Hindawi Publishing Corporation

Evidence-Based Complementary and Alternative Medicine

Volume 2016, Article ID 5850739, 14 pages
http://dx.doi.org/10.1155/2016/5850739

Research Article
Xiao Yao San against Corticosterone-Induced Stress
Injury via Upregulating Glucocorticoid Receptor Reaction
Element Transcriptional Activity

Guoping Cao,1 Shenglan Gong,2 Fengxue Zhang,3 and Wenjun Fu3

1
Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006, China
2
Shenzhen Clinical Medical College of Guangzhou University of Chinese Medicine, Shenzhen, Guangdong 51800, China
3
School of Basic Medical Science, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006, China

Correspondence should be addressed to Wenjun Fu; fuwenjun201511@163.com

Received 15 April 2016; Revised 28 June 2016; Accepted 4 September 2016

Academic Editor: Abir El-Alfy

Copyright © 2016 Guoping Cao et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Previous studies have revealed that uncontrollable stress can impair the synaptic plasticity and firing property of hippocampal
neurons, which influenced various hippocampal-dependent tasks including memory, cognition, behavior, and mood. In this work,
we had investigated the effects and mechanisms of the Chinese herbal medicine Xiao Yao San (XYS) against corticosterone-induced
stress injury in primary hippocampal neurons (PHN) cells. We found that XYS and RU38486 could increase cell viabilities and
decrease cell apoptosis by MTT, immunofluorescence, and flow cytometry assays. In addition, we observed that XYS notably
inhibited the nuclear translocation of GR and upregulated the mRNA and protein expressions levels of Caveolin-1, GR, BDNF,
TrkB, and FKBP4. However, XYS downregulated the FKBP51 expressions. Furthermore, the results of the electrophoretic mobility
shift assay (EMSA) and double luciferase reporter gene detection indicated that FKBP4 promotes the transcriptional activity of
GR reaction element (GRE) by binding with GR, and FKBP51 processed the opposite action. The in vivo experiment also proved
the functions of XYS. These results suggested that XYS showed an efficient neuroprotection against corticosterone-induced stress
injury in PHN cells by upregulating GRE transcriptional activity, which should be developed as a potential candidate for treating
stress injury in the future.

