1 Thymoquinone sensitizes lung and breast cancer cells to doxorubicin via

2 downregulating FOXO6 and CYP1B1

5 Abstract

6 Thymoquinone (TQ), the main constituent of Nigella sativa, has shown potent anti-neoplastic,
7 antioxidant and anti-inflammatory activities. In the present study we evaluated the role of
8 synthetic TQ (40 μmol L-1) and Nigella sativa extract with 10%TQ (NSE-10%TQ) in inducing
9 anticancer effect and in synergizing doxorubicin (5 µg mL -1). MDA-MB-231 breast cancer and
10 A549 lung cancer cells were treated with TQ or NSE-10%TQ as monotherapy or combined with
11 doxorubicin for 48 h. Cytotoxicity and cell viability assays showed a significant reduction in
12 either the cell count or viability in all treatments with synthetic TQ/doxorubicin being the most
13 effective treatment. Assessment of the apoptotic power using Annexin V-FITC/PI indicated a
14 significant increase in the apoptosis level in synthetic TQ combined doxorubicin followed by
15 NSE-10%TQ combined with doxorubicin. MDA-MB-231 breast cancer cells were more
16 sensitive to the applied drugs/combinations compared to A549 and WISH (human amnion-
17 derived cells, served as control). Cell phases distribution showed that most of the treatments have
18 arrested the cells at G2/M, indicating their cytotoxic effects. Here also breast cancer cells were
19 more sensitive to the treatments and showed higher percentages of G2/M phase compared to lung
20 and amnion-derived cells. The expression profiles of Bcl-XL, TGF-β, IL-6, FOXO6, and
21 CYP1B1 were evaluated. All treatments induced downregulation of TGF-β and IL-6 and
22 upregulation of Bcl-XL, FOXO6, and CYP1B1 in lung cancer cells. Our results indicate the role
23 of TQ and NSE-10%TQ in sensitizing breast and lung cancer cells to doxorubicin, however these
24 data call for further studies.

25 Key word: MDA-MB-231 cells; A549 cells; Bcl-XL; TGF-β; IL-6; tumor, black seed.

26

27

28 ‫الملخص العربي‬
‫‪29‬‬ ‫أظه ر ال ثيموكينون‪ ،‬المك ون الرئيس ي بالحب ة الس وداء‪ ،‬أظه ر أنش طة قوي ة مض ادة لألورام‪ ،‬األكس دة‬
‫‪30‬‬ ‫وااللتهاب ات‪ .‬في الدراس ة الحالي ة‪ ،‬تم تق ييم دور ال ثيموكينون المخل ق ص ناعيا (بترك يز ‪ 40‬ميكروم والر)‬
‫‪31‬‬ ‫ومستخلص حبة البركة (بتركيز ‪ ٪ 10‬من الثيموكينون) في إحداث تأثير مضاد للسرطان وفي موازاة عقار‬
‫‪32‬‬ ‫الدوكسوروبيسين (بتركيز نهائي ‪ 5‬ميكروجرام لكل مليليتر)‪ .‬وقد تمت معاملة خاليا سرطان الث دي وخالي ا‬
‫‪33‬‬ ‫سرطان الرئة باس تخدام المع املتين س الفتي ال ذكر كعالج منف رد أو م ع الدوكسوروبيس ين لم دة ‪ 48‬س اعة‪.‬‬
‫‪34‬‬ ‫أظهرت فحوصات السمية الخلوية وحيوية الخاليا انخفاضًا كبيرً ا في عدد الخاليا أو قابليتها للبق اء في جمي ع‬
‫‪35‬‬ ‫العالجات عند معاملتها بالثيموكينون المخلق‪/‬الدوكسوروبيسين باعتب اره أفض ل توليف ة عالجي ة‪ .‬أش ار تق ييم‬
‫‪36‬‬ ‫موت الخاليا المبرمج باستخدام تقنيات التدفق الخلوي إلى زيادة كبيرة في مستوى موت الخاليا المبرمج عند‬
‫‪37‬‬ ‫معامل ة الخالي ا ب الثيموكينون المخل ق م ع الدوكسوروبيس ين متبوعً ا بمس تخلص الحب ة الس وداء م ع‬
‫‪38‬‬ ‫الدوكسوروبيسين‪ .‬كانت خاليا سرطان الث دي أك ثر حساس ية مقارن ًة بخالي ا س رطان الرئ ة وخالي ا الس ائل‬
‫‪39‬‬ ‫األمنيوسي البشري التي استخدمت كخاليا طبيعية‪ .‬أظهر توزيع مراحل الخلية أن معظم العالجات ق د أوقفت‬
‫‪40‬‬ ‫أيض ا ك انت خالي ا س رطان الث دي أك ثر‬ ‫الخاليا عند ‪ ، G2/M‬مما يشير إلى آثارها الس امة للخالي ا‪ .‬وهن ا ً‬
‫‪41‬‬ ‫حساسية للعالجات من خاليا سرطان الرئة وخاليا السائل األمنيوسي البشري‪ ،‬حيث أظه رت نس بًا أعلى من‬
‫‪42‬‬ ‫طور‪ .G2/M‬تم تقييم أنماط التعبير الجيني لجينات ‪ Bcl-XL‬و‪ TGF‬و ‪ IL-6‬و ‪ FOXO6‬و ‪ .CYP1B1‬وقد‬
‫‪43‬‬ ‫تسببت جميع العالجات في انخفاض التعبير الجيني لك ل من ‪ TGF‬و ‪ IL-6‬وزي ادة التعب ير الجي ني لك ل من‬
‫‪44‬‬ ‫‪ Bcl-XL‬و ‪ FOXO6‬و ‪ CYP1B1‬في خاليا سرطان الرئة‪ .‬تشير نتائجنا إلى دور الثيموكينون ومس تخلص‬
‫‪45‬‬ ‫حبة البركة في زيادة حساسية خاليا سرطان الثدي والرئة لعقار الدوكسوروبيسين‪ ،‬لكن هذه البيان ات تتطلب‬
‫‪46‬‬ ‫مزي ًدا من الدراسات‪.‬‬
‫‪47‬‬

