Veterinary Parasitology xxx (xxxx) 109611

Contents lists available at ScienceDirect

Veterinary Parasitology
journal homepage: www.elsevier.com/locate/vetpar

F
Research paper

OO
Enhanced apoptotic index, chemokines and inflammatory recruitment in
renal tissues shows relationship with the clinical signs in Leishmania-
infected dogs
Barbara Laurice Araújo Verçosa a, b, ⁎, Maria Imaculada Muniz-Junqueira b,

PR
Daniel Menezes-Souza a, Luísa Mourão Dias Magalhaes a, Ricardo Toshio Fujiwara a,
Maria Norma Melo a, Anilton Cesar Vasconcelos a
a Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil
b Laboratório de Imunologia Celular, Faculdade de Medicina, Universidade de Brasília, Brasília, Brazil

ARTICLE INFO

Keywords:
Apoptosis
Canine leishmaniosis
Inflammation
ABSTRACT

ED
Apoptosis is associated with resolution of inflammation. However, apoptosis may also occur in active inflamma-
tion, balancing inflammatory recruitment instead of a resolution event. To test that hypothesis, we measured
apoptosis and chemokines expression, involved in recruitment of inflammatory cells. Clinical affected and sub-
clinically infected dogs with canine leishmaniosis (CanL) and uninfected controls were assessed. Apoptosis in re-
Kidney
nal tissue (glomeruli, tubules, and inflammatory infiltrate) and cellularity in inflammatory foci were quantified.
Leishmania infantum
CT
Messenger RNA of CCL5, CCL4, MCP-1, MCP-2, Caspase (Casp) 3, Casp 8, Casp 9, Bax, Bcl2 and Fas were quanti-
fied by qRT PCR. Clinical affected dogs showed more intense inflammation and higher cellularity in the inflam-
matory infiltrates than subclinically infected ones, which were higher than controls. Glomerular and tubular
cells showed higher apoptotic index in clinical affected dogs when compared to controls. Apoptosis within the in-
flammatory infiltrates was higher in clinical affected dogs. Bax/Bcl2 ratio and CCL4 showed higher expression in
kidney from clinical affected when compared to subclinically infected dogs. Casp 3/CCL4 ratio expression were
higher in subclinically infected dogs than in the clinical affected group. Additionally, results suggest that Casp 3/
RE

CCL4 ratio is balancing towards an inflammatory recruitment and CCL4 and Bax/Bcl2 ratio expression is associ-
ated with active inflammation in clinical affected CanL. Data demonstrate that apoptosis was not always corre-
lated with resolution of inflammation, when a morphometric and a molecular evaluation were performed con-
comitantly. In kidneys of Leishmania infected dogs, apoptosis and chemokines may be balancing inflammatory
recruitment. In conclusion, Bax/Bcl2 ratio, chemokines, Casp 8, Casp 3 and Fas were associated with renal apop-
tosis, active inflammation and increased inflammatory recruitment observed in clinical affected animals, influ-
encing the clinical presentation of leishmaniosis.
R

1. Introduction 2010). Apoptosis is a cell death type that occurs as a response to the cell
CO

microenvironment, and it is fundamental to cellular and tissue physiol-

Leishmaniosis still represents a global scourge, mainly affecting
low-incoming people worldwide, causing approximately one million in-
fections and 20000–30000 deaths per year (WHO, 2020). Dogs are the
main reservoirs of the Leishmania infantum (Burza et al., 2018).
Kidneys may be affected in leishmanial disease. Recent studies on
canine glomerulonephritis pathogenesis caused by L. infantum have re-
UN
ogy. Apoptosis contributes to parenchymal cell loss during renal injury
(Priante et al., 2019). Apoptosis is also a defense mechanism against in-
fectious agents (Vaux et al., 1994).
Apoptosis is a regulated cellular death (RCD) characterized by mor-
phological features as cell rounding, cell shrinkage, chromatin conden-
sation, and nuclear fragmentation. There are few ultrastructural modifi-

vealed the involvement of T cells (Costa et al., 2000), cytokines cations of cytoplasmic organelles and maintenance of plasma mem-
(Verçosa et al., 2021), adhesion molecules and apoptosis (Costa et al., brane integrity. Membrane blebbing culminates in the formation of

⁎ Corresponding author at: Universidade Federal de Minas Gerais, Instituto de Ciências Biológicas, Departamento de Morfologia, Av. Antônio Carlos, 6627, Campus

Pampulha, CEP: 31270-010, Belo Horizonte, Minas Gerais, Brazil.

E-mail address: brbaravet@yahoo.com.br (B.L. Araújo Verçosa).

https://doi.org/10.1016/j.vetpar.2021.109611
Received 17 June 2021; Received in revised form 17 October 2021; Accepted 23 October 2021
0304-4017/© 2021
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

Table 1 death receptors are inserted in cell plasma membrane, as Fas (CD95/
Sequence of primers used for quantification of apoptotic proteins (Casp Apo-1) molecule, as well as activation of caspases (Belizário et al.,
3,Casp 8, Casp 9, Bax, Bcl2, and Fas), cytokines (TNF-α, IL-10, IFN-γ, IL-12, 2007). The apoptotic process is an intricate web of intracellular signal-
IL-4 and IL-2), and chemokines (CCL5, CCL4, MCP-1, MCP-2) in kidney sam- ing pathway that encompasses three phases: activation, execution and
ples by quantitative RT-PCR. cellular demolition that may be triggered by extrinsic or intrinsic path-
Apoptotic Sequence of primers Size (nt Product Length ways (Elmore, 2007).
protein a) (bp b) The extrinsic pathway involves cell death receptors inserted in the

F
plasma membrane as well as caspases and molecules of the Bcl2 (B-cell
C asp 3
lymphoma-2) family. It is activated via extracellular stress signaling by
F TTCATTATTCAGGCCTGCCGAGG 23 83

R TTCTGACAGGCCATGTCATCCTCA
Casp 8
F ACAAGGGCATCATCTATGGCTCTGA 25
R CCAGTGAAGTAAGAGGTCAGCTCAT 25
Casp 9
F TCAGTGACGTCTGTGTTCAGGAGA
R TTGTTGATGATGAGGCAGTAGCCG
Bax
F TTCCGAGTGGCAGCTGAGATGTTT
OO
24 transmembrane receptors, such as Fas receptor, and inflammatory cy-
tokines or immune cytokines, such as TNF and IFN-γ. Intrinsic pathway
70 is activated by intracellular stress, as oxidative stress, and high calcium
(Ca+) concentration in the cytoplasm. The intrinsic pathway involves
pro- and anti-apoptotic molecules of the Bcl2 family and relies on mito-
24 97
chondrial outer membrane permeabilization that results in the release
34
of molecules from mitochondria, such as cytochrome c, and, to the acti-
24 79 vation of specific enzymes called caspases (Garrido et al., 2006). Cas-

PR
R TGCTGGCAAAGTAGAAGAGGGCAA 24 pase (Casp) 8 and 9 are among initiator caspases and play a role in ini-
Bcl2 tial signaling events of apoptosis, whereas Casp 3 is an effector or exe-
F CATGCCAAGAGGGAAACACCAGAA 24 76 cutioner caspase and causes proteolytic cleavages (Parrish et al., 2013;
R GTGCTTTGCATTCTTGGATGAGGG 24 Jan and Chaudhry, 2019). The process is controlled by anti-apoptotic
Fas
molecules, (Bcl2), and apoptotic ones (Bax) (Brunelle and Letai, 2009;
F AGACATCGACCTGAGCAAAT 20 109
R CTCGTCTATCTTGGCTTCG 19
Shamas-Din et al., 2013).
In parasites, such as Trypanosoma cruzi, Trypanosoma brucei and
Leishmania spp., parasite apoptosis can occur associated with produc-

D
Chemokines
CCL5 tion of cytokines and chemokines (Ameisen, 2002), which takes part in
F TTCTACACCAGCAGCAAG 18 136 the evolution of lesions triggered by several microorganisms, including
R GCCCTACATCCTAACTCAT 19
Leishmania spp. (Das et al., 2001; Lee et al., 2002).
CCL4
TE
F TCCTACTGCCTGCTGCTT 18 76
Apoptosis participates actively in modulation of the inflammatory
R GCTGGTCTCAAAGTAATCTG 20 response (Weinrauch and Zychlinsky, 1999; Carrero et al., 2004) and is
MCP-1 associated with resolution of inflammation (de Cathelineau and
F CCTGCTGCTATACACTCA 18 91 Henson, 2003). It is characterized by large numbers of cells in apoptosis
R GCTTCTTTGGGACACTT 17 within the inflammatory sites (Fadok et al., 1998; Huynh et al., 2002;
MCP-2
Maderna and Godson, 2003; Eda et al., 2004). Inflammation, as a mech-
EC

F GCTTCTATGCCTTCTGCT 18 123
R TTCTGCATGGGGATCTTC 18
anism of host defense against parasitic infections, plays a role in the
progression and resolution of the infection. Thus, the inflammatory in-
Cytokines filtrate modulates the parasite-host relationship. Depending on the
TNF-α stimulus, activation state and involved receptors, the response of
F CGTCCATTCTTGCCCAAAC 19 94 macrophages may have an anti- or a pro-inflammatory profile (Krysko
R AGCCCTGAGCCCTTAATTC 19
et al., 2006). In addition, the exacerbation of responses will determine
IL-10
RR

F ACCACGACCCAGACATCAAGA 21 153
the success or failure of Leishmania infection. During the progression of
R CCTGGAGCTTACTAAATGCGCT 22 experimental glomerulonephritis, apoptosis is involved in the resolu-
IFN-γ tion of intra- and extra-glomerular inflammation (Praga and Morales,
F GGAAGACATGCTTGGCAAGTTC 22 144 2002). Apoptosis is also intrinsically related to the pathogenesis of kid-
R GGTGAGAGATCATTCATCACTTTGA 25 ney injury (Ueda et al., 2000).
IL-12
The balance between members of the Bcl2 family of pro and anti-
F ACCTGCAGCTGAAGCCATTG 20 163
apoptotic proteins has been implicated in the control of Casp 3 activity,
CO

