Molecular Basis of Inheritance

Active site edutech- 9844532971
BIOLOGY 51
Percentage of Questions in Last 34 Years’ in NEET / AIPMT from this Chapter
WHAT DO YOU WANT TO KNOW 6.6 GENETIC CODE

6.6.1 Mutations and Genetic Code
6.0 INTRODUCTION 6.6.2 t-RNA - the Adapter Molecule
6.1 THE DNA 6.7 TRANSLATION
6.1.1 Structure of Polynucleotide Chain
6.8 REGULATION OF GENE EXPRESSION
6.1.2 Packaging of DNA Helix
6.8.1 The Lac Operon
6.2 THE SEARCH FOR GENETIC MATERIAL
6.9 HUMAN GENOME PROJECT
6.2.1 The Genetic Material is DNA
6.9.1 Salient Features of Human Genome
6.2.2 Properties of Genetic Material (DNA versus
RNA) 6.9.2 Applications and Future Challenges
6.3 RNA WORLD 6.10 DNA FINGERPRINTING
6.4 REPLICATION 6.11 SYNOPSIS

6.4.1 The Experimental Proof 6.12 MISCELLANEOUS Questions from NCERT
6.2.2 The Mechinery and the Enzymes 6.13 NCERT Exemplar Questions
6.5 TRANSCRIPTION 6.14 ASSERTION-REASON and STATEMENT
Based Questions from NCERT
6.5.1 Transcription Unit
6.5.2 Transcription Unit and the Gene 6.15 MATRIX TYPE QUESTIONS
6.5.3 Types of RNA and the processs of 6.16 ARCHIVE QUESTIONS
Transcription 6.17 ANSWER KEY
52 Molecular Basis of Inheritance
6.0 INTRODUCTION NCERT P. No. 95-96
• At the time of Mendel, the nature of those ‘factors’ regulating the pattern of inheritance was not clear.
Over the next hundred years, the nature of the putative genetic material was investigated culminating in
the realisation that DNA-deoxyribonucleic acid - is the genetic material, at least for majority of organisms.
6.1 THE DNA NCERT P. No. 96-100
• Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are the two types of nucleic acids found in
living systems. DNA acts as the genetic material in most of the organisms.
• RNA though it also acts as a genetic material in some viruses, mostly functions as a messenger. RNA has
additional roles as well. It functions as adapter, structural, and in some cases as a catalytic molecule.
• T he most interesting molecule in the living system is the DNA. DNA is a long polymer of
deoxyribonucleotides.
• The length of DNA is usually defined as number of nucleotides (or a pair of nucleotide referred to as base
pairs) present in it. This also is the characteristic of an organism. For example, a bacteriophage known as
 × 174 has 5386 nucleotides, Bacteriophage lambda has 48502 base pairs (bp), Escherichia coli
has 4.6 × 106 bp, and haploid content of human DNA is 3.3 × 10 9 bp.
6.1.1 Structure of Polynucleotide Chain
• A nucleotide has three components – a nitrogenous base, a pentose sugar (ribose in case of RNA, and
deoxyribose for DNA), and a phosphate group.
• There are two types of nitrogenous bases – Purines (Adenine and Guanine), and Pyrimidines (Cytosine,
Uracil and Thymine). Cytosine is common for both DNA and RNA and Thymine is present in DNA.
Uracil is present in RNA at the place of Thymine.
• A nitrogenous base is linked to the OH of 1 C pentose sugar through a N-glycosidic linkage to form a
nucleoside, such as adenosine or deoxyadenosine, guanosine or deoxyguanosine, cytidine or deoxycytidine
and uridine or deoxythymidine.
• When a phosphate group is linked to OH of 5' C of a nucleoside through phosphoester linkage,
a corresponding nucleotide (or deoxynucleotide depending upon the type of sugar present) is formed.
• Two nucleotides are linked through 3'-5' phosphodiester linkage to form a dinucleotide.
• The phosphate group is attached to carbon 5' of the sugar of its own nucleotide and carbon 3' of sugar of
next nucleotide to form 3'-5' phosphodioster bond. During each ester bond formation - OH group of sugar
and - H of phosphate are eliminated as H2O.
Note • Phosphate group provide acidity to the nucleic acid (DNA or RNA).
• A solution of purified DNA will have acidic pH.
• More nucleotides can be joined in such a manner to form a polynucleotide chain.

• A polymer thus formed has at one end a free phosphate moiety at 5'-end of ribose sugar, which is
referred to as 5'-end of polynucleotide chain. Similarly, at the other end of the polymer the sugar has a
free 3'-OH group which is referred to as 3' – end of the polynucleotide chain.
BIOLOGY 53
• The backbone in a polynucleotide chain is formed due to sugar and phosphates. The nitrogenous bases
linked to sugar moiety project from the backbone.
• In RNA, every nucleotide residue has an additional –OH group present at 2'-position in the ribose. Also,
in RNA the uracil is found at the place of thymine (5-methyl uracil, another chemical name for thymine).
• DNA as an acidic substance present in nucleus was first identified by Friedrich Meischer in 1869. He
named it as ‘Nuclein’. However, due to technical limitation in isolating such a long polymer intact, the
elucidation of structure of DNA remained elusive for a very long period of time.
• It was only in 1953 that James Watson and Francis Crick, based
on the X-ray diffraction data produced by Maurice Wilkins and
Rosalind Franklin, proposed a very simple but famous Double Helix
model for the structure of DNA (B-DNA). For this Watson, Crick
and Wilkins awarded the Nobel Prize in 1962.
• One of the hallmarks of their proposition was base pairing between
the two strands of polynucleotide chains. However, this proposition
was also based on the observation of Erwin Chargaff that for a
double stranded DNA, the ratios between Adenine and Thymine and
Guanine and Cytosine are constant and equals one.
• Chargaff’s rule is not applicable to RNA or ss-DNA. (Q 2015)
• The base pairing confers a very unique property to the polynucleotide chains. They are said to be
complementary to each other, and therefore if the sequence of bases in one strand is known then the
sequence in other strand can be predicted.
• Also, if each strand from a DNA (let us call it as a parental

DNA) acts as a template for synthesis of a new strand, the
two double stranded DNA (let us call them as daughter DNA)
thus, produced would be identical to the parental DNA
molecule.
• Because of this, the genetic implications of the structure of
DNA became very clear. The salient features of the Double-
helix structure of DNA are as follows:
(i) It is made of two polynucleotide chains, where the
backbone is constituted by sugar-phosphate, and the bases
project inside.
(ii) The two chains have anti-parallel polarity. It means, if
one chain has the polarity 5'  3', the other has 3'  5'.
DNA strands are antiparallel becuase of H-bonds.
(iii) The bases in two strands are paired through hydrogen bond (H-bonds) forming base pairs (bp). Adenine
forms two hydrogen bonds with Thymine from opposite strand and vice-versa.
 Similarly, Guanine is bonded with Cytosine with three H-bonds. As a result, always a purine
comes opposite to a pyrimidine. This generates approximately uniform distance between the two
strands of the helix.
BIOLOGY 55
(iv) The two chains are coiled in a right-handed fashion. The pitch of the
helix is 3.4 nm (a nanometre is one billionth of a metre, that is 10–9 m)
and there are roughly 10 bp in each turn. Consequently, the distance
between a bp in a helix is approximately equal to 0.34 nm.
 A-DNA, B-DNA, C-DNA and D-DNA have right handed helix with
11, 10, 9 and 8 base pairs per turn respectively. Z-DNA has left
handed helx with 12 base pairs per turn.
(v) The plane of one base pair stacks over the other in double helix. This,
in addition to H-bonds, confers stability of the helical structure.
(vi) Diameter of DNA helix is 20 Å.
• The proposition of a double helix structure for DNA and its simplicity in
explaining the genetic implication became revolutionary. Very soon,
Francis Crick proposed the Central dogma in molecular biology, which
states that the genetic information flows from DNA  RNA  Protein.
• In some viruses the flow of information is in reverse direction, that is, from RNA to c-DNA. The c-DNA
(complementary DNA) is ssDNA produced from template mRNA. This process is called reverse
transcription.
Note • Reverse transcription (Teminism) was discovered by Temin and Baltimore. Teminism is
seen in HIV and rous sarcoma virus.
4. Purines of DNA are represented by

Daily Practice Problem (DPP-01) (1) Uracil and thymine (2) Guanine and adenine
NCERT P. No. 95-100 (3) Uracil and cytocine (4) Thymine and cytocine
5. The salient feature of DNA are
1. Select the statement that is correctly relatable with DNA.
(i) It is made of two polynucleotide chain
(1) Double helical structure in which two strands of
(ii) Back bone is constituted by sugar and nitrogen base
polynucleotide runs parallel to each other.
(iii) Two chain have parallel polarity
(2) The chief bond to hold the monomeric units together
(iv) Bases in two strands are paired through H-bonds
is the H-bonds.
(v) The two chain are coiled in a left handed fashion
(3) N -bases projected more or less perpendicular to
(1) i, iv, v (2) i, iv
back bone and faces inside.
(3) i, ii, v (4) i, ii, iii, iv, v.
(4) DNA is a homopolymer of nucleosides.
6. The double helix model of Watson and Crick is known
2. Find the incorrect statement: as
(1) N-glycosidic linkage between nitrogenous base and (1) C-DNA (2) B-DNA
sugar forms a nucleotide. (3) Z-DNA (4) D-DNA
(2) 5-methyl uracil is present in DNA 7. DNA is double helix and
(3) In RNA, every nucleotide residue has additional – (1) Complementary and parallel
OH group (2) Complementary and antiparallel
(4) The ratio of A + T/G + C is variable (3) Without super coils
3. Which of the following is not correct (4) Always circular
8. In a given DNA segment the number of nucleotides of
(1) A/T = 1
guanine is 75 and those of thymine is 75. The total num-
(2) A + T = G + C ber of nucleotides in the segment will be
(3) A + G = C + T (1) 75 (2) 750
(4) None of these (3) 150 (4) 300
9. Which of the following is not found in DNA 10. A nucleoside differs from a nucleotide in not having
(1) Adenine (2) Cytosine (1) Phosphate (2) Sugar
(3) Uracil (4) Thymine (3) Nitrogen base (4) Phosphate and sugar.
6.1.2 Packaging of DNA Helix
• Taken the distance between two consecutive base pairs as 0.34 nm (0.34 × 10–9 m), if the length of DNA
double helix in a typical mammalian cell is calculated (simply by multiplying the total number of bp with
distance between two consecutive bp, that is, 6.6 × 109 bp × 0.34 × 10–9 m/bp), it comes out to be approximately
2.2 metres. A length that is far greater than the dimension of a typical nucleus (approximately 10 –6 m).
Total length
No. of base pair =
Length between two consecutive bases
Packaging in Prokaryotes
• In prokaryotes, such as, E. coli, though they do not have a defined nucleus, the DNA is not scattered
throughout the cell. DNA (being negatively charged) is held with some proteins (that have positive charges)
in a region termed as ‘nucleoid’.
• The DNA in nucleoid is organised in large loops held by proteins.
Packaging in Eukaryotes
• In eukaryotes, this organisation is much more complex. DNA is negatively charged due to phosphate
groups. There is a set of positively charged, basic proteins called histones.
EM picture - ‘Beads-on-string’
• A protein acquires charge depending upon the abundance of amino acids residues with charged side chains.
Histone proteins are of five types- H1, H2A, H2B, H3 and H4.
 Histones are rich in the basic amino acid residues lysines and arginines. Both the amino acid residues
carry positive charges in their side chains.
 Histones are organised to form a unit of eight molecules called as histone octamer. Histone octamer
or nu body is formed by two molecules of each H 2A, H2B, H3 and H4.
BIOLOGY 57
• The negatively charged DNA is wrapped around the positively charged histone octamer to form a structure
called nucleosome. A typical nucleosome contains 200 bp of DNA helix. DNA connecting two adjacent
nucleosome bear H1 histone protein.
• Nucleosomes constitute the repeating unit of a structure in nucleus called chromatin, thread-like stained
(coloured) bodies seen in nucleus. The nucleosomes in chromatin are seen as ‘beads-on-string’ structure
when viewed under electron microscope (EM).
• The beads-on-string structure in chromatin is packaged to form chromatin fibers that are further coiled
and condensed at metaphase stage of cell division to form chromosomes.
• The packaging of chromatin at higher level requires additional set of proteins that collectively are referred
to as non-histone chromosomal (NHC) proteins.
• In a typical nucleus, some region of chromatin are loosely packed (and stains light) and are referred to as
euchromatin. The chromatin that is more densely packed and stains dark are called as Heterochromatin.
• Euchromatin is said to be transcriptionally active chromatin, whereas heterochromatin is inactive.
• Correct sequence of organization of genetic material from smallest to largest is as

follows:
Nucleotide  Gene  Chromosome  Genome.
Brain Twister
15. Identify parts labelled A,B, and C in the given diagram