‫‪48‬‬

‫‪49‬‬ ‫‪Introduction‬‬

‫‪50‬‬ ‫‪Cancer remains the challenging disease worldwide with an ever-increasing number of cases. By‬‬
‫‪51‬‬ ‫‪the end of 2020, 1,806,590 new cancer cases are expected to occur in the USA (1). Among the‬‬
‫‪52‬‬ ‫‪most common types of cancer come lung carcinoma represents the globally highest cancer-‬‬
‫‪53‬‬ ‫‪associated mortality rate (2). Breast cancer is a major life-threatening disorder in women‬‬
‫‪54‬‬ ‫‪worldwide. It affects 2.1 million women each year (3), with about 276,480 new cases of‬‬
‫‪55‬‬ ‫‪invasive breast cancer are expected to be diagnosed by the end of 2020 in the USA.‬‬

‫‪56‬‬ ‫‪Despite that conventional chemotherapeutic drugs, such as Doxorubicin (DOX), have proved to‬‬
‫‪57‬‬ ‫‪be reliable; they are associated with some problems including non-specificity, poor‬‬
‫‪58‬‬ ‫‪bioavailability, development of multiple drug resistance in patients (4), and cardiotoxicity (5).‬‬
‫‪59‬‬ ‫‪DOX (Adriamycin) is considered the most effective drug for breast cancer (6), although it‬‬
60 induces drug resistance and tumor growth, which negatively affects the patient’s overall survival
61 (7).

62 Cancer therapy are mainly relied on synthetic compounds, although naturally derived drugs has
63 been tested for their anticancer activities. Synergizing synthetic compounds such as DOX with
64 TQ is believed to improve the anti-cancer properties of DOX in leukemia, melanoma, colon,
65 cervix, and breast cancer cells (5). Thus, introducing alternative medications become a demand,
66 given their limited side effects compared to commercially available chemo drugs. Meanwhile,
67 combining TQ with chemotherapeutic drugs improve their therapeutic indices (8).

68 Nigella sativa (NS) is known for its content of potent anti-proliferative, cytotoxic, pro-apoptotic,
69 and anti-metastatic agents (9). Of these, Thymoquinone (TQ), which is the major bioactive
70 component of the volatile oil of N. sativa (54%). As a natural polyphenol, TQ has many potential
71 pharmacological functions against several diseases, including cancer (10). Its biological
72 antioxidant, anti-inflammatory, and anticancer activity have been studied in several models,
73 although the molecular mechanism by which it exerts its action needs further investigation (11).
74 TQ exhibits its anticancer activity by inhibiting the proliferation, invasion, migration, and
75 metastasis of cancer cells (12, 13). It also improves the action of different types of
76 chemotherapeutic drugs, where it sensitizes cancer cells to drugs and ameliorates their adverse
77 effects, and result in a greater anticancer effect (14). Moreover, TQ can relief the cytotoxic effect
78 of cisplatin that causes nephrotoxicity in rodents (15) and the cardiotoxicity of doxorubicin in
79 mice (16). Different type of proteins that promote EMT, and hence activate the pathways of
80 cancer metastasis. Thus, inhibition of these pathways is crucial in controlling cancer
81 development and/or progression (17). TQ can revert epithelial-mesenchymal transition (EMT) by
82 activating CDH1 and downregulating mesenchymal markers, such as vimentin and N-cadherin
83 (12). NS oil and TQ reduced tumor markers and histopathological findings of breast cancer
84 induced by DMBA in rats (18). Ethanol and water extract of NS were found to induce significant
85 cytotoxicity of breast cancer cells (MCF-7) with higher potency of the ethanol extract (19). TQ
86 and Aqueous extract of NS produced significant augmentation of natural killer cells activity
87 against YAC tumor cells (20). NS aqueous and alcohol extracts potentiated the cytotoxic effect
88 of Doxorubicin on MCF-7 breast cancer cells while both had anticancer effect on their own (21).
 89 In view of lack of studies comparing the effect of NS extract with TQ, we carried out this study
90 to compare the action of black seed water extract, synthetic thymoquinone anticancer effect
91 against lung and breast cancer cells. Further we evaluated their adjuvant effect to Doxorubicin
92 and investigated possible genetic mechanisms.

93

94 Materials and Methods

95 Cell line maintenance

96 Triple negative breast cancer cells (MDA-MB-231) and lung cancer cells (A549) were purchased
97 for the Holding Company for Sera and Vaccines (VACSERA, Cairo, Egypt). Cells were grown
98 under the normal laboratory conditions; 5% CO2 and 37 °C. Cells were maintained one DEME
99 media supplemented with 10% FBS and 1% antibiotic mix. At least two passages were
100 performed before exposing the cells to any treatments. Viability of cells was checked before
101 work using Trypan blue assay.

