Microbial Pathogenesis 183 (2023) 106301

Contents lists available at ScienceDirect

Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath

Future scope of plant-derived bioactive compounds in the management of

methicillin-resistant Staphylococcus aureus: In vitro antimicrobial and
antivirulence prospects to combat MRSA
Sherief M. Abdel-Raheem a, b, **, Marwa I. Abd El-Hamid c, Doaa Ibrahim d, Rania M.S. El-Malt e,
Waleed Rizk El-Ghareeb a, f, Hesham A. Ismail a, g, Saad Ibrahim Al-Sultan a,
Ahmed M.A. Meligy h, i, Reham M. ELTarabili j, *
a
Department of Public Health, College of Veterinary Medicine, King Faisal University, P.O. Box 400, Hofuf, 31982, Al-Ahsa, Saudi Arabia
b
Department of Animal Nutrition and Clinical Nutrition, Faculty of Veterinary Medicine, Assiut University, Assiut, 71526, Egypt
c
Department of Microbiology, Faculty of Veterinary Medicine, Zagazig University, 44519, Zagazig, Egypt
d
Department of Nutrition and Clinical Nutrition, Faculty of Veterinary Medicine, Zagazig University, Zagazig, 44511, Egypt
e
Department of Bacteriology, Animal Health Research Institute, Zagazig Branch, Agriculture Research Center, 44516, Zagazig, Egypt
f
Food Control Department, Faculty of Veterinary Medicine, Zagazig University, Zagazig, 44519, Egypt
g
Food Hygiene Department, Faculty of Veterinary Medicine, Assiut University, Assiut, 71526, Egypt
h
Department of Clinical Sciences, Central Lab, College of Veterinary Medicine, King Faisal University, P.O. Box 400, Hofuf, 31982, Al-Ahsa, Saudi Arabia
i
Department of Physiology, Agricultural Research Center (ARC), Giza, Egypt
j
Department of Bacteriology, Immunology, and Mycology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, 41522, Egypt

A R T I C L E I N F O A B S T R A C T

Keywords: Methicillin-resistant Staphylococcus aureus (MRSA) is a foremost human and animal pathogen with public health
Thymol and veterinary significance causing hospital and community infections and contagious bovine mastitis. Due to its
Carvacrol ability to develop multidrug resistance (MDR) and its pathogenicity, MRSA infection control is becoming a global
Trans-cinnamaldehyde
concern. Natural antibacterial options are needed to combat MDR development and infectious dissemination.
MRSA
MDR
This study investigated the antimicrobial resistance and virulence genes profiling of MRSA isolates and explored
Multivirulent the antivirulence efficacy of trans-cinnamaldehyde, thymol, and carvacrol essential oils (EOs) against multi­
virulent and MDR-MRSA isolates. Thirty six S. aureus isolates (25%) were retrieved, of which 34 (94.4%) were
MRSA. A high prevalence of MDR (66.7%) was monitored and all 53 molecularly verified isolates possessed icaA
and cna virulence genes. Moreover, 94.1% of these isolates were multivirulent with 23.5% of them carrying icaA,
cna, eta, tst, and sea virulence genes. Our data proved superior in vitro antimicrobial and antivirulence activities
of trans-cinnamaldehyde, thymol, and carvacrol. They inhibited the growth of multi-virulent and MDR-MRSA
isolates and downregulated the transcription of examined virulence genes. Our study suggests using EOs as
prospective antimicrobials with excellent antivirulence activities against MRSA isolates. We provided data
regarding the eventual role of phytogenics in prevention and control of MRSA infection.

1. Introduction Staphylococcus aureus (MRSA) is globally [4] considered one of the

most threatening bacteria causing serious nosocomial, community,
In developing countries, antibiotic misuse induces resistant patho­ foodborne [5] and animal infections such as osteomyelitis, septic
gens [1], especially multidrug-resistant (MDR) bacteria [2]; [3]. Staph­ arthritis, pneumonia, endocarditis, cutaneous infections and mastitis.
ylococcus aureus (S. aureus), particularly methicillin-resistant Therefore, effective control strategies against S. aureus growth and

* Corresponding author.
** Corresponding author. Department of Public Health, College of Veterinary Medicine, King Faisal University, P.O. Box 400, Hofuf, 31982, Al-Ahsa, Saudi Arabia.
E-mail addresses: sdiab@kfu.edu.sa (S.M. Abdel-Raheem), mero_micro2006@yahoo.com (M.I. Abd El-Hamid), doibrahim@vet.zu.edu.eg (D. Ibrahim),
raniaelmalt@yahoo.com (R.M.S. El-Malt), welsaid@kfu.edu.sa (W.R. El-Ghareeb), hismail@kfu.edu.sa (H.A. Ismail), amelegi@kfu.edu.sa (A.M.A. Meligy), riham_
tarabily@vet.suez.edu.eg (R.M. ELTarabili).