Daily Practice Problem (DPP-02) and select the correct option.
NCERT P. No. 96-100
11. Read the following statements and choose the correct option
a. Nitrogenous base is linked to the pentose sugar
through a N-glycosidic linkage
b. Phosphate group is linked to 5’-OH of a nucleoside
through phosphoester linkage
c. Two nucleosides are linked through 3’-5’ N-
glycosidic linkage
A B C
d. Negatively charged DNA is wrapped around positively Negatively Positively charged
(1) H1 Histone
charged histone octamer to form nucleosome charged DNA histone
e. The chromatin that is more densely packed and stains Negatively charged Positively charged
(2) H1 histone
DNA histone octamer
dark is called euchromatin Positively charged Negatively charged
(3) H1 histone
(1) a, b and c alone are wrong histone octamer DNA
(2) d alone is wrong Negatively charged Negatively charged
(4) H1 histone
histone octamer DNA
(3) c and e alone are wrong
16. Nucleosome consists of
(4) a alone is wrong.
(1) Nucleolus (2) Genes
12. The core of nucleosome is made up of
(3) Microfilaments (4) Histones and DNA
(1) H1, H2A, H2B, H3 (2) H1, H2A, H2B, H4
17. The packaging of chromatin at ahigher level requires an
(3) H1, H2A, H2B, H3, H4 (4) H2A, H2B, H3, H4 additionalset of proteins that collectively arereferred to as
13. The region of chromatin that is stained lightly is (1) Histones (2) NHC proteins
(1) Heterochromatin (3) Tubulin (4) Actin.
(2) Transcriptionally inactive region 18. Identify the correct pairing regarding the structure of
(3) Centromere heterochromatin.
(4) Transcriptionally active region. (1) Loosely packed; Stain light
14. Which amino acids are present in histones (2) Loosely packed; Stain dark
(1) Lysine and histidine (2) Valine and Histidine (3) Densely packed' Stain light
(3) Arginine and lysine (4) Arginine and histidine (4) Densely packed; Stain dark
19. The packaging of DNA at higher level requires 20. The eukaryotic chromosomes are made up of
(1) Five types of histones (1) DNA
(2) A histone octamer called nu body (2) RNA
(3) Non-histone chromosomal proteins (3) DNA, RNA and proteins
(4) Lysine and Arginine. (4) DNA and lipids
6.2 THE SEARCH FOR GENETIC MATERIAL NCERT P. No. 100-104
• Even though the discovery of nuclein by Meischer and the proposition for principles of inheritance by
Mendel were almost at the same time, but that the DNA acts as a genetic material took long to be discovered
and proven. By 1926, the quest to determine the mechanism for genetic inheritance had reached the
molecular level.
• Previous discoveries by Gregor Mendel, Walter Sutton, Thomas Hunt Morgan and numerous other
scientists had narrowed the search to the chromosomes located in the nucleus of most cells. But the
question of what molecule was actually the genetic material, had not been answered.
6.2.1 The Genetic Material is DNA
• In 1928, Frederick Griffith, in a series of experiments with Streptococcus pneumoniae (bacterium

responsible for pneumonia), witnessed a miraculous transformation in the bacteria. (NEET 2018)
• During the course of his experiment, a living organism (bacteria) had changed in physical form.
• When Streptococcus pneumoniae (pneumococcus) bacteria are grown on a culture plate, some produce
smooth shiny colonies (S) while others produce rough colonies (R). This is because the S strain bacteria
have a mucous (polysaccharide) coat, while R strain does not.
• Mice infected with the S strain (virulent) die from pneumonia infection but mice infected with the R
strain do not develop pneumonia.
S strain Inject into mice Mice die
R strain Inject into mice Mice live
• Griffith was able to kill bacteria by heating them. He observed that heat-killed S strain bacteria injected
into mice did not kill them.
S strain Inject into mice Mice live
(heat killed)
• When he injected a mixture of heat-killed S and live R bacteria, the mice died. Moreover, he recovered
living S bacteria from the dead mice.
S strain R strain
(live) Inject into mice Mice die
(heat killed) +
• He concluded that the R strain bacteria had somehow been transformed by the heat-killed S strain bacteria.
• Some ‘transforming principle’, transferred from the heat-killed S strain, had enabled the R strain to
synthesise a smooth polysaccharide coat and become virulent. This must be due to the transfer of the
genetic material. However, the biochemical nature of genetic material was not defined from his
experiments.
BIOLOGY 59
Biochemical Characterisation of Transforming Principle
• Prior to the work of Oswald Avery, Colin MacLeod and Maclyn McCarty (1933-1944), the genetic
material was thought to be a protein. They worked to determine the biochemical nature of ‘transforming
principle’ in Griffith’s experiment.
• They purified biochemicals (proteins, DNA, RNA, etc.) from the heat-killed S cells to see which ones
could transform live R cells into S cells. They discovered that DNA alone from S bacteria caused R
bacteria to become transformed.
• They also discovered that protein-digesting enzymes (proteases) and RNA-digesting enzymes (RNases)
did not affect transformation, so the transforming substance was not a protein or RNA.
• Digestion with DNase did inhibit transformation, suggesting that the DNA caused the transformation.
They concluded that DNA is the hereditary material, but not all biologists were convinced.
• DNAs are nucleic acid while DNase is enzyme (protein).
The Genetic Material is DNA
• The unequivocal proof that DNA is the genetic material came from the experiments of Alfred Hershey and
Martha Chase (1952). They worked with viruses that infect bacteria called bacteriophages (NEET 2018).
The bacteriophage attaches to the bacteria and its genetic material then enters the bacterial cell.
• The bacterial cell treats the viral genetic material as if it was its own and subsequently manufactures more
virus particles. Hershey and Chase worked to discover whether it was protein or DNA from the viruses
that entered the bacteria. They grew some viruses on a medium that contained radioactive phosphorus
and some others on medium that contained radioactive sulfur.
• Viruses grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive
protein because DNA contains phosphorus but protein does not.
• Similarly, viruses grown on radioactive

sulfur contained radioactive protein
but not radioactive DNA because DNA
does not contain sulfur.
• Radioactive phages were allowed to
attach to Escherichia coli bacteria.
Then, as the infection proceeded, the viral
coats were removed from the bacteria
by agitating them in a blender. The virus
par ticles wer e separ ated from the
bacteria by spinning them in a centrifuge.
• Bacter ia which was infected with
viruses that had radioactive DNA were
radioactive, indicating that DNA was
the material that passed from the
virus to the bacteria.
• Bacteria that were infected with viruses
that had radioactive proteins were not
radioactive. This indicates that proteins
did not enter the bacteria from the viruses. DNA is therefore the genetic material that is passed from
virus to bacteria.
6.2.2 Properties of Genetic Material (DNA versus RNA)
• From the foregoing discussion, it is clear that the debate between proteins versus DNA as the genetic
material was unequivocally resolved from Hershey-Chase experiment. It became an established fact that
it is DNA that acts as genetic material. However, it subsequently became clear that in some viruses, RNA
is the genetic material (for example, Tobacco Mosaic viruses, QB bacteriophage, etc.).
• Answer to some of the questions such as, why DNA is the predominant genetic material, whereas RNA
performs dynamic functions of messenger and adapter has to be found from the differences between
chemical structures of the two nucleic acid molecules.
• A molecule that can act as a genetic material must fulfill the following criteria :
(i) It should be able to generate its replica (Replication).
 Because of rule of base pairing and complementarity, both the nucleic acids (DNA and RNA)
have the ability to direct their duplications. The other molecules in the living system, such as
proteins fail to fulfill first criteria itself.
(ii) It should chemically and structurally be stable.
 The genetic material should be stable enough not to change with different stages of life cycle, age
or with change in physiology of the organism.
 Stability as one of the properties of genetic material was very evident in Griffith’s ‘transforming
principle’ itself that heat, which killed the bacteria, at least did not destroy some of the properties
of genetic material.
BIOLOGY 61
 This now can easily be explained in light of the DNA that the two strands being complementary if
separated by heating come together, when appropriate conditions are provided.
 Further, 2'-OH group present at every nucleotide in RNA is a reactive group and makes RNA
labile and easily degradable.
 RNA is also now known to be catalytic, hence reactive. Therefore, DNA chemically is less reactive
and structurally more stable when compared to RNA. Therefore, among the two nucleic acids, the
DNA is a better genetic material.
 In fact, the presence of thymine at the place of uracil also confers additional stability to DNA.
(iii) It should provide the scope for slow changes (mutation) that are required for evolution. Both DNA
and RNA are able to mutate. In fact, RNA being unstable, mutate at a faster rate. Consequently,
viruses having RNA genome and having shorter life span mutate and evolve faster.
(iv) It should be able to express itself in the form of ‘Mendelian Characters’.
 RNA can directly code for the synthesis of proteins, hence can easily express the characters.
DNA, however, is dependent on RNA for synthesis of proteins. The protein synthesising machinery
has evolved around RNA.
• The above discussion indicate that both RNA and DNA can function as genetic
material, but DNA being more stable is preferred for storage of genetic information.
For the transmission of genetic information, RNA is better.
Brain Booster
6.3 RNA WORLD NCERT P. No. 104
• RNA was the first genetic material. There is now enough evidence to suggest that essential life processes
(such as metabolism, translation, splicing, etc.), evolved around RNA.
• RNA used to act as a genetic material as well as a catalyst (there are some important biochemical reactions
in living systems that are catalysed by RNA catalysts and not by protein enzymes). But, RNA being a
catalyst was reactive and hence unstable. Therefore, DNA has evolved from RNA with chemical
modifications that make it more stable.
• DNA being double stranded and having complementary strand further resists changes by evolving a process
of repair.
22. The result of which of the following reaction experiments

Daily Practice Problem (DPP-03) carrid out by Avey et. on Streptococcus pneumoniae has
NCERT P. No. 100-104 proved conclusively that DNA is the genetic material ?
21. Which of these statements of comparison regarding (1) Live ‘R’ strain + DNA from ‘S’ strain + RN ase
DNA and RNA holds true? (2) Live ‘R’ strain + DNA from ‘S’ strain +DN ase
(1) DNA chemically is less reactive and structurally less (3) Live ‘R’ strain+Denatured DNA of ‘S’ strain+protease
stable when compared to RNA. (4) Heat killed ‘R’ strain+DNA from ‘S’ strain+DN ase.
(2) DNA chemically is more reactive and structurally 23. Select an incorrect statement regarding RNA molecule
less stable when compared to RNA.
(1) It has highly reactive 2'-OH group
(3) DNA chemically is less reactive and structurally
more stable when compared to RNA. (2) It shows high rate of mutation than DNA
(4) DNA chemically is more reactive and structurally (3) It is genetic material in some viruses
more stable when compared to RNA. (4) It follows Chargaff rule.
24. Pathogenicity of Pneumococcus in the transformation 28. Hershey-Chase experiment successfully proved DNA to
experiment carried out by Griffith was due to be the genetic material. The correct sequence of steps
(1) Carotenoid followed in this experiment is
(2) RNA (1) Blending, Infection, Centrifugation
(3) Protein (2) Centrifugation, Infection, Blending
(4) Polysaccharide.
(3) Infection, Centrifugation, Blending
25. Transforming principle in Griffith’s experiment was
DNA. It was discovered by (4) Infection, Blending, Centrifugation.
(1) Zinder and Lederberg 29. In the Avery, MacLeod, and McCarty experiment, which
(2) Avery, Mcleod and McCarty of the following enzyme did not affect the process of
(3) Lederberg and Tatum transformation?
(4) Zinder and Tatum. (1) Protease
26. Some viruses do not have DNA. This suggests that (2) RNase
(1) They are non-infective viruses
(3) DNase
(2) RNA is the genetic material in these viruses
(3) DNA is not the genetic material (4) Both (1) and (2).
(4) RNA is a self replicating molecule 30. The concept of transforming principle was first estab-
27. The biochemical nature of transforming principle was lished by ___ using the bacterium
defined by (1) Hershey and Chase, Streptococcus Pneumonia
(1) Griffith
(2) Garrod, Escherichia coli
(2) Avery, Macleod, McCarty
(3) Watson and Crick (3) Fredrick Griffith, Streptococcus pneumoniae
(4) Taylor. (4) Oswald Avery, Klebsiella pneumonia
6.4 REPLICATION NCERT P. No. 104-107
• While proposing the double helical structure for DNA, Watson and Crick had immediately proposed a
scheme for replication of DNA.
• To quote their original statement that is as follows: ‘‘It has not escaped our notice that the specific
pairing we have postulated immediately suggests a possible copying mechanism for the genetic
material’’ (Watson & Crick, 1953).
• The scheme suggested that the two strands would separate and act as a template for the synthesis of new
complementary strands. After the completion of replication, each DNA molecule would have one parental
and one newly synthesised strand. This scheme was termed as semiconservative DNA replication.
6.4.1 The Experimental Proof
• It is now proven that DNA replicates semiconservatively. It was shown first in Escherichia coli (NEET
2018) and subsequently in higher organisms, such as plants and human cells. Matthew Meselson and
Franklin Stahl performed the following experiment in 1958 :
15
(i) They grew E. coli in a medium containing NH4Cl (15N is the heavy isotope of nitrogen) as the
only nitrogen source for many generations.
 The result was that 15N was incorporated into newly synthesised DNA (as well as other nitrogen
containing compounds). This heavy DNA molecule could be distinguished from the normal
DNA by centrifugation in a cesium chloride (CsCl) density gradient (Please note that 15N is
not a radioactive isotope, and it can be separated from 14N only based on densities).
BIOLOGY 63
(ii) Then they transferred the cells into a medium with