102 Drug preparations

103 Doxorubicin was purchased from Sigma (USA) and dissolved in ddH 2O to a final concertation of
104 5 µg mL-1 as a working stock. The dissolved drug was kept at 4 °C until use.

105 Black seed extract

106 Nigella sativa (Black seed or Black cumin) crude extract was purchased from a specialized
107 company (Shaanxi Honghao Bio-Tech Co., Ltd, China) in which TQ concentration is 10% (NSE-
108 10%TQ). Synthetic TQ was purchased form Frinton laboratories, USA.

109 Treatment of cancer cells

110 Cells (5 x 105) were seeded on 12-well plates 24 h prior treatment to reach at least 80%
111 confluent. Old media were changed with fresh one and the drugs were applied to cells. Normal
112 Human cells (WISH) were also treated the same way. For each cancer type, cells were
113 categorized into five groups; control with treatment, 10% TQ (200 PPM), 10% TQ combined with
114 DOX, Synthetic TQ (40 μmol L-1), Synthetic TQ combined with DOX (Table 1). Cells were
115 incubated with drugs for 38 h. in the standard cell culture conditions.

116 Table 1: the scheme of drug/drug combination applied to the cells.

 Cell line T1 T2 T3 T4

WISH, MDA-MB-231, 10% TQ 10% TQ + DOX Synthetic TQ Syn. TQ (40 μmol L-1)
and A549 (200 PPM) (5 µg mL-1) (40 μmol L-1) + DOX (5 µg mL-1)

117

118 Harvesting cells

119 After the incubation period, cells were harvested by trypsinization (0.025%). Briefly, old media
120 were discarded, and cells were washed three times with PBS, then trypsin was added for 3 min.
121 the cells were collected by centrifugation at 300 rpm for 15 min at room temperature.
122 Supernatant was discarded and the pellet was kept for the downstream analysis.

123 Cell viability assay

124 Up o treatment, 10 µL of the harvested cells was mixed with an equal amount pf trypan blue dye
125 (Sigma-Aldrich) and incubated for 3 min at room temperature. The mix was then loaded on
126 hemocytometer slide and examined under light microscope. The number of viable cells was
127 calculated according the following equation:
4
128 Number of viable cells=averrage count of cells x 2 x 10

129 The average count of cells is the average of readings of the four quadrants of the slide.

130 Cytotoxicity assay

131 Treated and untreated cells were harvested and subjected to 3-(4,5- dimethylthiazol-2-yl)-2,5-
132 diphenyl-tetrazolium bromide (MTT) assay to evaluate the cytotoxicity of the loaded drugs.
133 Briefly, 100 µL of the resuspended cells was mixed with MTT reagent (50 μL MTT of 5 mg mL -
134 1
in PBS). The plate was incubated for 4 h at 37 °C in a humidified atmosphere with 5% CO 2,
135 and then 200 μL of DMSO was added and the mix was incubated for 30 min at 37 °C to dissolve
136 the formed formazan crystals. the optical density was measured at 550 nm using a
137 spectrophotometric plate reader (BioTek Instruments, Inc., Winooski, VT, USA).

138

139 Apoptosis assay

140 To detect apoptosis, breast and lung cancer cells were cultured in a 12-well tissue culture plate
141 and were treated with TQ, 10% TQ with DOX for 48 h. The apoptotic cells were stained using
142 Annexin V Fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI). Briefly, cells were
143 harvested and resuspended in 100 μL Annexin V binding buffer and 5 μL Annexin V Alexa
144 Fluor 488 and incubated 15 min in the dark. Four μL of PI was added and the mix and incubated
145 for an extra for 15 min in the dark. The PI-stained cells were washed with 500 μL Annexin V
146 binding buffer. Stained cells were visualized on flow cytometer (BD FACSCalibur™). The
147 binding was analyzed at Ex = 488 nm; Em = 530 nm using FITC signal detector (FL1) and PI
148 staining by the phycoerythrin emission signal detector (FL2).

149

150 Cell cycle analysis

151 To assess the disturbances of the cell cycle phases, treated and untreated cells were harvested
152 after 48 h of incubation of the drugs. Cells were then centrifuged at 600 rpm for 5 min and left
153 for 2 h at 4 C. cells were then incubated for 25 min in the dark with 50 μg/mL RNAse, 50 μg/mL
154 PI, and 0.1% Triton X-100. The fluorescence of the PI stain was assessed by FACScan flow
155 cytometer (BD FACSCalibur™).

156

157 RNA extraction and cDNA synthesis

158 Total RNA was extracted from treated and untreated lung and breast cancer cells using RNA
159 Isolation System (Qiagen, GmbH, Germany). RNA quality and quantity were checked. To
160 synthesize cDNA, 4 μg of RNA was incubated with 1 μM deoxyribonucleotides (dNTP), 10
161 units of M-MLV SuperScript II Reverse Transcriptase (Invitrogen), and 1 μg random 6-mer
162 primers. The mix was incubated at 42 °C for one hour. It was then ready for amplification.

163

164 Gene expression analysis

165 In the present study, qPCR was used to amplify Bcl-XL, TGF-β, IL-6, FOXO6, and CYP1B1
166 genes. The primer sequences used in this amplification are presented in table 2. All primers were
167 designed by using Primer-BLAST tool, NCBI. For the amplification reaction, 100 ng of cDNA
168 was mixed with 12.5 μL of SYBR Green master mix, 10 pM of each primer, and the final
169 volume was brough to 25 μL. The thermal cycler profile was as follows: 95 °C for 5 min as a
170 pre-PCR step, and then we performed 35 cycles of 94 °C for 45 sec, 57 °C for 45 sec, and 72 °C
171 for 50 sec. The reaction was followed with a final step of 72 °C for 10 min. We used
172 StepOnePlus thermal cycler (Applied Biosystems, UK), and we calculated the fold change by
173 applying the 2−ΔΔCT method.

