring
onion and onion as root crops, maize as a fast growing crop, and
lettuce as a high risk-concern leafy vegetable (Mok et al., 2014) in a
semi-arid area that is facing a water crisis.
2. Material and methods
2.1. Experimental field description
The experiment was conducted in an open site of a wastewater
treatment plant which had not already been used for agricultural
activity. The wastewater treatment plant was located in Isfahan
(32 37ʹ 6.024ʺ N, 51 43ʹ 38.983ʺ W; elevation, 1564.8 m), in the
central part of Iran. Isfahan with a semi-arid climate has an average
annual temperature of 16.7  C and an average annual rainfall of
130 mm/year. Climate parameters were recorded during the
experimental period.
2.2. Experimental design
In order to assess the effect of various parameters in the reuse of
wastewater for agriculture, the experiment was carried out over
two consecutive cropping seasons from July to November 2016
(cycle 1) for cultivation of lettuce and maize as summer crops, and
from December 2016 to June 2017 (cycle 2) for cultivation of spring
onion and onion as winter crops, according to the common practice
used in the study region.
The experimental design was based on the randomized use of
two water qualities: secondary treated wastewater (STWW) and
tap water (TW). Three types of plants (lettuce and maize in cycle 1
and onion in cycle 2) were used, each in three replications as pre-
sented in Fig. 1. Each plot comprised 7.5 m2 (2.5 m  3 m) and
consisted of three rows with a distance of 0.4 m. Seeds of lettuce
and maize were implanted in rows with a distance of about 0.15 m
and 0.2 m, respectively. Seeds of onion were directly sown at the
soil surface. STWW was the effluent of a municipal treatment plant
after screening and grit removal, primary clarification followed by
activated sludge process and finally chlorination. Tap water was
provided through the municipal water supply system, with no
microbial pollution, for irrigation of control plots. The soil was
characterized as silty-loam (51% silt, 30% sand, 19% clay). A furrow
irrigation system, as a common practice in the study region, with an
irrigation volume of 0.5 m3/plot per each irrigation event was
applied. Irrigation of plants was performed once a weak except for
the first two weeks of planting in cycle 1, in which watering was
358 M. Farhadkhani et al. / Water Research 144 (2018) 356e364
P10 P11
P7 P8
P4 P5
P1 P2
2.5 m
Fig. 1. Design of the experimental site for lettuce (or onion) and maize cultivation using two water qualities (tap water [TW] and secondary treated wastewater [STWW]) for
irrigation.
performed semi-weekly.
2.3. Collection and preparation of samples
Wastewater samples were collected at every watering event
throughout the crop irrigation period (5e6 h). Wastewater samples
were analyzed for the following parameters: Total suspended solids
(TSS), biochemical oxygen demand (BOD), chemical oxygen de-
mand (COD), nitrate nitrogen (NO 3 ) in triplicate; and temperature,
pH, EC and microbial parameters for each irrigation event.
Soil samples were collected before start-up of irrigation and at
the time of harvesting of crops (cycle 1 and cycle 2). A composite
soil sample consisting of three subsamples was collected from each
plot by an auger from the 0e20 cm topsoil layer. Soil samples were
also collected before and after watering of the crops throughout the
growing period (80 samples). For this stage, a completely mixed soil
sample (consisting of three soil samples from a plot, giving a total of
9 samples per each irrigation type) was taken as STWW or TW-
irrigated soil sample. All soil samples were analyzed for pH, EC and
microbial parameters. Physicochemical analysis of soil was per-
formed on samples collected before start-up of irrigation as well as
samples collected at the time of harvesting in cycle 1. For microbial
analysis of soil samples, 25 g of sample was added to 225 ml of
sterile peptone water and then homogenized for 1 h in a shaker-
incubator (Environmental agency, 2004).
The sample of grown produce was taken three days after the last
irrigation event for lettuce and spring onion and seven days after
the last irrigation for onion and maize. Within each plot, at least
five plants were randomly selected and aseptically picked using
disposable gloves. For each plot, the edible parts of fresh plant
samples were washed with tap water, crushed and then compos-
ited. A certain amount of each composite sample was placed in a
stomacher bag, mixed with sterile peptone water (1:10 w/v) and
homogenized for 180 s in a stomacher (Adams and Moss, 2007).
Crop samples were analyzed for microbial parameters.
All samples were collected in sterile glasses or bags and
immediately transferred to the laboratory for chemical and
microbiological tests.
P12
P9
P6
maize cultivation (TW)
maize cultivation (STTW)
P3
3m
lettuce or onion cultivation (TW)
lettuce or onion cultivation (STTW)
0.4 m 0.4 m
2.4. Physicochemical analyses
The pH and EC of STWW were determined using a pH meter and
an electrical conductivity meter (Eutech Instruments, Singapore),
respectively. Analysis of BOD5, COD, TSS and nitrate nitrogen was
performed according to standard procedures (APAH, 2013).
The physicochemical quality of the soil, including porosity, total
nitrogen (TN), organic carbon (OC), total potassium (TK), total phos-
phorus (TP), available phosphorus (AP), cation exchange capacity
(CEC), and sodium adsorption ratio (SAR) were analyzed as described
previously (Abegunrin et al., 2016; Miller and Keeney, 1982). The pH
and EC of soil samples were analyzed in the 1: 2 soil: water extract and
determined as described for wastewater samples.
2.5. Microbial analyses
Samples of STWW, soil, and crops were analyzed for microbial
parameters including total coliforms (TC), fecal coliforms (FC),
E. coli as indicator microorganisms, and E. coli O157, Salmonella and
Shigella as pathogenic bacteria.
The concentration of TC, FC, and E. coli was determined by
multiple-tube fermentation (MTF) technique as described in Stan-
dard Methods (APAH, 2013). The media used included lauryl tryp-
tose broth, brilliant green lactose bile broth, and EC broth for TC and
FC; and EC-MUG medium for E. coli. For positive samples, results
were reported based on the most probable number (MPN) of
detected microorganisms per 100 ml or 100 g of sample. Further-
more, the concentration of TC and E. coli in all samples was eval-
uated by spreading of an appropriate sample volume of dilutions
(depending on the bacterial load) on Fluorocult LMX (Merck, Ger-
many) agar plates and incubation of plates at 37  C for 24e48 h.