https://doi.org/10.1016/j.micpath.2023.106301
Received 5 July 2023; Received in revised form 8 August 2023; Accepted 9 August 2023
Available online 12 August 2023
0882-4010/© 2023 Elsevier Ltd. All rights reserved.
S.M. Abdel-Raheem et al.
survival are necessary [6].
Staphylococcus aureus pathogenicity is attributed to its recalcitrant
nature owing to the ability to survive and multiply in different condi­
tions. This could be associated to host cell adhesion and invasion via
staphylococcal adhesin genes such as cna encoding collagen binding
protein and biofilm formation on abiotic or biotic surfaces [7–9] via
intercellular adhesion A-D (icaA-D) genes encoding polysaccharide
intercellular adhesin [8]. The success of this bacterial pathogen to pro­
tect their cells from the effect of antimicrobials and host immune system,
which complicates infection eradication [10] is achieved via its resis­
tance to antimicrobials, especially methicillin in addition to the pro­
duction of numerous virulence genes. Methicillin resistance in S. aureus
is conferred via the expression of different penicillin-binding protein
(PBP) that is encoded by the methicillin resistance gene (mecA) [11].
Many further S. aureus virulence attributes augment its pathogenesis
such as adhesin [6,8], 18 types of heat-stable staphylococcal entero­
toxins (SEs) [11–14] causing worldwide foodborne illness [8], exotoxins
such as exfoliative toxins (ETs) (A and B) causing staphylococcal scalded
skin syndrome [15] and toxic shock syndrome toxin (TSST-1), which is
responsible for a multiorgan disease called toxic shock syndrome (TSS)
[8,15] and enzymes such as collagenase, hyaluronidase, lipases, pro­
teases, coagulase, and nucleases [16] as thermonuclease (TNase)
secretion encoded by nuclease gene (nuc) used for rapid identification of
S. aureus owing to its species-specific sequences [16,17]. The SEs, ETs
and TSST-1 are staphylococcal pyrogenic toxins, which have a signifi­
cant role in host colonization, invasion of mucus and damaged skin,
intestinal tract infection and evasion from host immune system causing
acute staphylococcal toxemia syndrome [16,18,19].
Lately, to overcome resistance, there are increasing trends to new
alternatives from natural and safe herbal substances [20,21] having
antimicrobial activities against different pathogens such as S. aureus
[22]; [23], Campylobacter species (spp.) [24]; [3], Salmonella spp. [25,
26], Mycoplasma spp. [20,27], Clostridium spp. [28–30], Escherichia coli
[23,28,29], Streptococcus spp. [31], Pasteurella spp. [13] and Aeromonas
spp. [28,29,32]. Essential oils (EOs) are complex combinations of aro­
matic volatile herbal plants’ extracts or secondary metabolites (phyto­
genics). Since ancient times, EOs have been utilized in food industry as
food preservatives and flavoring agents for their antioxidant,
anti-inflammatory, immunostimulant and antimicrobial activities.
These activities are owing to their effective roles in minimizing the
bacterial loads [24,33] and downregulating cytokines and bacterial
virulence genes expression [28,29]. Moreover, EOs have lipophilic
characters facilitating their ability to accumulate in biological mem­
branes [34] causing them more permeable to proteins and other cell
constituents with inactivation of cytoplasmic membrane enzymes [35,
36]. Trans-cinnamaldehyde, thymol, and carvacrol are the main EOs’
phenolic components of cinnamon (Cinnamomum zeylandicum), thyme
(Thymus vulgaris), and oregano (Origanum glandulosum), respectively.
Their sub-inhibitory concentrations (SICs) were proved to interfere with
some S. aureus activities such as inhibition of enterotoxin secretion [37].
There is little information on the effect of trans-cinnamaldehyde,
thymol, and carvacrol on the expression levels of sea and icaA genes in
MRSA isolates [38–41], but, to the best of our knowledge, there have
been no researches describing the efficacy of the aforementioned EOs on
the transcription levels of eta, tst or cna genes in MRSA isolates. There­
fore, the current work was designed to investigate the antimicrobial
resistance profiles of S. aureus isolates from different sources in Egypt as
well as the virulence profiles of confirmed MRSA isolates. Additionally,
the antimicrobial effects of trans-cinnamaldehyde, thymol and carvacrol
against multi-virulent and MDR-MRSA isolates and the inhibitory ac­
tivities of the selected EOs on the transcription levels of S. aureus viru­
lence genes; sea, eta, tst, cna and icaA were evaluated to assess their
prospective use as novel therapeutic agents.
2
Microbial Pathogenesis 183 (2023) 106301
2. Materials and methods
2.1. Sample collection
A total of 144 samples were collected from animal (n = 103) and
human (n = 41) origins from various localities in Sharkia Governorate,
Egypt during the period from May 2018 to June 2020. Animal samples
included 82 milk ones obtained aseptically, prior to antimicrobial
treatment, from mastitis (n = 50) and apparently healthy (n = 32) cows
in various farms and meat products (n = 21), which comprised minced
meat, burger, and sausage (n = 7 each). Additionally, the human sam­
ples comprising pus (n = 8), midstream urine, sputum, and blood (n = 6
each) and pericardial fluid, peritoneal fluid, and cerebrospinal fluid, CSF
(n = 5 each) were collected from patients admitted to Zagazig University
Hospital, Zagazig, Egypt. All collected samples were aseptically trans­
ferred on ice, as soon as possible, to the laboratory for further bacteri­
ological examination.
2.2. Staphylococcus species isolation and identification
For Staphylococcus -spp. isolation, all samples were inoculated onto
mannitol salt agar (Oxoid, UK). A single suspected colony was cultivated
on blood agar (Oxoid, UK) for examining beta hemolysis and milk agar
(Oxoid, UK) for golden yellow pigment production. Suspected isolates
were further identified via standard conventional phenotypic microbi­
ological methods including cultural characteristics, Gram staining, and
biochemical identifications utilizing coagulase and catalase tests [42].
2.3. Antimicrobial susceptibility test
Antimicrobial susceptibility test was done according to Clinical and
Laboratory Standards Institute (CLSI) guidelines [43] using the standard
disc diffusion method [44] on Muller-Hinton agar (MHA) (Oxoid, UK)
against 11 antimicrobial discs (Oxoid, UK) of 7 classes. The discs used
were amoxicillin (AX, 25 μg), ampicillin (AM, 10 μg), oxacillin (OX, 1
μg), amoxicillin/clavulanic acid (AMC, 20 + 10 μg), erythromycin (E,
15 μg), tobramycin (TOB, 10 μg), gentamicin (CN, 10 μg), ciprofloxacin
(CIP, 5 μg), chloramphenicol (C, 30 μg), trimethoprim-sulfamethoxazole
(SXT, 23.75 + 1.25 μg) and vancomycin (VA, 30 μg). The MDR was
defined as resistance to at least one antimicrobial agent in three or more
classes. The multiple antibiotic resistance (MAR) index for each isolate
was measured using the formula; MAR = a/b, where a is the number of
antimicrobials to which the isolates were resistant and b is the total
number of antimicrobials [45]. Minimum inhibitory concentrations
(MICs) for vancomycin (Sigma-Aldrich, USA) against all isolates were
determined using the broth microdilution method (CLSI).
2.4. Molecular characterization and virulence genes profiling of MRSA
isolates
Extraction of total DNA was carried out via QIAamp DNA Mini Kit
(Qiagen, Valencia CA, USA) following the manufacturer’s instructions.
Of phenotypically identified S. aureus isolates, all oxacillin-resistant
ones were firstly screened for S. aureus species-specific nuc gene and
then the isolates positive for nuc gene were tested for mecA gene for
molecular confirmation of MRSA. Five uniplex conventional PCR assays
were carried out for the amplification of five virulence genes within
molecularly confirmed MRSA isolates; sea, eta, tst, icaA and cna. All PCR
assays were carried out utilizing the Emerald Amp GT PCR master mix
(Takara, USA) following the instructions of the manufacturer. The se­
quences of primers utilized in all PCR reactions are presented in Table 1.
All amplification protocols were conducted as pronounced previously
[46,47]. Positive (DNA extracted from S. aureus reference strain
ATCC25923), negative (DNA extracted from Escherichia coli reference
strain ATCC25922), and no template (PCR reaction mixture components
without DNA) controls were included in each PCR run. Amplicons were
S.M. Abdel-Raheem et al. Microbial Pathogenesis 183 (2023) 106301

Table 1
Oligonucleotide primers’ sequences used for PCR amplification of seven target Staphylococcus aureus genes.
Target gene Encoding specificity Primer sequence (5′-3′) Amplicon size (bp) Reference

nuc TNase secretion, a species-specific gene for S. aureus identification [17] F: GCGATTGATGGTGATACGGTT 270 [46]
R: AGCCAAGCCTTGACGAACTAAAGC
mecA Penicillin-binding protein (PBP) (M. I. [11] F: TCCAGATTACAACTTCACCAGG 162 [47]
R: CCACTTCATATCTTGTAACG
sea Staphylococcal enterotoxin a causing food poisoning [8] F: GGTTATCAATGTGCGGGTGG 102 [48]
R: CGGCACTTTTTTCTCTTCGG
eta Exfoliative toxin a causing scalded skin syndrome [15,49] F: GCAGGTGTTGATTTAGCATT 93
R: AGATGTCCCTATTTTTGCTG
tst Toxic shock syndrome toxin causing toxic shock syndrome [8,15] F: ACCCCTGTTCCCTTATCATC 326
R: TTTTCAGTATTTGTAACGCC
icaA Polysaccharide intercellular adhesin for biofilm formation (M. I. [6,8] F: CCTAACTAACGAAAGGTAG 315 [50]
R: AAGATATAGCGATAAGTGC
cna Collagen binding protein for host cell adhesion and invasion [8,9,15] F: GTCAAGCAGTTATTAACACCAGAC 423 [9]
R: AATCAGTAATTGCACTTTGTCCACTG

nuc: nuclease, mecA: methicillin resistance gene, sea: staphylococcal enterotoxin a, eta: exfoliative toxin a, tst: toxic shock syndrome toxin, icaA: intercellular adhesion
A, cna: staphylococcal collagen adhesin gene, F: forward, R: reverse, bp: base pair.