174

175 Table 2: primer sequences used to amplify the specified genes.

Primer name Forward Reverse

Bcl-XL TGACCAGGGTGAAAGATGCC GGAGAGTACTCCTGGCTCCC

TGF-b ACTTTCACACCAGTATGGGGC TGTCTGAGAGGGTAGTGCCT

IL-6 ACTTTCCTGGCTGTGGTTGAA CTGCATGCAAGAGGGAGAAGT

FOXO6 GGGGTGATACCTCCGAAAAGT TCCTAGTTGGCTTCCCCGA

CYP1B1 GGGTATGGAGCACACCTCAC TGCTCACTTGCTTTTCTCTCTC

176

177 Statistical analysis

178 We presented data in all experiments as mean± standard error (SE), and all experiments were
179 performed in triplicates. We used ANOVA and the student's t-test to compare control with
180 treatment where applicable, and the values of p < 0.05 was considered significant.

181

182 Results

183 Cytotoxicity and cell count

184 In the present study, MDA-MB-231 breast cancer and A549 lung cancer cells along with WISH
185 human amnion-derived cells were treated with synthetic TQ and NSE-10%TQ, either each alone
186 or combined with DOX for 48 h. The cell viability was measured using Trypan blue assay and
187 the results indicated that the highest reduction in the cells viability resulted from the combination
188 of synthetic TQ and DOX, while the lowest reduction rate was shown by the application of
189 synthetic TQ alone (Fig. 1).

190 Fig. 1

191

192 Apoptosis detection

193 We further assessed the apoptosis levels in the treated and untreated cells using Flow Cytometry.
194 Data presented in Fig. (2 & 3) indicated that the treatment of MDA-MB-231 with designated
195 drugs/combinations have resulted in a significant increase in the level of late apoptosis compared
196 to either WISH cells (p = 0.013) or A549 lung cancer cell (p = 0.028). However, the changes in
197 the apoptosis levels were not significant between WISH and A549 cells (p = 0.088). Meanwhile,
198 no significant differences were found between the different treatments and control.

199 Fig. 2

200 Fig. 3

201

202

203 Cell phases distribution

204 The treated and untreated cells were subjected to cell cycle analysis using flow cytometer. Data
205 presented in Fig. (4 & 5) indicated that for lung cancer cells (A549), all treatments have affected
206 the distribution of cell cycle phases, with the NSE-10%TQ combined with DOX showing the
207 most powerful treatment as it arrested cell cycle at G2/M phase. However, for breast cancer cells
208 (MDA-MB-231), all the drugs/combinations have arrested the cells at G2/M phase with the
209 highest effect given by the synthetic TQ combined with DOX.

210 Fig. 4

211 Fig. 5

212

213 Gene expression analysis

214 In the present study, breast and lung cancer cells were treated with TQ in combination with DOX
215 to assess the synergetic effect of this combination. To have a deep look on the molecular
216 mechanism by which this combination might exert its action, we evaluated the expression profile
217 of Bcl-XL, TGF-β, IL-6, FOXO-6, and CYP1B1. The obtained data (Fig. 6 & 7) showed that in
218 both lung and breast cancer cells, Bcl-XL, FOXO6, and CYP1B1 were upregulated while TGF-β
219 and IL-6 were downregulated.

220 Fig. 6

221 Fig. 7

222

223

224 Discussion

225 To the best of our knowledge, this is the first report comparing the anticancer activity of TQ and
226 NSE-10%TQ. The antitumor effect of NSE-10%TQ exceeds 50% of that produced by TQ in
227 most of the results. This shows that the extract has other ingredients, apart from TQ, which
228 possess anticancer activity. One of these ingredients is α-Hederin which has been shown to
229 induce apoptosis and arrest cell cycle at G2/M phase in colon cancer cells (22). It also induces
230 cytotoxicity and apoptosis in breast cancer cells (23).

231 We also evaluated the role of TQ and NSE-10%TQ in synergizing the effect of DOX in
232 controlling breast and lung cancer cells. TQ antitumor activity is well documented in the
233 literature (24). Doxorubicin, the potent anthracycline antibiotic, can intercalate with DNA helix
234 and inhibit topoisomerase II; the DNA repair enzyme (25). Cytotoxicity and cell viability data
235 have indicated that all treatments could reduce the cell count, with the combination of synthetic
236 TQ and DOX showing the most potent effect. These data highlighted the synergetic action of TQ
237 and DOX as TQ can reduce the dose of DOX needed to treat cancer such as ATL (26).
238 Moreover, TQ synergistically improves the anti-cancer activity of DOX and triggers apoptosis
239 (27), and this was the case in our results.

240 TQ induced apoptosis in breast and lung cancer cells solely or combined with DOX via either
241 decreasing the levels of glutathione and/or increasing the levels of ROS (28, 29), and this might
242 occur by modulating the PI3K/Akt and p38 kinase pathways (30), or by upregulating caspase-3
243 and caspase-7, and cleavage of poly(ADP-ribose)polymerase (31). Other mechanisms include the
244 upregulation of p53 (2). The data obtained in the present study indicated that TQ synergized
245 DOX in inducing apoptosis in lung and breast cancer cells via upregulating FOXO6 and
246 CYP1B1 and downregulating TGF-β, IL-6.