1. Introduction plasticity and firing properties of hippocampal neurons [8].

In the last decade, hippocampal neurogenesis in the mature
brain has attracted considerable attention [1–3]. Up to now,
stress is the earliest identified and the most profound factor
that can affect adult neurogenesis both positively and nega-
tively [4, 5]. In brain, hippocampal area was crucially involved
in memory and emotional information processing, which
affects the abilities of generating and differentiating into
multiple neural cell lineages [6]. A large number of evidences
have suggested that hippocampal neurogenesis contributes to
some hippocampus-dependent tasks, such as cognition and
mood [7]. Uncontrollable stress exerts long-lasting changes
in the brain, and it leads to behavioral, emotional, and
cognitive modifications including Alzheimer’s disease (AD),
anxiety, and major depression through altering the synaptic
Therefore, investigations of the underlying mechanisms of
stress cascades are urgently needed for developing effective
therapies of hippocampal dysfunction.
The hypothalamic-pituitary-adrenal (HPA) axis and its
end-effect neuroendocrine hormones, namely, glucocorti-
coids, are mediators of the myriad stress effects on the
hippocampus [9]. Briefly, HPA axis is activated after uncon-
trollable stress accumulating in brain either internally or
externally, and then glucocorticoid receptors (GRs) are
triggered and expressed densely in the hippocampus [10].
Corticosterone, the major glucocorticoid, exerts powerful
feedback effects on the HPA axis. Accumulating reports have
proved that nerve cells under persistent exposure to high
concentration of corticosterone can notably induce DNA
damage, some protein activation, and cells apoptosis [11].
2 Evidence-Based Complementary and Alternative Medicine
GR is the main mediator of the stress response in neu-
ronal progenitor cells and hippocampal neurogenesis [12].
The expression level of GR directly regulates the excitation-
inhibition balance, which is key for the positioning and
functional integration of newborn neurons and may con-
tribute to the chronification of paroxysmal brain diseases
[13]. The hippocampal area expresses GR in a high level, so
it is sensitive to the fluctuating levels of corticosterone in
particular [14].
Traditional Chinese medicines (TCMs) have been used
in China for thousands of years. Due to the advantage of
high efficiency and low toxicity, TCMs have attracted great
interest in recent years [15]. Some active natural components
from TCMs, including icariin from Epimedium brevicornum
Maxim, baicalin from Scutellaria baicalensis Georgi, and
Shugan Lifei Recipe (SGLFR), have already been proved
with excellent activities against corticosterone-induced stress
injury [16, 17]. Icariin was able to prevent corticosterone-
induced hypothalamic cell apoptosis via activation of the
PI3K/Akt pathway [18]. Baicalin exhibits a beneficial effect on
adult neurogenesis [19]. SGLFR is beneficial to asthma under
stress in rats by regulating the hyperfunction of HPA axis and
the disorder of immunosystem [20]. Therefore, it is reason-
able to exploit effective herbal products for the treatment of
corticosterone-induced stress injury in primary hippocampal
neurons (PHN) cells. Xiao Yao San (XYS) is a Chinese herbal
formula that has been widely used to treat mental disorders
for thousands of years in China [21]. It was reported that XYS
had anxiolytic-like effects on the elevated plus-maze (EPM)
test by decreasing brain-derived neurotrophic factor (BDNF)
and increasing tyrosine hydroxylase (TrkB) [22]. In addition,
previous research has proved that treatments with XYS could
cause significant reversal of stress-induced deficits in learning
and memory in a spatial memory task [23]. However, no
papers have been published to report the effects of XYS
against corticosterone-induced stress injury in PHN cells.
Therefore, in this paper, we decided to investigate whether
XYS ameliorated corticosterone-induced stress injury in
PHN cells and whether the change of GR level was involved
in underlying molecular mechanism.
2. Materials and Methods
2.1. Chemicals and Materials. Compounds including paeoni-
florin, liquiritin, ferulic acid, and glycyrrhizic acid were
purchased from Chengdu Pufeide Biological Technology Co.,
Ltd. (Chengdu, China). RU-38486 used for the positive drug
was obtained from the Medchem Express (Princeton, USA).
Corticosterone is one kind of adrenal cortical hormone,
which has the strongest effect on carbohydrate metabolism.
As a potent GR antagonist, RU-38486 (mifepristone) can
decrease the injury caused by high level of adrenal corti-
cal hormone [24]. Fetal bovine serum (FBS), penicillin, and
streptomycin were obtained from Hyclone Laboratories,
Inc. (Massachusetts, USA). Dulbecco’s minimum essential
medium (DMEM), Neurobasal-A medium, B27 NeuroMix,
cytosine arabinoside, poly-L-lysine, and trypsin were pur-
chased from Gibco (California, USA). Tissue Protein Ex-
traction Kit was purchased from KEYGEN Biotech. Co.,
Ltd. (China). Bicinchoninic acid (BCA) Protein Assay Kit,
bovine serum albumin (BSA), and Firefly Luciferase Reporter
Gene Assay Kit were purchased from Beyotime Institute of
Biotechnology (Shanghai, China). Cell Cycle and Apopto-
sis Analysis Kits were all purchased from Beyotime Insti-
tute of Biotechnology (Shanghai, China). Corticosterone,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bro-
mide (MTT), and 4,6-diamidino-2-phenylindole (DAPI)
were provided by Sigma (St. Louis, MO, USA). Anti-
bodies against microtubule-associated protein 2 (MAP-2),
Caveolin-1, GR, BDNF, TrkB, FKBP4, FKBP51, and GAPDH-
conjugated affinipure goat anti-rabbit IgG and horseradish
peroxidase-conjugated goat anti-rabbit IgG were supplied
by Abcam (Cambridge, UK). Electrophoretic mobility shift
assay (EMSA) kit was obtained from Invitrogen (Carlsbad,
USA).
2.2. High Performance Liquid Chromatography (HPLC) Anal-
ysis of XYS. HPLC analysis of XYS was performed on
Agilent 1100 HPLC system (Agilent Co., USA) using C18
column COSMOSIL (4.6 mm × 250 mm ID; particle size
5 𝜇m, Japan). The mobile phases comprised eluent A (0.1%
trifluoroacetic acid) and eluent B (acetonitrile). The gradient
flow was as follows: 0.00–15.00 min, 17% B; 15–40 min, 17%–
45% B; 40–60 min, 45%–60% B; 60–70 min, 60%–80% B;
70–85 min, 80% B. The analysis was performed at a flow
rate of 1.0 mL/min with DAD detection at 235 nm. The
injection volume was 20 𝜇L. Furthermore, the professional
software Similarity Evaluation System for Chromatographic
Fingerprint of TCM (version 2004A), which was used for
data analysis, was recommended by the State Food and Drug
Administration. We calculated the correlation coefficients of
entire chromatographic profiles of samples for the simulated
mean chromatogram.
2.3. Animals. Male Wistar rats (180–220 g) were purchased
from the Experimental Animal Center in Guangzhou Uni-
versity of Chinese Medicine. All experimental procedures
were approved by the Animal Care and Use Committee of
the Experimental Animal Center in Guangzhou University
of Chinese Medicine and performed in strict accordance
with the PR China Legislation Regarding the Use and Care
of Laboratory Animals. The rats were allowed to adapt to
the new environment for one week before the experiments,
which were housed in a room under 12 h light/dark cycles, a
relative humidity of 60 ± 10%, and a controlled temperature
of 22 ± 3∘ C. The rats were allowed ad libitum access to water
and a standard pellet diet throughout the experiment.
2.4. Preparation of XYS Cerebrospinal Fluid. The herbal for-
mula of XYS comprises the following traditional Chinese
medicines: Angelica sinensis (Oliv.) Diels, Paeonia lactiflora
Pall., Bupleurum chinense DC., Atractylodes macrocephala
Koidz, Glycyrrhiza uralensis Fisch., Poria cocos (Schw.) Wolf,
Zingiber officinale Rosc., and Mentha haplocalyx Briq., and
the ratio is 6 : 6 : 6 : 6 : 6 : 2 : 2 : 3 [24]. The herbal formula was
immersed in 10 times volume of distilled water and boiled
at 80∘ C for 1 h. The water extracts were collected and then
concentrated by rotary evaporator. The rats were randomly
Evidence-Based Complementary and Alternative Medicine
divided into four groups: animals in Control groups were
treated with physiological saline; XYS groups were treated
with 20.106 (High), 10.053 (Medium), and 5.256 (Low)
g/kg of XYS water extracts. Physiological saline and XYS
water extracts were administered intragastrically (i.g.) twice
daily for five consecutive days. Rats were anesthetized using
intraperitoneal (i.p.) chloral hydrate (350 mg/kg) 1 hour after
the last administration [25]. The skin, fascia, and muscle in
the back side of the neck were exposed successively, subse-
quently piercing the ring pillow membrane and extracting
cerebrospinal fluid (CSF) from the cisterna magna. The CSF
was centrifuged (13,000 r/min) at 4∘ C for 10 min and then
sterilized by 0.22 𝜇m microporous membrane.
2.5. PHN Cells Isolation and Culture. PHN cells were isolated
from fetal Sprague-Dawley (SD) rats at embryonic day
18 (E18) based on the previously described method [26].
Briefly, the embryos were removed by caesarian section and
hippocampi were rapidly isolated under sterile conditions,
cut into 1 mm pieces, and digested with 0.125% trypsin at
37∘ C for 15 min. Trypsin activity was then stopped by planting
DMEM containing 10% FBS, 100 U/mL of penicillin, and
100 U/mL streptomycin. The cells (5×105 cells/mL) were then
planted on poly-l-lysine coated plastic dishes in a constant
temperature and humidity incubator. 24 hours after plant-