electrophoresed in 1.5% agarose gel stained with ethidium bromide 2.6. Statistical analysis
(Sigma-Aldrich, USA) and visualized under UV fluorescence [51].
Variations in the prevalence of Staphylococcus spp. from different
2.5. Evaluation of essential oils efficacy on multi-virulent and MDR- sources and their antimicrobial resistance profiles were measured using
MRSA isolates Chi-square test. The effect of SICs of trans-cinnamaldehyde, thymol, and
carvacrol on MRSA virulence genes expression was assessed using One
Assessment of antibacterial effects of essential oils via agar well way ANOVA and Tukey’s tests All analysis was carried out via SPSS Inc.
diffusion and broth microdilution assays. version 26 (IBM Corp., USA) and the p < 0.05 was considered statisti­
Three EOs; trans-cinnamaldehyde, thymol and carvacrol (Sigma- cally significant. All graphs were made using GraphPad Prism software
Aldrich, USA), the main phenolic components of cinnamon (Cinnamo­ Version 8 (San Diego, CA, USA).
mum zeylandicum), thyme (Thymus vulgaris) and oregano (Origanum
glandulosum), respectively [33] were utilized to assess their antibacterial 3. Results
activities against the multi-virulent and MDR-MRSA isolates harboring
all investigated virulence genes; sea, eta, tst, icaA, and cna using agar 3.1. Phenotypic characterization and occurrence of Staphylococcus
well diffusion [52] and broth microdilution [53] methods. Each exper­ species
iment was done in triplicate. Inhibition zones were measured as di­
ameters of clear areas surrounding EOs wells with subtracted well size Initial phenotypic analysis of human and animal samples revealed 52
(5 mm). The tested EOs with the lowest minimal inhibitory concentra­ staphylococcal isolates (36.1%), which were 36 (25%) S. aureus and 16
tion (MIC) values were the most potent ones [23]. (11.1%) coagulase-negative staphylococci, CoNS (Table 2). Of note,
Assessment of essential oils’ effects on MRSA virulence genes S. aureus isolates were more distributed among meat products (33.3%)
expression by real-time quantitative reverse transcription PCR assay. than human (31.7%) and milk (19.5%) samples in contrast to CoNS ones
The efficacy of EOs’ SICs on virulence genes expression in multi- that prevailed in milk (14.6%) more than human (9.8%) samples.
virulent and MDR-MRSA isolates was detected using real-time quanti­ Moreover, S. aureus isolates were more predominant in raw (25%) than
tative reverse transcription PCR (qRT-PCR) assay [53]. Briefly, each mastitis (16%) cow milk and sausage (57.1%) than minced meat
selected multi-virulent and MDR-MRSA isolate was incubated at 37 ◦ C (28.6%) and burger (14.3%) samples. Among human samples, S. aureus
for 24 h in Muller-Hinton broth (Oxoid, UK) with and without tested isolates were isolated with high occurrence rates among pus (50%),
EOs’ SICs. Aliquots (approximately 108 CFU/mL) were centrifuged to followed by sputum (33.3%) samples, while they were isolated with
collect the pellet for RNA extraction using QIAamp RNease Mini Kit lower existence rates in blood (16.7%) and pericardial fluid (20%)
(Qiagen, USA). Transcript levels of virulence genes of MRSA isolates samples (Fig. 1). There were no significant differences in the occurrence
pretreated or not with EOs were determined via SYBR Green qRT-PCR rates of Staphylococcus spp., S. aureus, and CoNS among milk, meat
assay, in triplicates, in Stratagene MX3005P real-time PCR machine products and human samples (p = 0.716, 0.244, and 0.176, respectively,
(Thermo Fisher, USA) using their respective primers (Table 1) and
QuantiTect SYBR Green PCR Master Mix (Qiagen, USA). The 16S rRNA
gene was utilized as an internal amplification control (M. I. [6]. Positive Table 2
(DNA extracted from S. aureus reference strain ATCC25923), negative Total occurrence rates of staphylococcal isolates in human and animal samples.
(DNA extracted from Escherichia coli reference strain ATCC25922) and Samples origin Total No. of staphylococcal No. of Staphylococcus species
no template (PCR reaction mixture components without DNA) controls (No.) isolates (%) (%)
were included in each qPCR run. Amplification curves and cycle
Staphylococcus CoNS
threshold (Ct) values were determined using Stratagene MX3005P aureus
software. Melting curves of the amplified DNAs were generated to assess
Milk (82) 28 (34.1) 16 (19.5) 12
the reaction specificity. The relative mRNA expression levels of viru­ (14.6)
lence genes in isolates treated with EOs compared to the non-treated Meat products 7 (33.3) 7 (33.3) 0
ones were assessed using the 2− ΔΔCt method [54]. The final results (21)
were presented as fold changes of target genes expression in the target Human (41) 17 (41.5) 13 (31.7) 4 (9.8)
Total (144) 52 (36.1) 36 (25) 16
isolates relative to the reference ones, normalized to a reference 16S (11.1)
rRNA gene. p value 0.716 0.244 0.176

No.: number and CoNS, coagulase-negative staphylococci.

3
S.M. Abdel-Raheem et al. Microbial Pathogenesis 183 (2023) 106301

Fig. 1. Distribution of Staphylococcus aureus (S. aureus) and coagulase-negative staphylococci (CoNS) in various meat products, milk and human samples.

Table 2). statistically significant variations in the resistance patterns between

3.2. Antimicrobial susceptibility results
Among fifty-two recovered staphylococcal isolates, high resistance
rates were observed against amoxicillin and oxacillin (94.2% each),
followed by ampicillin (92.3%). Meanwhile, all tested isolates were
sensitive to vancomycin (100%) with MICs ranging from 0.125 to 1 μg/
ml. Additionally, low resistance rates were detected against
trimethoprim-sulfamethoxazole (15.4%), followed by ciprofloxacin
(21.2%) and chloramphenicol (25%).
Notably, resistances to all examined antimicrobial agents were
higher among S. aureus than CoNS isolates. Moreover, S. aureus isolates
showed the highest resistance rates to amoxicillin and ampicillin
(97.2%, each), oxacillin (94.4%) and erythromycin (77.8%) and CoNS
isolates were highly resistant to oxacillin (93.8%), amoxicillin (87.5%),
ampicillin (81.3%) and erythromycin (50%, Table 3). There were
S. aureus and CoNS isolates against amoxicillin-clavulanic acid, eryth­
romycin, ciprofloxacin, tobramycin, and gentamicin (p < 0.05).
Interestingly, higher resistance rates were detected among S. aureus
isolates recovered from human samples than those from meat products
and milk ones to the examined antimicrobial agents except for eryth­
romycin. Regarding CoNS isolates, resistances to the examined antimi­
crobial agents were the most frequently observed for those recovered
from human samples than milk ones except for trimethoprim-
sulfamethoxazole. Moreover, all examined human and meat products
S. aureus and human CoNS isolates were resistant to amoxicillin, ampi­
cillin and oxacillin (100% each, Fig. 2).
Of note, 66.7% (24/36) of the tested S. aureus isolates were MDR
having MAR indices over 0.4 (Fig. 3). Moreover, 25% (9/36) of S. aureus
isolates were resistant to 8 and 9 antimicrobials with MAR indices of
0.73 and 0.82, respectively and they were isolated from human pus (5/
13, 38.5%) and mastitis cow milk (4/16, 25%) samples. Concerning

Table 3
Antimicrobial resistance patterns of Staphylococcus species.
Antimicrobial Class Antimicrobial agent Number of resistant isolates (%)

Staphylococcus aureus (n = 36) CoNS (n = 16) Total Staphylococcus species (n = 52)

Beta-lactams Amoxicillin 35 (97.2) 14 (87.5) 49 (94.2)

Ampicillin 35 (97.2) 13 (81.3) 48 (92.3)
Oxacillin 34 (94.4) 15 (93.8) 49 (94.2)
Amoxycillin-clavulanic acid 17 (47.2) 3 (18.8) 20 (38.5)
Macrolides Erythromycin 28 (77.8) 8 (50) 36 (69.2)
Aminoglycosides Tobramycin 26 (72.2) 2 (12.5) 28 (53.9)
Gentamicin 18 (50) 2 (12.5) 20 (38.5)
Fluoroquinolones Ciprofloxacin 11 (30.6) 0 11 (21.2)
Phenicols Chloramphenicol 8 (22.2) 5 (31.3) 13 (25)
Sulphonamides Trimethoprim-sulfamethoxazole 4 (11.1) 4 (25) 8 (15.4)
Glycopeptides Vancomycin 0 0 0

n: number and CoNS; coagulase-negative staphylococci.

4
S.M. Abdel-Raheem et al. Microbial Pathogenesis 183 (2023) 106301

Fig. 2. Antimicrobial resistance patterns of Staphylococcus aureus (S. aureus) and coagulase-negative staphylococci (CoNS) isolated from different origins.

Fig. 3. Multiple antibiotic resistance indices of Staphylococcus aureus (S. aureus) and coagulase-negative staphylococci (CoNS) isolated from different origins.