Although an enzymatic assay using LMX medium has been
considered a suitable alternative to the conventional method for
detection of indicator bacteria (Nikaeen et al., 2009), our investi-
gation showed more reliable results for the MTF technique, possibly
due to the analysis of higher volume of samples than the spread
plate method. Therefore, all results are presented based on the MTF
analysis.
 M. Farhadkhani et al. / Water Research 144 (2018) 356e364
For detection of E. coli O157 in STWW, 100 ml of sample was
added to lauryl tryptose broth (LTB) as described in Standard
Methods (APAH, 2013). For soil and crop samples, 100 ml of a 101
homogenate sample was prepared in peptone water containing
cefixime and vancomycin. Liquid media were incubated at 37  C for
20e24 h followed by subculture onto sorbitol-MacConkey (SMAC)
agar plates. Colorless colonies on SMAC were subsequently trans-
ferred into LTB-MUG and incubated at 35  C for 18e24 h. Following
incubation, test tubes were exposed to UV light, and non-
fluorescent tubes were suspected as E. coli O157 (Adams and
Moss, 2007; APAH, 2013; Environmental agency, 2004). Sus-
pected colonies were identified by polymerase chain reaction (PCR)
assay with specific primers (Table 1).
For detection of Salmonella spp. and Shigella spp. 200e300 ml of
STWW samples were concentrated by membrane filtration
(0.22 mm, 47 mm in diameter, Millipore). Filters were immersed in
100 ml of peptone water. For soil and crop, a 101 homogenate of
sample in peptone water (250 ml) was used. Isolation of Salmonella
spp. and Shigella spp. was done by pre-enrichment in peptone
water for 16e20 h at 37  C followed by a selective enrichment step
in selenite cysteine broth over a period of 24 h at 37  C. After
enrichment, aliquots of the broth medium were streak-plated on
xylose lysine deoxycholate (XLD) agar and SalmonellaeShigella (SS)
agar (Adams and Moss, 2007; APAH, 2013; Environmental agency,
2004). Following incubation on selective agar media, suspected
colonies were confirmed and identified with cultural and
biochemical tests using triple sugar iron (TSI) agar, urea agar base,
and SIM medium (APAH, 2013). For final confirmation, PCR using
specific primers (Table 1), was done on the extracted DNA of the
isolated colonies.
2.6. DNA extraction and PCR
For PCR analysis, isolated colonies were suspended in 100 ml of
deionized water, and genomic DNA was extracted and used in PCR
assay as described by Shamsizadeh et al. (2017). Specific primers
were used for detection of Salmonella, Shigella, and E. coli O157
(Table 1).
2.7. Inactivation rate of E. coli in the environment
E. coli, an important indicator of fecal pollution, was chosen as a
target microorganism for estimation of the inactivation rate of mi-
croorganisms in soil. In plots receiving STWW, the decay rate of E. coli
was calculated by a first-order decay model (Rogers et al., 2011):
Ct ¼ C0 10(0.434 kt)
Where Ct is the concentration of E. coli in soil samples before the
watering event, C0 is the E. coli concentration in soil samples on the
day of the watering event, k is the first-order decay rate coefficient,
Table 1
Primers used for PCR.
Target Primer
30 )
Sequence (5 /
ipaH ipaH-L1 CCTTTTCCGCGTTCCTTGA
ipaH-U1 CGGAATCCGGAGGTATTGC
invA 139 GTGAAATTATCGCCACGTTCGGGCAA
141 TCATCGCACCGTCAAAGGAACC
O157 RfbF GTGTCCATTTATACGGACATCCATG
RfbR CCTATAACGTCATGCCAATATTGCC
uidA PT-2 GCGAAAACTGTGGAATTGGG
PT-3 TGATGCTCCATCACTTCCTG
Intimin IntF GACTGTCGATGCATCAGGGAAAG
IntR TTGGAGTATTAACATTAACCCCAGG
359
and t is the time (7 days, based on the time interval between the
two irrigation events). The average value of k was calculated, and
the effect of the physicochemical parameters on the decay rate was
determined by correlation analysis.
2.8. Statistical analysis
Statistical analyses were performed with SPSS 22.0. Initially,
normality of the data was evaluated. Correlations between pa-
rameters were determined by Spearman's correlation analysis. The
Mann-Whitney test was used to evaluate the difference of physi-
cochemical and microbial parameters in plots irrigated with the
two types of water. A probability (p) value less than 0.05 was
considered statistically significant.
3. Results
The mean annual rainfall and temperature from July 2016 to July
2017 was 90 mm and 21  C, respectively.
3.1. STWW quality
The results of physicochemical and microbial quality testing of
STWW in each cycle of irrigation are presented in Table 2. During
the study period (July 2016 to July 2017), E. coli was detected in 18/
25 of the STWW samples. Significant differences were observed
between the amounts of FC and E. coli in the two cycles, being
higher in cycle 2. Correlation analyses indicated that air and
effluent temperature had a significant effect on the concentration
of E. coli in STWW samples. Salmonella, Shigella, and E. coli O157
were not found in any of the STWW samples during of study period.
3.2. Physicochemical characteristics of soil
As shown in Table 3, in all of the plots, the amounts of porosity,
SAR and EC were significantly different at first (before cultivation)
and at the end of cycle 1. EC measurement at the end of cycle 2 also
showed that the average of EC was decreased to 155 and 264 for
plots irrigated with TW and STWW, respectively. The value of CEC
in plots irrigated with STWW was significantly higher than in plots
irrigated with TW. The organic matters content of STWW-irrigated
soils increased slightly after irrigation. Statistical analysis showed
no significant difference between the values of other parameters.
The pH of the soil was relatively constant in all of the plots (6.5e8)
and with no change upon irrigation.