ing, the DMEM was replaced with Neurobasal-A medium
containing 2% B27 NeuroMix, 100 U/mL of penicillin, and
100 U/mL streptomycin. Cultures were treated with cytosine
arabinoside (2 𝜇g/mL) to inhibit glial proliferation after 48
hours. The hippocampal neurons were used for experiments
after 7–10 days of culture.
2.6. Corticosterone Injury. The PHN cells were incubated in
corticosterone (Cort) at different concentrations (1280, 640,
320, 160, 80, 40, 20, 10, and 0 𝜇mol/L) for 7 days. The cell
viabilities were detected according to the MTT assay. Briefly,
10 𝜇L MTT was added to each well at 37∘ C for 1 h, and
the formative formazan crystals were dissolved by DMSO
(100 𝜇L) at 37∘ C for 4 h. The absorbance of samples then
was measured at 492 nm using a spectrophotometer (Huayi
Science and Technology Co. Ltd., China).
2.7. Cell Viabilities and Morphological Changes Assay. We
used different concentrations of corticosterone pretreating
PHN cells to mimic stress-induced damage and found the
IC50 of corticosterone was 223 𝜇mol/L. Thus, we chose
223 𝜇mol/L as the corticosterone dose. The PHN cells were
allocated to seven groups: (1) the Control group, in which
they were treated by 0.1% DMSO; (2) the CSF group, in
which they were treated by control cerebrospinal fluid; (3)
the Cort group, in which they received administration of
corticosterone at a dose of 223 𝜇mol/L; (4) the Cort +
Low group, in which they received administration of both
corticosterone and XYS cerebrospinal fluid (low dose); (5) the
Cort + Medium group, in which they received administration
of both corticosterone and XYS cerebrospinal fluid (medium
dose); (6) the Cort + High group, in which they received
administration of both corticosterone and XYS cerebrospinal
fluid (high dose); and (7) the Cort + RU-38486 group, in
3
which they were administered corticosterone plus RU-38486
(2 𝜇mol/L 0.1% DMSO). The PHN cells in different groups
were incubated for 7 days. Finally, the cell viabilities of
hippocampal neurons were detected according to the MTT
assay. For examination of morphological changes, the cells
were photographed by using an inverted microscope (Nikon,
Japan).
2.8. MAP-2 Detection in PHN Cells. The PHN cells were
fixed using methanol for 30 min and permeabilized using
0.3% Triton X-100 for 10 min after XYS pretreatment and
corticosterone injury. The cells were incubated with 5% goat
serum albumin for 1 h at 37∘ C to block nonspecific binding.
The cells were incubated with the anti-MAP-2 antibody
(1 : 100 dilution) for 16 h at 4∘ C and then incubated with Alexa
Fluor 488 Goat Anti-Mouse IgG (H+L) (Proteintech Group,
Chicago, USA) for 1 h at 37∘ C. The images were obtained
using a fluorescence microscope (OLYMPUS, Japan).
2.9. Cell Survival Rate and Cycle Analysis. The PHN cells
were incubated in 6-well plates and treated by XYS and
corticosterone for 7 days. Then, the cells were collected,
washed three with PBS, centrifuged at 600 ×g for 5 min, and
fixed with 75% ethanol at 4∘ C for 24 h. After that, the cells
were stained with PI staining solution for 30 min at 37∘ C
and then analyzed by flow cytometry (FACSCalibur Becton
Dickson, San Diego, CA, USA).
2.10. Cell Apoptosis Analysis. For detecting the PHN cells
apoptosis, Annexin and PI staining solution were added
into cell suspension medium for 20 min in 37∘ C prior to
assessment by flow cytometry.
2.11. Immunofluorescent Examination. The PHN cells were
treated with methanol for 30 min and 0.3% Triton X-100 for
10 min. The cells were then incubated in a moist box overnight
at 4∘ C with the rabbit anti-GR, at a 1 : 100 dilution after the
blocking of nonspecific protein binding by 5% goat serum
albumin, then incubated with Alexa Fluor 488 Goat Anti-
Mouse IgG (H+L) (Proteintech Group, Chicago, USA) for 1 h
at 37∘ C, and counterstained by DAPI (1 𝜇g/mL) for 15 min.
Images of the cells were obtained using a laser scanning
confocal microscope (Leica, TCS SP5, Germany).
2.12. Quantitative Real-Time PCR Assay. The total RNA
samples of PHN cells were extracted by using RNAiso Plus
reagent (TaKaRa Biotechnology Co., Ltd., China) following
the manufacturer’s protocol. The purity of the extracted
RNA was determined; then reverse transcription polymerase
chain reaction (RT-PCR) was performed using PrimeScript
RT reagent kit (TaKaRa Biotechnology Co., Ltd., China)
following the manufacturer’s instructions with a TC-512 PCR
system (TECHNE, UK). Subsequently, the levels of mRNA
expression were quantified by real-time PCR with SYBR
PremixEx TaqII (Tli RNaseH Plus) (TaKaRa Biotechnology
Co., Ltd., China) and ABI 7500 Real-Time PCR System
(Applied Biosystems, USA). The sequences of the primers
are shown in Table 1. A no-template control was analyzed in
parallel for each gene, and GAPDH gene was selected as the
4 Evidence-Based Complementary and Alternative Medicine
Table 1: The primer sequences used for real-time PCR assay in rats.
Gene Full name
Caveolin-1 Caveolin-1
GR Glucocorticoid receptor
BDNF Brain-derived neurotrophic factor
TrkB Neurotrophic tyrosine kinase, receptor, type 2
FKBP4 FK506 binding protein 4
FKBP51 FK506 binding protein 4
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
house-keeping gene in our study. Eventually, the unknown
template was calculated through the standard curve for
quantitative analysis. Briefly, all gene expression levels were
normalized to GAPDH, and the fold changes between the
different groups were calculated using the 2−ΔΔCt method.
2.13. Western Blotting Assay. The PHN cells were plated in 6-
well plates and treated; then the cell proteins were collected
using appropriate cold lysis buffer containing 1 mM phenyl-
methylsulfonyl fluoride (PMSF) based on the manufacturer’s
instructions. Finally, the protein samples were loaded onto
the SDS-PAGE gel (10%–15%), separated electrophoretically,
and transferred onto a PVDF membrane (Millipore, USA).
After blocking nonspecific binding sites for 1 h with 5%
dried skim milk in TTBS at 37∘ C, the membrane was
individually incubated for overnight at 4∘ C with primary
anti-Caveolin-1, anti-GR, anti-BDNF, anti-TrkB, anti-FKBP4,
and anti-FKBP51. Then the membrane was incubated at room
temperature for 2 h with horseradish peroxidase-conjugated
antibodies at a 1 : 5,000 dilution. Protein expression was
detected by an enhanced chemiluminescence (ECL) method
and imaged using ChemiDoc XRS (BIO-RAD, USA). To
eliminate the variations of protein expression, the data were
adjusted to correspond to internal reference expression (IOD
value of target protein versus IOD of corresponding internal
reference).
2.14. Electrophoretic Mobility Shift Assay (EMSA). For deter-
mining the bonding abilities of GR with FKBP4 and FKBP51,
EMSA was carried out. 1 nM Cy5-labeled DNA, 10 𝜇mol/L
FKBP4, and 10 𝜇mol/L FKBP51 were incubated in 10 mM
Tris-HCl (pH = 8.0) buffer including 10 𝜇mol/L Histone H1
and 10 𝜇mol/L BSA at 4∘ C for 1 h. Reactions were run on 20%
Native-PAGE with 1x Tris-glycine buffer (pH = 8.3) at 4∘ C
under 200 V voltage for 15 min. The gels were scanned using
ChemiDoc XRS (BIO-RAD, USA).
2.15. Dual-Luciferase Reporter Assay. The GRE-tk-Luc and
pRL-SV40 plasmids were mixed in the Eppendorf tube
Primer (5󸀠 -3󸀠 )
F: GACTTTGAAGATGTGATTGC
R: AGATGGAATAGACACGGCTG
F: TGTATCCCACAGACCAAAGCA
R: AATCCTCATTCGTGTTCCCTTC
F: ATCCCATGGGTTACACGAAGGAAG
R: AGTAAGGGCCCGAACATACGATTG
F: GATCCTGGTGGCCGTGAA
R: GCTTCGCGATGAAAGTCCTT
F: AGATGACAGCCGAGGAGATG
R: AATTTGTCCTTGCGATCCAG
F: GAGCCGTTTGTCTTTAGCCTTG
R: GCCAGCAGAGCCGTAAGC
F: TGCACCACCAACTGCTTAG
R: GATGCAGGGATGATGTTC
and then transfected into PHN cells. After the cells were
cultured for 21 h, FKBP4 (10 𝜇g/L) or FKBP51 (10 𝜇g/L) was
added for 1 h culturation. Finally, the cell lysis solutions
were collected and the effects of FKBP4 and FKBP51 against
GRE transcriptional activity were determined using the single
photon fluorescence detector (Promega, USA).
2.16. In Vivo Experiments. The rats were randomly allocated
to six groups: (1) the Control group (𝑛 = 6), in which they
were given an equal volume of 0.5% CMC-Na; (2) the Cort
group (𝑛 = 6), in which they received administration of
corticosterone at a dose of 40 mg/kg per day; (3) the Cort
+ Low group (𝑛 = 6), in which they were given both
corticosterone and XYS water extracts at 5.256 g/kg per day;
(4) the Cort + Medium group (𝑛 = 6), in which both
corticosterone and XYS water extracts at 10.053 g/kg per day
were administered to them; (5) the Cort + High group (𝑛 =
6), in which both corticosterone and XYS water extracts at
20.106 g/kg per day were administered to them; and (6) the
Cort + RU-38486 group (𝑛 = 6), in which they received
administration of corticosterone plus RU-38486 (20 mg/kg
per day). Corticosterone was subcutaneously injected once
a day, RU-38486 was subcutaneously injected once a day,
and XYS (suspended in 0.5% CMC-Na) was administered
orally via a gastric tube once a day, with all drugs being given
to the animals for 21 days. Finally, rats were anesthetized
using intraperitoneal (i.p.) chloral hydrate (350 mg/kg), and
hippocampus was quickly dissected out on a cold plate
and immediately frozen in liquid nitrogen and stored at
−80∘ C until assayed. Caveolin-1, GR, BDNF, TrkB, FKBP4,
and FKBP51 mRNA levels of tissue were detected as above
method.
2.17. Statistical Analysis. All the data were analyzed using
statistical software SPSS 18.0 and expressed as means ± SEM.
Differences among groups were determined using the one-
way ANOVA, followed by a post hoc Newman-Keuls test.
Comparisons between two groups were performed using
Evidence-Based Complementary and Alternative Medicine 5