CoNS, 31.3% of them were MDR and only two isolates (12.5%) were 3.4. Molecular investigation of methicillin-resistant Staphylococcus
resistant to 7 and 8 antimicrobials with MAR indices of 0.64 and 0.73, aureus virulence genes
respectively (Table 4).
All thirty-four molecularly confirmed MRSA isolates were positive
3.3. Molecular identification of methicillin-resistant Staphylococcus for icaA and cna genes (100% each), while 29 (85.3%), 18 (52.9%), and
aureus 11 (32.4%) were positive for sea, eta and tst genes, respectively (Fig. 4).
Furthermore, sea, eta, and tst genes were more predominant among
All thirty-four phenotypically oxacillin-resistant S. aureus isolates animal-derived MRSA isolates (85.7, 66.7, and 33.3%, respectively)
recovered from milk (n = 14), meat products (n = 7) and human (n = than human ones (84.6, 30.8, and 30.8%, respectively). Concerning
13) samples were positive for nuc (S. aureus species-specific) and mecA animal origin, sea, eta, and tst genes were more prevalent among meat
(MRSA-specific) genes; thus, molecularly confirmed as MRSA. MRSA isolates (100, 71.4, and 57.1%, respectively) than milk ones
(78.6, 64.3, and 21.4%), respectively (Fig. 5. Interestingly, all 34 MRSA
isolates had at least two virulence genes (icaA and cna) (Fig. 6A).
Furthermore, 32 MRSA isolates (94.1%) were multi-virulent (harbored 3
or more virulence genes), of which 8 (23.5%) possessed all five virulence
Table 4 genes and they were distributed as 3 meat (42.9%), 3 human (23.1%)
Multiple antibiotic resistance indices of Staphylococcus species. and 2 milk (14.3%) MRSA isolates. Of note, six virulence genes’ profiles
MAR Number of Number of resistant isolates (%) were detected among the investigated MRSA isolates. Eleven MRSA
index antimicrobials to
Staphylococcus CoNS Total isolates (32.4%) showed the most common virulence genes profile (sea,
which the isolates
aureus (n = 36) (n = Staphylococcus icaA and cna) (Fig. 6B).
were resistant
16) species (n = 52)

0.09 1 1 (2.8) 1 (6.3) 2 (3.8) 3.5. Effect of trans-cinnamaldehyde, thymol, and carvacrol on multi-
0.18 2 1 (2.8) 2 3 (5.8) virulent and MDR-MRSA isolates
(12.5)
0.27 3 0 5 5 (9.6)
The antimicrobial activities of trans-cinnamaldehyde, thymol and
(31.3)
0.36 4 7 (19.4) 2 9 (17.3) carvacrol at their SICs (Sub-inhibitory Concentrations)were detected on
(12.5) 8 multi-virulent and MDR-MRSA isolates harboring all five virulence
0.45 5 7 (19.4) 2 9 (17.3) genes. They were obtained from milk (n = 2), meat products (n = 3) and
(12.5)
human (n = 3) sources.
0.55 6 3 (8.3) 2 5 (9.6)
(12.5)
0.64 7 8 (22.2) 1 (6.3) 9 (17.3) 3.6. Antibacterial efficacy of trans-cinnamaldehyde, thymol, and
0.73 8 6 (16.7) 1 (6.3) 7 (13.5) carvacrol on multi-virulent and MDR-MRSA isolates
0.82 9 3 (8.3) 0 3 (5.8)

MAR: multiple antibiotic resistance and CoNS, coagulase-negative Agar well diffusion techniques revealed concentration-dependent
staphylococci. antimicrobial activities of carvacrol, trans-cinnamaldehyde and thymol

5
S.M. Abdel-Raheem et al. Microbial Pathogenesis 183 (2023) 106301

Fig. 4. Heat map and hierarchical clustering of the examined 34 methicillin-resistant Staphylococcus aureus isolates based on the occurrence of target virulence genes
and antimicrobial resistance. In the heat map, red and blue colors denote the presence/absence of the target genes and the resistance/sensitivity to an antimicrobial
agent, respectively. The code numbers on the right of the heat map refer to the isolates from pus (P), urine (U), sputum (Sp), sausage (Sg), minced meat (Mm) and
milk (M) samples. Different categories of antimicrobial classes and virulence genes are color-coded on the right of the heatmap
tst: toxic shock syndrome toxin, eta: exfoliative toxin a, sea: staphylococcal enterotoxin a, cna: staphylococcal collagen adhesin gene, icaA: intercellular adhesion A,
CIP: ciprofloxacin, SXT: trimethoprim-sulfamethoxazole, C: chloramphenicol, VA: vancomycin, E: erythromycin, TOB: tobramycin, CN: gentamicin, OX: oxacillin,
AMC: amoxycillin/clavulanic acid, AM: ampicillin, AX: amoxicillin.

3.7. Efficacy of trans-cinnamaldehyde, thymol, and carvacrol on

virulence gene expression of multi-virulent and MDR-MRSA isolates

The efficacy of trans-cinnamaldehyde, thymol and carvacrol at their

Fig. 5. Distribution of sea, eta, tst, icaA and cna virulence genes among
methicillin-resistant Staphylococcus aureus isolates from milk, meat products
and human samples.
EOs against multi-virulent and MDR-MRSA isolates with inhibition zone
diameters ranging from 20 to 26, 19–23 and 17–21 mm, respectively.
The broth microdilution method showed more effective bacterial growth
inhibition using carvacrol than trans-cinnamaldehyde and thymol with
MIC values of 1–4, 4–8, and 4–16 μg/mL, respectively.
SICs on the expression levels of five virulence genes in the eight multi-
virulent and MDR-MRSA isolates were approved via qRT-PCR assay.
The transcriptional levels of five virulence genes (sea, eta, tst, icaA and
cna) were significantly (p > 0.05) down-regulated after exposure of
MRSA isolates to the investigated EOs at their SICs. Interestingly, the
transcriptional levels of the five virulence genes were markedly down-
regulated (up to 0.1466-fold) in the examined isolates post-exposure
to carvacrol indicating its broad-spectrum antivirulence activity.
Moreover, trans-cinnamaldehyde and thymol decreased virulence gene
expression (up to 0.1845 and 0.3901-fold, respectively). Notably,
carvacrol, trans-cinnamaldehyde and thymol displayed the highest
repression levels for sea (up to 0.1466, 0.1845, and 0.3901-fold), fol­
lowed by icaA (up to 0.1547, 0.3433 and 0.5446-fold), eta (up to 0.1763,
0.4535 and 0.5486-fold), tst (up to 0.1788, 0.3321 and 0.5657-fold) and
cna (up to 0.2904, 0.3448 and 0.4543-fold) virulence genes, respectively
(Fig. 7).
4. Discussion
Multidrug-resistant MRSA is considered one of the most common
causes of nosocomial infections globally with high morbidity and mor­
tality rates [55]. Herein, our collected human and animal samples had a
high occurrence rate of staphylococcal isolates (36.1%). Our result was
lower than the findings detected in previous studies carried out in Iran
(43.3%) [56] and Bangladesh (43.4%). According to the phenotypic
properties of the isolates investigated in the current study, 25% were
identified as S. aureus. This result came in parallel with that in a previous
study conducted in Algeria (27%) [57]. In the current work, S. aureus

6
S.M. Abdel-Raheem et al. Microbial Pathogenesis 183 (2023) 106301

Fig. 6. Distribution of virulence genes (A) and virulence genes’ profiles (B) among methicillin-resistant Staphylococcus aureus isolates from milk, meat products and
human samples.
I: sea, eta, tst, icaA and cna, II: sea, eta, icaA and cna, III: sea, tst, icaA and cna, IV: sea, icaA and cna, V: eta, icaA and cna and VI: icaA and cna.