3.3. Microbial characteristics of soil
The microbiological characteristics of soil prior to cultivation
and after harvesting for each cycle are presented in Table 4. In soil
samples taken before irrigation, E. coli was not detected. At the end
Size of amplicon (bp) Reference
426 (Thiem et al., 2004)
284 (Malorny et al., 2003)
292 (Hu et al., 1999)
252 (Cebula et al., 1995)
368 (Hu et al., 1999)
360 M. Farhadkhani et al. / Water Research 144 (2018) 356e364

Table 2 Table 4
Characteristics of secondary treated wastewater (STWW). Soil microbial quality before cultivation and after harvesting.

Parameters Units Mean ± standard Irrigation Type of Total coliforms Fecal coliforms E. coli
deviation water irrigation (TC) (MPN/g) (FC) (MPN/g) (MPN/g)
quality
c Before cultivation TWa 94 6 ND
guidelines
STWWb 94 6 ND
COD mg l1 87.8 ± 29.9 After cycle 1 TW 2635 1 1
BOD5 mg l1 14.1 ± 8.7 STWW 2114 146 94
TSS mg l1 44.3 ± 19.9 <50 d
After cycle 2 TW 77 ND ND
NO3-N mg l1 1.1 ± 0.64 STWW 3114 1048 581
Residual mg l1 <0.5a a
Tap water.
chlorine b
Secondary treated wastewater, ND: Not detected.
pH e 7. ± 0.3 6.5e8.4
Electrical Total dS m1 1 ± 0.2 <0.70d/0.70
conductivity cycle 1 1 ± 0.2 e3e
cycle 2 1 ± 0.1
irrigated with STWW, the concentration of E. coli was significantly
Temperature Total ºC 21 ± 4
cycle 1 24 ± 3 higher after irrigation than before irrigation. After irrigation, E. coli
cycle 2 20 ± 3 was present in significantly higher concentration in plots irrigated
Total coliforms Total log MPN 5.3 ± 1.5 with STWW than TW-irrigated plots.
cycle 1 100 ml1 4.9 ± 1.6
Salmonella, Shigella and E. coli O157 were not found in any soil
cycle 2 5.7 ± 1.4
Fecal coliforms Total log MPN 4.7 ± 2. samples.
cycle 1 100 ml1 4.2 ± 2
cycle 2 5.1 ± 1.9
E. coli Total log MPN 4.3 ± 1.9 3.4. Microbial characteristics of crop samples
cycle 1 100 ml1 3.5 ± 1.6
cycle 2 5.1 ± 1.9
The microbial quality of crops irrigated with the two types of
E. coli O157:H7 MPN ND b
100 ml1 water is presented in Table 6. In plots irrigated with TW, E. coli
Salmonella MPN ND was detected in 2/6 of lettuce samples and 1/3 of spring onion
100 ml1 samples, with a mean concentration of 827 MPN/100 g and 12
Shigella MPN ND MPN/100 g, respectively. In plots irrigated with STWW, E. coli was
100 ml1
detected in 1/6 of lettuce samples and 3/3 of spring onion sam-
a
There was no standard deviation for the average. ples, with a mean concentration of 4000 MPN/100 g and 363
b
Not detected.
c MPN/100 g, respectively. Meanwhile, E. coli was not detected in
As set by the FAO's water quality for agriculture report (Ayers and Westcot,
1985). any maize or onion samples.
d
No restrictions. The Mann-Whitney test showed a significant difference be-
e
Slight to moderate restrictions for use for irrigation. tween the values of E. coli, TC, and FC in spring onion samples of
STWW-irrigated plots and TW-irrigated plots. However, no statis-
tically significant difference between the values of indicator bac-
of cycle 1, only 1/6 of the soil samples irrigated with TW was teria was observed in other crops. Statistical analysis showed a
E. coliepositive. Meanwhile, E. coli was detected in all soil samples significant difference in the values of E. coli for spring onion with
collected after STWW irrigation. A significant difference between maize and onion samples. All the crop samples were negative for
the concentrations of FC and E. coli in plots irrigated with TW and Salmonella, Shigella and E. coli O157.
STWW was observed at the end of cycle 1. At the end of cycle 2, As for the total yield, no significant difference between crops
E. coli was detected in 3/6 soil samples, which were all irrigated irrigated with TW and STWW was observed.
with STWW. Values of FC and E. coli in STWW-irrigated plots were
significantly higher than those for TW-irrigated plots. With regard
to plots irrigated with STWW, a significant difference was observed 3.5. Decay of E. coli and environmental parameters
in the concentration of indicator bacteria between the three stages
(Table 4). The average value of k was 0.27 d1. A significantly positive
The variation in microbial quality of plots before and after irri- correlation was found between the rate of E. coli decay (k) with air
gation with TW and STWW is presented in Table 5. For plots temperature and UV index values.

Table 3
Physicochemical properties of the soil irrigated with tap water (TW) and secondary treated wastewater (STWW).

Parameter TW STWW Sign

a b
Before cultivation After cycle 1 Sign Before cultivation After cycle 1 Sign STWW/TW

Porosity (%) 39.3 42.8 * 39.9 43.4 * ns

Total nitrogen (%) 0.11 0.1 ns 0.09 0.1 ns ns
Organic carbon (%) 1.08 1 ns 0.86 0.98 ns ns
Total potassium (%) 0.36 0.38 ns 0.38 0.34 ns ns
Total phosphorus (%) 0.14 0.15 ns 0.13 0.14 ns ns
AP (mg/kg) 50.01 41.3 ns 41.2 45.9 ns ns
CEC (meq/kg) 12 12 ns 11.9 13 * *
SAR (mg/kg) 2.686 0.54 * 3.348 1.607 * *
EC (ms/cm) 1297 365 * 1297 537 * ns
a
Sign.: Significance, *T test significant at P
0.05. ns: not significant.
b
Comparison of the physicochemical quality of STWW-irrigated and TW-irrigated plots.
 M. Farhadkhani et al. / Water Research 144 (2018) 356e364 361

Table 5 achieved through improvement of effluent quality using appro-

Microbiological quality of the soil irrigated with tap water (TW) and secondary
treated wastewater (STWW) before and after irrigation.