R GTCTTGTCCACGCAGAGTCT
IL-4
F CCTCACAGCGAGAAACGACTC
R CAGTACAGTAGCAGCTCT
IL-2
F ACAAAATGCAACTCTTGTCT
R GCTCCATCTGTTGCTCTG
a nt = nucleotides.
UN
20
by inhibiting the activation of procaspase 3, thus preventing the release
21 109 of cytochrome c from mitochondria (Siddiqui et al., 2015). The role
18 played by caspases and the balance between pro and anti-apoptotic pro-
teins in renal glomeruli, tubules, and inflammatory cells infiltrate in
20 105
naturally Leishmania infected dogs with or without clinical signs of ca-
18
nine leishmaniosis (CanL) have not been evaluated yet.
Chemokines and their receptors play an important role in the re-

b bp = base pair.
apoptotic bodies that are phagocytosed by nearby cells (Tang et al.,
2019).
Apoptosis is initiated by intracellular or extracellular stimuli, the in-
trinsic and extrinsic apoptosis pathway, respectively. Intrinsic apopto-
sis is initiated by several intracellular micro-environmental perturba-
tions whereas extrinsic apoptosis is initiated by perturbations of the ex-
tracellular microenvironment (Galluzzi et al., 2018). In the intrinsic
pathway mitochondrial outer membrane permeabilization may occur,
resulting in the release of molecules from mitochondria, such as cy-
tochrome c and activation of caspases. In the extrinsic pathway cell
cruitment of T cells, macrophages, and dendritic cells during the devel-
opment of chronic kidney injury (Holdsworth and Tipping, 2007;
Chung and Lan, 2011). Alteration in the cytokine profile, especially
chemokines, may contribute to the development of severe glomerular
lesion (Araya et al., 2006; Vaidya et al., 2011). In chronic infection by
Leishmania spp., infection induces expression of several chemokine
genes (Brenier-Pinchart et al., 2001; Ritter and Körner, 2002). Studies
reported the expression of CCL2 (MCP-1), CCL4 (macrophage inflam-
matory protein (MIP)-1β), CCL5 (RANTES) in humans and mice in-
fected with L. major (Ji et al., 2003; Matte and Olivier, 2002).

2
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

Table 2
Results of canine leishmaniosis diagnostic test (serological, parasitological and molecular) of clinical affected and subclinically infected dogs and uninfected con-
trols.
SAMPLES SEROLOGICAL TESTS PARASITOLOGICAL TESTS PCR
Kidney
Dogs Clinical status Sex IFAT (titre) ELISA Impression smears Culture

F
1:40 1:80 1:160 1:320 Spleen liver skin LN# Spleen liver LN#

01 Clinical affected F – + – – + + + + – + + – +

OO
02 F – + – – + + – – + – + + +
03 F – + – – + + + – + – + – +
04 M – – + – + + + – + + – + +
05 M – + – – + – – + – + – + +
06 F – + – – + + + – + – + – +
07 F – – – + + + + – + + + + +
08 M – + – – + + + – + – – + +
TOTAL – 6/8 (75 1/8 (12.5 1/8 (12.5 8/8 (100 7/8 (87.5 6/8(75 2/8 (25 6/8 (75 4/8 (50 5/8 (62.5 5/8 (62.5 8/8 (100
%) %) %) %) %) %) %) %) %) %) %) %)

PR
09 Subclinically F + – – – + + – – + + + + +
10 infected M + – – – + + + – – – + – +
11 F + – – – + – + – + + + – +
12 F + – – – + + + – – – – + +
13 F + – – – + – – – + + – – +
14 M + – – – + – + – + – + – +
15 F + – – – + + + – + – + + +
16 F + – – – + – – – + – – + +
TOTAL 8/8 (100 – – – 8/8 (100 4/8 (50 5/8 (62.5 – 6/8 (75 3/8 (37.5 5/8 (62.5 4/8 (50 8/8 (100

17
18
19
20
21
Unifected M
F
M
F
F
%)
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
%)
–
–
–
–
–
ED %)
–
–
–
–
–
%)
–
–
–
–
–
–
–
–
–
–
%)
–
–
–
–
–
%)
–
–
–
–
–
%)
–
–
–
–
–
%)
–
–
–
–
–
%)
–
–
–
–
–
22 F – – – – – – – – – – – – –
23 M – – – – – – – – – – – – –
CT
TOTAL – – – – – – – – – – – – –
# LN = lymph nodes.

We have shown that the balance between IL-12 and IL-4 plays an Zoonotic Diseases of Teresina- State of Piaui, Brazil. Initially, dogs were
important role in the regulation of inflammation in renal tissue related subjected to physical examination emphasizing the main parameters in-
to clinical presentations in CanL (Verçosa et al., 2021). To our knowl- dicative of CanL (Verçosa et al., 2008).
RE

edge, the expression of apoptotic proteins in renal tissue in CanL has
not been fully elucidated yet.
Considering that inflammation stimulates apoptosis as a protection
mechanism against tissue lesion and Leishmania inhibits apoptosis as an
escape mechanism from immune defense, we hypothesize that the bal-
ance between proteins from apoptotic pathways can be differently ex-
pressed in renal tissue, and they could be related to clinical manifesta-
R
Sixteen naturally infected (confirmed by positive tests) L. infantum
dogs were evaluated. Serological diagnosis tests (immunofluorescence
antibody test: IFAT, Bio-Manguinhos, Fiocruz, Rio de Janeiro, Brazil
and enzyme-linked immunosorbent assay: ELISA, Bio-Manguinhos,
Fiocruz, Rio de Janeiro, Brazil), parasitological tests (impression
smears and culture), and molecular tests (PCR) for CanL were per-
formed to diagnose leishmaniosis. The seven dogs that tested negative

tions in leishmaniosis. Thus, the aim of this study was to evaluate cell for L. infantum were used as controls. All infected dogs (clinical and sub-
death by apoptosis in glomeruli, in renal tubules and within the inflam- clinical infection) tested positive in the PCR test and in at least one of
matory infiltrates, and to correlate these results with the intensity of in- the two parasitological tests in different organs (bone marrow, spleen,
CO

flammation and clinical form of L. infantum naturally infected dogs. liver, skin, and lymph nodes).
Morphometric approach, chemokines and molecules involved in apop- Based on their clinical signs, the 23 dogs were divided into three
tosis and inflammatory recruitment were measured by quantitative RT- groups: a) eight clinically affected CanL-positive dogs with clinical
PCR (qRT-PCR). signs of the disease; b) eight serological, parasitological, and molecular
positive CanL tests in subclinically infected dogs, with no clinical signs
2. Material and methods of the disease; and c) Seven CanL-negative control dogs.
Dogs were tranquilized with acepromazine (1%) and euthanized
UN

2.1. Ethical issues, samples, and experimental design
All procedure were done according to the guidelines established by
Institutional Dog Care and Use Committee (Ethical Committee in Dog
Experimentation - CETEA, from Federal University of Minas Gerais)
(protocol number 224/2009), which approved the experimental proto-
col of this study. All efforts during study were made to prevent unneces-
sary suffering of the animals.
This study evaluated only stray dogs captured as part of a National
Visceral Leishmaniosis Surveillance and Control Program (PNVCLV).
Samples of all studied dogs were collected in the Control Center of
with an overdose of sodium thiopental 7.5 % (75 mg/kg) for post-
mortem examination and sent for sample collection. Macroscopic ab-
normalities were assessed, and these changes were included as parame-
ters used in the classification of animals and subsequent distribution in
study groups.
Kidney samples were collected and fixed in 10 % formalin solution.
Samples of kidney, spleen, liver, skin, and lymph nodes were collected
and impression smears of the cut surface were taken on cleaned slides
for direct visualization of the parasite and to confirm visceralization of
the infection (Verçosa et al., 2012). After sedation of animals with
sodium thiopental, myelograms were performed in samples collected

3
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

Table 3
Inflammatory response in the kidney of the clinical affected, subclinically Leishmania- infected and uninfected dogs.
Sample Inflammatory infiltrate

Dogs Clinical status Inflammation score* Localization Distribuition Inflammatory cells

Perivascular Periglomerular Peritubular Subcapsular Focal Multifocal Difuse

F
01 Clinical affected 3 x x x – – – x ↑M, L
02 3 x x x – – x – ↑M, L
03 2 x x x – – x – M, L

OO
04 2 x x x – – x – M, L, ↓N
05 2 x – x – x – – M, L
06 2 x x x – – x – M, L
07 2 x – x – x – – M, L
08 3 x x x – – x – ↑M, L
TOTAL 8/8 (100 %) 8/8 (100 %) 6/8 (75 %) 8/8 (100 %) 0 2/8 (25 %) 5/8 (62.5 %) 1/8 (12.5 %) –
09 Subclinically infected 1 – – x – x – – M, ↓L
10 2 x x x x x – – M, L

PR
11 1 x x x – x – – M, L
12 1 x – x – x – – M, ↓L
13 1 x x x – x – – M, L
14 1 – – x x x – – M, L
15 1 – – x – x – – M, ↓L
16 1 – x x – x – – M, L
TOTAL 8/8 (100 %) 4/8 (50 %) 4/8 (50 %) 8/8 (100 %) 2/8 (25 %) 8/8 (100 %) 0 0 –
17 Uninfected – – – – – – – – –
18 1 x x x M, L
19
20
21
22
23
TOTAL
–
–
–
–
1
2/8 (25 %)
–
–
–
–
–
0
–
–
–
–
x
2/8 (25 %)
ED –
–
–
–
x
2/8 (25 %) 0
–
–
–
–
–
–
–
–
–
x
2/8 (25 %) 0
–
–
–
–
–
–
–
–
–
–
0
–
–
–
–
M, L
–

Inflammation score: 0- absent, 1- minimum; 1- mild, 3- moderate and 4 – severe. * p < 0,000, Kruskal Wallis. Inflammatory cells: M-macrophages, l- lymphocytes,
and N- neutrophils. + = positive, - = negative. ↑: predominant cells. ↓ rare cells.
CT
from the ventral region of sternum bone with a 20 mL syringe attached Verçosa et al. (2008). The intensity of the lesions was graded as follows:
to a quality precision sterile disposable BD needle 40 mm x 120 (18 G x 1 – minimal; 2 – mild; 3- moderate and 4- severe, according to Verçosa
1 1/2). Smears from bone marrow aspirates were stained with Giemsa et al. (2010).
and examined under an optical microscope (Olympus CX23). Bone mar-
row aspirates were also cultured in NNN culture medium enriched with 2.3. Histomorphometric analysis of cellularity and apoptosis in renal tissue
RE