Fig. 7. Fold changes in icaA (A), cna (B), sea (C), eta (D) and tst (E) genes expression in eight methicillin-resistant Staphylococcus aureus isolates treated with SICs of
carvacrol, trans-cinnamaldehyde and thymol, compared to untreated ones (control) having a value of 1. The outcomes represented the mean of three independent
experiments ± standard error of the mean (SEM, error bar). a–d Columns with various letters within the same isolate represent statistically significant variations (p <
0.05). MRSA: methicillin-resistant Staphylococcus aureus; M: milk; Mm: minced meat; Sg sausage; P: pus; U: urine; Sp: sputum.

isolates were more distributed among meat products, followed by
human samples (33.3 and 31.7%, respectively), which was in agreement
with the findings of previous studies carried out in Egypt; 48 and 38%
[58] and Italy; 4.9 and 3.5% [59], respectively. Moreover, S. aureus
isolates were recovered from 19.5% of the examined milk samples,
which was lower than the results of previous studies conducted in
Cameroon (48%) [60] and Bangladesh (23.2%) [61]; meanwhile, it was
similar to that of a previous study conducted in Egypt (17.3%) [62].
Generally, the variations in the occurrence of Staphylococcus spp. be­
tween various studies could be attributed to the origin of the examined
specimens, phenotypic identification techniques, climate factors,
geographical area, health and contamination status [3].
Of note, there are variations in the antimicrobial resistance patterns
among various countries because of the differences in the prescribed
antimicrobial agents [63]. Herein, the majority of S. aureus isolates were
resistant to oxacillin (94.4%). This result was higher than those of pre­
vious studies conducted in Nigeria (91.8%) [59], Cameroon (74%) [60],
South Africa (65.1%) [64] and Egypt (52.6%) [11]. In the current study,
high resistance levels to amoxicillin and ampicillin were detected among
our tested S. aureus isolates (97.2% each). These results were higher than
those observed in a recent study carried out in Cameroon (76 and 50%,
respectively) [60]. Additionally, the majority of CoNS isolates were
resistant to oxacillin (93.8%) and 31.3% of the tested CoNS isolates were
MDR. In the present work, all the tested staphylococcal isolates were
sensitive to vancomycin (100%), which was in accordance with the
findings of previous studies carried out in Egypt; 100% [62] and 97%
[11], but it was higher than those of recent studies conducted in Egypt;
84.3% [58] and Cameroon (80%) [60]. These results confirm that
vancomycin is still the drug of choice for the treatment of diseases
caused by β-lactams resistant staphylococcal strains [65]. Herein, the
higher resistance patterns of human S. aureus isolates than animal ones
was in contrast with those of a recent study carried out in Egypt, where
S. aureus isolates from animal origin were more resistant than those from
human one [58]. Alarmingly, all warnings around the world are corre­
lated to the emergence of MDR strains. In the present work, 66.7% of
S. aureus isolates were MDR with MAR indices greater than 0.4, which