247 One of the main mechanisms of TQ is to trigger apoptosis during different stages of cell cycle. It
248 arrested breast cancer cells at G1 phase and eventually shifted the cells to sub-G1, which indicate
249 apoptosis (32). In the present study, generally, synthetic TQ and NSE-10%TQ solely or
250 combined with DOX could arrest breast and lung cancer cells at G2/M. TQ induced G2/M arrest,
251 by inactivating PI3K/Akt and nuclear factor-κB pathways in other human cancers such as
252 cholangiocarcinoma in a dose- and time-dependent manner (33). Our data showed that in breast
253 cancer cells, the highest percentage of G2/M arrest was obtained when cells were treated
254 synthetic TQ combined with DOX, although a high percentage of cells were recorded at pre-G1
255 in the same combination. This phenomenon has been indicated earlier by several research groups
256 (34-36), although it was in contradiction with Rajput, Kumar (32). TQ exerts its function by
257 inhibiting the expression of antiapoptotic genes, such as XIAP, Bcl-XL, and Bcl-2 (37).

258 To further investigate the mechanism by which TQ synergistically improve the action of DOX,
259 we assessed the expression profile of Bcl-XL, TGF-β, IL-6, FOXO-6, and CYP1B1 in treated
260 and untreated cells. In lung cancer cells, IL-6, and TGF-β were downregulated in all treatments,
261 with synthetic TQ combined with DOX being the most effective treatment. In this regard, TQ
262 was previously found to decrease the activation of STAT3 and downregulate both Bcl-2 and Bcl-
263 XL in Multiple Myeloma cells (38, 39). Furthermore, this inhibition of Bcl-XL sensitizes
264 malignant cells to DOX (40).

265 Moreover, the expression of IL-6 was upregulated in different types of cancer due to the strong
266 association between inflammation and cancer (41). In this study, IL-6 was downregulated in the
267 two cancer cell lines, with the NSE-10%-TQ combined with DOX inducing the highest effect.
268 Other reports indicated that TQ downregulated IL-6 via downregulating the pSTAT3, pAKT, and
269 pERK1/2 signaling pathway (42). TQ does not only downregulate IL-6, but also IL-1β and TNF-
270 α (43).

271 Our results showed that TQ synergized DOX in controlling breast and lung cancer cells, at least
272 in part, by downregulating TGF-β1, the multifunctional regulatory polypeptide which regulates
273 cell growth, cell proliferation, and apoptosis (44). TGF-β1 exerts two actions in terms of its role
274 in carcinogenesis, where it functions as tumor suppressor gene (TSG) in the early stages of
275 cancer, and at late stages it promotes the cell proliferation (45). Furthermore, its activity is
276 associated with poor clinical outcome (46).

277 On the other hand, CYP1B1 and FOXO6 were upregulated in both cell lines, with variation in
278 the level of expression as revealed by fold change. For CYP1B1, the key enzyme involved in the
279 metabolism of exogenous procarcinogens and xenobiotics (47), there are conflicting reports
280 regarding its role in carcinogenesis. Zordoky and El-Kadi (48) reported that DOX could induce
281 CYP1B1 expression in dose-dependent fashion, where the promoter of this gene is
282 hypomethylated (49). Other researchers indicated that the expression of this gene is elevated in
283 cancer cells compared to normal tissue (50), and it is constitutively expressed in health cells (51).
284 In this study, DOX and TQ as xeno compounds were able to trigger CYP1B1 to exert its normal
285 function.

286 Furthermore, our results showed upregulation of FOXO6, the member of the subfamily of the
287 fork head transcription factor family. Ye and Duan (52) reported that the downregulation of
288 FOXO6 may induce EMT and facilitate migration and metastasis. Thus, activation of FOXO6
289 seems to be a reliable approach to control cancer. Meanwhile, several reports indicated that
290 upregulation of FOXO6 inhibited lung cancer in vitro (53), and it could be considered a tumor
291 suppressor due to its inhibitory effect on cancer cell growth and survival (54).

292

293 Conclusion

294 The results in this study shows a significant and comparable anticancer effect of TQ and NSE-
295 10%TQ in addition a synergetic effect on the antitumor effect of DOX. TQ antcancer effect is, at
296 leat in part, related to downregulation of TGF-β and IL-6 and an upregulation of Bcl-XL,
297 FOXO6, and CYP1B1. This study calls for further investigations on the role of NSE and TQ in
298 different concentrations to explore their anticancer effect on various cancer cell lines.