Schneider’s medium. Growth of the promastigote forms of leishmania

was found on days 5, 8, 10, and 15.
Kidney samples were processed for histological and molecular
analyses. RNA extraction was done from the samples. Tissue sections
(5-μm thick) were stained with hematoxylin and eosin (HE), periodic
acid–Schiff (PAS), and Masson’s trichrome and analyzed by light mi-
R
Morphometry was conducted in a blind assay by a single observer,
using digitized pictures in Media Cybernetics Image-Pro Plus version 4.5
software (Supplementary Fig. 1). Twenty histological fields per dog
were quantified as described by Moro et al. (2004). Cellularity and
apoptosis were quantified in microscopic fields of 23,437.6 µm2 (with a

croscopy (Olympus CX23).
Kidney samples from all dogs were submitted for DNA extraction,
with the “Genomic DNA from tissue kit” (NucleoSpin®Tissue,
Macherey-Nagel, Durën, Germany). PCR was performed using GoTaq®
CO
40x objective) in HE stained slides, evaluating a final total kidney area
of 468,752 µm2. Apoptotic cells were counted considering the simulta-
neous presence of at least three peculiar morphological features of the

process: 1) Shrunken anoikic cells (cellular retraction, dehydration and

Green Master Mix Kit (Promega Corporation, Madison, WI) using loss of adherence between cells and basement membranes); 2) Cyto-
primers from the specific L. donovani DNA sequence, as described by plasmic and nuclear condensation (nuclear chromatin in homogenous
Piarroux et al. (1993). DNA (10 ρM) of each primer was diluted to 1:10 dense masses, aligned on the internal side of the nuclear membrane,
LV1 (5-ACGAGGTCAGCTCCACTCC-3) and LV2 (5- sometimes forming “crescents” or “black hole” images; 3) Nuclear frag-
CTGCCACGCCTGTGTCTAC-3), at a concentration of 10 µM. DNA sam- mentation (convolution and fragmentation (with formation of apop-
ples from previously tested infected dogs as well as L. infantum DNA, totic bodies). The apoptotic index (AI) was determined by the following
MHOM/BR/1967/BH46 strain were used as the PCR-generated positive
UN

formula: AI = (Σ number of apoptotic cells/ Σ total number of cells) x

control. DNA from non-infected dogs along with a reaction control with
no DNA was used as a negative control.
2.2. Descriptive evaluation of the inflammatory response in the kidney
Intensity, composition, and distribution of the inflammatory re-
sponse of kidney were evaluated in samples stained on hematoxylin and
eosine (HE). Inflammatory infiltrates were characterized as: (a) discrete
and focal: with a small, isolated foci of inflammatory cells; (b) moderate
and multifocal: with coalescent foci; and (c) severe and diffuse: with
large diffuse areas, as described by Solano-Galleno et al. (2004) and
100.
Histomorphometric parameters were correlated with AI. They were
evaluated from sections stained with HE. The number of inflammatory
foci, areas, perimeters, and extreme diameters was quantified in 20
fields of 356,207 μm2 at ×10 magnification, evaluating a total area of
7,124.140 μm2. Areas occupied by large blood vessels and glomeruli
were excluded (Verçosa et al., 2021). Supplementary Fig. 2.

4
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

F
OO
PR
D
TE
EC

Fig. 1. Representative images of apoptosis by morphological characteristic in HE stained slide (A,C,E) and by in situ fragmentation of genomic DNA by terminal de-
RR

oxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling (TUNEL method) (B,D,F) in the kidney of a clinical affected dog. Morphological characteristics
of apoptosis (cell shrinkage, chromatin condensation at the periphery of the nucleus, nuclear and/or cytoplasm fragmentation, nuclear pyknosis, and nucleolar dis-
integration) are shown in glomeruli (A), tubules (C), and inflammatory infiltrate (E) (black arrow). Brownish intranuclear clusters that confirm in situ fragmenta-
tion of genomic DNA by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling (TUNEL method) are showed in glomeruli (B), tubules (D)
and inflammatory infiltrate (F) associated with apoptosis morphological characteristics (black arrow). (400x magnification, Olympus CX23 microscope).
Bar = 50 μm.
CO

2.4. Detection of the renal apoptosis by terminal deoxynucleotidyl
transferase (TdT)-mediated dUTP nick end labeling (TUNEL method)
Apoptotic cells were detected by in situ cell death detection specific
kit (“Apoptag® Peroxidase in situ, Apoptosis Detection Kit”, Chemicon),
and the assay was performed following the protocols provided by the
manufacturer. Then, the development was performed with DAB+ (Sub-
UN
methanol for 30 min in the dark, to block the activity of endogenous
peroxidase. Antigenic recovery was performed using 1.2 mg/mL Tris-
HCl (pH 1.0) in a microwave oven (Sanyo, Brazil), in consecutive cycles
of 10 and 5 min. After washing with 0.01 M phosphate buffered saline,
pH 7.2 (PBS), the sections were treated with Lock Kit (Vector Laborato-
ries, Inc., Burlingame, USA) and a protein block (Dako Corporation).
The slides were then incubated at 4 °C with different antibodies diluted

strate Chromogen System, DAKO Corporation, Carpinteria, USA), and
stained with Methyl Green, for 3 min, at room temperature. A negative
control was performed omitting TdT in the reaction (Gavrieli et al.,
1992; Ueda and Shah, 2000). Positive control contained in the kit was
used.
2.5. Detection of Casp 3, Bcl2 and Bax by immunohistochemistry
Histological slides of kidney samples embedded in paraffin were de-
paraffinized in xylene and rehydrated in alcohol (absolute and decreas-
ing concentrations from 90 % to 60 %). After this procedure, the slides
were incubated with a solution containing 0.03 % hydrogen peroxide in
in PBS in a humid atmosphere for at least 12 h. Immune expression of
Casp 3 (Lyophilized mouse monoclonal antibody CPP32 (Caspase 3),
Novocastra), Bax (Polyclonal Rabbit anti-human Bax, DAKO) and Bcl2
(Monoclonal mouse anti-human Bcl2 oncoprotein, clone 124, DAKO)
antigens were detected in renal sections. Monoclonal antibodies were
used in 1:100 dilution and a LSAB® System - HRP (Biotinylated Link
Streptavidin – HRP, DAKO) was revealed with a 3.3´- diaminobenzidine
(DAB) solution (0.024 %) in PBS. The slides for negative controls were
incubated only with PBS. Counterstaining was performed using Harry's
haematoxylin (Sigma Chemical, USA).

5
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

F
OO
PR
D
Fig. 2. Representative images of immunohistochemistry (immunoperoxidase) staining Bax in glomeruli (A) and tubules (C) and Bcl2 in glomeruli (B) and in tubules
(D) in kidney of a clinical affected Leishmania-infected dog. Cells of glomeruli, epithelial cells of the cortical and medullar tubules and cells of inflammatory foci
TE
showed intense cytoplasmic expression of Bax and Bcl2, associated with morphological characteristics of apoptosis (cell shrinkage, chromatin condensation and nu-
cleolar disintegration) (black arrows). Cells in glomeruli show chromatin condensation at the periphery of the nucleus, nucleolar disintegration and nuclear retrac-
tion associated with positive expression for the pro-apoptotic molecule Bax (A). Strong expression of the anti-apoptotic Bcl2 was also detected in glomeruli of Leish-
mania-infected dogs, but it was not associate with morphological features of apoptosis (B). Peculiar morphological features of apoptosis (anoikia, chromatin conden-
sation, nucleolar fragmentation, and nuclear retraction) were associated with strong expression of Bax (C). Whereas expression of Bcl2 is also observed in cortical
and medullar cells of tubules in Leishmania-infected dogs, but it does not correlate with morphological characteristics of the apoptosis (D). (400x magnification,
EC

Olympus CX23 microscope). Bar = 50 μm.

2.6. Tissue samples collection, extraction of total RNA and synthesis of first
strand cDNAs
Samples of kidney were stored at −80 °C until RNA extraction.
About 20 mg of each sample were homogenized and treated with the
RR
samples were incubated at 95 °C for 10 min and then submitted to 40
cycles of 95 °C for 15 s and 60 °C for 1 min, during which, time fluores-
cence data were collected. Three replicate analyses were performed,
and the amount of target RNA was normalized with respect to the en-
dogenous controls (housekeeping) genes GAPDH, HPRT, RPS18, RPL1

NucleoSpin® RNA II Kit (Macherey-Nagel, Germany), according to the
manufacturer´s recommendations. cDNAs were synthesized from 1.0 µg
of total RNA, using the High-Capacity cDNA Reverse Transcription Kit
(Applied Biosystems, USA) with RT random primers according to the
manufacturer´s instruction, and stored at −20 °C until used.
CO
and β-Actin. Finally, each qRT-PCR run was performed with five inter-
nal controls assessing both potential genomic DNA contamination (no
reverse transcriptase added) and purity of the reagents used (no cDNA
added). The specificity of qRT-PCR products was confirmed by the sin-
gle peak dissociation curves. Data were expressed according to the 2-
ΔΔCT method using the mean value of the ΔCt of the control group as

2.7. Primers for gene evaluation
Specific primers for chemokine and apoptotic proteins were de-
signed, according to DelPuerto et al. (2010). For PCR controls, primers
were designed with the aid of Gene Runner version 3.05 (Hasting Soft-
ware Inc. 2004) using specific canine sequences from GeneBank. The
primers were synthesized by Eurofins MWG operon (Huntsville, Al,
UN
the calibrator (Bustin et al., 2009). After normalization, the expression
levels of genes in the infected groups were considered up-regulated or
down-regulated compared to expression levels in the control group
(Menezes-Souza et al., 2011).
2.9. Statistical analysis