100 1.2

80

Absorbance (490 nm)

Inhibition rate (%) 60
0.8 ∗∗
∗∗
∗∗ ∗∗
40 ##
0.4
IC50 = 223 𝜇mol/L
20

0 0.0
0 320 640 960 1280

Control

CSF

Cort

Medium

High

RU-38486
Low
Cort (𝜇mol/L)

(a) (b)
Control CSF Cort Low Medium High RU-38486
Morphology
MAP-2

(c)
Figure 1: The effects of XYS on the viabilities of corticosterone treated PHN cells. (a) The inhibition rate of corticosterone against PHN cells.
(b) The effect of XYS on the cell viabilities of PHN cells after corticosterone-induced stress injury. (c) The effects of XYS on the morphological
changes and MAP-2-immunopositive neurons (green) of PHN cells (200x magnification) after corticosterone-induced stress injury (𝑛 = 3;
## ∗∗
𝑃 < 0.01 versus CSF; 𝑃 < 0.01 versus Cort).

unpaired Student’s 𝑡-test. 𝑃 < 0.05 and 𝑃 < 0.01 were con-
sidered to be significant.
3. Results
3.1. High Performance Liquid Chromatography (HPLC) Anal-
ysis of XYS. Excellent separations were achieved and the
chromatograms are shown in Supplementary Figures 1(a)
and 1(b) in Supplementary Material available online at
http://dx.doi.org/10.1155/2016/5850739, in which peaks 1–
4 represent paeoniflorin, liquiritin, ferulic acid, and gly-
cyrrhizic acid, respectively. And the results also showed
that the contents of paeoniflorin, liquiritin, ferulic acid, and
glycyrrhizic acid in total of XYS crude drugs were 21.53 mg/g,
5.32 mg/g, 4.56 mg/g, and 6.41 mg/g, respectively. Similarity
analysis of chromatographic XYS samples was shown in
Supplementary Figure 2. The results showed that all the
similarity values of the 9 samples were greater than 0.95.
viabilities. The MTT results also indicated that the viability
of PHN cells notably decreased after corticosterone treatment
compared with CSF group (𝑃 < 0.01). However, the cell
viability was significantly restored by XYS cerebrospinal
fluid of different concentrations, low (5.256 g/kg), middle
(10.053 g/kg), and high (20.106 g/kg), and the positive drug
RU-38486 (2 𝜇mol/L). Furthermore, Figure 1(c) showed that
PHN cells were exposed to corticosterone exhibiting char-
acteristic of neurodegeneration including a loss of synapses
by using the inverted microscope. However, XYS could
decrease the synapses injury. In addition, the control and
CSF treated cells exhibited higher fluorescence intensity of
MAP-2 than that of the Cort group by the observation using
fluorescence microscope. XYS pretreatment and RU-38486
increased the fluorescence intensity (Figure 1(c)). However,
there was no remarkable difference between CSF and Control
group, which showed that the CSF had no significant effect on
PHN cells morphology.

3.2. The Effects of XYS on the Viabilities of Corticosterone
Treated PHN Cells. We used different concentrations of
corticosterone pretreating PHN cells to mimic stress-induced
damage and found the IC50 of corticosterone was 223 𝜇mol/L
(Figure 1(a)). As shown in Figure 1(b), there was no remark-
able difference between CSF and Control group, which
showed that the CSF had no significant effect on PHN cells
3.3. The Effects of XYS on Cell Survival Rate, Cycle, and
Apoptosis. As shown in Figure 2(a), the first peak represented
live cells, and the second peak represented the dead cell. The
results of flow cytometry indicated that there was no signif-
icant difference between CSF and Control group. However,
corticosterone significantly decreased the cell survival rate,
while XYS and RU-38486 could raise the rate compared to
6 Evidence-Based Complementary and Alternative Medicine

Control CSF Cort Low Medium High RU-38486

Counts

0 0 0 0 0 0 0
PI intensity PI intensity PI intensity PI intensity PI intensity PI intensity PI intensity
(a)
Control CSF Cort Low Medium High RU-38486
1200

900
Counts

600

300

0
0 200 400 0 200 400 0 200 400 0 200 400 0 200 400 0 200 400 0 200 400
DNA content DNA content DNA content DNA content DNA content DNA content DNA content
(b)
80

##
Percentage of cells (%)

60 ∗
∗∗
∗∗
40
∗∗ #
∗∗ ∗ ∗
∗∗ ∗ ∗
20
∗∗
##
0
G0/G1 S G2/M

Control Medium
CSF High
Cort RU-38486
Low
(c)

Figure 2: The effects of XYS on cell survival rate and cycle. (a) The effect of XYS on cell survival rate using flow cytometry detection. (b) The
effect of XYS on cell cycle using flow cytometry detection. (c) Data analysis of the effect of XYS on cell cycle (𝑛 = 3; # 𝑃 < 0.05 versus CSF;
## ∗ ∗∗
𝑃 < 0.01 versus CSF; 𝑃 < 0.05 versus Cort; 𝑃 < 0.01 versus Cort).

the Cort group. The results of Figures 2(b) and 2(c) showed corticosterone notably increased the cell apoptosis; however,
that the content of cells DNA at G0/G1 and G2/M phase XYS and RU-38486 could decrease the rate of apoptotic
was increased, whereas the cells DNA content at S phase cells compared to Cort group. Furthermore, there was no
was decreased after corticosterone treatment. Furthermore, significant difference of the effects produced by CSF and
XYS decreased the cells DNA content at G0/G1 and G2/M control vehicle (𝑃 > 0.05).
phase and increased the cells DNA content at S phase. In the
same way, there was no significant difference of the effects 3.4. The Effect of XYS on GR Nuclear Transfer in PHN Cells.
produced by CSF and control vehicle. As shown in Figures The results of immunofluorescent examination shown in
3(a) and 3(b), the results of flow cytometry showed that Figure 4 indicated that the nuclear to cytosolic translocation
Evidence-Based Complementary and Alternative Medicine 7

Control CSF Cort

104 1.19 2.88 104 6.23 6.59 104 2.87 30.60
FL3-H:: 7-AAD

FL3-H:: 7-AAD
FL3-H:: 7-AAD
3 3 3
10 10 10

102 102 102

101 101 101

91.27 4.66 84.88 2.30 41.65 24.88
100 100 100
0 1 2 3 4 0 1 2 3 4 0 1 2 3
10 10 10 10 10 10 10 10 10 10 10 10 10 10 104
FL4-H:: Annexin APC FL4-H:: Annexin APC FL4-H:: Annexin APC
Low Medium High
104 4.32% 28.9% 104 2.49 15.10 104 4.38% 12.3%
FL3-H:: 7-AAD

FL3-H:: 7-AAD
FL3-H:: 7-AAD

3 3 3
10 10 10

102 102 102

101 101 101

59.4% 7.44% 70.15 12.27 80.2% 3.14%
100 100 100
0 1 2 3
10 0
101
10 2
10 3
10 4
10 10 10 10 104 10 0
101
102
103 104
FL4-H:: Annexin APC FL4-H:: Annexin APC FL4-H:: Annexin APC
RU-38486
104
7.22 8.07
FL3-H:: 7-AAD

3
10

102

101

82.28 2.43
100
0 1 2 3
10 10 10 10 104
FL4-H:: Annexin APC
(a)

80

##
Apoptosis rate (%)

60

40 ∗∗
## ∗∗
## ∗
20 ∗∗∗∗ ∗∗
∗∗ ∗∗
∗∗∗∗∗∗∗∗
0
Early Later Total

Control Medium
CSF High
Cort RU-38486
Low
(b)