299

300

301 Acknowledgement
302 This work received no fund from any funding bodies.

303 Conflict of interest

304 The authors declare no conflict of interests.

305 Author contribution

306 The two authors contributed equally.

307 Refrences
308 1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2020. CA Cancer J Clin. 2020;70(1):7-30.
309 2. Samarghandian S, Azimi-Nezhad M, Farkhondeh T. Thymoquinone-induced antitumor and
310 apoptosis in human lung adenocarcinoma cells. J Cell Physiol. 2019;234(7):10421-31.
311 3. Abdel-Hakeem MA, Abdel-Haseb OM, Abdel-Ghany SE, Cevik E, Sabit H. Doxorubicin loaded on
312 chitosan-protamine nanoparticles triggers apoptosis via downregulating Bcl-2 in breast cancer cells.
313 Journal of Drug Delivery Science and Technology. 2020;55:101423.
314 4. Huang CY, Ju DT, Chang CF, Muralidhar Reddy P, Velmurugan BK. A review on the effects of
315 current chemotherapy drugs and natural agents in treating non-small cell lung cancer. Biomedicine
316 (Taipei). 2017;7(4):23.
317 5. Effenberger-Neidnicht K, Schobert R. Combinatorial effects of thymoquinone on the anti-cancer
318 activity of doxorubicin. Cancer Chemother Pharmacol. 2011;67(4):867-74.
319 6. Barrett-Lee PJ, Dixon JM, Farrell C, Jones A, Leonard R, Murray N, et al. Expert opinion on the
320 use of anthracyclines in patients with advanced breast cancer at cardiac risk. Annals of Oncology.
321 2009;20(5):816-27.
322 7. Li X, Lu Y, Liang K, Liu B, Fan Z. Differential responses to doxorubicin-induced phosphorylation
323 and activation of Akt in human breast cancer cells. Breast Cancer Research. 2005;7(5):R589.
324 8. Gali-Muhtasib H, Roessner A, Schneider-Stock R. Thymoquinone: A promising anti-cancer drug
325 from natural sources. The international journal of biochemistry & cell biology. 2006;38(8):1249-53.
326 9. Pop RM, Trifa AP, Popolo A, Chedea VS, Militaru C, Bocsan IC, et al. Nigella sativa: Valuable
327 perspective in the management of chronic diseases. Iran J Basic Med Sci. 2020;23(6):699-713.
328 10. Alhakamy NA, Badr-Eldin SM, U AF, Alruwaili NK, Awan ZA, Caruso G, et al. Thymoquinone-
329 Loaded Soy-Phospholipid-Based Phytosomes Exhibit Anticancer Potential against Human Lung Cancer
330 Cells. Pharmaceutics. 2020;12(8).
331 11. Noorbakhsh MF, Shaterzadeh-Yazdi H, Hayati F, Samarghandian S, Farkhondeh T. Protective
332 Effects of Thymoquinon on Pulmonary Disorders in Experimental Studies. Tanaffos. 2018;17(4):211-22.
333 12. Zhang M, Du H, Wang L, Yue Y, Zhang P, Huang Z, et al. Thymoquinone suppresses invasion and
334 metastasis in bladder cancer cells by reversing EMT through the Wnt/β-catenin signaling pathway. Chem
335 Biol Interact. 2020;320:109022.
336 13. Imran M, Rauf A, Khan IA, Shahbaz M, Qaisrani TB, Fatmawati S, et al. Thymoquinone: A novel
337 strategy to combat cancer: A review. Biomed Pharmacother. 2018;106:390-402.
338 14. Jafri SH, Glass J, Shi R, Zhang S, Prince M, Kleiner-Hancock H. Thymoquinone and cisplatin as a
339 therapeutic combination in lung cancer: In vitro and in vivo. Journal of Experimental & Clinical Cancer
340 Research. 2010;29(1):87.
341 15. Badary OA, Nagi MN, Al-Shabanah OA, Al-Sawaf HA, Al-Sohaibani MO, Al-Bekairi AM.
342 Thymoquinone ameliorates the nephrotoxicity induced by cisplatin in rodents and potentiates its
343 antitumor activity. Canadian Journal of Physiology and Pharmacology. 1997;75(12):1356-61.
344 16. al-Shabanah OA, Badary OA, Nagi MN, al-Gharably NM, al-Rikabi AC, al-Bekairi AM.
345 Thymoquinone protects against doxorubicin-induced cardiotoxicity without compromising its antitumor
346 activity. J Exp Clin Cancer Res. 1998;17(2):193-8.
347 17. Khan MA, Tania M, Wei C, Mei Z, Fu S, Cheng J, et al. Thymoquinone inhibits cancer metastasis
348 by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition. Oncotarget.
349 2015;6(23):19580-91.
350 18. Linjawi SAA, Khalil WKB, Hassanane MM, Ahmed ES. Evaluation of the protective effect of
351 Nigella sativa extract and its primary active component thymoquinone against DMBA-induced breast
352 cancer in female rats. Archives of medical science : AMS. 2015;11(1):220-9.
353 19. Farah IO. Assessment of cellular responses to oxidative stress using MCF-7 breast cancer cells,
354 black seed (N. Sativa L.) extracts and H2O2. International journal of environmental research and public
355 health. 2005;2(3-4):411-9.
356 20. Abuharfeil NM, Maraqa A, Von Kleist S. Augmentation of natural killer cell activity in vitro
357 against tumor cells by wild plants from Jordan. Journal of Ethnopharmacology. 2000;71(1):55-63.
358 21. Mahmoud SS, Torchilin VP. Hormetic/cytotoxic effects of Nigella sativa seed alcoholic and
359 aqueous extracts on MCF-7 breast cancer cells alone or in combination with doxorubicin. Cell Biochem
360 Biophys. 2013;66(3):451-60.
361 22. Sun D, Shen W, Zhang F, Fan H, Xu C, Li L, et al. α-Hederin inhibits interleukin 6-induced
362 epithelial-to-mesenchymal transition associated with disruption of JAK2/STAT3 signaling in colon cancer
363 cells. Biomed Pharmacother. 2018;101:107-14.
364 23. Cheng L, Xia T-S, Wang Y-F, Zhou W, Liang X-Q, Xue J-Q, et al. The anticancer effect and
365 mechanism of α-hederin on breast cancer cells. Int J Oncol. 2014;45(2):757-63.
366 24. Samarghandian S, Azimi‐Nezhad M, Farkhondeh T. Thymoquinone‐induced antitumor and
367 apoptosis in human lung adenocarcinoma cells. Journal of cellular physiology. 2018;234(7):10421-31.
368 25. Chen N-T, Wu C-Y, Chung C-Y, Hwu Y, Cheng S-H, Mou C-Y, et al. Probing the dynamics of
369 doxorubicin-DNA intercalation during the initial activation of apoptosis by fluorescence lifetime imaging
370 microscopy (FLIM). PloS one. 2012;7(9):e44947-e.
371 26. Fatfat M, Fakhoury I, Habli Z, Mismar R, Gali-Muhtasib H. Thymoquinone enhances the
372 anticancer activity of doxorubicin against adult T-cell leukemia in vitro and in vivo through ROS-
373 dependent mechanisms. Life sciences. 2019;232:116628.