USA), and reconstituted in nuclease free water. All specific primers for
chemokine and apoptotic proteins are shown in Table 1.
2.8. Real-Time PCR
Expression of the chemokines (CCL5, CCL4, MCP-1, and MCP-2),
pro-apoptotic and anti-apoptotic proteins (Casp 3, Casp 8, Casp 9, Bax,
Bcl2, and Fas), and molecules involved in the recruitment of inflamma-
tory cells and in apoptosis, was quantified by qRT-PCR. qRT-PCR was
performed on an ABI Prism 7500 DNA Sequence Detection System us-
ing SYBR Green PCR Master Mix (PE Applied Biosystems, Foster City,
CA, USA), with 100 mM of each primer and cDNA diluted to 1:10. The
The sample size was calculated according to the method used by
Dell et al. (2002). The power was 90 % (0.9) and α = 0.05; the stan-
dard deviation of the variables was estimated as 20 % (0.2), and the
magnitude of the difference (d) was estimated as 40 % (0.4). The mini-
mum number of animals per group was found to be seven.
Data collection and statistical tests were performed using blind
analysis. Morphometric results were submitted to the Lilliefors test for a
Gaussian distribution and to a Cochran-Bartlett test to evaluate the ho-
moscedasticity. Data with Gaussian distribution were subjected to
ANOVA and Tukey multiple comparison procedure. Non-parametric
data were analyzed using Kruskal Wallis and Dunn tests. Chemokines
and apoptotic protein expression data in infected groups were analyzed

6
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

F
OO
PR
D
Fig. 3. Representative images of immunohistochemistry (immunoperoxidase) staining Casp 3 in glomeruli and tubules in kidney of a clinical affected Leishmania-
infected dog. Cells of renal glomeruli and cells present in tubules also show intense expression of Casp 3 in tissue section stained with immunoperoxidase. Intense
TE
expression of Casp 3 was associated with morphological characteristics of apoptosis (cell shrinkage, chromatin condensation and nucleolar disintegration) (black ar-
rows). Cells in glomeruli showing morphological characteristics of apoptosis were associated with intense expression of Casp 3 in clinical affected dogs (A). Casp 3
expression was seen in cells of renal tubules, both in cortical and medullary region, in Leishmania-infected dogs. Immunoexpression of Casp 3 in tubules was associ-
ated with morphological feature of apoptosis (B). In addition, cells in inflammatory foci localized in periglomerular region and/or interstitial space showed a strong
expression of the Casp 3 associated with morphological characteristics of apoptosis (C and D). (400x magnification, Olympus CX23 microscope). Bar = 50 μm.
EC

Table 4
Apoptotic index in cortical and medullary regions of kidneys in glomeruli, tubules and inflammatory infiltrate in Leishmania infantum naturally infected dogs
(clinically affected and subclinically infected) and uninfected (control) groups.
Groups APOPTOSIS

Glomeruli Tubules Inflammatory infiltrate

RR

Cortical region of kidney Medullar region of kidney

Clinical affected N = 8 42.04 ± 3.90a* 20.86 ± 2.73a* 29.57 ± 3.61a* 49.30 ± 3.43a*
Subclinically infected N = 8 33.49 ± 3.46ab 17.49 ± 1.13ab 23.33 ± 2.86ab 38.47 ± 1.72b
Uninfected N = 7 23.89 ± 2.15b 12.22 ± 0.93b 17.90 ± 1.87b 26.22 ± 1.34c
p = 0.004 p = 0.013 p = 0.039 p< 0.001

Different letters indicate values that are significantly different among the groups for each morphometric parameter by Tukey test (p < 0.05). Mean ± standard error.
CO

(a > b>c).

by Mann Whitney test. Morphometric data were subjected to ANOVA chogryphosis (4/8, 50 %), fever (2/8; 25 %), and paleness of the mu-
and Tukey multiple comparison procedure. The Chi-square was used to cous membranes (1/8, 12.5 %).
test the association of variables. To verify an eventual correlation be-
tween variables, the Pearson and Spearman test were used in morphom- 3.2. Macroscopic and histopathological findings
etry and molecular data, respectively. All statistical analysis were done
UN

with SAS program and were considered significant to p < 0.05.
3. Results
3.1. Clinical and laboratory findings
In this study, dogs regarded as non-infected controls had negative
results in all tests, including PCR. Laboratory findings for all clinical
forms of canine leishmaniosis and control groups are shown in Table 2.
The main clinical signs of CanL were lymphadenopathy (6/8; 75 %),
conjunctivitis (5/8; 62.5 %), hepatosplenomegaly (4/8, 50 %), ony-
Macroscopic changes were observed only in clinical affected Leish-
mania-infected dogs. Congestion in the cortical and medullary areas of
renal tissue and interstitial nephritis, characterized by the presence of
several whitish spots in the kidneys were observed in four (4/8, 50 %)
clinical affected dogs. Histopathological sections of all groups (clinical
affected subclinically infected, and uninfected) showed inflammatory
infiltrates and other renal alterations. Inflammatory response in the
kidney of Leishmania-infected dogs (clinical affected and subclinically
infected) and uninfected controls are shown in Table 3. Clinical affected
dogs showed more intense inflammation (p < 0001 by Kruskal Wallis
followed by the Dunn’s method for multiple comparison) and higher
cellularity (99.65 ± 8.07 cells) in the inflammatory infiltrates com-

7
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

F
OO
PR
D
TE
EC

Fig. 4. mRNA expression of apoptotic proteins in kidney of Leishmania-infected dogs, with or without clinical manifestations. The expression of Bax, Bcl2, Casp 9
and Fas were upregulated in clinical affected dogs and downregulated in subclinically infected dogs. Casp 3, Casp 8, Casp 8/Casp 3 and Bax/Bcl2 expression were up-
regulated in clinical affected and subclinically infected dogs. Casp 9/Casp 3 expression was downregulated in clinical affected and subclinically infected dogs.
Bax/Bcl2 showed higher mRNA expression levels in kidney from clinical affected as compared to subclinically infected dogs. Clinical affected dogs (n=8) and sub-
clinically infected dogs (n=8). Mann-Whitney test, * p <0,05. Values were considered up- or down-regulated compared to expression levels in the control group.
RR

pared to subclinically infected ones (77.51 ± 4.58 cells), which were
higher than controls (32.85 ± 1.47 cells) (p < 0.05; Tukey test). Only
Leishmania-infected dogs showed tubular atrophy, mesangial and inter-
stitial fibrosis, hyaline cylinders, hyaline degeneration, and tubular di-
lation. Leishmania amastigotes were not found in any kidney sample by
CO
Apoptosis was confirmed by in situ fragmentation of genomic DNA
by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick
end labeling, TUNEL reaction, in glomeruli, tubules and inflammatory
foci, in Fig. 1B, D, F, respectively. Positive cells show a brownish in-
tranuclear staining.

histopathological analysis. Representative images of cells in glomeruli presenting shrunken

3.3. Apoptosis in cells of renal glomeruli, tubules and within inflammatory
foci by morphological aspects and TUNEL method
Apoptosis was observed in cells of glomeruli, tubules, and inflam-
matory foci in all infected dogs (clinical affected and subclinically in-
UN
anoikic cells, cytoplasmic and nuclear condensation, and nuclear con-
volution and fragmentation in the kidney slides of Leishmania-infected
dogs stained with HE are shown in Fig. 1A. Representative images of
cells in glomeruli with similar morphological features of apoptosis, pre-
senting a brownish intranuclear cluster, assessed by in situ fragmenta-
tion of the genomic DNA TUNEL method, are shown in Fig. 1B. Chro-

fected). Representative images illustrating morphological aspects of
apoptosis in renal cells in glomeruli (Fig. 1A), tubules (Fig. 1C), and in-
flammatory foci (Fig. 1E) are shown in slides stained by HE. The follow-
ing morphological features of apoptosis were observed in analyze of
slides; 1) Shrunken anoikic cells (cellular retraction, dehydration and
loss of adherence between cells and basement membranes). 2) cytoplas-
mic and nuclear condensation (nuclear chromatin in homogenous
dense masses, aligned on the internal side of the nuclear membrane,
sometimes forming “crescents” or “black hole” images. 3) Nuclear frag-
mentation (convolution and fragmentation, with formation of apoptotic
bodies.
matin condensation of the nucleus periphery and nucleolar fragmenta-
tion were observed in cells of the tubules in the medulla and cortical lo-
calization, in both clinically affected and subclinically infected Leishma-
nia-infected dogs (Fig. 1C). Representative images of apoptosis are
shown by TUNEL staining in tubular cells (Fig.1D). Morphological char-
acteristics of apoptosis were also observed in cells in the renal inflam-
matory foci (Fig. 1E and F).
Fig. 2 shows representative images of immunohistochemistry for
Bax in cells of glomeruli (Fig. 2A) and tubules (Fig. 2 C) and for Bcl2 in
cells of glomeruli (Fig. 2B) and tubules (Fig. 2D). Cells of glomeruli, ep-
ithelial cells of the cortical and medullar tubules and cells of inflamma-
tory foci showed intense cytoplasmic expression of Bax and Bcl2 (Fig.