normal 14NH4Cl and took samples at various definite
time intervals as the cells multiplied, and extracted the
DNA that remained as double-stranded helices.
 The various samples were separated independently
on CsCl gradients to measure the densities of DNA.
Due to centrifugal force a molecule with higher
mass/density would sediment faster.
(iii) Thus, the DNA that was extracted from the culture one
generation after the transfer from 15N to 14N medium
[that is after 20 minutes; E. coli divides in 20 minutes]
had a hybrid or intermediate density.
 DNA extracted from the culture after another
generation [that is after 40 minutes, II generation]
was composed of equal amounts of this hybrid DNA
and of ‘light’ DNA.
 After thir d gener ation (60 minutes), bacter ia
contains 25% hybrid DNA (N15N14) and 75% light
DNA (N14N14) in 1 : 3 ratio.
 After fourth generation (80 minutes), bacteria
contains 12.5 % hybrid DNA and 87.5 % light DNA
in 1 : 7 ratio.
• Very similar experiments involving use of radioactive
thymidine to detect distribution of newly synthesised DNA
in the chromosomes was performed on Vicia faba (faba beans) by Taylor and colleagues in 1958. The
experiments proved that the DNA in chromosomes also replicate semiconservatively.
6.4.2 The Machinery and the Enzymes
• In living cells, such as E. coli, the process of replication requires a set of catalysts (enzymes). The main enzyme
is referred to as DNA-dependent DNA polymerase, since it uses a DNA template to catalyse the polymerisation
of deoxynucleotides. These enzymes are highly efficient enzymes as they have to catalyse polymerisation of a
large number of nucleotides in a very short time.
• E. coli that has only 4.6 × 106 bp (compare it with human
whose diploid content is 6.6 × 109 bp), completes the process
of replication within 18 minutes; that means the average
rate of polymerisation has to be approximately 2000 bp per
second.
• Not only do these polymerases have to be fast, but they also
have to catalyse the reaction with high degree of accuracy.
Any mistake during replication would result into mutations.
• Further more, energetically replication is a very expensive
process. Deoxyribonucleoside triphosphates serve dual
purposes. In addition to acting as substrates, they provide
energy for polymerisation reaction (the two terminal
phosphates in a deoxynucleoside triphosphates are high-
energy phosphates, same as in case of ATP).
• In prokaryotes, DNA polymerases are of three types - DNA
polymerase I, II and III. DNA polymerase III is mainly
involved in DNA replication. DNA polymerase I is major
repair enzyme.
• In addition to DNA-dependent DNA polymerases, many additional enzymes are required to complete the
process of replication with high degree of accuracy.
• For long DNA molecules, since the two strands of DNA cannot be separated in its entire length (due to
very high energy requirement), the replication occur within a small opening of the DNA helix, referred to
as replication fork. The DNA-dependent DNA polymerases catalyse polymerisation only in one direction,
that is 5'  3'.
• This creates some additional complications at the replicating fork. Consequently, on leading strand (the
template with polarity 3'  5'), the replication is continuous, while on the lagging strand (the template
with polarity 5'  3'), it is discontinuous.
• The discontinuously synthesised fragments are called okazaki fragments which are later joined by the
enzyme DNA ligase.
• Hargobind Khorana is known for the discovery of DNA ligase.
• The DNA polymerases on their own cannot initiate the process of replication. Also the replication does
not initiate randomly at any place in DNA. There is a definite region in E. coli DNA where the replication
originates. Such regions are termed as origin of replication. It is because of the requirement of the origin
of replication that a piece of DNA if needed to be propagated during recombinant DNA procedures, requires
a vector. The vectors provide the origin of replication.
• In eukaryotes, the replication of DNA takes place at S-phase of the cell-cycle. The replication of DNA
and cell division cycle should be highly coordinated. A failure in cell division after DNA replication
results into polyploidy (a chromosomal anomaly).
BIOLOGY 65
PROKARYOTIC DNA
S. No. S. No. EUKARYOTIC DNA REPLICATION
REPLICATION
Prokaryotic DNA replication is the
Eukaryotic DNA replication is the process
process by which a prokaryotic organism
1. 1. by which the eukaryotic genome duplicates
duplicates its entire genome in order to
prior to cell division
pass the second copy to a daughter cell
2. Occurs just before fission 2. Occurs during the S phase of the cell cycle
3. Takes place in the cytoplasm 3. Takes place in the nucleus
4. DNA is circular and double-stranded 4. DNA is linear and double-stranded
DNA forms loop-like structures by DNA forms nucleosomes and shows higher
5. 5.
wrapping around protein molecules order packaging
Consists of a single origin of replication

6. 6. Consists of multiple origins of replication
(ori).
7. DNA gyrase is required 7. DNA gyrase is not required

Final product is two circular chromosomes
8. 8. Final product is two two sister chromatids
35. Replication of DNA is in

Daily Practice Problem (DPP-04) (1) 5'  3' direction
NCERT P. No. 104-107 (2) 2'  5' direction
31. Which enzyme is responsible for linking the fragments (3) Both 3'  5' and 5'  3' direction
of DNA (4) 3'  3' direction
(1) DNA polymerase III (2) Endonuclease 36. The one which is capable of self replication is
(3) DNA polymerase I (4) DNA ligase (1) DNA (2) Polysaccharide
32. Semiconservative model of DNA replication was pro- (3) Enzyme (4) Protein
posed by which workers in eukaryotes
37. DNA replication occurs during
(1) Taylor, Woods and Hughes
(1) Prophase (2) Metaphase
(2) Messelson and Stahl
(3) Nirenberg and Khorana (3) Anaphase (4) Interphase
(4) Watson and Crick 38. During Meselson and Stahl’s experiments, heavy DNA
was distinguished from normal DNA by centrifugation
33. DNA polymerase catalyses condensation reactions between
in
molecules during semi-conservative replication of DNA.
Which two molecules are joined by DNA polymerase? (1) CsOH gradient (2) 14NH4 Cl
(1) Base and base (3) 15NH4Cl (4) CsCl gradient
(2) Base and nucleotide 39. In proces s of replication deoxyribonucleos ide
(3) Nucleotide and nucleotide triphosphate
(4) Phosphate and deoxyrobose. (1) Acting as substrate
34. A DNA molecule in which both strands have radioactive (2) Providing energy for polymerisation reaction
thymidine is allowed to duplicate in an environment con- (3) Acting as an enzyme
taining non-radioactive thymidine. What will be the cor-
(4) Both (1) & (2).
rect number of DNA molecules that contain some radio-
active thymidine after three duplications 40. Replication fork is
(1) There will be four such molecules (1) Large opening of the DNA helix
(2) There will be eight such molecules (2) Small opening of the DNA helix
(3) There will be only one such molecule (3) Tightly coiled part of DNA helix
(4) There will be two such molecules (4) Loosely coiled part of DNA helix.
6.5 TRANSCRIPTION NCERT P. No. 107-111
• The process of copying genetic information from one strand of the DNA into RNA is termed as transcription.
Here also, the principle of complementarity governs the process of transcription, except the adenosine
complements now forms base pair with uracil instead of thymine.
• However, unlike in the process of replication, which once set in, the total DNA of an organism gets
duplicated, in transcription only a segment of DNA and only one of the strands is copied into RNA.
This necessitates defining the boundaries that would demarcate the region and the strand of DNA that
would be transcribed.
• Why both the strands are not copied during transcription has the simple answer. First, if both strands act
a template, they would code for RNA molecule with different sequences (Remember complementarity
does not mean identical), and in turn, if they code for proteins, the sequence of amino acids in the proteins
would be different. Hence, one segment of the DNA would be coding for two different proteins, and this
would complicate the genetic information transfer machinery.
• Second, the two RNA molecules if produced simultaneously would be complementary to each other, hence
would form a double stranded RNA. This would prevent RNA from being translated into protein and the
exercise of transcription would become a futile one.
Note • Antisense Technology : Use of complementary RNA to stop expression of a specific
6.5.1 Transcription Unit
• The segment of DNA that takes part in transcription is called transcription unit. A transcription unit in
DNA is defined primarily by the three regions in the DNA : (i) A Promoter, (ii) The Structural gene and
(iii) A Terminator.
6.5.2 Transcription Unit and the Gene

• A gene is defined as the functional unit of inheritance. Term gene was coined by Johannsen (1909) for the
Mendelian factor. Though there is no ambiguity that the genes are located on the DNA, it is difficult to
literally define a gene in terms of DNA sequence.
• Gene is considered as a segment of DNA. The DNA sequence coding for tRNA or rRNA molecule also
define a gene. Term gene is now replaced by cistron. Portion of DNA having information for an entire
polypeptide or trait is called cistron. However by defining a cistron as a segment of DNA coding for a
polypeptide, the structural gene in a transcription unit could be said as monocistronic (mostly in
eukaryotes) or polycistronic (mostly in bacteria or prokaryotes).
• Term cistron, recon and muton were given by Benzer.

• In eukaryotes, the monocistronic structural genes have interrupted coding
sequences – the genes in eukaryotes are split. The coding sequences or expressed
Brain Twister sequences are defined as exons . Exons are said to be those sequence that appear in
mature or processed RNA. The exons are interrupted by introns. Introns or
intervening sequences do not appear in mature or processed RNA.
BIOLOGY 67
• The split-gene arrangement further complicates the definition of a gene in terms of a DNA segment.
• Inheritance of a character is also affected by promoter and regulatory sequences of a structural gene.
Hence, sometime the regulatory sequences are loosely defined as regulatory genes, even though these
sequences do not code for any RNA or protein.
• One gene-one enzyme hypothesis was given by Beadle and Tatum (1948) for
which they awarded Nobel Prize in 1958. This theory was based on the studies of
Neurospora crassa (pink or red mould.
Brain Twister
6.5.3 Types of RNA and the process of Transcription
• There is a convention in defining the two strands of the DNA in the structural gene of a transcription unit.
• Since the two strands have opposite polarity and the DNA-dependent RNA polymerase also catalyse the
polymerisation in only one direction, that is, 5'  3', the strand that has the polarity 3'  5' acts as a
template, and is also referred to as template strand or antisense or master or (-) strand.
• The other strand which has the polarity (5'  3') and the sequence same as RNA (except thymine at the
place of uracil), is displaced during transcription. Strangely, this strand (which does not code for anything)
is referred to as coding strand or sense or (+) strand. All the reference point while defining a transcription
unit is made with coding strand.
• The promoter and terminator flank the structural gene in a transcription unit. The promoter is said to be
located towards 5'-end (upstream) of the structural gene (the reference is made with respect to the
polarity of coding strand).
• Promoter is a DNA sequence that provides binding site for RNA polymerase, and it is the presence of a
promoter in a transcription unit that also defines the template and coding strands. By switching its position
with terminator, the definition of coding and template strands could be reversed.
• The terminator is located towards
3'-end (downstream) of the coding
strand and it usually defines the end
of the process of transcription.
• There are additional regulatory
sequences that may be present
further upstream or downstream to
the promoter.
• In bacteria, there are three major

types of RNAs: mRNA (messenger
RNA), tRNA (transfer RNA), &
rRNA (ribosomal RNA).
• All three RNAs ar e needed to
synthesise a protein in a cell. The
mRNA provides the template,
tRNA brings aminoacids and
reads the genetic code, and rRNAs
play structural and catalytic role
during translation.
• There is single DNA-dependent
RNA polymerase that catalyses
transcription of all types of RNA
in bacteria.
• RNA polymerase binds to promoter and initiates transcription (Initiation). It uses nucleoside triphosphates
as substrate and polymerises in a template depended fashion following the rule of complementarity. It
somehow also facilitates opening of the helix and continues elongation. Only a short stretch of RNA
remains bound to the enzyme.
• Once the polymerase reaches the
terminator region, the nascent
RNA falls off, so also the RNA
polymer ase. T his r es ults in
termination of transcription.
• An intriguing question is that
how is the RNA polymerases
able to catalyse all the three
steps, which ar e initiation,
elongation and termination.
The RNA polymerase is only
capable of catalysing the process
of elongation. It ass ociates
tr ansient ly with initiation-
factor (s igma) and
termination-factor (rho) to
initiate and ter minate the
transcription, respectively.
• Association with these factors
alter the specificity of the RNA
polymerase to either initiate or
terminate. During elongation,
sigma and rho factors become functionless.
• In bacteria, since the mRNA does not require any processing to become active, and also since transcription
and translation take place in the same compartment (there is no separation of cytosol and nucleus in
bacteria), many times the translation can begin much before the mRNA is fully transcribed. Consequently,
the transcription and translation can be coupled in bacteria.
BIOLOGY 69
• In eukaryotes, there are two additional complexities

(i) There are at least three RNA polymerases in the nucleus (in addition to the RNA polymerase found
in the organelles). There is a clear cut division of labour.
• The RNA polymerase I transcribes rRNAs (28S, 18S, and 5.8S).