374 27. Jehan S, Zhong C, Li G, Zulqarnain Bakhtiar S, Li D, Sui G. Thymoquinone Selectively Induces
375 Hepatocellular Carcinoma Cell Apoptosis in Synergism With Clinical Therapeutics and Dependence of
376 p53 Status. Front Pharmacol. 2020;11:555283.
377 28. Dergarabetian EM, Ghattass KI, El-Sitt SB, Al-Mismar RM, El-Baba CO, Itani WS, et al.
378 Thymoquinone induces apoptosis in malignant T-cells via generation of ROS. Front Biosci (Elite Ed).
379 2013;5:706-19.
380 29. Hussain AR, Ahmed M, Ahmed S, Manogaran P, Platanias LC, Alvi SN, et al. Thymoquinone
381 suppresses growth and induces apoptosis via generation of reactive oxygen species in primary effusion
382 lymphoma. Free Radic Biol Med. 2011;50(8):978-87.
383 30. Yu SM, Kim SJ. Thymoquinone-induced reactive oxygen species causes apoptosis of
384 chondrocytes via PI3K/Akt and p38kinase pathway. Exp Biol Med (Maywood). 2013;238(7):811-20.
385 31. Ashour AE, Ahmed AF, Kumar A, Zoheir KM, Aboul-Soud MA, Ahmad SF, et al. Thymoquinone
386 inhibits growth of human medulloblastoma cells by inducing oxidative stress and caspase-dependent
387 apoptosis while suppressing NF-κB signaling and IL-8 expression. Mol Cell Biochem. 2016;416(1-2):141-
388 55.
389 32. Rajput S, Kumar BN, Dey KK, Pal I, Parekh A, Mandal M. Molecular targeting of Akt by
390 thymoquinone promotes G(1) arrest through translation inhibition of cyclin D1 and induces apoptosis in
391 breast cancer cells. Life Sci. 2013;93(21):783-90.
392 33. Xu D, Ma Y, Zhao B, Li S, Zhang Y, Pan S, et al. Thymoquinone induces G2/M arrest, inactivates
393 PI3K/Akt and nuclear factor-κB pathways in human cholangiocarcinomas both in vitro and in vivo. Oncol
394 Rep. 2014;31(5):2063-70.
395 34. Fatfat M, Fakhoury I, Habli Z, Mismar R, Gali-Muhtasib H. Thymoquinone enhances the
396 anticancer activity of doxorubicin against adult T-cell leukemia in vitro and in vivo through ROS-
397 dependent mechanisms. Life Sciences. 2019;232:116628.
398 35. Arafa E-SA, Zhu Q, Shah ZI, Wani G, Barakat BM, Racoma I, et al. Thymoquinone up-regulates
399 PTEN expression and induces apoptosis in doxorubicin-resistant human breast cancer cells. Mutation
400 research. 2011;706(1-2):28-35.
401 36. Xu D, Ma Y, Zhao B, Li S, Zhang Y, Pan S, et al. Thymoquinone induces G2/M arrest, inactivates
402 PI3K/Akt and nuclear factor-κB pathways in human cholangiocarcinomas both in vitro and in vivo. Oncol
403 Rep. 2014;31(5):2063-70.
404 37. Woo CC, Hsu A, Kumar AP, Sethi G, Tan KH. Thymoquinone inhibits tumor growth and induces
405 apoptosis in a breast cancer xenograft mouse model: the role of p38 MAPK and ROS. PLoS One.
406 2013;8(10):e75356.
407 38. Badr G, Mohany M, Abu-Tarboush F. Thymoquinone decreases F-actin polymerization and the
408 proliferation of human multiple myeloma cells by suppressing STAT3 phosphorylation and Bcl2/Bcl-XL
409 expression. Lipids in health and disease. 2011;10:236-.
410 39. Saffari Chaleshtori J, Heidari-Sureshjani E, Moradi F, Heidarian E. The Effects of Thymoquinone
411 on Viability, and Anti-apoptotic Factors (BCL-XL, BCL-2, MCL-1) in Prostate Cancer (PC3) Cells: An In Vitro
412 and Computer-Simulated Environment Study. Adv Pharm Bull. 2019;9(3):490-6.
413 40. Baranski Z, de Jong Y, Ilkova T, Peterse EFP, Cleton-Jansen A-M, van de Water B, et al.
414 Pharmacological inhibition of Bcl-xL sensitizes osteosarcoma to doxorubicin. Oncotarget.
415 2015;6(34):36113-25.
416 41. Kumari N, Dwarakanath BS, Das A, Bhatt AN. Role of interleukin-6 in cancer progression and
417 therapeutic resistance. Tumour Biol. 2016;37(9):11553-72.
418 42. Ranjbari A, Heidarian E, Ghatreh-Samani K. Effects of Thymoquinone on IL-6 Gene Expression
419 and Some Cellular Signaling Pathways in Prostate Cancer PC3 Cells. Jundishapur J Nat Pharm Prod.
420 2017;12(3):e63753.
421 43. Farkhondeh T, Samarghandian S, Shahri AMP, Samini F. The Neuroprotective Effects of
422 Thymoquinone: A Review. Dose-response. 2018;16(2):155932581876145-1559325818761455.
423 44. Jakowlew SB. Transforming growth factor-beta in cancer and metastasis. Cancer Metastasis Rev.
424 2006;25(3):435-57.
425 45. Syed V. TGF-β Signaling in Cancer. J Cell Biochem. 2016;117(6):1279-87.
426 46. Ruan H, Wang T, Yang C, Jin G, Gu D, Deng X, et al. Co-expression of LASS2 and TGF-β1 predicts
427 poor prognosis in hepatocellular carcinoma. Scientific reports. 2016;6:32421-.
428 47. Rochat B, Morsman JM, Murray GI, Figg WD, McLeod HL. Human CYP1B1 and anticancer agent
429 metabolism: mechanism for tumor-specific drug inactivation? J Pharmacol Exp Ther. 2001;296(2):537-
430 41.
431 48. Zordoky BN, El-Kadi AO. Induction of several cytochrome P450 genes by doxorubicin in H9c2
432 cells. Vascul Pharmacol. 2008;49(4-6):166-72.
433 49. Alsubait A, Aldossary W, Rashid M, Algamdi A, Alrfaei BM. CYP1B1 gene: Implications in
434 glaucoma and cancer. J Cancer. 2020;11(16):4652-61.
435 50. Kwon Y-J, Baek H-S, Ye D-J, Shin S, Kim D, Chun Y-J. CYP1B1 Enhances Cell Proliferation and
436 Metastasis through Induction of EMT and Activation of Wnt/β-Catenin Signaling via Sp1 Upregulation.
437 PloS one. 2016;11(3):e0151598.
438 51. Mahemuti L, Chen Q, Coughlan MC, Qiao C, Chepelev NL, Florian M, et al. Bisphenol A induces
439 DSB-ATM-p53 signaling leading to cell cycle arrest, senescence, autophagy, stress response, and
440 estrogen release in human fetal lung fibroblasts. Arch Toxicol. 2018;92(4):1453-69.
441 52. Ye H, Duan M. Downregulation of FOXO6 in breast cancer promotes epithelial-mesenchymal
442 transition and facilitates migration and proliferation of cancer cells. Cancer Manag Res. 2018;10:5145-
443 56.
444 53. Hu H-J, Zhang L-G, Wang Z-H, Guo X-X. FoxO6 inhibits cell proliferation in lung carcinoma
445 through up-regulation of USP7. Mol Med Rep. 2015;12(1):575-80.
446 54. Hornsveld M, Dansen TB, Derksen PW, Burgering BMT. Re-evaluating the role of FOXOs in
447 cancer. Seminars in Cancer Biology. 2018;50:90-100.
448