8
B.L. Araújo Verçosa et al.
D
TE
Fig. 5. mRNA expression of inflammatory chemokines in kidney of the clinical affected and subclinically infected Leishmania-infected dogs. The expression of MCP-
1 (CCL2) (A), and CCL5 (RANTES) (E) were up regulated in clinical affected and subclinically infected dogs. MCP-2 (CCL8) (B) and CCL4 (MIP-1b) (C) were upregu-
lated in clinical affected dogs and downregulated in subclinically infected dogs. CCL4 (C) showed higher mRNA expression levels in kidney from clinical affected as
EC
compared to subclinically infected dogs. Clinical affected dogs (n=8) and subclinically infected dogs (n=8). Mann-Whitney test, * p <0,05. Values were consid-
ered up- or down-regulated compared to expression levels in the control group.
2). Cells in glomeruli presented chromatin condensation at the periph-
ery of the nucleus, nucleolar disintegration and nuclear retraction asso-
ciated with positive expression for the pro-apoptotic molecule Bax (Fig.
2 A). Strong expression of the anti-apoptotic Bcl2 was also detected in
RR
glomeruli of Leishmania-infected dogs, but it was not associate with
morphological features of apoptosis, as observed in Fig. 2 B. Similar re-
sults were found when epithelial cells of the renal tubules were ob-
served. Peculiar morphological features of apoptosis (anoikia, chro-
matin condensation, nucleolar fragmentation, and nuclear retraction)
were associated with strong expression of Bax (Fig. 2 C), whereas ex-
CO
pression of Bcl2 was also observed in cortical and medullar cells of
tubules in Leishmania-infected dogs, although it was not correlated with
morphological characteristics of the apoptosis (Fig. 2D).
Representative images of immunohistochemistry for Casp 3 are
shown in glomeruli and tubules in Fig. 3. Cells of renal glomeruli and
cells present in tubules also showed intense expression of Casp 3 in tis-
sue section stained with immunoperoxidase (Fig. 3). Cells in glomeruli
UN
showing morphological characteristics of apoptosis were associated
with intense expression of Casp 3 in clinical affected dogs (Fig. 3A).
Casp 3 expression was seen in cells of renal tubules, both in cortical and
medullary region, in Leishmania-infected dogs. Immunoexpression of
Casp 3 in tubules was associated with morphological feature of apopto-
sis, as shown in Fig. 3 B. In addition, cells in inflammatory foci localized
in periglomerular region and/or interstitial space showed a strong ex-
pression of the Casp 3 associated with morphological characteristics of
apoptosis (Fig. 3C and D, respectively).
Apoptotic cells were quantified in HE stained slides, considering the
simultaneous presence of at least three peculiar morphological features
of apoptosis to calculate the apoptotic index. Cells in glomeruli and
9
Veterinary Parasitology xxx (xxxx) 109611
F
OO
PR
tubules, both in cortical and medullar regions, showed a higher apop-
totic index in clinical affected dogs as compared to control ones
(p < 0.05, Tukey test). Apoptosis within the inflammatory infiltrates
was highest in clinical affected dogs, intermediary in subclinically in-
fected and lowest in uninfected controls (p < 0.05, Tukey test) (Table
4). Positive and significant correlation between cellularity and apopto-
sis index was detected in medullar tubules (r = 0.40, n = 23,
p = 0.033) and within inflammatory foci (r = 0.58, n = 23,
p < 0.002). Additionally, strong positive correlation between apop-
totic index and histomorphometrical parameters of inflammation were
observed in area (r = 0.68, n = 23, p < 0.001), perimeter (r = 0.70,
n = 23, p < 0.001), major diameter (r = 0.71, n = 23, p < 0.001)
and minor diameter (r = 0.77, n = 23, p < 0.001) and number of in-
flammatory focus (r = 0.78, n = 23, p < 0.001).
3.4. Molecular findings
The expression of MCP-2, CCL4, Bax, Bcl2, Casp 9, and Fas was up-
regulated in clinically affected dogs and downregulated in subclinically
infected dogs. MCP-1, CCL5, Casp 3, Casp 8, Casp 8/Casp 3 and
Bax/Bcl2 expression was upregulated in clinical affected and subclini-
cally infected dogs. Casp 9/Casp 3 expression was downregulated in
clinical affected and subclinically infected dogs (Figs. 4 and 5).
Bax/Bcl2, Casp 3/CCL4 and CCL4 expression was directly associated
with the presence of clinical manifestations (p = 0.048, p = 0.008,
p = 0.036 Chi-square test, respectively). Bax/Bcl2 and CCL4 showed a
higher mRNA expression levels in kidney from clinical affected as com-
pared to subclinically infected dogs (p < 0.05; Mann Whitney test).
Casp 3/CCL4 ratio expression was lower in clinical affected dogs than
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

Table 5 dogs than that of subclinically infected and control group. Expression of
The expression of apoptosis proteins and chemokines in kidney samples of the pro-apoptotic Bax, the initiator Casp 8, and the effector Casp 3, the
clinical affected and subclinically infected dogs with canine leishmaniosis. main molecules involved in apoptosis, were enhanced only in clinical
Apoptotic protein Expressions (μg/μL) H *p affected leishmaniosis dogs, although the expression of the anti-
and Chemokines apoptotic Bcl2 was also increased in this group, therefore suggesting
Clinical affected Subclinically infected
that there was also regulation of apoptosis in clinical affected CanL.
Median ± SD (n) Median ± SD (n)
Several molecules have been identified as capable of influencing the

F
Casp 3 1.86 ± 1.47 (5) 1.27 ± 0.69 (7) 0.01 process of apoptosis. Bcl2 protein family plays critical role in the regula-
Casp 8 2.82 ± 2.58 (6) 2.37 ± 1.79 (7) 0.33 tion of apoptosis in physiological or pathological conditions (Patel and

OO
Casp 9 0.87 ± 1.22 (6) 0.15 ± 0.13 (7) 2.04 Gores, 1998). Bcl2 family cause inhibition of cytochrome c release, re-
Bcl2 1.38 ± 1.57 (6) 0.82 ± 0.73 (7) 0
sulting in increased levels of phospho-Bad (Akarid et al., 2004).
Bax 0.55 ± 0.55 (6) 0.71 ± 0.69 (7) 0.73
Our data suggest that although there was a high expression of both
Fas 0.03 ± 0.04 (6) 0.01 ± 0.01 (7) 1.31
MCP1 142.70 ± 212.30 (7) 12.56 ± 9.83 (7) 1.10
apoptotic Bax and anti-apoptotic Bcl2 molecules in kidney tissues of
MCP2 3.56 ± 4.07 (7) 0.76 ± 1.08 (7) 0.92 clinical affected infected dogs, the Bax expression was higher than Bcl2.
CCL4 6.23 ± 6.78 (7) 0.14 ± 0.14 (6) 1.31 0.04 This finding indicates predominance of molecules that induces apopto-
CCL5 0.63 ± 0.67 (6) 0.46 ± 0.55 (6) 0.41 sis in renal tissue of clinical affected dogs, which was not observed in
Bax/Bcl2* 0.87 ± 0.28 (6) 0.49 ± 0.20 (6) 5.03 0.026 subclinically infected ones. In fact, the apoptotic index was higher in

PR
Casp 8/ Casp 9 17.77 ± 15.60 (8) 37.64 ± 45.55 (6) 0.42 clinical affected animals. The ratio of Bax/Bcl2 may be used as a para-
Casp 8/ Casp 3 1.83 ± 0.32 (7) 1.88 ± 0.67 (6) 0 meter to determine cellular susceptibility to cell death (Oltvai et al.,
Casp 9/ Casp 3 0.16 ± 0.11 (8) 0.20 ± 0.21 (6) 0.27 1993; Yang and Korsmeyer, 1996). The proportion of proteins of the
Casp 3/CCL4* 0.35 ± 0.29 (5) 9.58 ± 4.98 (5) 6.82 0.008 Bcl2 family (pro and anti-apoptotic) can define which cells will live or
Casp 3/CCL5 3.11 ± 2.66 (6) 4.19 ± 3.29 (7) 0.02 die under the continuous action of adverse agents (Kale et al., 2018). An
Casp 3/ MCP-1 7.33 ± 0.34 (8) 0.34 ± 0.42 (6) 0 increase in Bcl2 expression induces cell survival, while Bax (a pro-
Casp 3/ MCP-2 3.76 ± 4.03 (7) 6.16 ± 6.25 (6) 0.08
apoptotic antagonist of Bcl2) favors apoptosis (Kale et al., 2018). Our
Mann Whitney test. results indicate that there was more cell death in glomeruli, tubules and

D
*

in inflammatory foci in clinical affected dogs than in subclinically in-

subclinically infected ones (p < 0.05; Mann Whitney test). Data are
shown in Table 5.
TE
Additionally, strong positive correlations were detected between
apoptotic Bax and anti-apoptotic Bcl2 mRNA expression levels
(r = 0.93, n = 13, p < 0.001) in the renal tissues. A positive correla-
tion was detected between Casp 3 mRNA expression with Casp 8
(r = 0.96, n = 12, p < 0.001). Furthermore, Casp 3 expression was
positively correlated with CCL4 (r = 0.61, n = 11, p = 0.04), CCL5
EC
fected ones.
The upregulation of the cytotoxic Fas molecule that trigger the ex-
trinsic pathway of apoptosis, and the positive correlation between Fas
and IFN-γ indicate that extrinsic pathway of apoptosis was activated in
the clinical affected leishmaniosis dogs evaluated. Furthermore, im-
mune response to Leishmania infection increases the production of hy-
drogen peroxide (de Saldanha et al., 2012; Kückelhaus et al., 2013) and
nitric oxide (Kückelhaus et al., 2013), mainly in monocytes/

(r = 0.84, n = 11, p = 0.001), MCP-1 (r = 0.84, n = 12, p < 0.001)
and MCP-2 (r = 0.71, n = 12, p = 0.009). Likewise, Casp 8 was posi-
tively correlated with CCL5 (r = 0.67, n = 12, p = 0.017), MCP-1
(r = 0.81, n = 13, p = 0.001) and MCP-2 (r = 0.67, n = 13,
p = 0.012) mRNA expression levels in the renal tissues. In addition,
Bax expression was positively correlated with CCL5 (r = 0.75, n = 12,
RR
macrophages, suggesting that the intrinsic pathway of apoptosis should
also be activated, possibly in both clinical affected and subclinically in-
fected animals. The inflammatory response develops to inactivate and
destroy dangerous pathogens. These events include the production and
release of oxidative compounds such as nitric oxide and oxygen
metabolites. However, oxygen radicals can also cause damage to tissue,

p = 0.005), MCP-1 (r = 0.72, n = 13, p = 0.005) and MCP-2
(r = 0.79, n = 13, p = 0.001).
In addition, strong positive correlations between apoptotic protein
and cytokines mRNA expression levels were observed in renal tissue.
Casp 3 expression was positively correlated with IFN-γ (r = 0.86,
n = 11, p = 0.001), IL-4 (r = 0.79, n = 13, p < 0.001), IL-10
(r = 0.93, n = 12, p < 0.001) and IL-12 (r = 0.93, n = 13,
CO
so antioxidant defense are also active during inflammation. Oxidative
stress occurs when there is an imbalance between the production of oxi-
dant substance and the antioxidant molecules by organism (Peake and
Suzuki, 2004). The role of oxidizing substances has also been studied in
pathogenesis of CanL and other diseases (Erel et al., 1997; Oliveira and
Cecchini, 2000; Bildik et al., 2004; Heidarpour et al., 2012). In these
cases, the oxidative stress could activate caspases by the intrinsic path-