• The RNA polymerase II transcribes precursor of mRNA, the heterogeneous nuclear
RNA (hnRNA).
Brain Booster • RNA polymerase III is responsible for transcription of tRNA, 5srRNA, and snRNAs
(small nuclear RNAs).
(ii) The second complexity is that the primary transcripts (hn – RNA) contain both the exons and the
introns and are non-functional. Hence, it is subjected to a process called splicing where the introns
are removed and exons are joined in a defined order.
 Intron is the portion of gene which is transcribed but not translated. In prokaryotes hn RNA is
absent so splicing in not required.
 A spliceosome is a large molecular structure found within the nucleus of eukaryotic cells.
Spliceosomes are not found in cells of prokaryotes (bacteria). (NEET 2017)
 The spliceosome removes introns from hnRNA – the process is called splicing.
• hnRNA undergoes additional processing called as capping and tailing.
 In capping an unusual nucleotide (methyl guanosine triphosphate) is added to the 5'-end of hnRNA.
In tailing, adenylate residues (200-300) are added at 3'-end in a template independent manner.
• It is the fully processed hnRNA, now called mRNA, that is transported out of the nucleus for translation.
• The significance of such complexities is now beginning to be understood. The split-

gene arrangements represent probably an ancient feature of the genome.
• The presence of introns is reminiscent of antiquity, and the process of splicing
Brain Booster represents the dominance of RNA-world.
• In recent times, the understanding of RNA and RNA-dependent processes in the
living system have assumed more importance.
43. Mark the incorrect differences between eukaryotic and

Daily Practice Problem (DPP-05) prokaryotic transcripiton.
NCERT P. No. 107-111
i. In eukaryotes, the genes are split having exons and
41. The process of copying genetic information from one introns while in prokaryotes it isn't.
strand of DNA into ___Y____ is termed as___Z___ ii. The structural gene which is to be transcribed is
Y Z generally monocistronic in prokaryotes and poly
cistronic in eukaryotes.
(1) Transcription RNA
iii. The RNA formed with the help of RNA polymerase
(2) RNA Transcription in eukaryotes requires further processing to function
(3) DNA Replication as m-RNA while in prokaryotes it is directly used
(4) Replication RNA as m-RNA.
42. Select the incorrect statement from the following. iv. In eukaryotes, RNA polymerase binds to the
promoter region while in prokaryotes it binds to the
(1) Cistron is segment of DNA coding for a polypeptide.
operator region.
(2) The coding sequence or expressed sequences are
(1) i and iv
defined as exons
(2) ii and iii
(3) Introns or intervening sequences appears in mature
or processed RNA (3) iii and iv
(4) Split gene arrangement is present in eukaryotes. (4) iii and iv.
44. Mark the correct statement. 47. If one strand of DN A ha s the bas e s equence
(1) mRN A is polycistronic in euka ryotes and ATCCACGACTAG and the second strand undergoes
monocistronic in prokaryotes. transcription, what would be the base sequence on
mRNA?
(2) mRN A is polycistronic in proka ryotes and
(1) TACGTGCTGATC (2) ATCCACGACTAG
monocistronic in eukaryotes.
(3) AUCCACGACUAG (4) AUGCACGACTAG
(3) mRNA is polycistronic in both eukaryotes and
prokaryotes. 48. The core enzyme requires a factor for termination of RNA
synthesis at some sites. This is known as
(4) mRNA is monocistronic in both eukaryotes and
(1) Sigma factor (2) Rho factor
prokaryotes.
(3) Gamma factor (4) Alpha particle
45. In which of the following organism mRNA has introns?
49. One functional unit of gene which specifies synthesis of
(1) Nostoc (2) Rhizobium one polypeptide is known as
(3) Chlamydomonas (4) Mycoplasma (1) Recon (2) Clone
46. If the DNA strand has the nitrogenous base sequence (3) Codon (4) Cistron
ATTGCC, the mRNA will have 50. In split genes, the coding sequences are called
(1) ATTGCA (2) ATCGCC (1) Cistrons (2) Operons
(3) UGGACC (4) UAACGG (3) Exons (4) Introns
6.6 GENETIC CODE NCERT P. No. 111-114
• During replication and transcription a nucleic acid was copied to form another nucleic acid. Hence,
these processes are easy to conceptualise on the basis of complementarity.
 The process of translation requires transfer of genetic information from a polymer of nucleotides
to a polymer of amino acids. Neither does any complementarity exist between nucleotides and
amino acids, nor could any be drawn theoretically.
 There existed ample evidences, though, to support the notion that change in nucleic acids
(genetic material) were responsible for change in amino acids in proteins. This led to the proposition
of a genetic code that could direct the sequence of amino acids during synthesis of proteins.
(JIPMER 1997)
• If determining the biochemical nature of genetic material and the structure of DNA was very exciting, the
proposition and deciphering of genetic code were most challenging.
 In a very true sense, it required involvement of scientists from several disciplines – physicists,
organic chemists, biochemists and geneticists.
• It was George Gamow, a physicist, who argued that since there are only 4 bases and if they have to code
for 20 amino acids, the code should constitute a combination of bases.
 He suggested that in order to code for all the 20 amino acids, the code should be made up of three
nucleotides. This was a very bold proposition, because a permutation combination of 4 3 (4 × 4 ×
4) would generate 64 codons; generating many more codons than required. Providing proof that
the codon was a triplet, was a more daunting task.
• Experimental evidence supporting concept of triplet genetic code was first provided by Crick. (AIIMS 1997)
• The chemical method developed by Har Gobind Khorana was instrumental in synthesising RNA molecules
with defined combinations of bases (homopolymers and copolymers).
• Marshall Nirenberg’s cell-free system for protein synthesis finally helped the code to be deciphered.
• Severo Ochoa enzyme (polynucleotide phosphorylase) was also helpful in polymerising RNA with
defined sequences in a template independent manner (enzymatic synthesis of RNA).
• Holley, Nirenberg and Khorana were awarded the Nobel Prize in 1968 for deciphering or cracking the
genetic code. Finally a checker-board for genetic code was prepared.
BIOLOGY 71
Salient Features of Genetic Code

(i) The codon is triplet. 61 codons code for amino acids and three codons do not code for any amino
acids, hence they function as stop codons or non sense codons / termination codons. These are UAA
(Ochre), UAG (Amber) and UGA (Opal).
 All the terminator codons begin with uracil.
(ii) Some amino acids are coded by more than one codon, hence the code is degenerate or redundant.
This property is called degeneracy or redundancy.
(iii) The codon is read in mRNA in a contiguous fashion. There are no punctuations. Codons are commaless.
(iv) The code is nearly universal: for example, from bacteria to human UUU would code for Phenylalanine
(phe). Some exceptions to this rule have been found in mitochondrial codons, and in some protozoans.
In human mitrochondria AUA codes for methionine.
(v) AUG has dual functions. It codes for Methionine (met), and it also act as initiator codon.
(vi) One codon codes for only one amino acid, hence, it is unambiguous and specific.
• 61 codons code for 20 amino acids, this is degeneracy.

• Only methionine (AUG) and tryptophan (UGG) are specified by single codons.
• In degenerate codons, mostly the first two bases are similar while third is different.
Brain Booster Degeneracy is due to the third base of codon. (AIPMT 2003)
• Genetic code are always read in 5  3 direction.

• Four codons have all the three bases same.
• The number of base substitution possible in amino acid codons is 549 (61 × 32).
Brain Twister
6.6.1 Mutations and Genetic Code
• The relationships between genes and DNA are best understood by mutation studies. Effects of large deletions
and rearrangements in a segment of DNA are easy to comprehend. It may result in loss or gain of a gene
and so a function.
• Deletions and insertions of base pairs of DNA, causes frame-shift mutations. Effect of point mutations
that inserts or deletes a base in structural gene can be better understood by following simple example.
• Consider a statement that is made up of the following words each having three letters like genetic code :
RAM HAS RED CAP
• If we insert a letter B in betweeen HAS and RED and rearrange the statement, it would read as follows :
RAM HAS BRE DCAP
• Similarly, if we now insert two letters at the same place, say BI’. Now it would read as,
RAM HAS BIR EDC AP
• Now e insert three letters together, say BIG, the staement would read as,
RAM HAS BIG RED CAP
• The same exercise can be repeated, by deleting the letters R, E and D, one by one and rearrange the
statement to make a triplet word.
RAM HAS EDC AP
RAM HAS DCA P
RAM HAS CAP
• The conclusion from the above exercise is very obvious. Insertion or deletion of one or two bases changes
the reading frame from the point of insertion or deletion.
• Insertion or deletion of three or its multiple bases insert or delete one or multiple codon hence one or
multiple amino acids, and reading frame remains unaltered from that point onwards. Such mutations are
referred to as frame-shift insertion or deletion mutations. This forms the genetic basis of proof that codon
is a triplet and it is read in a contiguous manner.
53. Which is wrong

Daily Practice Problem (DPP-06)
(1) Most forests have been lost in tropical areas
NCERT P. No. 111-114
(2) Greenhouse effect is natural phenomenon
51. The given nucleotide sequence on mRNA is as shown (3) Ozone in upper part of atmosphere is harmful to
below animals
5' AUGUCAUGGGAGUGAGUUGGGCUAAAAUAG 3' (4) Eutrophication is natural phenomenon in fresh water
(a) How many amino acids will be inserted in a polypep- bodies.
tide chain under normal conditions? 54. In a given DNA segment ATGACC AGG ACC CCA
(b) How many amino acids will be inserted in a polypep- ACA, the first base gets mutated. The effect of this on
tide chain in a mutated situation by the deletion of coding by this DNA segment will result in
9th nucleotide in the cistron part of DNA? (1) Complete change in the type as well as sequence of
(1) (a)-4, (b)-9 (2) (a)-4, (b)-7 amino acids
(3) (a)-6, (b)-8 (4) (a)-5, (b)-7. (2) Change in the first amino acid only
52. Which one of the following mRNA sequences can be (3) No change in the squence
translated completely? (4) One amino acid less in the protein
(1) AUG UUC UCC UGG UAA UAU 55. Which of the following bases is absent in the coding
(2) AUG UUC UCC UGA UGG UAU dictionary
(3) AUG ACG UAU UUC UGA CUC (1) Uracil (2) Thymine
(4) AUG UAU UUC UGC CUC UAG. (3) Cytosine (4) Adenine
BIOLOGY 73
56. There are 64 types of codons in genetic code dictionary 58. A sequence of how many nucleotides in messenger RNA
because makes a codon for an amino acid
(1) There are 64 types of tRNA's found in cell (1) One (2) Two
(2) There are 44 meaningless and 20 codons for (3) Three (4) Four
amino acids 59. Which one of the following is common to both prokary-
(3) There are 64 amino acids for coding otes and eucaryotes
(4) Genetic code is triplet (1) Mitotic apparatus
57. A naturally occurring coding strand composed of (2) Histones
alternating C and U residues would result in the (3) Mitochondira
formation of (4) Genetic code
(1) A polypeptide containing alternating leu and 60. Genetic code translates the language of
ser residues (1) RNA into that of proteins
(2) A polypeptide containing either leu or ser residues (2) Proteins into that of RNA
(3) A polypeptide containing only leu residues (3) Amino acids into that of RNA
(4) A polypeptide containing only ser residues (4) RNA into that of DNA.
6.6.2 tRNA– the Adapter Molecule NCERT P. No. - 114
• From the very beginning of the proposition of code, it was clear to Francis Crick that there has to be a
mechanism to read the code and also to link it to the amino acids, because amino acids have no structural
specialities to read the code uniquely.
• He postulated the presence of an adapter molecule that would on one hand read the code and on other
hand would bind to specific amino acids.
• T he tRNA, then called sRNA
(soluble RNA), was known before
the genetic code was postulated.
However, its role as an adapter
molecule was assigned much later.
• tRNA has an anticodon loop that
has bases complementary to the
code, and it also has an amino acid
accepter end to which it binds to
amino acids. tRNAs are specific for
each amino acid. There are 20 types
of t-RNAs for 20 types of amino
acids.
• A t-RNA molecule has five arms or
loops :
(I) DHU (dihydroxyuridine) loop : It is recognising site for aminoacyl synthetase enzyme. (JIPMER 1997)
(II) Anticodon loop : It has 7 bases of which 3 bases form anti codon (NODOC). Used for recognizing
and binding to the codon of m-RNA. (CBSE 2009)
(III)Extra arm : Work unknown.
(IV) T C arm : It has 7 bases. By T  C arm, tRNA recognises ribosome and attach to it.
(V) AAA end : This is amino acid acceptor end or amino acid binding site.
• The site present at the 3' end (opposite the antiocodon) and has CCA-OH group. The 5' and bears G.
• For initiation, there is another specific tRNA that is referred to as initiator tRNA. There are no tRNAs for
stop codons.
• The secondary structure of tRNA has been depicted that looks like a clover-leaf.
Clover leaf model of tRNA was proposed by Holley.
• In actual structure or 3-dimensional shape the tRNA is a compact molecule which
Brain Booster looks like inverted L. (AIPMT 2000)
6.7 TRANSLATION NCERT P. No. 114-115
• Translation refers to the process of polymerisation of amino acids to form a polypeptide. Protein synthesis
requires ribosome, amino acids, m-RNA, t-RNA and r-RNA. Ribosome is the site of protein synthesis.
• The order and sequence of
amino acids are defined by
the sequence of bases in the
mRNA. m RNA function as
template. t-RNA reads the
genetic code and brings
amino acids. r RNA plays
str uctur al and catalytic
role. Translation occurs in
cytoplasm.
• The amino acids are joined
by a bond which is known
as a pept ide bond.
Formation of a peptide
bond requires energy.
Therefore, in the first phase
itself amino acids ar e
activated in the presence of
ATP and linked to their
cognate tRNA– a process
commonly called as activation or charging of tRNA or aminoacylation of tRNA to be more specific.
BIOLOGY 75
• If two such charged tRNAs are brought close enough, the formation of peptide bond between them would
be favoured energetically. The presence of a catalyst would enhance the rate of peptide bond formation.
• The process of translation involves three steps, viz. initiation, elongation and termination.
Initiation
• The cellular factory responsible for synthesising proteins is the ribosome. The ribosome consists of
structural RNAs and about 80 different proteins.
• In its inactive state, it exists as two subunits; a large subunit and a small subunit. When the small subunit
encounters an mRNA, the process of translation of the mRNA to protein begins.
• There are two sites in the large subunit, for subsequent amino acids to bind to and thus, be close enough
to each other for the formation of a peptide bond. Enzyme catalysing peptide bond formation is located in
larger subunit of ribosome.
• The ribosome also acts as a catalyst (23S rRNA in bacteria is the enzyme- ribozyme) for the formation of
peptide bond or polyribonucleotides.
• A translational unit in mRNA is the sequence of RNA that is flanked by the start codon (AUG) and the
stop codon and codes for a polypeptide.
• A mRNA also has some additional sequences that are not translated and are referred as untranslated
regions (UTR). The UTRs are present at both 5' -end (before start codon) and at 3' -end (after stop codon).
They are required for efficient translation process.
• For initiation, the ribosome binds to the mRNA at the start codon (AUG) that is recognised only by the
initiator tRNA.
Elongation
• The ribosome proceeds to the elongation phase of protein synthesis. During this stage, complexes composed
of an amino acid linked to tRNA, sequentially bind to the appropriate codon in mRNA by forming
complementary base pairs with the tRNA anticodon.
• The ribosome moves from codon to codon along the mRNA. Amino acids are added one by one, translated
into polypeptide sequences dictated by DNA and represented by mRNA.
Termination
• At the end, a release factor binds to the stop codon, terminating translation and releasing the complete
polypeptide from the ribosome.
62. Which one of the following pairs is correctly matched