7
S.M. Abdel-Raheem et al.
was lower than those of previous studies carried out in Cameroon (92%)
[60] and Egypt; 85% [62] and 74.4% [11]. The high resistance patterns
in staphylococcal isolates might be attributed to the misuse of antibiotics
in human and animal treatment without any prescription and their
usage as growth promoters in animal husbandry in developing coun­
tries. Furthermore, our results presented alarming high resistance rates
to oxacillin, amoxicillin and ampicillin because they are commonly
utilized for the treatment of staphylococcal infection being problematic
when antibiotic treatment becomes limited. Therefore, antibiotic usage
must be controlled in animals and humans [53] by employing phyto­
genics as a natural alternative-based medicine [20].
In the current work, all the tested MRSA isolates harbored icaA and
cna genes. Correspondingly, recent studies stated that all their investi­
gated staphylococcal isolates possessed icaA [66] and cna [8] genes.
Herein, the majority of the tested MRSA isolates were positive for sea
gene (85.3%), which was higher than the findings of previous studies
conducted in Brazil (73.4%) [66] and Iran (68%) [15]. Moreover, sea,
eta, and tst genes were more prevalent among our animal-derived
staphylococcal isolates than the human ones, which was in contrast
with the outcome of a previous study conducted in Italy, where these
genes were more distributed among human staphylococcal isolates than
the animal ones [67]. Furthermore, 94.1% of the investigated MRSA
isolates in the present study were multi-virulent harboring three or more
virulence genes. These results are lower than those of recent studies
carried out in Brazil [66] and China [8] (100% each). The variations in
the occurrence of target virulence genes could be resulted from different
sources of the studied samples and various geographical areas [24].
The antimicrobial effectiveness of trans-cinnamaldehyde, thymol
and carvacrol at their SICs against multivirulent and MDR-MRSA iso­
lates were detected to develop safer substitutions to antimicrobial agents
to stop the ongoing expansion of MDR bacterial strains worldwide. The
examined EOs presented promising in vitro antimicrobial effectiveness
against the examined MRSA isolates as proven in a recent study con­
ducted in Morocco [68]. Similarly, previous studies conducted in USA
[69] and China [70] stated that trans-cinnamaldehyde, followed by
carvacrol and thymol had broad-spectrum antimicrobial activities
against several pathogens including S. aureus. The antimicrobial prop­
erties of trans-cinnamaldehyde, thymol and carvacrol could be attrib­
uted to their ability to modify the membrane fatty acids composition of
microbial cells [71] in addition to their ability to accumulate in bio­
logical membranes due to their lipophilic characters [34]; thus, they
could damage the cell membrane making it more permeable to proteins
and other cell constituents and inactivate enzymes embedded in the
cytoplasmic membrane [35,36]. In addition to EOs’ impact on cell
membranes, trans-cinnamaldehyde is thought to kill microorganisms by
preventing their ability to produce energy and uptake glucose [69].
Moreover, the SICs of EOs could interfere with some physiological ac­
tivities of S. aureus such as inhibition of their enterotoxin secretion [37].
The SICs of several antimicrobials might reduce microbial pathoge­
nicity and virulence by altering their invasion and virulence genes [3,
33]. Our findings demonstrated that trans-cinnamaldehyde, thymol, and
carvacrol, at their SICs, had similar activities on the pathogenicity of
multi-virulent and MDR-MRSA isolates via minimizing the transcription
levels of their significant virulence genes; sea, eta, tst, icaA, and cna.
Similar studies revealed that icaA gene expression level in MRSA isolates
was minimized after exposure to trans-cinnamaldehyde [39,72], thymol
[38,39] and carvacrol [73] and sea gene was also downregulated after
exposure to trans-cinnamaldehyde [74], thymol [75] and eugenol [75].
Consistently, recent studies in Pakistan and India stated that trans-­
cinnamaldehyde [72] and Sapindus mukorossi plant extract [73] down­
regulated cna gene in MRSA isolates. Moreover, previous studies
indicated that eugenol [75], perilla [76] and citral [77] EOs down­
regulated tst [40,76] and eta [77] genes in S. aureus isolates. However, to
the best of our knowledge, there is no studies on the efficacy of trans-­
cinnamaldehyde, thymol or carvacrol on the transcription levels of tst,
eta or cna genes in MRSA isolates.
8
Microbial Pathogenesis 183 (2023) 106301
5. Conclusion
This study showed a high prevalence of MDR staphylococcal isolates
from milk, meat products and human sources in Egypt. Therefore, all
strategies should target optimizing antimicrobial usage in animals and
humans. Our data demonstrated that all tested MRSA isolates harbored
at least two virulence genes; icaA and cna and a majority of them were
multi-virulent exacerbating their infection. Of note, the SICs of trans-
cinnamaldehyde, thymol, and carvacrol markedly downregulated the
expression levels of sea, eta, tst, icaA and cna genes in multi-virulent and
MDR-MRSA isolates. Thus, the present work recommends the potential
usage of phytogenics such as trans-cinnamaldehyde, thymol and carva­
crol as safe and viable alternatives for antimicrobial agents for the
prevention and control of MRSA infection.
Data availability
The datasets generated and/or analysed during the current study are
available from the corresponding author on reasonable request.
Ethical considerations
The only aim of sample collection in this study was to provide patient
care and antimicrobial resistance profiling for accurate diagnosis and
treatment. Therefore, all research procedures were conducted consistent
with the guiding principle of the Animal Ethics Review Committee of
Suez Canal University (AERC-SCU), Egypt with the reference number of
AERC-SCU2023021. Furthermore, all participants provided written
informed consent that was approved prior to starting the study.
CRediT authorship contribution statement
Sherief M. Abdel-Raheem: Methodology, Investigation, Conceptu­
alization. Marwa I. Abd El-Hamid: Writing – review & editing, Writing
– original draft, Formal analysis, Data curation, Conceptualization.
Doaa Ibrahim: Formal analysis, Data curation, Conceptualization.
Rania M.S. El-Malt: Formal analysis, Data curation, Conceptualization.
Waleed Rizk El-Ghareeb: Resources, Investigation, Conceptualization.
Hesham A. Ismail: Data curation, Conceptualization. Saad Ibrahim Al-
Sultan: Formal analysis, Data curation, Conceptualization. Ahmed M.
A. Meligy: Formal analysis, Data curation, Conceptualization. Reham
M. ELTarabili: Writing – original draft, Visualization, Software, Meth­
odology, Conceptualization.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgment
This work was supported by the Deanship of Scientific Research, Vice
Presidency for Graduate Studies and Scientific Research, King Faisal
University, Saudi Arabia [Grant No 3918].
Abbreviations
MRSA Methicillin-resistant Staphylococcus aureus
MDR Multidrug resistance
EOs Essential oils
MAR Multiple antibiotic resistance
qRT-PCR Real-time quantitative reverse transcription PCR
icaA-D Intercellular adhesion A-D
PBP Penicillin-binding protein
ETs Exfoliative toxins
S.M. Abdel-Raheem et al.
TSST-1 Toxic shock syndrome toxin-1
TNase Thermonuclease
nuc Nuclease
References
[1] A. Ammar, M. El-Hamid, S.E. Eid, A.S. El Oksh, Insight into antimicrobial
resistance and virulence genes of emergent multidrug resistant avian pathogenic
Escherichia coli in Egypt: how closely related are they, Rev. Med. Vet. 166 (9–10)
(2015) 304–314.
[2] H.A. Ahmed, A.B. Tahoun, R.M. Abou Elez, M.I. Abd El-Hamid, S.S. Abd Ellatif,
Prevalence of Yersinia enterocolitica in milk and dairy products and the effects of
storage temperatures on survival and virulence gene expression, Int. Dairy J. 94
(2019) 16–21.
[3] A.M. Ammar, M.I. Abd El-Hamid, Y.H. Mohamed, H.M. Mohamed, D.H. Al-
Khalifah, W.N. Hozzein, et al., Prevalence and antimicrobial susceptibility of
bovine Mycoplasma species in Egypt, Biology 11 (7) (2022) 1083.
[4] A. El-Hamid, I. Marwa, A.H. Sewid, M. Samir, W.A. Hegazy, M.M. Bahnass, et al.,
Clonal diversity and epidemiological characteristics of ST239-MRSA strains, Front.
Cell. Infect. Microbiol. 241 (2022).
[5] G.A.E. Elmowalid, A.A.M. Ahmad, M.I.A. El-Hamid, D. Ibrahim, A. Wahdan, A.S. El
Oksh, et al., Nigella sativa extract potentially inhibited methicillin resistant
Staphylococcus aureus induced infection in rabbits: potential immunomodulatory
and growth promoting properties, Animals 12 (19) (2022) 2635.