Figure 3: The effect of XYS on cell apoptosis using flow cytometry detection. (a) The effect of XYS on cell apoptosis using flow cytometry
detection. (b) Data analysis of the effect of XYS on cell apoptosis (𝑛 = 3; ## 𝑃 < 0.01 versus CSF; ∗ 𝑃 < 0.05 versus Cort; ∗∗ 𝑃 < 0.01 versus
Cort).
8 Evidence-Based Complementary and Alternative Medicine
Control CSF Cort
GR
DAPI
Merge
Figure 4: Immunofluorescence of GR nuclear transfer in PHN cells. FITC-labeled secondary antibodies were used (green fluorescence), and
nuclei were stained by DAPI (400x magnification).
of GR (green fluorescence) has no significant difference
between CSF and Control group (𝑃 > 0.05). However, it
was increased after corticosterone injury compared to CSF
group. Compared with Cort treated group, XYS and RU-
38486 decreased the nuclear translocation of GR, and there
was no significant difference between the high dose of XYS
and RU-38486.
3.5. The Effects of XYS on Caveolin-1, GR, BDNF, TrkB, FKBP4,
and FKBP51 mRNA Levels In Vitro. As shown in Figures
5(a)–5(f), the results of quantitative real-time PCR assay
revealed that Caveolin-1, GR, BDNF, TrkB, and FKBP4
mRNA levels were significantly decreased and the FKBP51
mRNA level was markedly increased in corticosterone treated
hippocampal neurons compared to CSF treated cells. How-
ever, there was no significant difference of the effects pro-
duced by CSF and control vehicle (𝑃 > 0.05). Furthermore, in
XYS and RU-38486 group, the Caveolin-1, GR, BDNF, TrkB,
and FKBP4 mRNA levels were significantly increased, and
the FKBP51 mRNA level was notably decreased compared to
Cort group. There was no significant difference of the effects
produced by high dose of XYS and RU-38486 (𝑃 < 0.05).
3.6. The Effects of XYS on Caveolin-1, GR, BDNF, TrkB, FKBP4,
and FKBP51 Protein Levels. As shown in Figures 6(a)–6(f),
the Western blotting results revealed that the protein levels
of Caveolin-1, GR, BDNF, TrkB, and FKBP4 were notably
downregulated, and the FKBP51 protein expression was
significantly upregulated after treatment with corticosterone
in hippocampal neurons when compared with the CSF group.
Furthermore, there was no significant difference of the effects
produced by CSF and control vehicle (𝑃 > 0.05). However,
compared to the Cort group, the protein levels of Caveolin-
1, GR, BDNF, TrkB, FKBP4, and FKBP51 were reversed by
XYS and RU-38486. Furthermore, there was no significant
difference of the effects produced by high dose of XYS and
RU-38486 (𝑃 < 0.05).
Low Medium High RU-38486
3.7. The Effects of FKBP4 and FKBP51 against GR and GRE
Transcriptional Activity. Notably, a new slow-migrating band
was observed by the EMSA, suggesting that FKBP4-GR
DNA complexes were present in the reaction (Figure 7(a)).
However, as shown in Figure 7(b), the single band indi-
cated that FKBP51 could not combine with GR DNA. As
shown in Figure 7(c), FKBP4 could notably increase the
GRE transcriptional activity in a dose-dependent manner
(𝑃 < 0.05 or 𝑃 < 0.01). Furthermore, the result of Dual-
Luciferase Reporter Assay suggested that FKBP51 signif-
icantly decreased the GRE transcriptional activity when
compared with FKBP4 for the same concentration (𝑃 < 0.01)
(Figure 7(d)).
3.8. The Effects of XYS on Caveolin-1, GR, BDNF, TrkB, FKBP4,
and FKBP51 mRNA Levels In Vivo. As shown in Figures 8(a)–
8(f), the results of quantitative real-time PCR assay revealed
that Caveolin-1, GR, BDNF, TrkB, and FKBP4 mRNA levels
were significantly decreased and the FKBP51 mRNA level
was markedly increased in Cort treated rats compared to
control rats. In addition, XYS significantly upregulated the
Caveolin-1, GR, BDNF, TrkB, and FKBP4 mRNA levels and
downregulated the FKBP51 mRNA level compared to Cort
group. There was no significant difference of the effects
produced by high dose of XYS and RU-38486 (𝑃 < 0.05).
4. Discussion
A number of neurodegenerative and neurodevelopmental
diseases involving cognitive injuries are probably linked to
hippocampal dysfunction, also leading to dysregulation of
neurogenesis [25, 27]. Plenty of researches about hippocam-
pal dysfunction have been carried out in recent decades,
but the pathogenesis of hippocampal dysfunction has not
been fully clarified, and few medicines are available. Previous
research has shown that stress is an integral part of the
pathogenesis of hippocampal dysfunction [28]. Briefly, stress
Evidence-Based Complementary and Alternative Medicine 9

Caveolin-1 GR
1.2 1.5
∗∗ ∗∗ ∗∗

Relative mRNA expression

Relative mRNA expression

0.9 ∗∗
∗∗ 1.0
∗∗
0.6
∗
0.5
0.3 ##
##

0.0 0.0
Control

CSF

Cort

Medium

High

RU-38486

Control

CSF

Cort

Medium

High

RU-38486
Low

Low
(a) (b)

1.5 BDNF 1.2 TrkB

∗∗
Relative mRNA expression

Relative mRNA expression

∗∗
∗∗
∗∗
1.0 0.8
∗∗
##
0.5 0.4
##

0.0 0.0
Control

CSF

Cort

Medium

High

RU-38486

Control

CSF

Cort

Medium

High

RU-38486
Low

Low
(c) (d)

1.2 FKBP4 ∗∗ 3.5 FKBP51

∗∗
Relative mRNA expression

Relative mRNA expression

##
2.8
∗∗
0.8
2.1
∗∗ ∗∗
1.4 ∗∗
∗∗
0.4
##
0.7

0.0 0.0
Control

CSF

Cort

Medium

High

RU-38486

Control

CSF

Cort

Medium

High

RU-38486
Low

Low

(e) (f)
Figure 5: The effects of XYS on the gene levels of Caveolin-1 (a), GR (b), BDNF (c), TrkB (d), FKBP4 (e), and FKBP51 (f) in PHN cells after
corticosterone-induced stress injury (𝑛 = 3; ## 𝑃 < 0.01 versus CSF; ∗ 𝑃 < 0.05 versus Cort; ∗∗ 𝑃 < 0.01 versus Cort).

triggers important neuroendocrine responses including the In this paper, we used different concentrations of cor-
rapid activation of HPA axis and sympathoadrenal system, ticosterone to pretreat PHN cells to mimic stress-induced
which leads to the release of catecholamines, adrenocorti- damage and found that the IC50 of corticosterone was
cotropic hormone, and glucocorticoids [29]. Moreover, hip- 223 𝜇mol/L. There is accumulating evidence that corticos-
pocampal dysfunction is induced by glucocorticoids, which terone could induce the apoptosis of PHN cells. XYS is a Chi-
are negatively regulated via GR [30]. GR especially plays an nese herbal formula that has been widely used to treat mental
important role in the process of corticosteroids induced stress disorders for thousands of years in China, and we found
[28]. Therefore, the decreasing of stress through upregulation that XYS mainly included paeoniflorin, liquiritin, ferulic acid,
of GRs represents a potential therapeutic approach to allevi- and glycyrrhizic acid by the HPLC analysis. Further studies
ating hippocampal dysfunction. proved that treatment of XYS presented neuroprotective
 10

Relative protein expression Relative protein expression

Relative protein expression

0.0
0.4
0.8
1.2
1.6

0.0
0.4
0.8
1.2
GAPDH
BDNF

GAPDH
FKBP4
0.0
0.4
0.8
1.2
GAPDH
Caveolin-1

Control Control Control Control Control Control

CSF CSF CSF CSF CSF CSF

Cort

##

##
Cort Cort Cort Cort

##
Cort

(c)
(a)