Parameter Total Fecal E. coli (log
coliforms (log coliforms (log MPN/g)
MPN/g) MPN/g)
before after before after before after
Plots irrigated with TW 3.34 3.87 1.67 3.34 0 1.37
Plots irrigated with STWW 3.53 4.5 3.17 3.72 1.13 2.9
4. Discussion
4.1. Quality of secondary treated wastewater
Microbial examination of wastewater revealed a high concen-
tration of indicator bacteria in STWW, as the mean concentration of
E. coli during the study period (4.3 log MPN per 100 ml) was much
higher than the amount recommended by the WHO for wastewater
reuse in irrigation of root and leafy crops (
103 and
104 E. coli per
100 ml for root and leafy crops, respectively) (WHO, 2006). The
results showed that in cycle 1, 5/11 of the samples had a concen-
tration higher than 104 E. coli per 100 ml for lettuce irrigation.
However, the results showed that the microbial quality of STWW is
appropriate for irrigation of maize as a high-growing crop (
105
E. coli per 100 ml) (WHO, 2006). In cycle 2, a higher mean con-
centration of indicator bacteria was detected in STWW, and 9/14
and 7/14 of the samples had a concentration of E. coli higher than
103 and 105 per 100 ml, respectively, indicating that wastewater
irrigation could increase the risk of enteric pathogen infections in
consumers of wastewater irrigated crops, even for high-growing
crops (WHO, 2006). A high concentration of indicator bacteria re-
flects low treatment plant efficiency in terms of removing such
bacteria, and is probably related to the absence of tertiary treat-
ment or inefficiency of disinfection process. Conventional waste-
water treatment processes reduce indicator bacteria by a 2e3 log,
which represents a concentration of 104e105 MPN/100 ml of E. coli
in the effluent (De Sanctis et al., 2017). Based on the WHO guide-
lines for unrestricted wastewater irrigation, the permissible annual
disease risk (
106 DALY per person per year) can be achieved by a
6e7 log unit of pathogen reduction. According to the rate of
pathogen die-off between the time of last irrigation and con-
sumption, and normal household washing of the crops, a 2 and 1
log unit reduction, respectively, could be considered (WHO, 2006).
Therefore, based on the concentration of E. coli in the effluent, a
further 1e2 log reduction for STWW irrigation of root and non-root
salad crops would be required. Estimation of the annual disease
burden for enteroviruses in STWW from two treatment plants
showed mean values exceeding the guideline value recommended
by WHO (
106 DALY per person per year) for wastewater-irrigated
lettuce consumers. Researchers have reported a concentration of
about 106 MPN/100 ml for FC in the treatment plants (Moazeni
et al., 2017). A further reduction of microorganisms could be
priate disinfection methods, especially UV disinfection or applica-
tion of methods such as filtration and storing wastewater effluent
in reservoirs. A study by De Sanctis et al. (2017) showed that with
combination of sequencing batch biofilter granular reactors and
sand filtration, the concentration of E. coli in wastewater effluent
can be reduced to 10 MPN per 100 ml. The mean concentration of
E. coli and FC in cycle 1 was significantly less than that of cycle 2
which may be related to effects of air and effluent temperature.
We did not detect any E. coli O157, Salmonella or Shigella in
wastewater samples. It appears that E. coli O157 is generally not
detected in primary and secondary wastewater effluent (Bitton,
2011). A typical range of 102-104 cells per 100 ml of raw waste-
water was reported for Salmonella spp. (Bitton, 2011). In a study in
Trinitapoli, Italy, most of the secondary effluent samples from a
wastewater treatment plant were positive for Salmonella spp.
(Gatta et al., 2016). However, Salmonella may not be detected in
treated wastewater due to removal of microorganisms by treat-
ment processes or low prevalence of clinical and subclinical Sal-
monella infections in the community. A number of studies have
reported no detection of Salmonella in treated municipal waste-
water (Cirelli et al., 2012; Lonigro et al., 2016).
As shown in Table 2, the average values of physicochemical
parameters of wastewater effluent were acceptable in terms of crop
irrigation according to FAO's guidelines (Ayers and Westcot, 1985),
except for the EC which presented a slight to moderate restriction
for agricultural reuse of wastewater effluent. The use of wastewater
with high EC values is directly related to the risk of soil salinization
after a long-term application of wastewater (Urbano et al., 2017).
The BOD value also slightly exceeded the limit set by the EPA for
food crops irrigation (
10 mg/l BOD) (USEPA, 2012). However, the
reported BOD value may not be considered a limiting factor for crop
irrigation because of the agronomic potential of organic matters
presented in municipal wastewater (Libutti et al., 2018). A study by
Elfanssi et al. (2018) showed improved soil fertility and crop pro-
ductivity after irrigation with treated wastewater.
4.2. Soil quality
Although it has been reported that wastewater irrigation could
increase the values of EC and SAR of irrigated soil, our results
showed a decrease in the amounts of EC and SAR in plots irrigated
with STWW as well as TW (Table 3). A notable reduction in soil EC
and SAR upon irrigation with TW or STWW may in part be due to
salt leaching as a result of irrigation (Christou et al., 2014). However,
the reduction of EC in STWW-irrigated plots was lower than
observed in TW plots, which indicates the effect of wastewater
irrigation on soil EC. In other words, more EC values in wastewater-
irrigated plots could be attributed to the relatively high level of
wastewater EC. The study by Gharaibeh et al. (2016) showed that
SAR in clay soil irrigated with treated wastewater increased over
time. The results of this study also showed an increase in porosity
when SAR and EC decreased (Table 3). The results of study showed

Table 6
Microbiological quality of crops irrigated with TW and STWW. Data are presented as mean (number of positive samples/total samples).

Crop type Total coliforms (MPN/100 g) Fecal coliforms (MPN/100 g) E. coli (MPN/100 g)

TWa STWWb TW STWW TW STWW

Lettuce 613167 (6/6) 95833 (6/6) 1882 (5/6) 5192 (6/6) 827 (2/6) 4000 (1/6)
maize ND 1000 (1/3) ND ND ND ND
spring onion 1667 (3/3) 153333 (3/3) 42 (2/3) 3977 (3/3) 12 (1/3) 363 (3/3)
onion 244 (3/3) 3050 (3/3) ND 1577 (2/3) ND ND
a
Tap water.
b
Secondary treated wastewater, ND: Not detectedd
362 M. Farhadkhani et al. / Water Research 144 (2018) 356e364
that the CEC of STWW-irrigated plots increased, which may be due
to slight increase of the organic matters in soil of STWW-irrigated
plots (Table 3). This finding is consistent with other studies which
have reported a correlation between the CEC and organic matter
content of soil (Becerra-Castro et al., 2015; Wu et al., 2015).