[6] M.I. Abd El-Hamid, Y. El-Naenaeey, E. s, T. M kandeel, W.A. Hegazy, R.A. Mosbah,
M.S. Nassar, et al., Promising antibiofilm agents: recent breakthrough against
biofilm producing methicillin-resistant Staphylococcus aureus, Antibiotics 9 (10)
(2020) 667.
[7] G. Laverty, S.P. Gorman, B.F. Gilmore, Biomolecular mechanisms of staphylococcal
biofilm formation, Future Microbiol. 8 (4) (2013) 509–524.
[8] Q. Ren, G. Liao, Z. Wu, J. Lv, W. Chen, Prevalence and characterization of
Staphylococcus aureus isolates from subclinical bovine mastitis in southern
Xinjiang, China, J. Dairy Sci. 103 (4) (2020) 3368–3380.
[9] A. Tristan, L. Ying, M. Bes, J. Etienne, F. Vandenesch, G. Lina, Use of multiplex PCR
to identify Staphylococcus aureus adhesins involved in human hematogenous
infections, J. Clin. Microbiol. 41 (9) (2003) 4465–4467.
[10] H. Van Acker, P. Van Dijck, T. Coenye, Molecular mechanisms of antimicrobial
tolerance and resistance in bacterial and fungal biofilms, Trends Microbiol. 22 (6)
(2014) 326–333.
[11] M.I. Abd El-Hamid, M. Bendary, Comparative phenotypic and genotypic
discrimination of methicillin resistant and susceptible Staphylococcus aureus in
Egypt, Cell. Mol. Biol. 61 (4) (2015) 101–112.
[12] M.I. Abd El-Hamid, N.F. Awad, Y.M. Hashem, M.A. Abdel-Rahman, A.
M. Abdelaziz, I.A. Mohammed, et al., In vitro evaluation of various antimicrobials
against field Mycoplasma gallisepticum and Mycoplasma synoviae isolates in
Egypt, Poultry Sci. 98 (12) (2019) 6281–6288.
[13] M.I. Abd El-Hamid, M. El-Sayed, A.R. Ali, H. Abdallah, M.I. Arnaout, G.A. El-
mowalid, Marjoram extract down-regulates the expression of Pasteurella multocida
adhesion, colonization and toxin genes: a potential mechanism for its antimicrobial
activity, Comp. Immunol. Microbiol. Infect. Dis. 62 (2019) 101–108.
[14] M. Abd El-Hamid, M. Bendary, A. Merwad, I. Elsohaby, D. Mohammad Ghaith,
W. Alshareef, What is behind phylogenetic analysis of hospital-, community-and
livestock-associated methicillin-resistant Staphylococcus aureus? Transboundary
Emerg. Dis. 66 (4) (2019) 1506–1517.
[15] H.R. Sharabiani, J. Sadeghi, T. Pirzade, M.A. Rezaee, R. Ghotaslou, D. Laghousi, et
al., Comparison of superantigens and attachment factors genes of Staphylococcus
aureus in clinical isolates and nasal colonizers in the same patients, Microb.
Pathog. 154 (2021), 104860.
[16] M. Abd El-Hamid, M.M. Bendary, Association between agr alleles and toxin gene
profiles of S. aureus isolates from human and animal sources in Egypt, Int. J. Adv.
Res. 1 (8) (2013) 133–144.
[17] A.A. Rushdy, M.S. Salama, A.S. Othman, Detection of methicillin/oxacillin
resistant Staphylococcus aureus isolated from some clinical hospitals in Cairo using
Meca/Nuc genes and antibiotic susceptibility profile, Int. J. Agric. Biol. 9 (6)
(2007) 800.
[18] A. Ruzin, J. Lindsay, R.P. Novick, Molecular genetics of SaPI1–a mobile
pathogenicity island in Staphylococcus aureus, Mol. Microbiol. 41 (2) (2001)
365–377.
[19] E.E. Udo, S. Al-Mufti, M.J. Albert, The prevalence of antimicrobial resistance and
carriage of virulence genes in Staphylococcus aureus isolated from food handlers in
Kuwait City restaurants, BMC Res. Notes 2 (2009) 1–6.
[20] Y.M. Hashem, M.I. Abd El-Hamid, N.F. Awad, D. Ibrahim, N.S. Elshater, R.M. El-
Malt, et al., Insights into growth-promoting, anti-inflammatory, immunostimulant,
and antibacterial activities of Toldin CRD as a novel phytobiotic in broiler chickens
experimentally infected with Mycoplasma gallisepticum, Poultry Sci. 101 (11)
(2022), 102154.
[21] D. Ibrahim, R. El Sayed, A. Abdelfattah-Hassan, A. Morshedy, Creatine or
guanidinoacetic acid? Which is more effective at enhancing growth, tissue creatine
stores, quality of meat, and genes controlling growth/myogenesis in Mulard ducks,
J. Appl. Anim. Res. 47 (1) (2019) 159–166.
[22] J. Carneiro de Barros, M.L. Da Conceicao, N.J. Comes Neto, A.C.V. Da Costa,
J. Pinto Siqueira, I. Diniz Basilio, Interference of Origanum vulgare L. essential oil
on the growth and some physiological characteristics of Staphylococcus aureus
9
Microbial Pathogenesis 183 (2023) 106301
strains isolated from foods, LWT (Lebensm.-Wiss. & Technol.) 42 (6) (2009)
1139–1143.
[23] G.A. Elmowalid, M.I. Abd El-Hamid, A.M. Abd El-Wahab, M. Atta, G. Abd El-Naser,
A.M. Attia, Garlic and ginger extracts modulated broiler chicks innate immune
responses and enhanced multidrug resistant Escherichia coli O78 clearance, Comp.
Immunol. Microbiol. Infect. Dis. 66 (2019), 101334.
[24] A. Aljazzar, M.I. Abd El-Hamid, R.M. El-Malt, W.R. El-Gharreb, S.M. Abdel-
Raheem, A.M. Ibrahim, et al., Prevalence and antimicrobial susceptibility of
Campylobacter species with particular focus on the growth promoting,
immunostimulant and anti-Campylobacter jejuni activities of eugenol and trans-
cinnamaldehyde mixture in broiler chickens, Animals 12 (7) (2022) 905.
[25] M.M. Bendary, D. Ibrahim, R.A. Mosbah, F. Mosallam, W.A. Hegazy, N.F. Awad, et
al., Thymol nanoemulsion: a new therapeutic option for extensively drug resistant
foodborne pathogens, Antibiotics 10 (1) (2020) 25.
[26] D. Ibrahim, A. Abdelfattah-Hassan, M. Badawi, T.A. Ismail, M.M. Bendary, A.
M. Abdelaziz, et al., Thymol nanoemulsion promoted broiler chicken’s growth,
gastrointestinal barrier and bacterial community and conferred protection against
Salmonella Typhimurium, Sci. Rep. 11 (1) (2021) 7742.
[27] N.F. Awad, Y.M. Hashem, N.S. Elshater, E. Khalifa, R.I. Hamed, H.H. Nossieur, et
al., Therapeutic potentials of aivlosin and/or zinc oxide nanoparticles against
Mycoplasma gallisepticum and/or Ornithobacterium rhinotracheale with a special
reference to the effect of zinc oxide nanoparticles on aivlosin tissue residues: an in
vivo approach, Poultry Sci. 101 (6) (2022), 101884.
[28] D. Ibrahim, F. Eldemery, A.S. Metwally, E.M. Abd-Allah, D.T. Mohamed, T.
A. Ismail, et al., Dietary eugenol nanoemulsion potentiated performance of broiler
chickens: orchestration of digestive enzymes, intestinal barrier functions and
cytokines related gene expression with a consequence of attenuating the severity of
E. coli O78 infection, Front. Vet. Sci. (2022) 540.
[29] D. Ibrahim, S. Shahin, L. Alqahtani, Z. Hassan, F. Althobaiti, S. Albogami, et al.,
Exploring the interactive effects of thymol and thymoquinone: moving towards an
enhanced performance, gross margin, immunity and Aeromonas sobria resistance
of nile Tilapia (Oreochromis niloticus), Animals 12 (2022) 3034, 2022.
[30] D. Ibrahim, T.A. Ismail, E. Khalifa, A. El-Kader, A. Shaimaa, D.I. Mohamed, et al.,
Supplementing garlic nanohydrogel optimized growth, gastrointestinal integrity
and economics and ameliorated necrotic enteritis in broiler chickens using a
Clostridium perfringens challenge model, Animals 11 (7) (2021) 2027.
[31] M.I. Abd El-Hamid, S.M. Ibrahim, F. Eldemery, S.A. El-Mandrawy, A.S. Metwally,
E. Khalifa, et al., Dietary cinnamaldehyde nanoemulsion boosts growth and
transcriptomes of antioxidant and immune related genes to fight Streptococcus
agalactiae infection in Nile tilapia (Oreochromis niloticus), Fish Shellfish Immunol.
113 (2021) 96–105.
[32] D. Ibrahim, A.T. Kishawy, S.I. Khater, E. Khalifa, T.A. Ismail, H.A. Mohammed, et
al., Interactive Effects of Dietary Quercetin Nanoparticles on Growth, Flesh
Antioxidant Capacity and Transcription of Cytokines and Aeromonas Hydrophila
Quorum Sensing Orchestrating Genes in Nile tilapia (Oreochromis niloticus), Fish
& Shellfish Immunology, 2021.
[33] B.R. Wagle, A. Upadhyay, I. Upadhyaya, S. Shrestha, K. Arsi, R. Liyanage, et al.,
Trans-cinnamaldehyde, eugenol and carvacrol reduce Campylobacter jejuni
biofilms and modulate expression of select genes and proteins, Front. Microbiol. 10
(2019) 1837.
[34] J. Sikkema, J.A. de Bont, B. Poolman, Interactions of cyclic hydrocarbons with
biological membranes, J. Biol. Chem. 269 (11) (1994) 8022–8028.
[35] M. Cristani, M. D’Arrigo, G. Mandalari, F. Castelli, M.G. Sarpietro, D. Micieli, et al.,
Interaction of four monoterpenes contained in essential oils with model
membranes: implications for their antibacterial activity, J. Agric. Food Chem. 55
(15) (2007) 6300–6308.
[36] A. Ultee, M. Bennik, R. Moezelaar, The phenolic hydroxyl group of carvacrol is
essential for action against the food-borne pathogen Bacillus cereus, Appl. Environ.
Microbiol. 68 (4) (2002) 1561–1568.
[37] E. Souza, C. Oliveira, T. Stamford, M. Conceição, N. Gomes Neto, Influence of
carvacrol and thymol on the physiological attributes, enterotoxin production and
surface characteristics of Staphylococcus aureus strains isolated from foods, Braz.
J. Microbiol. 44 (2013) 29–36.
[38] M.M. El-Azzouny, A.S. El-Demerdash, H.G. Seadawy, S.H. Abou-Khadra,
Antimicrobial effect of garlic (Allium sativum) and thyme (Zataria multiflora Boiss)