p < 0.001) mRNA expression levels in the renal tissues. Casp 8 corre-
lated with IFN-γ (r = 0.87, n = 11, p = 0.001), IL-4 (r = 0.80,
n = 12, p = 0.002), IL-10 (r = 0.79, n = 12, p = 0.002) and IL-12
(r = 0.96, n = 13, p < 0.001). Furthermore, Bax expression was posi-
tively correlated with IFN-γ (r = 0.91, n = 11, p < 0.001), IL-4
(r = 0.80, n = 12, p = 0.002), IL-10 (r = 0.74, n = 12, p = 0.005)
and IL-12 (r = 0.91, n = 13, p < 0.001). A positive correlation was
UN
way (Curtin et al., 2002). Oxidative stress has also been correlated with
uremia (Johnson-Davis et al., 2011), a common condition in late stage
of leishmaniosis (Costa et al., 2003). The increase in oxidative metabo-
lism exceeds the antioxidant capacity of the cell, causes oxidative
stress, triggering apoptosis (Cendoroglo et al., 1999).
All inflammatory chemokines assessed (MCP-1, MCP-2, CCL4 and
CCL5) were upregulated in clinical affected leishmaniosis dogs,

detected between the Casp 9 with MCP-1 (r = 0.63, n = 13,
p = 0.002) and CCL4 (r = 0.61, n = 12, p = 0.035). Correlations are
shown in Table 6.
4. Discussion
This study assessed apoptosis, inflammation, and the expression of
chemokines and cytokines in the kidneys of clinically affected and sub-
clinically naturally Leishmania infected dogs. Our data showed that
apoptosis was detected in the glomeruli, tubules, and inflammatory foci
in all the studied groups. Furthermore, the apoptotic index was higher
in the glomeruli, tubules, and inflammatory foci of clinically affected
whereas only MCP-1 and CCL5 were upregulated in subclinically in-
fected ones. Chemotactic cytokines regulate the migration of cells to the
site of injury, and these chemokines, mainly MCP-1 (CCL2) and CCL5,
strongly recruit monocytes to lesion foci, that are the main cells in-
volved in defense against Leishmania. The higher number of inflamma-
tory cells in kidney tissue of clinical affected leishmaniosis dogs might
be caused by the higher number of chemokine type expression in these
animals than in subclinically infected ones. The fact that there was a
higher number of inflammatory cells and the apoptotic index was
higher in clinical affected canine leishmaniosis than in subclinically in-
fected dogs suggests that recruitment of cells overtakes its death. It is

10
B.L. Araújo Verçosa et al. Veterinary Parasitology xxx (xxxx) 109611

Table 6 cal conditions (Tian and Phillips, 2002; Guh et al., 2003). Thomas et al.
Correlation between mRNA expression of cytokines, chemokines and apopto- (1998) have reported a progressive and sustained increase in apoptotic
sis protein in kidney lesions of Leishmania infantum clinical affected and sub- cells in glomeruli, tubules, and interstitial space in kidneys of rats, espe-
clinically infected dogs. cially in areas with sclerotic glomeruli and atrophied tubules. Thus,
APOPTOSIS PROTEIN EXPRESSION (μg/μL) r (n; p) * apoptosis of renal cells may contribute to the progression of tubular at-
rophy and chronic renal fibrosis. Increased parenchymal apoptosis (in
Casp 3 Casp 8 Casp 9 Bax Bcl2 Fas
glomeruli and in tubules) may reflect collateral damage related to in-

F
Apoptosis
flammation (Misseri et al., 2005; Duffield et al., 2000). The killing ef-
protein fect of reactive oxygen species or tumor necrosis factor (TNF) is not

OO
expression only limited to pathogens but also promotes cell cycle arrest or apopto-
(μg/μL) sis in epithelial and endothelial cells (Lenda et al., 2003).
Casp 3 – 0.96 (12; n.s 0.96 (12; 0.89 (13; 0.91 (12;
Both chemokines and apoptotic proteins were upregulated in clini-
<0.001) <0.001) <0.001) <0.001)
Casp 8 0.96 (12; – n.s 0.95 (12; 0.85 (13; n.s cal affected dogs, which also showed more cellularity within inflamma-
<0.001) <0.001) <0.001) tory foci. In addition, Bax/Bcl2 and CCL4 had higher expression in kid-
Casp 9 n.s n.s – n.s n.s n.s ney tissues from clinical affected dogs when compared to the subclini-
Bax 0.96 (12; 0.95 (12; n.s – 0.93 (13; 0.87 (12; cally infected group and were directly associated with the presence of
<0.001) <0.001) <0.001) 0.001)
clinical manifestations. Van Zandbergen et al. (2006) reported the pos-

PR
Bcl2 0.89 (13; 0.85 (13; n.s 0.93 (13; – 0.72 (13;
<0.001) <0.001) <0.001) 0.006) sible interference of the parasite in the enzymatic conversion of pro-
Fas 0.91 (12; n.s n.s 0.87 (12; 0.72 (13; – caspase-3 to its active form, resulting in the survival of Leishmania
<0.001) 0.001) 0.006) within the host cell.
Increased cell apoptosis within the inflammatory foci may not be
Citokines
considered as an evidence of resolution of inflammation in kidney of
TNF-α n.s n.s −0.73 n.s n.s n.s
(9; Leishmania-infected dogs, since no decrease in cellularity of inflamma-
0.025) tory foci was associated (Pillay et al., 2010).
Casp 3/CCL4 showed higher expression in kidney tissues from sub-

D
IFN-γ 0.86 (11; 0.87 (11; n.s 0.91 (11; 0.94 (12; 0.79 (12;
0.001) 0.001) <0.001) <0.001) 0.002) clinically infected dogs as compared to clinical affected ones. There-
IL-2 n.s n.s n.s n.s n.s 0.82 (11;
fore, these results may point out to an increased cellular turnover
0.002)
IL-4 0.79 (13; 0.80 (12; n.s 0.80 (12; 0.87 (13; n.s within the inflammatory foci, which involves a complex balance be-
TE
<0.001) 0.002) 0.002) 0.001) tween cellular recruitment and apoptosis (Milot and Filep, 2011). Our
IL-10 0.93 (12; 0.79 (12; n.s 0.74 (12; 0.64 (13; 0.72 (12; results show a strong positive correlation among chemokine expression,
<0.001) 0.002) 0.005) 0.01) 0.007)
cellularity and apoptosis supports this inference. Thus, apoptosis does
IL-12 0.93 (13; 0.96 (13; n.s 0.91 (13; 0.88 (14; 0.93 (13;
<0.001) <0.001) <0.001) <0.001) <0.001)
occur in both parenchyma and within inflammatory foci in the progres-
sion of renal lesions in course of canine leishmaniosis. Apoptosis was as-
CHEMOKINES sociated with inflammation in kidneys of clinical affected dogs. In this
EC

MCP-1 0.84 (12; 0.81 (13; 0.63 0.72 (13; 0.80 (13; 0.91 (13; context, apoptosis may be balancing inflammatory recruitment and act-
0.001) 0.001) (13; 0.005) 0.001) < 0.001)
ing as a marker of inflammatory activity, not necessarily as a resolution
0.002)
MCP-2 0.71 (12; 0.67 (13; n.s 0.79 (13; 0.78 (13; n.s
event. These results showed that apoptosis is not always and only corre-
0.009) 0.012) 0.001) 0.001) lated with resolution of inflammation, as we showed when morphomet-
CCL4 0.61 (11; n.s 0.61 n.s n.s n.s ric and a molecular evaluation were performed concomitantly. There-
0.046) (12; fore, in kidneys of Leishmania infantum infected dogs, apoptosis seems
0.035)
RR

to be balancing inflammatory recruitment and acting as a marker of in-

CCL5 0.84 (11; 0.67 (12; n.s 0.75 (12; 0.82 (11; 0.60 (12;
0.001) 0.017) 0.005) 0.001) 0.038)
flammatory activity, not as a resolution event.
In conclusion, our results suggest that Casp 3/CCL4 ratio is balanc-
* Pearson test, significant for p < 0.05. n.s: p > 0.05.
ing inflammatory recruitment in subclinically infected dogs, in which
was observed a minor cellularity on the inflammatory infiltrate associ-
possible that this occurred because there was more chemokine type ex-
ated with lower apoptotic index. Whereas, Bax/Bcl2 ratio, chemokines,
pression in clinical affected animals than in subclinically infected ones.
Casp 8, Casp 3 and Fas were associated with renal apoptosis, active in-
CO

Leukocyte infiltration and activation of interstitial macrophages play a

flammation and increased inflammatory recruitment observed in clini-
central role in the renal inflammatory response (Chevalier, 2006).
cal affected animals, influencing the clinical presentation of leishman-
Therefore, the maintenance of renal hypercellularity in canine leish-
iosis.
maniosis seems more likely to be due to active recruitment of inflam-
.
matory cells than to the inhibition of apoptosis in mesangial and tubu-
lar cells.
CRediT authorship contribution statement
The loss of resident renal cells by uncontrolled apoptosis is detri-
UN

mental as it may induce reduction of functional renal mass and may

Barbara Laurice Araújo Verçosa: Conceptualization, Data cura-
lead to renal insufficiency. However, some apoptosis is considered es-
tion, Formal analysis, Investigation, Methodology, Validation, Visu-
sential to ensure the adequate turnover and recovery of the original
alization, Writing – original draft, Writing – review & editing. Maria
glomerular and tubular structures when inflammatory process is pre-
Imaculada Muniz-Junqueira: Writing – review & editing. Daniel
sent (Li et al., 2004; Polycarpe et al., 2004; Kim and Dang, 2005).
Menezes-Souza: Data curation, Formal analysis. Luísa Mourão Dias
Tissue damage may also lead to release of reactive oxygen species
Magalhaes: Writing – review & editing. Ricardo Toshio Fujiwara:
and pro-apoptotic cytokines. Damaged tubular cells and interstitial
Data curation, Formal analysis, Writing – review & editing. Maria
macrophages produce cytokines and growth factors that promote an in-
Norma Melo: Resources, Supervision, Validation, Visualiza-
flammatory state in the kidney and may induce tubular cell apoptosis
tion, Writing – review & editing. Anilton Cesar Vasconcelos: Fund-
(Chevalier, 2006; Misseri et al., 2005). However, the mechanism of ep-
ing acquisition, Project administration, Resources, Supervision, Vali-
ithelial cell loss remains uncertain, although it is conceivable that tubu-
dation, Visualization, Writing – review & editing.
lar atrophy primarily results from apoptotic cell death under pathologi-