Although the organic matter content of soil increased with waste-
water irrigation, no sinificant diference was observed between the
STWW and TW-irrigated plots. A possible explanation is that more
microbial input from wastewater influences soil microbiological
activity which can induce soil organic matter losses (Wu et al.,
2013). Soil pH did not change during the study. A similar result
was reported by Rusan et al. (2007) after long-term irrigation of soil
with wastewater. Similar to the study of Gharaibeh et al. (2016), our
results showed no significant influence of wastewater irrigation on
essential soil nutrients.
The mean concentrations of E. coli, TC, and FC were increased
after irrigation in all plots (Table 5). This suggests that moist soil
provides suitable conditions for survival of microorganisms, lead-
ing to subsequent bacterial regrowth (WHO, 2006). The results
showed a significantly higher concentration of E. coli in
wastewater-irrigated plots than in TW-irrigated plots during the
cultivation period and at harvesting time (Tables 4 and 5). This
difference indicates that the microbial characteristics of soil could
be affected by the quality of irrigation water and that wastewater
could be considered as a contamination source of soil. The
increased concentration of indicator bacteria in plots irrigated with
STWW after cycle 2 compared with cycle 1 (Table 4) confirms the
effect of irrigation water quality on soil properties. Analysis of the
microbial quality of wastewater in cycle 2 showed a higher con-
centration of indicator bacteria (Table 2), which could influence the
microbial quality of STWW-irrigated soils. Furthermore, lower air
temperature and solar radiation in cycle 2 may have increased the
survivability of coliform bacteria in soil. E. coli was also detected in
the soil samples of control plots irrigated with TW (Tables 4 and 5).
Since E. coli is one of the most usual microbial indicators of fecal
contamination, its presence in soil irrigated with TW, as reported
by other investigators, could be due to an external environmental
source of fecal contamination such as birds, and/or wild and do-
mestic animals (Benami et al., 2013; Forslund et al., 2012; Gatta
et al., 2016). Presence of a large number of birds in our field could
be related to the E. coli contamination of TW-irrigated plots.
Benami et al. (2013) investigated the presence and abundance of six
pathogens and indicator organisms in soil irrigated with gray water
and fresh water. They suggested that the type of water had no effect
on the diversity and abundance of microorganisms. In the study by
Forslund et al. (2012), DNA fingerprints of E. coli isolates from
wastewater and wastewater-irrigated soil did not show identical
patterns, which indicates fecal contamination of soil from other
environmental sources such as wildlife. Although the results
showed that the microbial quality of the soil was affected by the
microbial quality of irrigation water, it should be noted that a
relatively low concentration of E. coli was found in STWW-irrigated
soil samples. In agreement with other studies, high numbers of
indicator bacteria in the irrigation wastewater did not lead to
accumulation of the bacteria in soil (Cirelli et al., 2012; Gatta et al.,
2016; Orlofsky et al., 2016). Throughout the entire irrigation period,
10/40 analyzed soil samples irrigated with STWW did either not
contain E. coli or had a concentration of less than 5 MPN/g. This is in
agreement with other studies in which E. coli was not detected or
presented with a low frequency in wastewater-irrigated soils
despite relatively high levels in irrigation water (Beneduce et al.,
2017; Gatta et al., 2016). The study by Gatta et al. (2016) under-
taken in a Mediterranean climate showed a low concentration of FC
in soil irrigated with secondary effluent, whereas a high concen-
tration of FC bacteria (higher than 104 CFU/100 ml) was found in
wastewater. They also reported that FC levels in the soil were not
affected by the different irrigation treatment factors. Certain envi-
ronmental factors contribute to the survival and die-off of micro-
organisms in soil (Bahri et al., 2009; Li and Wen, 2016). The results
of our study showed a significant effect of ambient temperature and
the value of UV index on the decay rate of E. coli in soil. Although a 2
log reduction of microorganisms in soil was recommended for
pathogens as a result of drip irrigation (Bahri et al., 2009), our re-
sults showed an approximate one log reduction for furrow irriga-
tion. It has been reported that drip irrigation is more efficient in
terms of reducing bacterial contamination compared with furrow
irrigation (Fonseca et al., 2011). Several studies have evaluated the
effect of different irrigation methods on the microbial quality of soil
and crops. The results of these studies showed that wastewater drip
irrigation, especially subsurface drip, can effectively reduce
contamination of soil and crops and consequently associated mi-
crobial health risks (Fonseca et al., 2011; Qadir et al., 2010; Song
et al., 2006). Song et al. (2006) found a higher concentration of
microorganisms on the soil surface of furrow-irrigated plots than
on subsurface drip-irrigated ones.
As anticipated, no pathogenic microorganisms were detected in
soil samples. A study of microbial quality as analyzed by pyrose-
quencing revealed absence of Salmonella in soil irrigated with
treated wastewater (Ibekwe et al., 2018). A study by Gatta et al.
(2016) showed a very low frequency of Salmonella spp. in soil
samples irrigated with secondary wastewater (SWW) despite a
high frequency of this microorganism in SWW samples. Further-
more, they found Salmonella spp. in tertiary wastewater-irrigated
soil, while it was not detected in tertiary wastewater samples.
They concluded that the water source cannot be the only source of
contamination.