extracts on some food borne pathogens and their effect on virulence gene
expression, Cell. Mol. Biol. 64 (10) (2018) 79–86.
[39] F. Noorbakhsh, P. Rahmati, Effects of thymus vulgaris and cinnamomum verum
essential oils on bap and ica gene expression in Staphylococcus aureus, Arch. Clin.
Infect. Dis. 17 (2) (2022).
[40] J. Qiu, D. Wang, H. Xiang, H. Feng, Y. Jiang, L. Xia, et al., Subinhibitory
concentrations of thymol reduce enterotoxins A and B and α-hemolysin production
in Staphylococcus aureus isolates, PLoS One 5 (3) (2010), e9736.
[41] A. Selvaraj, A. Valliammai, P. Muthuramalingam, A. Priya, M. Suba, M. Ramesh, et
al., Carvacrol targets SarA and CrtM of methicillin-resistant Staphylococcus aureus
to mitigate biofilm formation and staphyloxanthin synthesis: an in vitro and in vivo
approach, ACS Omega 5 (48) (2020) 31100–31114.
[42] K. Becker, R.L. Skov, C. von Eiff, Staphylococcus, Micrococcus, and other catalase-
positive cocci, Man. Clin. Microbiol. (2015) 354–382.
[43] P. Wayne, Clinical and Laboratory Standards Institute: Performance Standards for
Antimicrobial Susceptibility Testing: 20th Informational Supplement. CLSI
Document M100-S20, 2010.
[44] A. Bauer, W. Kirby, J.C. Sherris, turck, turck, Turck M. Antibiotic susceptibility
testing by a standardized single disk method, Am. J. Clin. Pathol. 45 (4) (1966)
493.
S.M. Abdel-Raheem et al.
[45] R. Sandhu, S. Dahiya, P. Sayal, Evaluation of multiple antibiotic resistance (MAR)
index and Doxycycline susceptibility of Acinetobacter species among inpatients,
Indian J. Microbiol. Res. 3 (3) (2016) 299.
[46] O.G. Brakstad, K. Aasbakk, J.A. Maeland, Detection of Staphylococcus aureus by
polymerase chain reaction amplification of the nuc gene, J. Clin. Microbiol. 30 (7)
(1992) 1654–1660.
[47] R. Niesche, M. Haase, Emotions and ethics: a Foucauldian framework for becoming
an ethical educator, Educ. Philos. Theor. 44 (3) (2012) 276–288.
[48] M. Mehrotra, G. Wang, W.M. Johnson, Multiplex PCR for detection of genes for
Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin
1, and methicillin resistance, J. Clin. Microbiol. 38 (3) (2000) 1032–1035.
[49] J.J. Iandolo, Genetic analysis of extracellular toxins of Staphylococcus aureus,
Annu. Rev. Microbiol. 43 (1) (1989) 375–402.
[50] A. Ciftci, A. Findik, E.E. Onuk, S. Savasan, Detecção de resistência a meticilina e
produção do fator slime por Staphylococcus aureus em mastite bovina, Braz. J.
Microbiol. 40 (2009) 254–261.
[51] J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning. A Laboratory Manual,
second ed., Cold Spring Harbor Laboratory Press, New York, USA, 1989.
[52] S. Yadav, N.A. Trivedi, J.D. Bhatt, Antimicrobial activity of fresh garlic juice: an in
vitro study, Ayu 36 (2) (2015) 203.
[53] A.M. Ammar, E.-S.Y. El-Naenaeey, R. El-Malt, A.A. El-Gedawy, E. Khalifa, S.
S. Elnahriry, et al., Prevalence, antimicrobial susceptibility, virulence and
genotyping of Campylobacter jejuni with a special reference to the anti-virulence
potential of eugenol and beta-resorcylic acid on some multi-drug resistant isolates
in Egypt, Animals 11 (1) (2021) 3.
[54] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2− ΔΔCT method, Methods 25 (4) (2001) 402–408.
[55] V. Thati, C. Shivannavar, S.M. Gaddad, Vancomycin resistance among MRSA
isolates from intensive care units of tertiary care hospitals in Hyderabad, Indian J.
Med. Res. 134 (2011) 704–708.
[56] L. Hoveida, M. Halaji, S. Rostami, S. Mobasherizadeh, Biofilm-producing ability of
Staphylococcus spp isolated from different foodstuff products, Ann Ig 31 (2) (2019)
140–147.
[57] R. Achek, H. El-Adawy, H. Hotzel, A. Hendam, H. Tomaso, R. Ehricht, et al.,
Molecular characterization of Staphylococcus aureus isolated from human and
food samples in northern Algeria, Pathogens 10 (10) (2021) 1276.
[58] E.E. Abdeen, W.S. Mousa, S.Y. Abdelsalam, H.S. Heikal, R.R. Shawish,
M. Nooruzzaman, et al., Prevalence and characterization of coagulase positive
Staphylococci from food products and human specimens in Egypt, Antibiotics 10
(1) (2021) 75.
[59] F.O. Ogundipe, O.E. Ojo, A.T. Feßler, D. Hanke, O.J. Awoyomi, D.A. Ojo, et al.,
Antimicrobial resistance and virulence of methicillin-resistant Staphylococcus
aureus from human, chicken and environmental samples within live bird markets
in three Nigerian cities, Antibiotics 9 (9) (2020) 588.
[60] M.E.A. Bissong, B.F. Tahnteng, C.N. Ateba, J.-F.T.K. Akoachere, Pathogenic
potential and antimicrobial resistance profile of Staphylococcus aureus in milk and
beef from the Northwest and Southwest Regions of Cameroon, Biomed. Res. Int.
2020 (2020) 6015283.
[61] M.A. Rahman, A.A. Rahman, M.A. Islam, M.M. Alam, Multi–drug resistant
Staphylococcus aureus isolated from milk, chicken meat, beef and egg in
Bangladesh, Res. Agric. Livestock Fish. 5 (2) (2018) 175–183.
[62] A. Ammar, A. Attia, M. Abd El-Hamid, I. El-Shorbagy, S. Abd El-Kader, Genetic
basis of resistance waves among methicillin resistant Staphylococcus aureus
10
Microbial Pathogenesis 183 (2023) 106301
isolates recovered from milk and meat products in Egypt, Cell. Mol. Biol. 62 (10)
(2016) 7–15.
[63] A.M. Ammar, A. El-Hamid, I. Marwa, R. El-Malt, D.S. Azab, S. Albogami, et al.,
Molecular detection of fluoroquinolone resistance among multidrug-, extensively
drug-, and pan-drug-resistant Campylobacter species in Egypt, Antibiotics 10 (11)
(2021) 1342.
[64] A. Pekana, E. Green, Antimicrobial resistance profiles of Staphylococcus aureus
isolated from meat carcasses and bovine milk in abattoirs and dairy farms of the
Eastern Cape, South Africa, Int. J. Environ. Res. Publ. Health 15 (10) (2018) 2223.
[65] J.L. Crandon, J.L. Kuti, D.P. Nicolau, Comparative efficacies of human simulated
exposures of telavancin and vancomycin against methicillin-resistant
Staphylococcus aureus with a range of vancomycin MICs in a murine pneumonia
model, Antimicrob. Agents Chemother. 54 (12) (2010) 5115–5119.
[66] F.S. Cavalcante, S. Saintive, D. Carvalho Ferreira, A.B. Rocha Silva, L.C. Guimarães,
B.S. Braga, et al., Methicillin-resistant Staphylococcus aureus from infected skin
lesions present several virulence genes and are associated with the CC30 in
Brazilian children with atopic dermatitis, Virulence 12 (1) (2021) 260–269.
[67] M. Vitale, P. Galluzzo, P.G. Buffa, E. Carlino, O. Spezia, R. Alduina, Comparison of
antibiotic resistance profile and biofilm production of Staphylococcus aureus
isolates derived from human specimens and animal-derived samples, Antibiotics 8
(3) (2019) 97.
[68] Y. El Atki, I. Aouam, A. Taroq, F. El Kamari, M. Timinouni, B. Lyoussi, et al.,
Antibacterial effect of combination of cinnamon essential oil and thymol,
carvacrol, eugenol, or geraniol, J. Rep. Pharmaceut. Sci. 9 (1) (2020) 104.
[69] S.A. Baskaran, G. Kazmer, L. Hinckley, S. Andrew, K. Venkitanarayanan,
Antibacterial effect of plant-derived antimicrobials on major bacterial mastitis
pathogens in vitro, J. Dairy Sci. 92 (4) (2009) 1423–1429.
[70] L. Fei, Y.-c. Ding, X.-q. Ye, Y.-t. Ding, Antibacterial effect of cinnamon oil combined
with thyme or clove oil, Agric. Sci. China 10 (9) (2011) 1482–1487.
[71] R. Di Pasqua, G. Betts, N. Hoskins, M. Edwards, D. Ercolini, G. Mauriello,
Membrane toxicity of antimicrobial compounds from essential oils, J. Agric. Food
Chem. 55 (12) (2007) 4863–4870.
[72] S. Mastoor, F. Nazim, S. Rizwan-ul-Hasan, K. Ahmed, S. Khan, S.N. Ali, et al.,
Analysis of the antimicrobial and anti-biofilm activity of natural compounds and
their analogues against Staphylococcus aureus isolates, Molecules 27 (20) (2022)
6874.
[73] A. Selvaraj, A. Valliammai, M. Premika, A. Priya, J.P. Bhaskar, V. Krishnan, et al.,
Sapindus mukorossi Gaertn. and its bioactive metabolite oleic acid impedes
methicillin-resistant Staphylococcus aureus biofilm formation by down regulating
adhesion genes expression, Microbiol. Res. 242 (2021), 126601.
[74] M. Azizkhani, M. Parsaeimehr, Effects of Cinnamomum zeylanicum and Ocimum
basilicum essential oils on the growth of Staphylococcus aureus ATCC 29213 and
gene expression of enterotoxins A, C and E, J. Essent. Oil Res. 27 (6) (2015)
506–513.
[75] J. Qiu, H. Feng, J. Lu, H. Xiang, D. Wang, J. Dong, et al., Eugenol reduces the
expression of virulence-related exoproteins in Staphylococcus aureus, Appl.
Environ. Microbiol. 76 (17) (2010) 5846–5851.
[76] J. Qiu, X. Zhang, M. Luo, H. Li, J. Dong, J. Wang, et al., Subinhibitory
concentrations of perilla oil affect the expression of secreted virulence factor genes
in Staphylococcus aureus, PLoS One 6 (1) (2011), e16160.
[77] H.B.M. Oliveira, N.d.N. Selis, B.A. Sampaio, M.N.S. Júnior, S.P. de Carvalho, J.
B. de Almeida, et al., Citral modulates virulence factors in methicillin-resistant
Staphylococcus aureus, Sci. Rep. 11 (1) (2021), 16482.