(e)
Low Low

∗∗
Low Low Low Low

Medium Medium

∗∗
Medium Medium Medium
∗∗

Medium

High High

∗∗

∗∗
High High High
∗∗

High

RU-38486 RU-38486

∗∗

∗∗
RU-38486 RU-38486 RU-38486
∗∗

RU-38486

Relative protein expression Relative protein expression

Relative protein expression

0
1
2
3
0.0
0.4
0.8
1.2
0.0
0.4
0.8
1.2

GAPDH
TrkB

GAPDH
FKBP51
GR
GAPDH

Control Control Control Control Control Control

CSF CSF CSF CSF CSF CSF

Cort

##
Cort Cort

##
Cort Cort Cort
##

(f)
(d)
(b)

∗
Low Low Low ∗∗ Low Low
∗∗

Low

Medium Medium

∗∗
∗∗

Medium Medium Medium

∗∗

Medium

High High
∗∗

∗∗
High High High
∗∗

High

after corticosterone-induced stress injury (𝑛 = 3, ## 𝑃 < 0.01 versus CSF; ∗ 𝑃 < 0.05 versus Cort; ∗∗ 𝑃 < 0.01 versus Cort).
RU-38486

∗∗
RU-38486
∗∗

RU-38486 RU-38486
∗∗

RU-38486 RU-38486

Figure 6: The effects of XYS on the protein levels of Caveolin-1 (a), GR (b), BDNF (c), TrkB (d), FKBP4 (e), and FKBP51 (f) in PHN cells
Evidence-Based Complementary and Alternative Medicine
Evidence-Based Complementary and Alternative Medicine
FKBP4
GR
(a)
120
90
Stimulation (%)
60 ∗∗
∗ ∗∗
30
0 0
0.00 0.25 0.50 1.00
FKBP4 (𝜇g)
(c)
Figure 7: The bonding abilities of GR with FKBP4 (a) and FKBP51 (b) and the effects of FKBP4 (c) and FKBP51 (d) on GRE transcriptional
activity (𝑛 = 3, ∗ 𝑃 < 0.05 versus FKBP4 or FKBP51 = 0 𝜇g, ∗∗ 𝑃 < 0.01 versus FKBP4 or FKBP51 = 40 𝜇g).
effects against corticosterone-induced insult in PHN cells,
which was confirmed by morphological observation and
MTT assay, as well as the MAP-2 staining that is known to
promote the extension of the dendritic tree and the plasticity
of neuronal morphogenesis [31].
Furthermore, the present study demonstrated that cor-
ticosterone resulted in reduction of survival rate of PHN
cells; however XYS and RU-38486 reversed this change. Cell
cycle is a close mechanism that controls cell reproduction
and proliferation. It is representatively divided into several
phases: the periods associated with DNA synthesis phase (S
phase) and mitosis phase (M phase) that are separated by
gaps called G1 and G2 phases [32, 33]. In addition, the cells at
G0 phase do not proliferate temporarily. The results showed
that XYS decreased the cells at G0/G1 and G2/M phases and
increased the cells at S phase, which indicated that XYS raised
the DNA synthesis of PHN cells. Furthermore, we found that
XYS decreased the rate of apoptotic cells by flow cytometry
analysis. Our results showed that XYS exhibited potent ability
to improve stress injury.
Increased corticosterone level is a hallmark of HPA axis
feedback inhibition, which is mediated by GR in the brain
[34]. The inhibition of BDNF-TrkB signaling pathway is asso-
ciated with memory impairment in corticosterone treatment
animals [35]. Caveolin-1 is localised to the growth cones and
dendrites of hippocampal neurons and it promotes neuronal
differentiation and maturation [36]. FK506 binding protein of
molecular weight 51 (FKBP51) and the related protein FKBP4
are thought to be involved in the regulation of GR signaling
[37]. Our results showed that corticosterone resulted in the
downregulation of Caveolin-1, which was reversed by XYS.
11
FKBP51
GR
(b)
120
∗∗
90
∗∗
Stimulation (%)
∗∗
60
∗∗
30 ∗∗
∗∗
2.00 3.00 0.00 0.25 0.50 1.00 2.00 3.00
FKBP51 (𝜇g)
(d)
GR, the steroid-activated nuclear receptor, translocates to the
nucleus to bind its target DNA sequences when it is triggered,
and it is a positive or negative transcription factor to mediate
mRNA production of genes related to neuronal plasticity,
activation, and metabolism [34, 36]. BDNF is a neurotrophic
factor playing an important role in the central nervous system
(CNS) and can prevent neuronal cells death induced by
corticosterone stress [37]. In this study, we demonstrated that
the underlying mechanism of XYS against corticosterone-
induced stress in the PHN cells involved the upregulation of
the BDNF-TrkB pathway [35].
The FK506 binding proteins (FKBPs) are members of
a large superfamily of peptidyl-prolyl isomerases (PPIases)
[38, 39]. Particularly, FKBP4 and FKBP51 that possess C-
terminal tetratricopeptide repeat (TPR) domains can bind to
GR [40, 41], and they play key roles in regulating the activities
of transient receptor potential channels and cell microtubule
function [41]. In our work, we found that GR DNA could
bind with FKBP4 instead of FKBP51 by EMSA. Moreover,
the results of Dual-Luciferase Reporter Assay indicated that
FKBP4 notably increased the GRE transcriptional activity
but FKBP51 significantly decreased the GRE transcriptional
activity. XYS upregulated the FKBP4 mRNA and protein
levels and downregulated the FKBP51 mRNA and protein
levels. These results proved that XYS promoted the GRE
transcriptional activity.
In summary, XYS conferred direct protective effects on
the corticosterone-induced PHN cells by promoting the
GRE transcriptional activity and the subsequent BDNF-TrkB
pathway in vitro. Accordingly, XYS represents a novel and
potent candidate that should be developed as one potent
12 Evidence-Based Complementary and Alternative Medicine

Caveolin-1 GR
2.1 2.0

Relative mRNA expression

Relative mRNA expression

1.6 ∗∗
∗
1.4 ∗ ∗∗
# ∗
1.2
##
0.8
0.7
0.4

0.0 0.0
Control

Cort

Medium

High

RU-38486

Control

Cort

Medium

High

RU-38486
Low

Low
(a) (b)
BDNF TrkB
1.8 2.0
Relative mRNA expression

Relative mRNA expression

∗∗
∗∗ 1.5 ∗∗
1.2 ∗∗
∗∗ ∗∗
∗ 1.0

0.6 ## ##
0.5

0.0 0.0
Control

Cort

Medium

High

RU-38486

Control

Cort

Medium

High

RU-38486
Low

Low
(c) (d)
FKBP4 FKBP51
1.8 1.6
##
Relative mRNA expression

Relative mRNA expression

∗∗
∗∗ 1.2
1.2 ∗∗ ∗∗

0.8
∗∗ ∗∗
0.6 ##
0.4

0.0 0.0
Control

Cort

Medium

High

RU-38486

Control

Cort

Medium

High

RU-38486
Low

Low

(e) (f)
Figure 8: The effects of XYS on the gene levels of Caveolin-1 (a), GR (b), BDNF (c), TrkB (d), FKBP4 (e), and FKBP51 (f) in brain tissue of
rats after corticosterone-induced stress injury (𝑛 = 3; ## 𝑃 < 0.01 versus Control; ∗ 𝑃 < 0.05 versus Cort; ∗∗ 𝑃 < 0.01 versus Cort).