4.3. Microbial quality of crops
Foodborne disease associated with consumption of contami-
nated produce is a main concern when using wastewater irrigation
(Bahri et al., 2009; Becerra-Castro et al., 2015; WHO, 2006). In the
present study, E. coli was found in only one plot of STWW-irrigated
lettuce, while all of the three plots of spring onion were contami-
nated by E. coli. However, similar to STTW-irrigated soil samples,
E. coli was also detected in TW-irrigated lettuce and spring onion,
which indicates an external environmental source of E. coli
contamination such as birds and rodents, which were abundantly
present in the experimental field (Gatta et al., 2016; Orlofsky et al.,
2016). Consistent with our results, Orlofsky et al. (2016) showed no
significant difference in the detection of fecal indictor bacteria on
tomatoes irrigated with treated wastewater as compared with to-
matoes irrigated with potable water. Although E. coli was detected
at a higher frequency in spring onion samples, the contamination
level of lettuce was higher, which may in part be related to the
higher retention capacity of irrigation water and hence a higher
potential for contamination (Mok et al., 2014; WHO, 2006). Urbano
et al. (2017) observed contamination of TC of the same order of
magnitude in lettuce samples irrigated with treated wastewater
and tap water and concluded that TC on lettuce leaves could not be
attributed to the use of treated wastewater. Li and Wen (2016)
detected only few counts of E. coli on the leaves of asparagus let-
tuce irrigated with secondary sewage effluent. As anticipated, E. coli
was not detected in any of the maize samples and this is related to
the type of crop. Growing conditions as well as contact with
wastewater or irrigated soil are important factors affect the level of
fecal contamination of wastewater-irrigated crops (Forslund et al.,
2012). The edible part of maize (maize kernels) is covered by
husks, which protect it from contamination. Furthermore, since it is
a high growing-crop, the risk of contamination by wastewater
 M. Farhadkhani et al. / Water Research 144 (2018) 356e364
irrigation is low; therefore, wastewater with higher microbial loads
could be applied for irrigation of this type of crops as indicated by
WHO (
105 E. coli per 100 ml) (WHO, 2006). In the study of drip
irrigation by Gatta et al. (2016), no artichoke heads were positive
for E. coli; nevertheless, a high concentration of E. coli was found in
SWW. Although, the authors detected Salmonella spp. in SWW and
irrigated soils, none of the plant or artichoke head samples were
positive for Salmonella spp. Similar results were reported with
regard to the microbial quality of eggplant and tomatoes drip-
irrigated with treated wastewater which often had an E. coli con-
tent higher than the guideline limit of WHO (Cirelli et al., 2012). A
study by Lonigro et al. (2016) revealed no or very low microbial
pollution of crops and soil at harvesting time in spite of the irri-
gation wastewater having high microbial loads (1713 and 123429 E.
coli CFU per 100 ml in lagoon treated wastewater and secondary
treated wastewater, respectively).
In contrast to spring onion, E. coli was not detected in any of the
onion samples. An important factor potentially related to this dif-
ference is the longer interval between the time of last irrigation and
harvesting (seven days). Li and Wen (2016) reported that an irri-
gation interval of more than three days reduces the risk of
contamination by E. coli for wastewater drip-irrigated soil. Similar
results were reported by Shock et al. (2016), who compared drip
and furrow irrigation in the transfer of E. coli to dry bulb onion.
Based on the climate condition (temperature, sunlight intensity,
humidity) and type of crop, a 0.5e2 log microorganism reduction
per day is achievable on crop surface after the last irrigation (Bahri
et al., 2009).
None of the STWW-irrigated soil and crop samples contained
detectable E. coli O157, Salmonella or Shigella; suggesting no
infection risk by these pathogens for wastewater-irrigated crops.
Lonigro et al. (2016) did not detect Salmonella or Cryptosporidium
on vegetables and soil drip-irrigated with treated municipal
wastewaters.
A notable result from our study is that the high numbers of
E. coli in the STWW did not lead to microbial contamination of
crops, especially so in the case of maize and onion. Moreover, no
significant E. coli contamination was found in STWW-irrigated
lettuce. Although fecal contamination level of wastewater-
irrigated crops is affected by the direct contact with wastewater
and soil (Forslund et al., 2012; WHO, 2006), the results of study
highlight that the climate conditions of arid and semi-arid areas
including high temperature, low humidity and sunlight intensity
could effectively inactivate microorganisms in soil and on crop
surfaces. In other words, the climate condition of our study as a
semi-arid region, may explain the reduction of FC and E. coli levels
from the STWW to the soil and from the soil to the plants, even
under furrow irrigation method. The longer time of paused irriga-
tion prior to the harvesting of onion, suggests a significant impact of
this control measure on the microbial quality of STWW-irrigated
crops. Lonigro et al. (2016) reported that the drip irrigation sys-
tem, weather conditions including increased exposure to UV radi-
ation in the summer or the low temperatures in the winter; and the
interval time between last watering and harvesting (one week)
could reduce the effects of wastewater on the microbial load of
crops and soil. Overall, the analysis of experimental field results
confirms that STWW could be used in water-scarce semi-arid areas
as an alternative source for the crops irrigation under in-field
controlled conditions. Since furrow irrigation was used in the
present study, drip irrigation as a more efficient method for
reducing microorganisms in soil and on crop surface (Becerra-
Castro et al., 2015; Fonseca et al., 2011) could be considered for
crop irrigation. Levels of microbial contamination could be further
reduced by applying post-harvest control measures including
produce disinfection and peeling (Bahri et al., 2009).
363
5. Conclusions
 Secondary treatment of wastewater is a common environmental
management strategy used worldwide, especially in developing
countries. However, the microbial quality of such wastewater is
a public health concern for irrigation of crops eaten raw. The
results of this study showed that the microbial quality of STWW
does not meet WHO guidelines for irrigation of root and leafy
crops.
 Although the E. coli concentration in STWW was mostly higher
than the WHO guideline limits that are considered safe for crop
irrigation, no or negligible microbial contamination of STWW-
irrigated crops (maize, onion and lettuce) was observed as
compared with TW-irrigated crops.
 The type of crop and the employed method for irrigation are two
important factors that should be considered in the reuse of
wastewater in agriculture. However, our results showed that the
climate conditions of arid and semi-arid areas could effectively
contribute to the inactivation of microorganisms in soil and on
crop surfaces for leafy and root crops, even when using the
furrow irrigation method.
 Considering the climate conditions, STWW could be reused as a
valid alternative source for irrigation of crops in water-scarce
Middle East region if leaving enough time between last irriga-
tion and harvesting. However, more study should be conducted
to evaluate the fate of enteric viruses and protozoan parasites in
field conditions.