Daily Practice Problem (DPP-07)
(1) Ribosomal RNA-carries aminoacids to the site of
NCERT P. No. 114-115 protein synthesis
61. Following are given sequences of mRNA. Identify the (2) Tra ns cription-proces s by which protein is
one that will not undergo complete translation. synthesized
(1) 5'AUG UUC AGC UCG UGA 3' (3) Translation-process by which carries the information
(2) 5'AUG CCA UAC GAC UAG 3' from nucleus to the ribosome
(3) 5'AUG UUA CUC GCG UAA 3' (4) Anticodon-site of tRNA molecule that contains
(4) 5'AUG AAC UAA CCA CUC 3'. complementary bases to the triple code on the RNA.
63. Consider the following 66. Which site of a t-RNA molecule hydrogen bonds to a m-
1. Structural gene 2. Messenger RNA RNA molecule
3. Ribosomes 4. Transcription (1) Codon
5. Translation (2) Anticodon
Which of the following is the correct sequence for protein (3) 5' end of the t-RNA molecule
synthesis (4) 3' end of the t-RNA molecule
(1) 1, 4, 3, 2, 5 (2) 1, 4, 5, 2, 3 67. Genetic code determines
(3) 1, 4, 2, 3, 5 (4) 3, 5, 4, 2, 1
(1) Structural pattern of organism
64. Consider the following statements
(2) The sequence of amino acid in a protein
(a) r-RNA provides the template for synthesis of
proteins (3) The number and variation of offspring
(b) t-RNA brings amino acids and reads the genetic code (4) Constancy of morphological traits
(c) RNA polymerase binds to promoter and initiates 68. Which of the following inhibits protein synthesis by
transcription binding to 50 S ribosome?
(d) A segment of DNA coding for polypeptide is called (1) Tetracycline
intron (2) Streptomycin
(1) (c) and (d) are correct (3) Erythromycin
(2) (a) and (b) are correct (4) Penicillin
(3) (a), (b) and (c) are correct 69. When the codon of mRNA is 5'GUC3' then the anticodon
(4) (b) and (c) are correct. on tRNA will be
65. Which of the following is incorrect in relation to an (1) 5'-CAG-3' (2) 3'-CAG-5'
adapter molecule?
(3) 3' -CUG-5' (4) 3'-GAC-5'
(1) It ha s an anticodon loop that ha s ba ses
70. Which of the following has a clover leaf shaped structure
complementary to the code
(1) t-RNA
(2) It is also called sRNA.
(3) It has an amino acid acceptor end to which it binds (2) r-RNA
to amino acid. (3) m-RNA
(4) It shows an inverted L-shaped 2-D structure. (4) s-RNA
6.8 REGULATION OF GENE EXPRESSION NCERT P. No. 115-117
• Regulation of gene expression refers to a very broad term that may occur at various levels. Considering
that gene expression results in the formation of a polypeptide, it can be regulated at several levels.
• In a transcription unit, the activity of RNA polymerase at a given promoter is in turn regulated by interaction
with accessory proteins, which affect its ability to recognise start sites. These regulatory proteins can act
both positively (activators) and negatively (repressors).
• The accessibility of promoter regions of prokaryotic DNA is in many cases regulated by the interaction of
proteins with sequences termed operators.
• The operator region is adjacent to the promoter elements in most operons and in most cases the sequences
of the operator bind a repressor protein. Each operon has its specific operator and specific repressor. For
example, lac operator is present only in the lac operon and it interacts specifically with lac repressor only.
• In eukaryotes, the regulation could be exerted at
(i) Transcriptional level (formation of primary transcript),
(ii) Processing level (regulation of splicing),
(iii) Transport of mRNA from nucleus to the cytoplasm,
(iv) Translational level.
BIOLOGY 77
• The genes in a cell are expressed to perform a particular function or a set of functions. For example, if an
enzyme called beta-galactosidase is synthesised by E. coli, it is used to catalyse the hydrolysis of a
disaccharide, lactose into galactose and glucose; the bacteria use them as a source of energy. Hence, if the
bacteria do not have lactose around them to be utilised for energy source, they would no longer require the
synthesis of the enzyme beta-galactosidase. Therefore, in simple terms, it is the metabolic, physiological
or environmental conditions that regulate the expression of genes. The development and differentiation
of embryo into adult organisms are also a result of the coordinated regulation of expression of several sets
of genes.
• In prokaryotes, control of the rate of transcriptional initiation is the predominant site for control of
gene expression.
The Operon System

• Operon is a set of closely placed genes regulating a metabolic pathway in prokaryotes. An operon is a
part of DNA having common promoter and regulatory genes for many structural gene.
• Regulatory genes / sequences form the protein but this protein do not control function of the cell. They
control the function of structural genes. Promoters, terminators, operators and i gene (regulator gene) are
important regulatory genes. i gene produce repressor which do not take part in cellular activity. Instead, it
regulates the activity of other genes.
6.8.1 The Lac operon

• The elucidation of the lac operon was also a result of a close association between a geneticist, Francois
Jacob and a biochemist, Jacque Monod in 1961 (NEET 2018) for which they awarded Nobel Prize.
They were the first to elucidate a transcriptionally regulated system.
• In lac operon (here lac referes to lactose), a polycistronic structural gene is regulated by a common
promoter and regulatory genes. Such arrangement is very common in bacteria and is referred to as
operon. To name few such examples, lac operon, trp operon, ara operon, his operon, val operon, etc.
• Lac operon is a type of inducible operon (CBSE 1995). In inducible operon, presence of a chemical
switch on the operon.
• The lac operon consists of one regulatory gene (the i gene – here the term i does not refer to inducer,
rather it is derived from the word inhibitor) and three structural genes (z, y and a).
• Regulatory gene occurs in front of structural genes. The i gene codes for the repressor of the lac operon.
• The z gene codes for beta-galactosidase ( -gal), which is primarily responsible for the hydrolysis of the
disaccharide, lactose into its monomeric units, galactose and glucose.
• The y gene codes for permease, which increases permeability of the cell to  -galactosides. The a gene
encodes a transacetylase. Hence, all the three gene products in lac operon are required for metabolism
of lactose.
• In most other operons as well, the genes present in the operon are needed together to function in the same
or related metabolic pathway. Operator gene is switched off in the presence of a repressor.
• Lactose is the substrate for the enzyme beta-galactosidase and it regulates switching on and off of the operon.
Hence, it is termed as inducer. Remember, glucose or galactose cannot act as inducers for lac operon.
• In the absence of a preferred carbon source such as glucose, if lactose is provided in the growth medium
of the bacteria, the lactose is transported into the cells through the action of permease (Remember, a very
low level of expression of lac operon has to be present in the cell all the time, otherwise lactose cannot
enter the cells).
• The lactose then induces the operon in the following manner. The repressor of the operon is synthesised
(all-the-time – constitutively) from the i gene.
• The repressor protein binds to the operator region of the operon and prevents RNA polymerase from
transcribing the operon.
• In the presence of an inducer, such as lactose or allolactose, the repressor is inactivated by interaction
with the inducer. This allows RNA polymerase access to the promoter and transcription proceeds.
• Essentially, regulation of lac operon can also be visualised as regulation of enzyme synthesis by its
substrate.
BIOLOGY 79
• Regulation of lac operon by repressor is referred to as negative regulation. Lac operon is under control
of positive regulation as well, but it is beyond the scope of discussion at this level.
• An operon consists of an operator region, a promoter region, one regulatory gene and structural genes.
(NEET 2018)
Jumping genes (Transposons)
• First discovered by Barbara Mc Clintock (1951) in Maize.

• Transposons are DNA segments that can jump or move from one place in the genome to another place.
• Transposons are found in both prokaryotes and eukaryotes.
76. Read the following statements for lac operon:

Daily Practice Problem (DPP-08) i. Each operon has its specific operator and specific
NCERT P. No. 115-117 repressor.
ii. The y gene codes for permease, which increases the
71. Select the two correct statement out of the four (i-iv)
permeability of the cell to -galactosides.
given below about Lac operon.
iii. Regulation of lac operon can be visualized as
i. Glucose or galactose may bind with the repressor
regulation of enzyme synthesis by its substrate.
and inactivate it.
Select the option with the correct statements.
ii. In the absence of lactose, the repressor binds with
the operator region. (1) All statements are correct.
iii. The z-gene codes for permease. (2) All statements are incorrect.
iv. This was elucidated by Francois Jacob and Jacques (3) Only i is correct and ii and iii are incorrect.
Monod. (4) Only i and iii are correct.
The correct statements are 77. Identify the INCORRECT statement from the following
(1) ii and iii (2) i and iii with reference to lac operon.
(3) ii and iv (4) i and ii. (1) It is a unit of gene expression and regulation for
lactose sugar metabolism in E. coli.
72. Sample of live microbial cells was presented to a scientist.
(2) Lactose sugar enters the cell due to the activity of
He decides to stop the synthesis of a particular protein
enzyme permease.
in the sample cells. Suggest a modification in the part of
the cell for the scientist to enable the prevention of that (3) Operators are present between promoters and
particular protein synthesis. structural genes.
(1) The DNA in the nucleus (4) The structural gene ‘Z’ code for -galactosidase,
‘Y’ for transacetylase, and ‘A’ for permease.
(2) An enzyme in the lysosomes
78. Genes that are involved in turning on or off the tran-
(3) The polysaccharides in the cytoplasm
scription of a set of structural genes are called
(4) A phospholipid in the plasma membrane
(1) Polymorphic genes
73. What will be the correct gene expression pathway?
(2) Operator genes
(1) Gene-mRNA-transcription-translation-protein
(3) Redundant genes
(2) Transcription-gene-translation-mRNA-protein
(4) Regulatory genes
(3) Gene-transcription-mRNA-translation-protein
79. In Operon concept, the regulator gene regulates chemi-
(4) Gene-translation-mRNA-transcription-protein cal reactions in the cell by
74. Repressor protein is formed from (1) Inactivating enzymes in the reaction
(1) Repressor gene (2) Structural gene (2) Inhibiting transcription of mRNA
(3) Operator gene (4) Regulatory gene (3) Inhibiting migration of mRNA into cytoplasm
75. In the lac operon, the structural genes are switched off (4) Inhibiting the substrate in the reaction
when 80. Lactose is the substrate for the enzyme beta galactosi-
(1) Repressor binds to operator dase and it regulates switching on and off of the operon.
(2) Repressor binds to promotor Hence it is termed as
(3) Repressor binds to regular (1) Inducer (2) Repressor
(4) Repressor binds to inducer. (3) Aporepressor (4) Co-repressor.
3 6.9 HUMAN GENOME PROJECT NCERT P. No. 115-121
• The sequence of bases in DNA determines the genetic information of a given organism. In other words,
genetic make-up of an organism or an individual lies in the DNA sequences.
• If two individuals differ, then their DNA sequences should also be different, at least at some places. These
assumptions led to the quest of finding out the complete DNA sequence of human genome.
• With the establishment of genetic engineering
techniques where it was possible to isolate and
clone any piece of DNA and availability of simple
and fast t echniques for deter mining DNA
sequences, a very ambitious project of sequencing
human genome was launched in the year 1990
• Further, if the obtained sequences were to be stored
in typed form in books, and if each page of the
book contained 1000 letter s and each book
contained 1000 pages, then 3300 such books would
be required to store the information of DNA
sequence from a single human cell.
• The enormous amount of data expected to be
generated also necessitated the use of high speed
computational devices for data storage and
retrieval, and analysis.
• HGP was closely associated with the r apid
development of a new area in biology called
Bioinformatics.
• Human Genome Project (HGP) was called a mega project. The Human Genome
Project was a 13-year project coordinated by the U.S. Department of Energy and
the National Institute of Health.
Brain Twister • During the early years of the HGP, the Wellcome Trust (U.K.) became a major
partner; additional contributions came from Japan, France, Germany, China and
others. The project was completed in 2003.
• The sequence of chromosome 1 was completed only in May 2006 (this was the last of
the 24 human chromosomes – 22 autosomes and X and Y – to be sequenced ).
• Human genome is said to have approximately 3 × 109 bp, and if the cost of sequencing
required is US $ 3 per bp (the estimated cost in the beginning), the total estimated
cost of the project would be approximately 9 billion US dollars .
Goals of HPG
(i) Identify all the approximately 20,000-25,000 genes in human DNA.
(ii) Determine the sequences of the 3 billion chemical base pairs that make up human DNA
(iii) Store this information in databases
(iv) Improve tools for data analysis
(v) Transfer related technologies to other sectors, such as industries
(vi) Address the ethical, legal, and social issues (ELSI) that may arise from the project.
BIOLOGY 81
Note • Many non-human model organisms, such as bacteria, yeast, Caenorhabditis elegans (a
free living non-pathogenic nematode), Drosophila (the fruit fly), plants (rice and
Arabidopsis), etc., have also been sequenced.
Methodologies
• The methods involved two major approaches. One approach focused on identifying all the genes that are
expressed as RNA (referred to as Expressed Sequence Tags (ESTs).
• The other took the blind approach of simply sequencing the whole set of genome that contained all the
coding and non-coding sequence, and later assigning different regions in the sequence with functions
(a term referred to as Sequence Annotation).
• For sequencing, the total DNA from a cell is isolated and converted into random fragments of relatively
smaller sizes (recall DNA is a very long polymer, and there are technical limitations in sequencing very
long pieces of DNA) and cloned in suitable host using specialised vectors.
 The cloning resulted into amplification of each piece of DNA fragment so that it subsequently could
be sequenced with ease.
 The commonly used hosts were bacteria and yeast, and the vectors were called as BAC (bacterial
artificial chromosomes), and YAC (yeast artificial chromosomes).
• The fragments were sequenced using automated DNA sequencers that worked on the principle of a
method developed by Frederick Sanger. Sanger is also credited for developing method for determination
of amino acid sequences in proteins.
• These sequences were then arranged based on some overlapping regions present in them. This required
generation of overlapping fragments for sequencing.
• Alignment of these sequences was humanly not possible. Therefore, specialised computer based programs
were developed. These sequences were subsequently annotated and were assigned to each chromosome.
• Another challenging task was assigning the genetic and physical maps on the genome. This was generated
using information on polymorphism of restriction endonuclease recognition sites, and some repetitive
DNA sequences known as microsatellites.
6.9.1 Salient Features of Human Genome
• Some of the salient observations drawn from human genome project are as follows:
(i) The human genome contains 3164.7 million nucleotide bases.
(ii) The average gene consists of 3000 bases, but sizes vary greatly, with the largest known human gene
being dystrophin at 2.4 million bases.
(iii) The total number of genes is estimated at 30,000–much lower than previous estimates of 80,000 to
1,40,000 genes. Almost all (99.9 per cent) nucleotide bases are exactly the same in all people.
(iv) The functions are unknown for over 50 per cent of the discovered genes.
(v) Less than 2 per cent of the genome codes for proteins.
(vi) Repeated sequences make up very large portion of the human genome.
(vii)Repetitive sequences are stretches of DNA sequences that are repeated many times, sometimes hundred
to thousand times. They are thought to have no direct coding functions, but they shed light on
chromosome structure, dynamics and evolution.
(viii)Chromosome 1 has most genes (2968), and the Y has the fewest (231).
(ix) Scientists have identified about 1.4 million locations where singlebase DNA differences (SNPs –
single nucleotide polymorphism, pronounced as ‘snips’) occur in humans.
• This information promises to revolutionise the processes of finding chromosomal locations for disease-
associated sequences and tracing human history.
6.9.2 Applications and Future Challenges
• Knowledge about the effects of DNA variations among individuals can lead to revolutionary new ways to
diagnose, treat and someday prevent the thousands of disorders that affect human beings.
• Besides providing clues to understanding human biology, learning about non-human organisms DNA
sequences can lead to an understanding of their natural capabilities that can be applied toward solving
challenges in health care, agriculture, energy production, environmental remediation.
• Deriving meaningful knowledge from the DNA sequences will define research through the coming decades
leading to our understanding of biological systems. This enormous task will require the expertise and creativity
of tens of thousands of scientists from varied disciplines in both the public and private sectors worldwide.
• One of the greatest impacts of having the HG sequence may well be enabling a radically new approach to
biological research. In the past, researchers studied one or a few genes at a time. With whole-genome
sequences and new high-throughput technologies, we can approach questions systematically and on a
much broader scale.
• They can study all the genes in a genome, for example, all the transcripts in a particular tissue or organ or
tumor, or how tens of thousands of genes and proteins work together in interconnected networks to
orchestrate the chemistry of life.
84. Select the correct set from the following statements with
Daily Practice Problem (DPP-09) respect to the salient features of the human genome.
NCERT P. No. 118-121 i. The huma n genome contains 3164.7 billion
nucleotides.
81. Which one of the following is incorrectly matched? ii. the function is unknown for over 50% of the
(1) Ribozyme - 23s rRNA discovered gene.
iii. Less than 20% of the genome code for proteins.
(2) lac A - Permease
iv. Chromosome–1 has the most genes (2968) and Y
(3) ESTs - Satellite DNA has the fewest (231).
(4) Chromosome 1 - 2968 genes v. The total number of genes estimated is 30,000.
82. SNP which is pronounced as "snips" stands for (1) ii, iv, v (2) i, ii, iv
(1) Small nuclear protein (3) i, iii, v (4) i, iv, v.
85. Complete genome of which non-crop and crop plants has
(2) Single nucleotide particle been sequenced?
(3) Single nucleotide polymorphism (1) Datura and wheat respectively
(4) Small nicking points (2) Arabidopsis and maize respectively
83. The Human Genome Project as megaproject was a 13 (3) Oenothera and oat respectively
year coordinated by the (4) Arabidopsis and rice respectively
86. The largest known gene is
(1) U.S. Department of Energy
(1) Gene for dystrophin
(2) National Institute of Health (2) Gene for ADA
(3) U.S. Department of Molecular Biology (3) Gene for cystic fibrosis
(4) Both (1) and (2). (4) Gene for phenylalanine hydroxylase.
BIOLOGY 83
87. In Sequence Annotation 89. The last human chromosome which sequence was
(1) All expressed genes are identified completed in May 2006 is
(2) Sequence that occurs only once in genome are tagged (1) Chromosome 22
(2) Chromosome 14
(3) All coding and non-coding sequence are involved.
(3) Chromosome 1
(4) Sequencing of genes with exact location and order
of known bases. (4) Chromosome X and Y
88. Sequencing the whole set of genome that contains all 90. Many non human model organisms have also been se-
the coding and non coding parts is quenced along with the human genome these are
(1) Expressed Sequence Tags (1) Bacteria and yeast
(2) Sequence Annotation (2) Plant (rise and arabidopsis)
(3) Microarray (3) Fruitfly and Coenohabdities
(4) Electrophoresis (4) All the above.
6.10 DNA FINGERPRINTING NCERT P. No. 121-123
• As stated in the preceding section, 99.9 per cent of base sequence among humans is the same. Assuming
human genome as 3 × 109 bp, in how many base sequences would there be differences? It is these differences
in sequence of DNA which make every individual unique in their phenotypic appearance. If one aims to
find out genetic differences between two individuals or among individuals of a population, sequencing
the DNA every time would be a daunting and expensive task.
• Imagine trying to compare two sets of 3 × 10 6 base pairs. DNA fingerprinting is a very quick way to
compare the DNA sequences of any two individuals.
• DNA finger printing is related to molecular analysis of profiles of DNA samples. (CBSE 2004)
• DNA fingerprinting involves identifying differences in some specific regions in DNA sequence called as
repetitive DNA, because in these sequences, a small stretch of DNA is repeated many times.
 These repetitive DNA are separated from bulk genomic DNA as different peaks during density gradient
centrifugation.
 The bulk DNA forms a major peak and the other small peaks are referred to as satellite DNA. Depending
on base composition (A : T rich or G : C rich), length of segment, and number of repetitive units, the
satellite DNA is classified into many categories, such as micro-satellites, mini-satellites etc. These
sequences normally do not code for any proteins, but they form a large portion of human genome.
 These sequence show high degree of polymorphism and form the basis of DNA fingerprinting.
Since DNA from every tissue (such as blood, hair-follicle, skin, bone, saliva, sperm etc.), from an
individual show the same degree of polymorphism, they become very useful identification tool in
forensic applications.
 Further, as the polymorphisms are inheritable from parents to children, DNA fingerprinting is the
basis of paternity testing, in case of disputes.
• As polymorphism in DNA sequence is the basis of genetic mapping of human genome as well as of
DNA fingerprinting, it is essential that we understand what DNA polymorphism means in simple terms.
 Polymorphism (variation at genetic level) arises due to mutations.
 New mutations may arise in an individual either in somatic cells or in the germ cells (cells that
generate gametes in sexually reproducing organisms).
 If a germ cell mutation does not seriously impair individual’s ability to have offspring who can transmit
the mutation, it can spread to the other members of population (through sexual reproduction).
• Allelic sequence variation has traditionally been described as a DNA polymorphism if more than
one variant (allele) at a locus occurs in human population with a frequency greater than 0.01.
• In simple terms, if an inheritable mutation is observed in a population at high frequency, it is referred to

as DNA polymorphism.
 The probability of such variation to be observed in noncoding DNA sequence would be higher as
mutations in these sequences may not have any immediate effect/impact in an individual’s reproductive
ability. These mutations keep on accumulating generation after generation, and form one of the basis
of variability/polymorphism.
• There is a variety of different types of polymorphisms ranging from single nucleotide change to very large
scale changes. For evolution & speciation, such polymorphisms play very important role.
• The VNTR belongs to a class of satellite DNA referred to as mini-satellite. A small DNA sequence is
arranged tandemly in many copy numbers. The copy number varies from chromosome to chromosome in
an individual. The numbers of repeat show very high degree of polymorphism. As a result the size of
VNTR varies in size from 0.1 to 20 kb.
• Consequently, after hybridisation with VNTR probe, the autoradiogram gives many bands of differing
sizes. These bands give a characteristic pattern for an individual DNA. It differs from individual to
individual in a population except in the case of monozygotic (identical) twins.
• The sensitivity of the technique has been increased by use of polymerase chain reaction. Consequently,
DNA from a single cell is enough to perform DNA fingerprinting analysis.
• PCR & RFLP (Restriction Fragment Length Polymorphism) are used in DNA fingerprinting
(Q 2012).
BIOLOGY 85
Note • RBCs cannot be used for DNA fingerprinting as they do not have nucleus/DNA.
• In addition to application in forensic science, it has much wider application, such as in determining
population & genetic diversities. DNA finger printing also used in solving immigration cases and
identifying gene mutation. Currently, many different probes are used to generate DNA fingerprints.
95. Satellite DNA has proven to have a huge application in