11
B.L. Araújo Verçosa et al.
Declaration of Competing Interest
The authors report no declarations of interest.
Acknowledgments
The study was supported by the Fundação de Amparo a Pesquisa do
Estado de Minas Gerais - FAPEMIG, Coordenação de Aperfeiçoamento de
Pessoal de Nível Superior-CAPES (Scholarship to BLAV), and Conselho
Nacional de Desenvolvimento Científico e Tecnológico - CNPq (fellowships
to MNM and AVC). Bárbara L. A. Verçosa was supported by CAPES
(Programa de Pós-gradução em Biologia Celular – ICB/UFMG) and was
an investigator supported by the Conselho Nacional de Desenvolvi-
mento Científico e Tecnológica (CNPq), Brazil (process number
168270/2017-0). Maria Imaculada Muniz-Junqueira was an investiga-
tor supported by the Conselho Nacional de Desenvolvimento Científico
e Tecnológico (CNPq), Brazil (process number 308344/2016-2). We ac-
knowledge the Laboratory of Histopathology at the Department of Gen-
eral Pathology of the Universidade Federal de Minas Gerais for
histopathological preparations. We also thank Francisco Assis Lima
Costa (in memorian) and Ivete Lopes Mendonça (Departamento de
Clínica e Cirurgia Veterinária, Centro de Ciências Agrárias, Universi-
dade Federal do Piauí, Teresina, Piauí, Brasil) for supporting us with
the collection of samples.
D
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
TE
online version, at doi:https://doi.org/10.1016/j.vetpar.2021.109611.
References
Akarid, K., Arnoult, D., Micro-Polianski, J., Sif, J., Estaquier, J., Ameisen, J.C., 2004.
Leishmania major-mediated prevention of programmed cell death induction in infected
macrophages is associated with the repression of mitochondrial release of cytochrome c.
EC
J. Leukoc. Biol. 76, 95–103.
Ameisen, J.C., 2002. Apoptosis in a unicellular eukaryote (Trypanossoma cruzi):
implications for the evolutionary origin and role of programmed cell death in the control
of cell proliferation, differentiation, and survival. Cell Death Differ. 2, 285–300.
Araya, C.E., Wasserfall, C.H., Brusko, T.M., Mu, W., Segal, M.S., Johnson, R.J., Garin,
E.H., 2006. A case of unfulfilled expectations. Cytokines in idiopathic minimal lesion
nephrotic syndrome. Pediatr. Nephrol. 21, 603–610.
Belizário, J.E., Alves, J., Occhiucci, J.M., Garay-Malpartida, M., Sesso, A., 2007. A
RR
mechanistic view of mitochondrial death decision pores. Braz. J. Med. Biol. Res. 40,
1011–1024.
Bildik, A., Kargin, F., Seyrek, K., Pasa, S., Ozensoy, S., 2004. Oxidative stress and non-
enzymatic antioxidant status in dogs with visceral Leishmaniasis. Res. Vet. Sci. 77,
63–66.
Brenier-Pinchart, M.P., Pelloux, H., Derouich-Guergour, D., Ambroise-Thomas, P., 2001.
Chemokines in host-protozoan-parasite interactions. Trends Parasitol. 17, 292–296.
Brunelle, J.K., Letai, A., 2009. Control of mitochondrial apoptosis by the Bcl-2 family. J.
CO
Cell. Sci. 122, 437–441.
Burza, S., Croft, S.L., Boelaert, M., 2018. Leishmaniasis. Lancet (London, England) 392,
951–970.
Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., 2009. The MIQE
guidelines: minimum information for publication of quantitative real-time PCR
experiments. Clin. Chem. 55, 611–622.
Carrero, J.A., Calderon, B., Unanue, E.R., 2004. Type I interferon sensitizes lymphocytes
to apoptosis and reduce resistances to Listeria infection. J. Exp. Med. 200, 535–540.
Cendoroglo, M., Jaber, B.L., Balakrishnan, V.S., Perianayagam, M., King, A.J., Pereira,
B.J., 1999. Neutrophil apoptosis and dysfunction in uremia. J. Am. Soc. Nephrol. 10,
UN
93–100.
Chevalier, R.L., 2006. Pathogenesis of renal injury in obstructive uropathies. Curr. Opin.
Pediatr. 18, 153–160.
Chung, A.C., Lan, H.Y., 2011. Chemokines in renal injury. J. Am. Soc. Nephrol. 22,
802–809.
Costa, F.A.L., Guerra, J.L., Silva, S.M.M.S., Klein, R.P., Mendonça, I.L., Goto, H., 2000.
CD4+ T cells participate in the nephropathy in canine visceral leishmaniasis. Braz. J.
Med. Biol. Res. 33, 1455–1458.
Costa, F.A., Goto, H., Saldanha, L.C., Silva, S.M., Sinhorini, I.L., Silva, T.C., Guerra, J.L.,
2003. Histopathologic patterns of nephropathy in naturally acquired canine visceral
leishmaniasis. Vet. Pathol. 40, 677e684. https://doi.org/10.1354/vp.40-6-677.
Costa, F.A.L., Prianti, M.G., Silva, T.C., Silva, S.M., Guerra, J.L., Goto, H., 2010. T cells,
adhesion molecules and modulation of apoptosis in visceral leishmaniasis
glomerulonephritis. BMC Infect. Dis. 10, 112–124.
Curtin, J.F., Donovan, M., Cotter, T.G., 2002. Regulation and measurement of oxidative
12
Veterinary Parasitology xxx (xxxx) 109611
stress in apoptosis. J. Immunol. Methods 265, 49–72.
Das, M., Mukherjee, S.B., Shaha, C., 2001. Hydrogen peroxide induces apoptosis-like
death in Leishmania donovani promastigotes. J. Cell. Sci. 114, 2461–2469.
de Cathelineau, A.M., Henson, P.M., 2003. The final step in programmed cell death:
phagocytes carry apoptotic cells to the grave. Essays Biochem. 39, 105–117.
de Saldanha, R.R., Martins-Papa, M.C., Sampaio, R.N.R., Muniz-Junqueira, M.I., 2012.
Meglumine antimonate treatment enhances phagocytosis and TNF-α production by
monocytes in human cutaneous leishmaniasis. Trans. R. Soc. Trop. Med. Hyg. 106,
596–603.
F
Dell, R.B., Holleran, S., Ramakrishnan, R., 2002. Sample size determination. ILAR J. 43,
207–213.
DelPuerto, H.L., Martins, A.S., Moro, L., Milsted, A., Alves, F., Vasconcelos, A.C., 2010.
OO
Caspase-3/-8/-9, Bax and Bcl-2 expression in the cerebellum, lymph nodes and
leukocytes of dogs naturally infected with canine distemper virus. Genet. Mol. Res. 9,
151–161.
Duffield, J.S., Erwig, L.P., Wei, X., Liew, F.Y., Rees, A.J., Savill, J.S., 2000. Activated
macrophages direct apoptosis and suppress mitosis of mesangial cells. J. Immunol. 164,
2110–2119.
Eda, S., Yamanaka, M., Beppu, M., 2004. Carbohydrate-mediated phagocytic recognition
of early apoptotic cells undergoing transient capping of CD43 glycoprotein. J. Biol.
Chem. 279, 5967–5974.
Elmore, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35,
PR
495–516.
Erel, D., Kocyigit, A., Avci, S., Aktepe, N., Bulut, V., 1997. Oxidative stress and
antioxidative status of plasma and erythrocytes in patients with malaria. Clin. Biochem.
30, 631–639.
Fadok, V.A., Bratton, D.L., Konowal, A., 1998. Macrophages that have ingested apoptotic
cells in vivo inhibit proinflammatory cytokine production through autocrine/paracrine
mechanisms involving TGF-beta PGE2 and PAF. J. Clin. Invest. 101, 890–898.
Galluzzi, L., Vitale, I., Aaronson, S., et al., 2018. Molecular mechanisms of cell death:
recommendations of the Nomenclature Committee on Cell Death. Cell Death Differ. 25,
486–541.
Garrido, C., Galluzzi, L., Brunet, M., Puig, P.E., Didelot, C., Kroemer, G., 2006.
Mechanisms of cytochrome c release from mitochondria. Cell Death Differ. 13,
1423–1433.
Gavrieli, Y., Sherman, Y., Ben-Sasson, S.A., 1992. Identification of programmed cell death
in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119, 493–501.
Guh, J.Y., Chuang, T.D., Chen, H.C., Hung, W.C., Lai, Y.H., Shin, S.J., Chuang, L.Y., 2003.
Β- hydroxybutyrate-induced growth inhibition and collagen production in HK-2 cells are
dependent on TGF-β and Smad3. Kidney Int. 64, 2041–2051.
Heidarpour, M., Soltani, S., Mohri, M., Khoshnegah, J., 2012. Canine visceral
Leishmaniasis: relationships between oxidative stress, liver and kidney variables, trace
elements, and clinical status. Parasitol. Res. 111, 1491–1496.
Holdsworth, S.R., Tipping, P.G., 2007. Leukocytes in glomerular injury. Semin.
Immunopathol. 29, 355–374.
Huynh, M.L., Fadok, V.A., Henson, P.M., 2002. Phosphatidylserine-dependent ingestion of
apoptotic cells promotes TGF-beta 1 secretion and the resolution of inflammation. J.
Clin. Invest. 109, 41–50.
Jan, R., Chaudhry, G.E., 2019. Understanding apoptosis and apoptotic pathways targeted
Cancer therapeutics. Adv. Pharm. Bull. 9, 205–218.
Ji, J., Sun, J., Soong, L., 2003. Impaired expression of inflammatory cytokines and
chemokines at early stages of infection with Leishmania amazonensis. Infect. Immun. 71,
4278–4288.
Johnson-Davis, K.L., Fernelius, C., Eliason, N.B., Wilson, A., Beddhu, S., Roberts, W.L.,
2011. Blood enzymes and oxidative stress in chronic kidney disease: a cross sectional
study. Ann. Clin. Lab. Sci. 41, 331–339.
Kale, J., Osterlund, E., Andrews, D., 2018. BCL-2 family proteins: changing partners in the
dance towards death. Cell Death Differ. 25, 65–80.