 Further public health protection and reduction of potential risks
could be achieved through application of in-field and post-
harvest control measures for reducing microorganisms,
including drip irrigation as well as washing, disinfection and
peeling of produce eaten raw.
Acknowledgement
This research was supported by the Vice Chancellery for
Research at the Isfahan University of Medical Sciences (Grant No.
395429), and by funds provided by Isfahan Water and Wastewater
Company (Grant No. 8459). We thank the workers and the head of
the wastewater treatment plant of the southern of Isfahan.
References
Abegunrin, T., Awe, G., Idowu, D., Adejumobi, M., 2016. Impact of wastewater irri-
gation on soil physico-chemical properties, growth and water use pattern of
two indigenous vegetables in southwest Nigeria. Catena 139, 167e178.
Adams, M.R., Moss, M., 2007. Food Microbiology. RSC.
APAH, 2013. Standard Methods for the Examination of Water and Wastewater,
Twenty-second Ed. American Public Health Association, Washington, DC.
Ayers, R., Westcot, D., 1985. Water Quality for Irrigation, FAO Irrigation and
Drainage, Paper.
Bahri, A., Drechsel, P., Raschid-Sally, L., Redwood, M., 2009. Wastewater Irrigation
and Health: Assessing and Mitigating Risk in Low-income Countries. Routledge.
Becerra-Castro, C., Lopes, A.R., Vaz-Moreira, I., Silva, E.F., Manaia, C.M., Nunes, O.C.,
2015. Wastewater reuse in irrigation: a microbiological perspective on impli-
cations in soil fertility and human and environmental health. Int. J. Environ 75,
117e135.
Benami, M., Gross, A., Herzberg, M., Orlofsky, E., Vonshak, A., Gillor, O., 2013.
Assessment of pathogenic bacteria in treated graywater and irrigated soils. Sci.
Total Environ. 458, 298e302.
Beneduce, L., Gatta, G., Bevilacqua, A., Libutti, A., Tarantino, E., Bellucci, M.,
Troiano, E., Spano, G., 2017. Impact of the reusing of food manufacturing
wastewater for irrigation in a closed system on the microbiological quality of
the food crops. Int. J.Food Mic 260, 51e58.

pez, M.I., Iban~ ez, P.F., 2012. Solar disinfection of wastewater to
Bichai, F., Polo-Lo
reduce contamination of lettuce crops by Escherichia coli in reclaimed water
irrigation. Water Res. 46, 6040e6050.
Bitton, G., 2011. Wastewater Microbiology. John Wiley & Sons Inc, Canada.
Cebula, T.A., Payne, W.L., Feng, P., 1995. Simultaneous identification of strains of
Escherichia coli serotype O157: H7 and their Shiga-like toxin type by mismatch
amplification mutation assay-multiplex PCR. J. Clin. Microbiol. 33, 248e250.
364 M. Farhadkhani et al. / Water Research 144 (2018) 356e364
Christou, A., Maratheftis, G., Eliadou, E., Michael, C., Hapeshi, E., Fatta-Kassinos, D.,
2014. Impact assessment of the reuse of two discrete treated wastewaters for
the irrigation of tomato crop on the soil geochemical properties, fruit safety and
crop productivity.Agric. Ecosyst. Environ 192, 105e114.
Christou, A., Maratheftis, G., Elia, M., Hapeshi, E., Michael, C., Fatta-Kassinos, D.,
2016. Effects of wastewater applied with discrete irrigation techniques on
strawberry plants' productivity and the safety, quality characteristics and
antioxidant capacity of fruits. Agric. Water Manag. 173, 48e54.
Cirelli, G., Consoli, S., Licciardello, F., Aiello, R., Giuffrida, F., Leonardi, C., 2012.
Treated municipal wastewater reuse in vegetable production. Agric. Water
Manag. 104, 163e170.
De Sanctis, M., Del Moro, G., Chimienti, S., Ritelli, P., Levantesi, C., Di Iaconi, C., 2017.
Removal of pollutants and pathogens by a simplified treatment scheme for
municipal wastewater reuse in agriculture. Sci. Total Environ. 580, 17e25.
Elfanssi, S., Ouazzani, N., Mandi, L., 2018. Soil properties and agro-physiological
responses of alfalfa (Medicago sativa L.) irrigated by treated domestic waste-
water. Agric. Water Manag. 202, 231e240.
Elgallal, M., Fletcher, L., Evans, B., 2016. Assessment of potential risks associated
with chemicals in wastewater used for irrigation in arid and semiarid zones: a
review. Agric. Water Manag. 177, 419e431.
Environmental agency, 2004. Methods for the Examination of Waters and Associ-
ated Materials, the Microbiology of Sewage Sludge-part 4- Methods for the
Detection, Isolation and Enumeration of Salmonellae.
Fonseca, J., Fallon, S., Sanchez, C., Nolte, K., 2011. Escherichia coli survival in lettuce
fields following its introduction through different irrigation systems. J. Appl.
Microbiol. 110, 893e902.
Forslund, A., Ensink, J., Markussen, B., Battilani, A., Psarras, G., Gola, S., Sandei, L.,
Fletcher, T., Dalsgaard, A., 2012. Escherichia coli contamination and health as-
pects of soil and tomatoes (Solanum lycopersicum L.) subsurface drip irrigated
with on-site treated domestic wastewater. Water Res. 46 (18), 5917e5934.
Gatta, G., Libutti, A., Beneduce, L., Gagliardi, A., Disciglio, G., Lonigro, A.,
Tarantino, E., 2016. Reuse of treated municipal wastewater for globe artichoke
irrigation: assessment of effects on morpho-quantitative parameters and mi-
crobial safety of yield. Sci. Hortic. 213, 55e65.
Gharaibeh, M.A., Ghezzehei, T.A., Albalasmeh, A.A., Ma'in, Z.A., 2016. Alteration of
physical and chemical characteristics of clayey soils by irrigation with treated
waste water. Geoderma 276, 33e40.
Hu, Y., Zhang, Q., Meitzler, J., 1999. Rapid and sensitive detection of Escherichia coli
O157: H7 in bovine faeces by a multiplex PCR. J. Appl. Microbiol. 87 (6),
867e876.