449

450

451

452
454 Fig. 1: Cytotoxicity and cell viability. A: MTT assay showed that treatments have affected the viability of
455 the two malignant cell lines compared to the WISH cells. B: the percentages of the reduction of cell
456 number was at the highest in the synthetic TQ combined with DOX treatment. TQ: Thymoquinone, DOX:
457 Doxorubicin.

458
459

460

461

462

463

464

465

466

467

468

469

470

471

472

473

474

475

476 Fig. 2: Apoptosis detection by flow cytometer. Generally, treatments of synthetic TQ and the crud extract
477 of black seeds combined with DOX cause the apoptosis level to increase in both malignant cell line
478 compared to WISH cells. TQ: Thymoquinone, DOX: Doxorubicin.

479
480

481

482

483

484

485

486

487

488

489

490 Fig. 3: Percentages of late apoptosis and necrosis in MDA-MB-2311, A549, and WISH cells. A: The
491 combination of synthetic TQ combined with DOX has caused the highest level of late apoptosis followed
492 by the crus extract that contains 10% of TQ combined with DOX in both cells. B: percentages of necrosis
493 also has been increases in all treatments and the two cell lines compared to WISH. TQ: Thymoquinone,
494 DOX: Doxorubicin.

495
496

497

498

499 Fig. 4: Histograms of cell cycle analysis. The overall trend is that the treatments have affected the
500 distribution of cell phases and arrested the cells at G2/M phases, indicating the cytotoxic effect of this
501 drug/combination. TQ: Thymoquinone, DOX: doxorubicin.

502
503

504

505
507 Fig. 5: Bar charts of the distribution of cell phases after being treated with either TQ as monotherapy or
508 combined with DOX. A: MDA-MB-231 breast cancer cells, B: A549 lung cancer cells, and C: WISH,
509 human amnion-derived cells.

510
511

512

513

514

515

516 Fig. 6.
517 Gene

518 expression analysis of A549 lung cancer cells treated with TQ solely or combined with DOX for 48 h.
519 Downregulation of both IL-6 and TGF-b and upregulation of FOXO6, Bcl-XL, and CYP1B1 were
520 observed.

521
522

523

524

525

526 Fig.
527 7: Gene expression analysis of MDA-MB-231 breast cancer cells treated with TQ solely or combined
528 with DOX for 48 h. Downregulation of both IL-6 and TGF-b and upregulation of FOXO6, Bcl-XL, and
529 CYP1B1 were observed.

530

531