Kim, J.W., Dang, C.V., 2005. Multifaceted roles of glycolytic enzymes. Trends Biochem.
Sci. 30, 142–150.
Krysko, D.V., Denecker, G., Festjens, N., 2006. Macrophages use different internalization
mechanisms to clear apoptotic and necrotic cells. Cell Death Differ. 18, 781–795.
Kückelhaus, C.S., Selma, A.S., Kückelhaus, S.A.S., Tosta, C.E., Muniz-Junqueira, M.I.,
2013. Pravastatin modulates macrophage functions of Leishmania (L.) amazonensis-
infected BALB/c mice. Exp. Parasitol. 134, 18–25.
Lee, N., Bertholet, S., Debrabant, A., 2002. Programmed cell death in the unicellular
protozoan parasite Leishmania. Cell Death Differ. 9, 53–64.
Lenda, D.M., Kikawada, E., Stanley, E.R., Kelley, V.R., 2003. Reduced macrophage
recruitment, proliferation, and activation in colony-stimulating factor-1-deficient mice
results in decreased tubular apoptosis during renal inflammation. J. Immunol. 170,
3254–3262.
Li, B., Li, X.M., Zhang, C.Y., Wang, X., Cai, S.Q., 2004. Injury in renal proximal tubular
epithelial cells induced by aristololactam I. Zhongguo Zhong Yao Za Zhi 29, 78–83.
Maderna, P., Godson, C., 2003. Phagocytosis of apoptotic cells and the resolution of
inflammation. Biochim. Biophys. Acta 1639, 141–151.
Matte, C., Olivier, M., 2002. Leishmania-induced cellular recruitment during the early
inflammatory response: modulation of proinflammatory mediators. J. Infect. Dis. 185,
673–681.
Menezes-Souza, D., Correa-Oliveira, R., Guerra-As, R., Giunchetti, R.C., Teixeira-
Carvalho, A., Martins-Filho, O.A., Corrêa Oliveira, G., Reis, A.B., 2011. Cytokine and
transcription factor profiles in the skin of dogs naturally infected by Leishmania
(Leishmania) chagasi presenting distinct cutaneous parasite density and clinical status.
Vet. Parasitol. 177, 39–49.
Milot, E., Filep, J.G., 2011. Regulation of neutrophil Survival/Apoptosis by Mcl-1.
Transfus. Apher. Sci. 11, 1948–1962.
Misseri, R., Meldrum, D.R., Dinarello, C.A., Dagher, P., Hile, K.L., Rink, R.C., Meldrum,
B.L. Araújo Verçosa et al.
K.K., 2005. TNF-alpha mediates obstruction-induced renal tubular cell apoptosis and
proapoptotic signaling. Am. J. Physiol. Renal Physiol. 288, F406–F411.
Moro, L., Vasconcelos, A.C., Santos, F.G.A., Alves, C.M., Nunes, J.E.S., Sampaio, I.B.M.,
2004. Determination of the minimal representative number of microscopic fields to
quantify apoptosis in canine lymph nodes. Arq. Bras. Med. Vet. Zootec. 56, 408–410.
Oliveira, F.J., Cecchini, R.J., 2000. Oxidative stress of liver in hamsters infected with
Leishmania (L.) chagasi. Parasitol. 86, 1067–1072.
Oltvai, Z., Milliman, C., Korsmeyer, S.J., 1993. Bcl-2 heterodimerizes in vivo with a
conversed homolog, Bax, that accelerates programmed cell death. Cell 74, 609–619.
Parrish, A.B., Freel, C.D., Kornbluth, S., 2013. Cellular mechanisms controlling caspase
activation and function. Cold Spring Harb. Perspect. Biol. 5, a008672. https://doi.org/
10.1101/cshperspect.a008672.
Patel, T., Gores, G.J., 1998. Apoptosis in liver transplantation: a mechanism contributing
to immune modulation, preservation injury, neoplasia, and viral disease. Liver Transpl.
Surg. 4, 42–50.
Peake, J., Suzuki, K., 2004. Neutrophil activation, antioxidant supplements and exercise-
induced oxidative stress. Exerc. Immunol. Rev. 10, 129–141.
Piarroux, P., Azaiez, R., Lossi, A.M., Fontes, M., Dunan, S., Mary, C., Toga, B., Quilici, M.,
1993. Isolation and characterization of a repetitive DNA sequence from Leishmania
infantum: development of s CanL Polymerase Chain Reaction. Am. J. Trop. Med. Hyg. 49,
364–369.
Pillay, J., den Braber, I., Vrisekoop, N., Kwast, L.M., de Boer, R.J., Borghans, J.A.,
Tesselaar, K., Koenderman, L., 2010. In vivo labeling with 2H2O reveals a human
neutrophil lifespan of 5.4 days. Blood 116, 625–627.
Polycarpe, E., Arnould, L., Schmitt, E., Duvillard, L., Ferrant, E., Isambert, N., Duvillard,
C., Beltramo, J.L., Chevet, D., Chauffert, B., 2004. Low urine osmolarity as a determinant
of cisplatin-induced nephrotoxicity. Int. J. Cancer 111, 131–137.
Praga, M., Morales, E., 2002. Renal damage associated with proteinuria. Kidney Int. 82,
S42-46.
Priante, G., Gianesello, L., Ceol, M., Del Prete, D., Anglani, F., 2019. Cell death in the
kidney. Int. J. Mol. Sci. 20, 3598. https://doi.org/10.3390/ijms20143598.
Ritter, U., Körner, H., 2002. Divergent expression of inflammatory dermal chemokines in
D
cutaneous leishmaniasis. Parasite Immunol. 24, 295–301.
Rocha, N.A., Silva, G.B., Oliveira, M.J., Abreu, K.L., Franco, L.F., Silva, M.P., Garcia, A.V.,
Daher, E.F., 2011. Visceral leishmaniasis in children: a cohort of 120 patients in a
metropolitan city of Brazil. Turk. J. Pediatr. 53, 154–160.
Shamas-Din, A., Kale, J., Leber, B., Andrews, D.W., 2013. Mechanisms of action of Bcl-2
TE
family proteins. Cold Spring Harb. Perspect. Biol. 5, a008714. https://doi.org/10.1101/
cshperspect.a008714.
Siddiqui, W.A., Ahad, A., Ahsan, H., 2015. The mystery of BCL2 family: Bcl-2 proteins and
apoptosis: an update. Arch. Toxicol. 89, 289–317.
Solano-Galleno, L., Fernandes-Bellon, H., Morell, P., Fondevila, D., Alberola, J., Ramis, A.,
Ferrer, L., 2004. Histological and immunohistochemical study of clinically normal skin
of L. infantum infected dogs. J. Comp. Pathol. 130, 7–12.
EC
RR
CO
UN
13
Veterinary Parasitology xxx (xxxx) 109611
Tang, D., Kang, R., Berghe, T.V., Vandenabeele, P., Kroemer, G., 2019. The molecular
machinery of regulated cell death. Cell Res. 29, 347–364.
Thomas, G.L., Yang, B., Wagner, B.E., Savill, J., El Nahas, A.M., 1998. Cellular apoptosis
and proliferation in experimental renal fibrosis. Nephrol. Dial. Transplant. 13,
2216–2226.
Tian, Y.C., Phillips, A.O., 2002. Interaction between the transforming growth factor-beta
Type II Receptor/Smad pathway and beta-Catenin during transforming growth Factor-
beta1-mediated adherens junction disassembly. Am. J. Pathol. 160, 1619–1628.
Ueda, N., Shah, S.V., 2000. Tubular cell damage in acute renal failure-apoptosis, necrosis,
F
or both. Nephrol. Dial. Transplant. 15, 318–323.
Ueda, N., Kaushal, G.P., Shah, S.V., 2000. Apoptotic mechanisms in acute renal failure.
Am. J. Med. 108, 403–415.
OO
Vaidya, V.S., Niewczas, M.A., Ficociello, L.H., Johnson, A.C., Collings, F.B., Warram, J.H.,
Krolewski, A.S., Bonventre, J.V., 2011. Regression of microalbuminuria in type 1
diabetes is associated with lower levels of urinary tubular injury biomarkers, kidney
injury molecule-1, and N-acetyl-β-D-glucosaminidase. Kidney Int. 79, 464–470.
Van Zandbergen, G., Bollinger, A., Wenzel, A., 2006. Leishmania disease development
depends on the presence of apoptotic promastigotes in the virulent inoculum. Proc. Natl.
Acad. Sci. U.S.A. 103 13837–1342.
Vaux, D.L., Haecker, G., Strasser, A., 1994. An evolutionary perspective on apoptosis. Cell
76, 777–779.
Verçosa, B.L.A., Silva, S.M.M.S., Mendonça, I.L., Lemos, C.M., Carvalho, S.M., Goto, H.,
PR
Costa, F.A.L., 2008. Transmission potential, skin inflammatory response and parasitism
of symptomatic and asymptomatic infected dogs with visceral leishmaniasis. BMC Vet.
Res. 4, 1–7.
Verçosa, B.L.A., Borges, A.C.J., Mendes, F.J.M., Costa, M.L.S., Braga, N.P., Melo, M.N.,
Mendonça, I.L., Costa, F.A.L., Vasconcelos, A.C., 2010. Inflammatory response, parasite
load and AgNOR expression in ear skin of symptomatic and asymptomatic L. Chagasi
infected dogs. J. Venom. Anim. Toxins inclu. Trop. Dis. 17, 308–317.
Verçosa, B.L.A., Melo, M.N., Del Puerto, H.L., Mendonça, I.L., Vasconcelos, A.C., 2012.
Apoptosis, inflammatory response, and parasite load in skin of Leishmania (Leishmania)
chagasi naturally infected dogs: a histomorphometric analysis. Vet. Parasitol. 189,
162–170.
Verçosa, B.L.A., Muniz-Junqueira, M.I., Menezes-Souza, D., Fujiwara, R.T., Melo, M.N.,
Vasconcelos, A.C., 2021. The balance between IL-12/IL4 in renal tissue switches the
inflammatory response arm and shows relationship with the clinical signs in Leishmania-
infected dogs. Vet. Immunol. Immunopathol. 234, 110196. https://doi.org/10.1016/
j.vetimm.2021.110196.
Weinrauch, Y., Zychlinsky, A., 1999. The induction of apoptosis by bacterial pathogens.
Annu. Rev. Microbiol. 53, 155–187.
World Health Organization (WHO), 2020. Leishmaniases Disponible in. https://
www.who.int/health-topics/leishmaniasis#tab=tab_1.
Yang, E., Korsmeyer, S., 1996. Molecular thanatopics: a discourse on the BCL2 family and
cell death. Blood 88, 386–401.