Daily Practice Problem (DPP-10) the
NCERT P. No. 121-123 (1) Genetic engineering
91. Select the incorrect statement (2) Organ transplantation
(1) VNTR belongs to a class of mini satellite DNA (3) Sex determination
(2) DNA Sequencers work on the principle developed (4) Forensic science.
by Frederick sanger 96. Some of the steps of DNA fingerprinting are given be-
(3) HGP was coordinated by us department of energy low. Identify their correct sequence from the options
and the national institute of health given
(4) DNA fingerprinting pattern is not unique to an a. Electrophoresis of DNA fragments
individual b. Hybridisation with DNA probe
92. Select the correct sequences of steps in DNA finger- c. Digestion of DNA by restriction endonucleases
printing involving Southern blot hybridisation using d. Autoradiography
radiolabelled VNTR as proble
e. Blotting of DNA fragments to nitrocellulose
i. Hybridisation using labelled VNTR probe. membrane
ii. Isolation of DNA (1) c – a – b – e – d
iii. Transferring (blotting) of separated DNA fragments (2) c – a – e – b – d
to synthetic membranes, such as nitrocellulose or
(3) a – e – c – b – d
nylon.
(4) a – c – e – d – b
iv. Detection of hybridisation DNA fragments by
autoradiography. 97. DNA fingerprinting can be used
v. Separation of DNA fragments by electrophoresis. (1) To solve cases of disputed paternity and maternity
vi. Digestion of DNA by restriction endonucleases. (2) For criminal identification and forensics
(1) i, v, vi, ii, iii and iv (3) For personal identification
(2) ii, vi, v, iii, i and iv (4) More than one option is correct.
(3) v, i, vi, iii, iv and ii 98. One of the following is major requirement for DNA
fingerprinting
(4) ii, i, v, vi, iv and iii.
(1) Electron microscopy
93. If an inheritable mutation is observed in a population at
high frequency, it is referred as (2) Electrophoresis
(1) DNA polymorphism (3) ELISA
(2) Expressed sequence tag (4) HPLC.
(3) Sequence annonation 99. Transfer of DNA bands from agarose gel to nitrocellulose
or nylon membrane is
(4) Linkage.
(1) Southern transfer
94. DNA fingerprinting is a technique used in generating a
profile of an individual. This technique identifies the (2) Western transfer
various satellite DNA found in the sequence and has high (3) Northern transfer
degree of (4) Eastern transfer
(1) Metamorphism 100. The probe us ed initially by A lec Ja ffrey during
(2) Polymorphism development of DNA fingerprinting was
(3) Biomorphism (1) Ribozyme (2) SAT chromosomes
(4) Pathomorphism. (3) VNTR (4) rDNA.
BIOLOGY 87
6.11 Synopsis NCERT P. No. - 124
• Nucleic acids are long polymers of nucleotides. While DNA stores genetic information, RNA mostly
helps in transfer and expression of information.
• Though DNA and RNA both function as genetic material, but DNA being chemically and structurally
more stable is a better genetic material. However, RNA is the first to evolve and DNA was derived from
RNA.
• The hallmark of the double stranded helical structure of DNA is the hydrogen bonding between the bases
from opposite strands.
• The rule is that Adenine pairs with Thymine through two H-bonds, and Guanine with Cytosine through
three H-bonds. This makes one strand complementary to the other.
• The DNA replicates semiconservatively, the process is guided by the complementary H-bonding.
• A segment of DNA that codes for RNA may in a simplistic term can be referred as gene.
• During transcription also, one of the strands of DNA acts a template to direct the synthesis of
complementary RNA.
• In bacteria, the transcribed mRNA is functional, hence can directly be translated. In eukaryotes, the gene
is split.
• The coding sequences, exons, are interrupted by non-coding sequences, introns.
• Introns are removed and exons are joined to produce functional RNA by splicing.
• The messenger RNA contains the base sequences that are read in a combination of three (to make triplet
genetic code) to code for an amino acid.
• The genetic code is read again on the principle of complementarity by tRNA that acts as an adapter
molecule. There are specific tRNAs for every amino acid.
• The tRNA binds to specific amino acid at one end and pairs through H-bonding with codes on mRNA
through its anticodons.
• The site of translation (protein synthesis) is ribosomes, which bind to mRNA and provide platform for
joining of amino acids.
• One of the rRNA acts as a catalyst for peptide bond formation, which is an example of RNA enzyme
(ribozyme).
• Translation is a process that has evolved around RNA, indicating that life began around RNA. Since,
transcription and translation are energetically very expensive processes, these have to be tightly regulated.
• Regulation of transcription is the primary step for regulation of gene expression. In bacteria, more than
one gene is arranged together and regulated in units called as operons.
• Lac operon is the prototype operon in bacteria, which codes for genes responsible for metabolism of
lactose.
• The operon is regulated by the amount of lactose in the medium where the bacteria are grown.
• Therefore, this regulation can also be viewed as regulation of enzyme synthesis by its substrate.
• Human genome project was a mega project that aimed to sequence every base in human genome. This
project has yielded much new information. Many new areas and avenues have opened up as a consequence
of the project.
• DNA Fingerprinting is a technique to find out variations in individuals of a population at DNA level. It
works on the principle of polymorphism in DNA sequences.
• It has immense applications in the field of forensic science, genetic biodiversity and evolutionary biology.
• Beta galactosidase enzyme will be produced in a cell in which there is a non sense mutation in the lac y
gene. (NEET 2013)
• In an inducible operon, the genes are usually not expressed unless a signal turns them on. (NEET 2013)
• Satellite RNA is present in some plant viruses. (NEET 2013)
• Satellite DNA is important because it shows high degree of polymorphism in population and also
the same degree of polymorphism in an individual, which is heritable from from parents to children.
(AIPMT 2015)
• Chargaff's rule is not applicable to RNA and ssDNA. (AIPMT 2015)
• The movement of gene from one linkage group to another is called translocation. (AIPMT 2015)
• Correct about cancer cells in relation to mutations:
a. Mutations inactivate the cell control. (NEET 2016)
b. Mutations destroy telomerase inhibitor. (NEET 2016)
c. Mutations in proto-oncogenes accelerate the cell cycle. (NEET 2016)
• The mechanism that causes a gene to move from one linkage group to another is called translocation.
(NEET 2016)
• Cistron is the equivalent of a structural gene. (NEET 2016)
• During DNA replication, okazaki fragments are used to elongate the lagging strand away from the
replication fork. (NEET 2017)
• Ribosomal RNA (r- RNA) is the most abundant RNA in animal cell. (NEET 2017)
• DNA replication in bacteria occurs prior to fission. (NEET 2017)
• Spliceosomes are found in plants, animals and fungal cells but not found in prokaryotic (bacterial) cells.
(NEET 2017)
• Expressed sequence Tags (ESTs) refers to gene expressed as RNA. (NEET 2019)
• Regulatory proteins are the accessory proteins that interact with RNA polymerase and affect its role in
transcription. They can act both as activators and as repressors. (NCERT EXEMPLAR)
• The amino acid attaches to the t-RNA at its 3' end. (NCERT EXEMPLAR)
• To initiate translation, the mRNA first binds to the smaller ribosomal sub-unit. (NCERT EXEMPLAR)
BIOLOGY 89
1. Of the total number of ganes estimated in human 8. DNA polymorphism that has been used to develop the
genome, nearly 10% are contained in DNA fingerprinting technology is based upon
(1) Chromosome 11 (2) Chromosome 21 (1) Single nucleotide polymorphism
(3) Y-chromosome (4) Chromosome 1 (2) Variation in the number of tandemly repeated sequence
2. The technique of DNA fingerprinting relies on
(3) Number of protein coding genes
(1) Repetitive DNA (2) Minisatellite DNA
(4) Unique nucleotide bases present in genome.
(3) Both 1 and 2 (4) None of the above.
9. Number of neucleotide bases of a spiral of ds-DNA
3. The coding region on the DNA is called a
molecule is
(1) Muton (2) Cistron
(1) 5 (2) 10
(3) Operon (4) Recon.
(3) 20 (4) 40.
4. Which of the following alters the genetic code
(1) Frameshift mutation (2) Translocation 10. The okazaki fragments on the lag strand are joined
together by the enzyme
(3) Inversion (4) Suppressor mutation.
5. Heterogeneous nuclear RNA is converted into mRNA (1) DNA primase (2) DNA polymerase
by (3) DNA ligase (4) Helicase.
(1) Splicing (2) Capping 11. The process of synthesis of messenger RNA on the
(3) Tailing (4) All of the above. DNA template is called
6. Which of the following are the purine nucleotides (1) Replication (2) Transcription
(1) Adenine & cytosine (2) Guanine & thymine (3) Translation (4) Reverse transcription
(3) Cytosine & thymine (4) Adenine & guanine. 12. Meselson and Stahl used an isotope to demonstrate
7. Escherichia coli was infected with bacteriophage semi-conservative nature of DNA duplication. Which
having radioactive ( 32P) DNA in a culture. It was isotope did they use
blended, centrifuged and distribution of 32P determined. (1) 14C (2) 3 H
What does the experiment show
(3) 32P (4) 15N.
Bacteriophage 32
Radioactive ( P) 13. In double helix of DNA, there are sugar phosphate
labelled DNA
backbones with bases projected
(1) Outwardly (2) Outwardly & inwardly
(3) Inwardly (4) Interpolated
14. Human Genome Project (HGP) is closely associated
with the rapid development of a new area in biology
called as
(1) Biotechnology (2) Bioinformatics
(3) Biogeography (4) Bioscience.
15. Crick, one of the discoverer of DNA double helix was
men of
(1) Botany (2) Physics
32
Radioactive ( P)
detected in cells
(3) Chemistry (4) Zoology.
+ 16. Number of codons coding GGG is
No Radioactivity
detected in supernatant (1) Six (2) Four
(1) Protein is not the genetic material (3) Two (4) One.
(2) DNA is not involved in heredity 17. In lac operon system, lac gene-i codes for
(3) Nothing is proved (1) Inducer (2) Repressor
(4) DNA is the genetic material. (3) Promoter (4) -galactosidase.
18. Match the codons given in column–I with their 26. The successive nucleotides of RNA are covalently
respective amino acids given in column–II and choose linked through or antiparallal
the correct answer. (1) Glycosidic bonds
Column–I Column–II (2) Phosphodiester bonds
(Codons) (Amino acids)
(3) Hydrogen bonds
a. UUU i. Serine
(4) None of these
b. GGG ii. Methionine
27. Which type of RNA is most abundant in cell
c. UCU iii. Phenylalanine
(1) m RNA (2) t RNA
d. CCC iv. Glycine
e. AUG v. Proline (3) r RNA (4) catalytic RNA
(1) a–iii; b–iv; c–i; d–v; e–ii 28. Jacob and Monad studied la ctose meta bolism
in E. coli and proposed operon concept, which is
(2) a–iii; b–i; c–iv; d–v; e–ii
applicable for
(3) a–iii; b–iv; c–v; d–i; e–ii
(1) Prokaryotes (2) Eukaryotes
(4) a–ii; b–iv; c–i; d–v; e–iii.
(3) Protozoanes (4) All of these
19. What is the first step in the Southern blot technique?
29. Which one of the following is called polynucleotide
(1) Denaturation of DNA on the gel for hybridization joining enzyme
with specific probe
(1) Polymerase I (2) Polymerase II
(2) Production of a group of genetically identical
cells (3) Ligase (4) Ribonuclease
(3) Digestion of DNA by restriction enzyme 30. What is false about t RNA
(4) Denaturation of DNA from a nucleated cell such (1) It binds with an amino acid at it 5' end
as the one from the scene of crime. (2) It has five double stranded regions
20. What is not true for genetic code (3) It has a codon at one end which recognizes the
(1) It is degenerate anticodon on messenger RNA
(2) It is nearly universal (4) It looks like clover leaf in the three dimensional
(3) A code in mRNA is read in a non-contiguous fashion structure
(4) It is unambiguous. 31. The given figure shows the structure of ne with their
21. In DNA helix, cytosine is paired with guanine by parts labelled as A, B & C. Identify A, B and C.
(1) Covalent bond
(2) Phosphate bond
(3) Three hydrogen bonds
(4) Two hydrogen bonds.
22. Which form of RNA is most heterogeneous
(1) tRNA (2) mRNA
(3) rRNA (4) hnRNA
23. RNA polymerase requires for initiation (1) A–DNA; B–H1 histone; C–Histone octamer
(1) Sigma subunit (2) b-subunit (2) A–H1 histone; B–DNA; C–Histone octamer
(3) Rho submit (4) Spliceosome. (3) A–Histone octamer; B–RNA; C–H1 histone
24. While working on Neurospora crassa, Beadle and (4) A–RNA; B–H1 histone; C–Histone octamer.
Tatum proved
32. Wh at would ha ppen if in a gen e encodi ng a
(1) Every gene is responsible for a specific enzyme polypeptide of 50 amino acids, 25 th codon (UAU) is
(2) Plant cells are totipotent mutated to UAA
(3) DNA replication is semiconservative (1) A polypeptide of 24 amino acids will be formed
(4) Viruses have genetic material. (2) Two polypeptides of 24 and 25 amino acids will
25. The enzyme that breaks H2 bonds in DNA is be formed
(1) Helicase (2) Topoisomerase (3) A polypeptides of 49 amino acids will be formed
(3) Ligase (4) Polymerase (4) A polypeptide of 25 amino acids will be formed
BIOLOGY 91
33. DNA consists of two complementary nucleotide 41. Nucleotides are building blocks of nucleic acids. Each
chains. If the sequence of nucleotide in one of the nucleotide is a composite molecule formed by
chains is AGCTTCGA, then the nucleotide sequence (1) (Base-sugar-phosphate) n
in the other chain shall be
(2) Base-sugar-OH
(1) TAGCATAT
(3) Base-sugar-phosphate
(2) GATCCTAG
(4) Sugar-phosphate.
(3) TCGAAGCT
42. Which one of the following correctly represents the