candidate for the treatment of hippocampal dysfunction. Of EMSA: Electrophoretic mobility shift assay
course, further investigations are needed to investigate the GRE: GR reaction element
clinical applications of XYS. FKBP51: FK506 binding protein of molecular
weight 51
AD: Alzheimer’s disease
Abbreviations HPA: Hypothalamic-pituitary-adrenal
XYS: Xiao Yao San TCMs: Traditional Chinese medicines
PHN: Primary hippocampal neurons SGLFR: Shugan Lifei Recipe
GR: Glucocorticoid receptor EPM: Elevated plus-maze
BDNF: Brain derived neurotrophic factor FBS: Fetal bovine serum
Evidence-Based Complementary and Alternative Medicine
DMEM: Dulbecco’s minimum essential medium
BCA: Bicinchoninic acid
MTT: Corticosterone, 3-(4,5-dimethylthiazol-
2-yl)-2,5-diphenyl tetrazolium
bromide
DAPI: 4,6-Diamidino-2-phenylindole
MAP-2: Microtubule-associated protein 2
CSF: Cerebrospinal fluid
HPLC: High performance liquid
chromatography
SD: Sprague-Dawley
Cort: Corticosterone
CNS: Central nervous system
PMSF: Phenylmethylsulfonyl fluoride
ECL: Chemiluminescence.
Additional Points
Availability of Data and Materials. Information on the per-
formance of antibodies for immunofluorescent staining and
Western blot was deposited in the open access database
abcam (http://www.abm.cn/). The datasets were processed by
the software GraphPad Prism 6 and Adobe Photoshop CS5.
Competing Interests
The authors declare that there is no conflict of interests
regarding the publication of this paper.
Authors’ Contributions
Guoping Cao and Wenjun Fu designed the study and the
experiments. Shenglan Gong carried out the PCR. Fengxue
Zhang and Wenjun Fu participated in the statistical analysis.
Guoping Cao and Wenjun Fu drafted the manuscript. All
authors read and approved the final manuscript.
Acknowledgments
This study is supported by National Natural Science Foun-
dation of China (no. 81403304) and Science and Tech-
nology Planning Project of Guangdong Province (no.
2014A020221075).
References
[1] S. K. Tiwari, B. Seth, S. Agarwal et al., “Ethosuximide induces
hippocampal neurogenesis and reverses cognitive deficits in an
amyloid-𝛽 toxin-induced Alzheimer rat model via the phos-
phatidylinositol 3-kinase (PI3K)/Akt/Wnt/𝛽-catenin pathway,”
Journal of Biological Chemistry, vol. 290, no. 47, pp. 28540–
28558, 2015.
[2] C.-Y. Tsai, C.-Y. Tsai, S. J. Arnold, and G.-J. Huang, “Ablation
of hippocampal neurogenesis in mice impairs the response to
stress during the dark cycle,” Nature Communications, vol. 6,
article 8373, 2015.
[3] Y. Yang, M. Zhang, X. Kang et al., “Thrombin-induced microgl-
ial activation impairs hippocampal neurogenesis and spatial
13
memory ability in mice,” Behavioral and Brain Functions, vol.
11, no. 1, article 30, 2015.
[4] L. D. LaDage, “Environmental change, the stress response, and
neurogenesis,” Integrative and Comparative Biology, vol. 55, no.
3, pp. 373–383, 2015.
[5] D. Suri and V. A. Vaidya, “The adaptive and maladaptive contin-
uum of stress responses—a hippocampal perspective,” Reviews
in the Neurosciences, vol. 26, no. 4, pp. 415–442, 2015.
[6] S. H. Takada, L. C. Motta-Teixeira, A. V. Machado-Nils et al.,
“Impact of neonatal anoxia on adult rat hippocampal volume,
neurogenesis and behavior,” Behavioural Brain Research, vol.
296, pp. 331–338, 2016.
[7] E. Okun, K. Griffioen, B. Barak et al., “Toll-like receptor 3
inhibits memory retention and constrains adult hippocampal
neurogenesis,” Proceedings of the National Academy of Sciences
of the United States of America, vol. 107, no. 35, pp. 15625–15630,
2010.
[8] H. Xiong and H. J. Krugers, “Tuning hippocampal synapses by
stress-hormones: relevance for emotional memory formation,”
Brain Research, vol. 1621, pp. 114–120, 2015.
[9] T. Kino, “Stress, glucocorticoid hormones, and hippocampal
neural progenitor cells: implications to mood disorders,” Fron-
tiers in Physiology, vol. 6, article 230, 2015.
[10] Y. Izumi, K. A. O’Dell, and C. F. Zorumski, “Corticosterone
enhances the potency of ethanol against hippocampal long-
term potentiation via local neurosteroid synthesis,” Frontiers in
Cellular Neuroscience, vol. 9, article 254, 2015.
[11] D.-J. Saaltink and E. Vreugdenhil, “Stress, glucocorticoid recep-
tors, and adult neurogenesis: a balance between excitation and
inhibition?” Cellular and Molecular Life Sciences, vol. 71, no. 13,
pp. 2499–2515, 2014.
[12] S. Chetty, A. R. Friedman, K. Taravosh-Lahn et al., “Stress and
glucocorticoids promote oligodendrogenesis in the adult hip-
pocampus,” Molecular Psychiatry, vol. 19, no. 12, pp. 1275–1283,
2014.
[13] I. Zalachoras, R. Houtman, E. Atucha et al., “Differential tar-
geting of brain stress circuits with a selective glucocorticoid
receptor modulator,” Proceedings of the National Academy of
Sciences of the United States of America, vol. 110, no. 19, pp. 7910–
7915, 2013.
[14] T. B. Santos, I. C. Céspedes, and M. B. Viana, “Chronic corti-
costerone administration facilitates aversive memory retrieval
and increases GR/NOS immunoreactivity,” Behavioural Brain
Research, vol. 267, pp. 46–54, 2014.
[15] D. Normile, “Asian medicine. The new face of traditional Chi-
nese medicine,” Science, vol. 299, no. 5604, pp. 188–190, 2003.
[16] B. Lee, B. Sur, I. Shim, H. Lee, and D.-H. Hahm, “Baicalin im-
proves chronic corticosterone-induced learning and memory
deficits via the enhancement of impaired hippocampal brain-
derived neurotrophic factor and cAMP response element-
binding protein expression in the rat,” Journal of Natural
Medicines, vol. 68, no. 1, pp. 132–143, 2014.
[17] X. Wu, J. Wu, S. Xia, B. Li, and J. Dong, “Icaritin opposes the
development of social aversion after defeat stress via increases
of GR mRNA and BDNF mRNA in mice,” Behavioural Brain
Research, vol. 256, pp. 602–608, 2013.
[18] H. Zhang, B. Liu, J. Wu et al., “Icariin inhibits corticosterone-
induced apoptosis in hypothalamic neurons via the PI3-K/Akt
signaling pathway,” Molecular Medicine Reports, vol. 6, no. 5, pp.
967–972, 2012.
14 Evidence-Based Complementary and Alternative Medicine