Ibekwe, A., Gonzalez-Rubio, A., Suarez, D., 2018. Impact of treated wastewater for
irrigation on soil microbial communities. Sci. Total Environ. 622-623,
1603e1610.
Jasim, S.Y., Saththasivam, J., Loganathan, K., Ogunbiyi, O.O., Sarp, S., 2016. Reuse of
treated sewage effluent (TSE) in Qatar. J. Water Process. Eng 11, 174e182.
Lehane, S., 2014. The Iranian Water Crisis. Strategic Analysis Paper. FDI.
Li, J., Wen, J., 2016. Effects of water managements on transport of E. coli in soil-plant
system for drip irrigation applying secondary sewage effluent. Agric. Water
Manag. 178, 12e20.
Libutti, A., Gatta, G., Gagliardi, A., Vergine, P., Pollice, A., Beneduce, L., Disciglio, G.,
Tarantino, E., 2018. Agro-industrial wastewater reuse for irrigation of a vege-
table crop succession under Mediterranean conditions. Agric. Water Manag.
196, 1e14.
Lonigro, A., Rubino, P., Lacasella, V., Montemurro, N., 2016. Faecal pollution on
vegetables and soil drip irrigated with treated municipal wastewaters. Agric.
Water Manag. 174, 66e73.
Malorny, B., Hoorfar, J., Bunge, C., Helmuth, R., 2003. Multicenter validation of the
analytical accuracy of Salmonella PCR: towards an international standard. Appl.
Environ. Microbiol. 69 (1), 290e296.
Miller, R., Keeney, D., 1982. Methods of Soil Analysis. Part 2: Chemical and Micro-
biological Properties, second ed. American Society of Agronomy, Madison. Soil
Sci Soc Am J.
Moazeni, M., Nikaeen, M., Hadi, M., Moghim, S., Mouhebat, L., Hatamzadeh, M.,
Hassanzadeh, A., 2017. Estimation of health risks caused by exposure to enterovi-
ruses from agricultural application of wastewater effluents. Water Res.125,104e113.
Mok, H.-F., Barker, S.F., Hamilton, A.J., 2014. A probabilistic quantitative microbial
risk assessment model of norovirus disease burden from wastewater irrigation
of vegetables in Shepparton, Australia. Water Res. 54, 347e362.
Nikaeen, M., Pejhan, A., Jalali, M., 2009. Rapid monitoring of indicator coliforms in
drinking water by an enzymatic assay. J. environ. health sci. eng 6 (1), 7e10.
Orlofsky, E., Bernstein, N., Sacks, M., Vonshak, A., Benami, M., Kundu, A., Maki, M.,
Smith, W., Wuertz, S., Shapiro, K., 2016. Comparable levels of microbial
contamination in soil and on tomato crops after drip irrigation with treated
wastewater or potable water. Agric. Ecosyst. Environ. 215, 140e150.
Qadir, M., Wichelns, D., Raschid-Sally, L., McCornick, P.G., Drechsel, P., Bahri, A.,
Minhas, P., 2010. The challenges of wastewater irrigation in developing coun-
tries. Agric. Water Manag. 97 (4), 561e568.
Rogers, S.W., Donnelly, M., Peed, L., Kelty, C.A., Mondal, S., Zhong, Z., Shanks, O.C.,
2011. Decay of bacterial pathogens, fecal indicators, and real-time quantitative
PCR genetic markers in manure-amended soils. Appl. Environ. Microbiol. 77
(14), 4839e4848.
Rusan, M.J.M., Hinnawi, S., Rousan, L., 2007. Long term effect of wastewater irri-
gation of forage crops on soil and plant quality parameters. Desalination 215
(1), 143e152.
Shamsizadeh, Z., Nikaeen, M., Esfahani, B.N., Mirhoseini, S.H., Hatamzadeh, M.,
Hassanzadeh, A., 2017. Detection of antibiotic resistant Acinetobacter bau-
mannii in various hospital environments: potential sources for transmission of
Acinetobacter infections. Environ. Health Prev. Med. 22 (1), 44.
Shock, C.C., Reitz, S.R., Roncarati, R.A., Kreeft, H., Shock, B.M., Klauzer, J.C., 2016. Drip
Vs. Furrow Irrigation in the Delivery of Escherichia coli to Onions.
Song, I., Stine, S.W., Choi, C.Y., Gerba, C.P., 2006. Comparison of crop contamination
by microorganisms during subsurface drip and furrow irrigation. J. Environ.
Eng. 132 (10), 1243e1248.
Thiem, V.D., Sethabutr, O., von Seidlein, L., Van Tung, T., Chien, B.T., Lee, H.,
Houng, H.-S., Hale, T.L., Clemens, J.D., Mason, C., 2004. Detection of Shigella by a
PCR assay targeting the ipaH gene suggests increased prevalence of shigellosis
in Nha Trang. Vietnam. J. Clin. Microbiol. 42 (5), 2031e2035.
Urbano, V.R., Mendonça, T.G., Bastos, R.G., Souza, C.F., 2017. Effects of treated
wastewater irrigation on soil properties and lettuce yield. Agric. Water Manag.
181, 108e115.
USEPA, 2012. Guidelines for Water Reuse. US Environmental Protection Agency,
Washington, DC, p. 643.
WHO, 2006. Guidelines for the Safe Use of Wastewater, Excreta and Greywater:
Volume II Wastewater Use in Agriculture. World Health Organization, Geneva,
Switzerland.
Wu, H., Zeng, G., Liang, J., Zhang, J., Cai, Q., Huang, L., Li, X., Zhu, H., Hu, C., Shen, S.,
2013. Changes of soil microbial biomass and bacterial community structure in
Dongting Lake: impacts of 50,000 dams of Yangtze River. Ecol. Eng. 57, 72e78.
Wu, H., Zeng, G., Liang, J., Guo, S., Dai, J., Lu, L., Wei, Z., Xu, P., Li, F., Yuan, Y., 2015.
Effect of early dry season induced by the Three Gorges Dam on the soil mi-
crobial biomass and bacterial community structure in the Dongting Lake
wetland. Ecol. Indicat. 53, 129e136.