[19] P.-W. Zhuang, G.-Z. Cui, Y.-J. Zhang et al., “Baicalin regu- DNA damage and activating mitochondrial signal pathway,”
lates neuronal fate decision in neural stem/progenitor cells Food and Chemical Toxicology, vol. 59, pp. 118–128, 2013.
and stimulates hippocampal neurogenesis in adult rats,” CNS [34] Z.-J. Wang, X.-Q. Zhang, X.-Y. Cui et al., “Glucocorticoid re-
Neuroscience and Therapeutics, vol. 19, no. 3, pp. 154–162, 2013. ceptors in the locus coeruleus mediate sleep disorders caused
[20] Y. Tong, N.-X. Zhang, H.-J. Chen, and L.-Q. Ni, “Protective and by repeated corticosterone treatment,” Scientific Reports, vol. 5,
therapeutic effects of Shugan Lifei Recipe on rats with asthma article 9442, 2015.
under stress and the mechanisms,” Zhong Xi Yi Jie He Xue Bao, [35] H.-J. Wei, J.-H. Xu, M.-H. Li et al., “Hydrogen sulfide inhibits
vol. 3, no. 5, pp. 391–396, 2005. homocysteine-induced endoplasmic reticulum stress and neu-
[21] Y. Zhang, M. Han, Z. Liu, J. Wang, Q. He, and J. Liu, “Chinese ronal apoptosis in rat hippocampus via upregulation of the
herbal formula Xiao Yao San for treatment of depression: a BDNF-TrkB pathway,” Acta Pharmacologica Sinica, vol. 35, no.
systematic review of randomized controlled trials,” Evidence- 6, pp. 707–715, 2014.
Based Complementary and Alternative Medicine, vol. 2012, [36] Y. Li, W.-M. Lau, K.-F. So, Y. Tong, and J. Shen, “Caveolin-
Article ID 931636, 13 pages, 2012. 1 inhibits oligodendroglial differentiation of neural stem/pro-
[22] J.-X. Chen, W. Li, X. Zhao, and J.-X. Yang, “Effects of the genitor cells through modulating 𝛽-catenin expression,” Neuro-
Chinese traditional prescription Xiaoyaosan decoction on chemistry International, vol. 59, no. 2, pp. 114–121, 2011.
chronic immobilization stress-induced changes in behavior and [37] Z.-H. Zhu, R. Yang, X. Fu, Y.-Q. Wang, and G.-C. Wu, “Astro-
brain BDNF, TrkB, and NT-3 in rats,” Cellular and Molecular cyte-conditioned medium protecting hippocampal neurons in
Neurobiology, vol. 28, no. 5, pp. 745–755, 2008. primary cultures against corticosterone-induced damages via
[23] X.-F. Ding, X.-H. Zhao, Y. Tao et al., “Xiao yao san improves PI3-K/Akt signal pathway,” Brain Research, vol. 1114, no. 1, pp.
depressive-like behaviors in rats with chronic immobilization 1–10, 2006.
stress through modulation of locus coeruleus-norepinephrine [38] P. Chmielarz, G. Kreiner, M. Kot et al., “Disruption of gluco-
system,” Evidence-Based Complementary and Alternative corticoid receptors in the noradrenergic system leads to BDNF
Medicine, vol. 2014, Article ID 605914, 10 pages, 2014. up-regulation and altered serotonergic transmission associated
[24] X. Zhu, O. Xia, W. Han et al., “Xiao Yao San improves with a depressive-like phenotype in female GR(DBHCre) mice,”
depressive-like behavior in rats through modulation of 𝛽- Pharmacology Biochemistry and Behavior, vol. 137, pp. 69–77,
arrestin 2-mediated pathways in hippocampus,” Evidence-Based 2015.
Complementary and Alternative Medicine, vol. 2014, Article ID [39] A. Galat, “Functional drift of sequence attributes in the FK506-
902516, 13 pages, 2014. binding proteins (FKBPs),” Journal of Chemical Information and
[25] S.-Y. Yau, A. Li, and K.-F. So, “Involvement of adult hippocam- Modeling, vol. 48, no. 5, pp. 1118–1130, 2008.
pal neurogenesis in learning and forgetting,” Neural Plasticity, [40] J. G. Scammell, T. R. Hubler, W. B. Denny, and D. L. Valentine,
vol. 2015, Article ID 717958, 13 pages, 2015. “Organization of the human FK506-binding immunophilin
[26] L. Xiang, Y. Ren, H. Cai, W. Zhao, and Y. Song, “MicroRNA- FKBP52 protein gene (FKBP4),” Genomics, vol. 81, no. 6, pp.
132 aggravates epileptiform discharges via suppression of 640–643, 2003.
BDNF/TrkB signaling in cultured hippocampal neurons,” Brain [41] D. L. Cioffi, T. R. Hubler, and J. G. Scammell, “Organization and
Research, vol. 1622, pp. 484–495, 2015. function of the FKBP52 and FKBP51 genes,” Current Opinion in
[27] E. J. Kim, B. Pellman, and J. J. Kim, “Stress effects on the hip- Pharmacology, vol. 11, no. 4, pp. 308–313, 2011.
pocampus: a critical review,” Learning and Memory, vol. 22, no.
9, pp. 411–416, 2015.
[28] S. Paul, W. K. Jeon, J. L. Bizon, and J.-S. Han, “Interaction of
basal forebrain cholinergic neurons with the glucocorticoid
system in stress regulation and cognitive impairment,” Frontiers
in Aging Neuroscience, vol. 7, article 43, 2015.
[29] Y. Xu, B. Ku, L. Tie et al., “Curcumin reverses the effects of
chronic stress on behavior, the HPA axis, BDNF expression and
phosphorylation of CREB,” Brain Research, vol. 1122, no. 1, pp.
56–64, 2006.
[30] T. Kino and G. P. Chrousos, “Glucocorticoid and mineralocor-
ticoid receptors and associated diseases,” Essays in Biochemistry,
vol. 40, pp. 137–155, 2004.
[31] M. Buddle, E. Eberhardt, L. H. Ciminello et al., “Microtubule-
associated protein 2 (MAP2) associates with the NMDA
receptor and is spatially redistributed within rat hippocampal
neurons after oxygen-glucose deprivation,” Brain Research, vol.
978, no. 1-2, pp. 38–50, 2003.
[32] L. Lv, L. Zheng, D. Dong et al., “Dioscin, a natural steroid
saponin, induces apoptosis and DNA damage through reactive
oxygen species: a potential new drug for treatment of glioblas-
toma multiforme,” Food and Chemical Toxicology, vol. 59, pp.
657–669, 2013.
[33] Y. Wei, Y. Xu, X. Han et al., “Anti-cancer effects of dioscin on
three kinds of human lung cancer cell lines through inducing

The Scientific
World Journal
Hindawi Publishing Corporation
http://www.hindawi.com
Journal of
Immunology Research
Hindawi Publishing Corporation
http://www.hindawi.com
PPAR Research
Hindawi Publishing Corporation
http://www.hindawi.com
Journal of
Ophthalmology
Hindawi Publishing Corporation
http://www.hindawi.com
Computational and
Mathematical Methods
in Medicine
Hindawi Publishing Corporation
http://www.hindawi.com
MEDIATORS of
INFLAMMATION
Gastroenterology Journal of
Research and Practice
Hindawi Publishing Corporation
Hindawi Publishing Corporation
Diabetes Research
Hindawi Publishing Corporation
Disease Markers
Hindawi Publishing Corporation
http://www.hindawi.com Volume 2014
Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014
International Journal of
Endocrinology
Hindawi Publishing Corporation
Volume 2014 http://www.hindawi.com Volume 2014
Submit your manuscripts at
http://www.hindawi.com
BioMed
Research International
Hindawi Publishing Corporation
Volume 2014 http://www.hindawi.com Volume 2014
Journal of
Obesity
Evidence-Based
Stem Cells Complementary and Journal of
International
Hindawi Publishing Corporation
Alternative Medicine
Hindawi Publishing Corporation Hindawi Publishing Corporation
Oncology
Hindawi Publishing Corporation
Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014
Parkinson’s
Disease
Behavioural
Neurology
AIDS
Research and Treatment
Oxidative Medicine and
Cellular Longevity
Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation
Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014