(4) GCTAAGCT manner of replication of DNA?
34. During transcription, if the nucleotide sequence of
the DNA strand that is being coded is ATACG; then
the nucleotide sequence in the mRNA would be
(1) (2)
(1) UAUGC (2) UATGC
(3) TATGC (4) TCTGG
35. During replication of a bacterial chromosome DNA
synthesis starts from a replication origin site and
(1) Moves in one direction of the site
(3) (4)
(2) Moves in bi-directional way
(3) RNA primers are involved
(4) Is facilitated by tolemerase
43. During transcription, DNA site at which RNA
36. Which form of RNA has a structure resembling clover polymerase binds is called
leaf
(1) Promoter (2) Receptor
(1) tRNA (2) HnRNA
(3) Regulator (4) Enhancer.
(3) mRNA (4) rRNA
44. A solution of purified DNA will have pH
37. E.coli cells with a mutated z gene of the lac operon
(1) Basic (2) Highly basic
cannot grow in medium containing only lactose as
(3) Acidic (4) Neutral.
the source energy because
45. 1.7 m double helical DNA will have base pairs
(1) In the presence of glucose, E.coli cells do not
utilize lactose (1) 3·4 × 109 (2) 5 × 109
(2) They cannot transport lactose from the medium (3) 1.7 × 109 (4) 1·7 × 105.
into the cell 46. In operon model, RNA polymerase binds to
(3) The lac operon is constitutively active in these (1) Structural gene (2) Promoter gene
cells (3) Regulator (4) Operator gene.
(4) T h ey ca n not syn t h esi z e fun ct i on a l bet a - 47. Site for protein synthesis is
galactosidase (1) Nucleus (2) Cytosol
38. In lac operon system lac gene – I codes for (3) Ribosome (4) Lysosomes.
(1) Inducer (2) Repressor 48. One of the following is major requirement for DNA
(3) Promoter (4) β -galactosidase fingerprinting
39. Protein synthesis in an animal cell occurs (1) Electron microscopy (2) Electrophoresis
(1) Only on the ribosomes present in cytosol (3) ELISA (4) HPLC.
(2) On ribosomes present in cytoplasm as well as in 49. Which of the following inhibits protein synthesis by
mitochondria binding to 50 S ribosome
(3) Only on ribosomes attached to the nuclear (1) Tetracycline (2) Streptomycin
envelope and endoplasmic reticulum (3) Erythromycin (4) Penicillin.
(4) On ribosomes present in the nucleolus as well as 50. The bacterial genome contains
in cytoplasm (1) DNA and histone
40. Which amino acid has a single codon (2) DNA or histone
(1) Serine (2) Cysteine (3) DNA without histone
(3) Tyrosine (4) Tryptophan. (4) Neither DNA nor histone.
(Concept Builder)
1. In a DNA strand the nucleotides are linked together 8. One of the following is true with respect to AUG
by: (1) It codes for methionine only
(1) Glycosidic bonds (2) It is also an initiation codon
(2) Phosphodiester bonds (3) It codes for methionine in both prokaryotes and
(3) Peptide bonds eukaryotes
(4) Hydrogen bonds (4) All of the above
2. A nucleoside differs from a nucleotide. It lacks the 9. The first genetic material could be :
(1) Base (1) Protein
(2) Sugar (2) Carbohydrates
(3) Phosphate group (3) DNA
(4) Hydroxyl group (4) RNA
3. Both deoxyribose and ribose belong to a class of 10. With regard to mature mRNA in eukaryotes :
sugars called: (1) Exons and introns do not appear in the mature
(1) Trioses (2) Hexoses RNA
(3) Pentoses (4) Polysaccharides (2) Exons appear but introns do not appear in the
mature RNA
4. The fact that a purine base always paired through
hydrogen bonds with a pyrimidine base leads to, (3) Introns appear but exons do not appear in the
in the DNA double helix : mature RNA
(1) The antiparallel nature (4) Both exons and introns appear in the mature RNA.
(2) The semiconservative nature 11. Who amongst the following scientists had no
contribution in the development of the double helix
(3) Uniform width throughout DNA
model for the structure of DNA?
(4) Uniform length in all DNA.
(1) Rosalind Franklin
5. The net electric charge on DNA and histones is :
(2) Maurice Wilkins
(1) Both positive
(3) Erwin Chargaff
(2) Both negative
(4) Meselson and Stahl.
(3) Negative and positive, respectively
12. DNA is a polymer of nucleotides which are linked
(4) Zero. to each other by 3-5 phosphodiester bond. To
6. The promoter site and the terminator site for prevent polymerisation of nucleotides, which of the
transcription are located at : following modifications would you choose?
(1) 3 (downstream) end and 5 (upstream) end, (1) Replace purine with pyrimidines
respectively of the transcription unit (2) Remove/Replace 3 OH group in deoxy ribose
(2) 5 (upstream) end and 3 (downstream) end, (3) Remove/Replace 2 OH group with some other
respectively of the transcription unit group in deoxy ribose
(3) The 5 (upstream) end (4) Both ‘2’ and ‘3’.
(4) The 3 (downstream) end. 13. Discontinuous synthesis of DNA occurs in one
7. Which of the following statements is the most strand, because :
appropriate for sickle cell anaemia? (1) DNA molecule being synthesised is very long
(1) It cannot be treated with iron supplements (2) DNA dependent DNA polymearse catalyses
(2) It is a molecular disease polymerisation only in one direction (5  3)
(3) It confers resistance to acquiring malaria (3) It is a more efficient process
(4) All of the above. (4) DNA ligase has to have a role
BIOLOGY 93
14. Which of the following steps in transcription is 21. If the sequence of nitrogen bases of the coding
catalysed by RNA polymerase? strand of DNA in a transcription unit is
(1) Initiation (2) Elongation 5 - A T G A A T G - 3,
(3) Termination (4) All of the above. The sequence of bases in its RNA transcript would
15. Control of gene expression takes place at the level be
of: (1) 5 - A U G A A U G - 3
(1) DNA-replication (2) 5 - U A C U U A C - 3
(2) Transcription (3) 5 - C A U U C A U - 3
(3) Translation (4) 5 - G U A A G U A - 3
(4) None of the above 22. The RNA polymerase holoenzyme transcribes :
16. Regulatory proteins are the accessory proteins that (1) The promoter, structural gene and the terminator
interact with RNA polymerase and affect its role in region
transcription. Which of the following statements is (2) The promoter, and the terminator region
correct about regulatory protein?
(3) The structural gene and the terminator regions
(1) They only increase expression
(4) The structural gene only.
(2) They only decrease expression
23. If the base sequence of a codon in mRNA is 5'-AUG-
(3) They interact with RNA polymerase but do not 3', the sequence of tRNA pairing with it must be
affect the expression
(1) 5' - UAC - 3' (2) 5' - CAU - 3'
(4) They can act both as activators and as repressors
(3) 5' - AUG - 3' (4) 5' - GUA - 3'
17. Which of the following are the functions of RNA?
24. The amino acid attaches to the tRNA at its :
(1) It is a carrier of genetic information from DNA
(1) 5 - end
to ribosomes synthesising polypeptides.
(2) 3 - end
(2) It carries amino acids to ribosomes.
(3) Anti codon site
(3) It is a constituent component of ribosomes.
(4) DHU loop.
(4) All of the above.
25. To initiate translation, the mRNA first binds to :
18. While analysing the DNA of an organism a total
(1) The smaller ribosomal sub-unit
number of 5386 nucleotides were found out of which
the proportion of different bases were: Adenine = (2) The larger ribosomal sub-unit
29%, Guanine = 17%, Cytosine = 32%, Thymine = (3) The whole ribosome
17%. Considering the Chargaff’s rule it can be (4) No such specificity exists.
concluded that : 26. In E.coli, the lac operon gets switched on when :
(1) It is a double stranded circular DNA (1) Lactose is present and it binds to the repressor
(2) It is single stranded DNA (2) Repressor binds to operator
(3) It is a double stranded linear DNA (3) RNA polymerase binds to the operator
(4) No conclusion can be drawn. (4) Lactose is present and it binds to RNA polymerase.
19. In some viruses, DNA is synthesised by using RNA 27. Which was the last human chromosome to be
as template. Such a DNA is called : completely sequenced :
(1) A-DNA (2) B-DNA (1) Chromosome 1
(3) c DNA (4) r DNA (2) Chromosome 11
20. If Meselson and Stahl’s experiment is continued (3) Chromosome 21
for four generations in bacteria, the ratio of (4) Chromosome x.
15
N/ 15 N: 15 N/ 14 N: 14 N/ 14 N containi ng DNA in 28. The human chromosome with the highest and least
the fourth generation would be : number of genes in them are respectively :
(1) 1 : 1 : 0 (1) Chromosome 21 and Y
(2) 1 : 4 : 0 (2) Chromosome 1 and X
(3) 0 : 1 : 3 (3) Chromosome 1 and Y
(4) 0 : 1 : 7. (4) Chromosome X and Y.
(Line by Line
from NCERT)
• Instructions for Questions 1 to 10 9. Assertion : One codon may code for more than one amino
acid.
Read the assertion and reason carefully to mark the
correct option in question Reason : A codon is degenerate and ambiguous.
(1) Both assertion and reason are correct and reason 10. Assertion : If each strand from a parental DNA acts as
is the correct explanation of assertion. template for synthesis of a new strand. the two double
(2) Both assertion and reason are correct but reason stranded daughter DNA thus produced would be identical
is not the correct explanation of assertion. to the parental DNA molecule.
(3) Assertion is correct but reason is not correct. Reason : The length of DNA double helix in a typical
(4) Assertion is not correct but reason is correct. mammalian cell is calculated simply by multiplying
the total number of bp with distance between two
1. Assertion : rRNA is the most abundant RNA. consecutive bp.
Reason : rRNA is a constituent of ribosomes.
2. Assertion : The nitrogen bases of the two chains of DNA • Instructions for Questions 11 to 15
are held together by hydrogen bonds. In the light of the given statements, choose the
Reason : Both chains of DNA are antiparallel. correct options in given below:
3. Assertion : DNA fingerprinting involves identifying (1) Both Statement I and Statement II are correct.
differences in some specific regions in DNA sequence. (2) Both Statement I and Statement II are incorrect.
Reason : In repetitive DNA sequences, a small stretch (3) Statement I is correct but Statement II is incorrect.
of DNA is repeated many times.
(4) Statement I is incorrect but Statement II is correct.
4. Assertion : Replication and transcription occur in the
nucleus but translaton occurs in the cytoplasm in bacteria. 11. Statement I : Transforming substance was not a protein
Reason : mRNA is transferred from the nucleus in the or RNA.
cytoplasm where ribosomes and amino acids are available Statement II : Proteases and RNases do not affect
for protein synthesis. transformation.
5. Assertion : The sugar phosphate backbone of two chains 12. Statement I : Deoxyribonuclesside triphosphate serve
in DNA double helix show anti parallel polarity.
dual purposes in replication process.
Reason : The phosphodfoster bonds in one strand go
Statement II : Deoxyribonucleotide triphosphate act
from a 3' carbon of one nucleotide to a 5' carbon of
as substrates and also provides energy for polymerisation.
adjacent nucleotide, whereas those in complementary
strand go vice versa. 13. Statem ent I : Monocis tronic genes are found in
6. Assertion : In Griffith's experiment, a mixture of heat- prokaryotes.
killed virulent bacteria R and live non-virulent bacteria Stateme nt I I : Polycis tronic genes a re found in
S, lead to the death of mice. eukaryotes.
Reason : Transforming principle got transferred from 14. Statement I : There is single DNA-dependent RNA
heat-killed R strain to S strain and made it virulent. polymerase that catalyses transcription of all types of
7. Assertion : The mechanism of DNA replication is RNA (mRNA, tRNA and rRNA) in eukaryotes.
semiconservative in nature. Statement II : In bacteria, there are at least three RNA
Reason : Each of the complementary strands of the polymerases are required.
parental double helix is conserved during the process.
15. Statement I : Chromosome 1 has 231 genes and the y
8. Assertion : The predominant site for control of gene has 2968 genes.
expression in prokaryotes is transtational initiation.
Statement II : Repetitive sequences of DNA are thought
Reason : The activity of RNA polymerase is regulated to have direct coding function and shed light on
by accessory proteins, which affect recognition of start chromosome structure, dynamics and evolution.
sites.
BIOLOGY 95
(Direct from
NCERT)
Match the following column and choose the correct 6. Column–I Column–II
option
a. Termination i. Aminoacyl synthetase
1. Column–I Column–II b. Translation ii. Okazaki fragments
a.  × 174 DNA (i) 3.3×109 bp c. Transcription iii. GTP dependent release factor
b. Bacteriophage lambda DNA (ii) 4.6×106 bp d. DNA replication iv. RNA polymerase
c. E. coli DNA (iii) 48502 bp (1) a–i, b–iii, c–i, d–iv
d. Haploid content (iv) 5386 bases (2) a–i, b–iv, c–ii, d–iii
of human DNA (3) a–iii, b–i, c–iv, d–ii
(1) a–iv, b–iii, c–ii, d–i (2) a–i, b–ii, c–iii, d–iv (4) a–iv, b–ii, c–i, d–iii.
(3) a–ii, b–iii, c–iv, d–i (4) a–i, b–iv, c–ii, d–iii. 7. Column–I Column–II
2. Column–I Column–II a. -galactosidase i. Joining of DNA fragments
a. Incomplete dominance i. Hershy and Chase b. Permease ii. Peptide bond formation
b. Linkage ii. Antirrhinum sp. c. Ligase iii. Hydrolysis of lactose
c. Transforming principle iii. Griffith d. Ribozyme iv. Increase permeability to
d. Proved that DNA is the iv. Morgan -galactosidase
genetic material (1) a–ii; b–i; c–iv; d–iii (2) a–iii; b–iv; c–i; d–ii
(1) a–i, b–iv, c–iii, d–ii (2) a–iv, b–ii, c–iii, d–i (3) a–ii; b–iv; c–i; d–iii (4) a–i; b–ii; c–iv; d–iii.
(3) a–ii, b–iii, c–iv, d–i (4) a–ii, b–iv, c–iii, d–i.
8. Column–I Column–II
3. Column–I Column–II a. F. Meischer i. DNA double helix
(Scientists) (Discoveries) b. Griffith ii. Nuclein
a. Alec Jeffreys (i) Lac operon c. Hershey and chase iii. S. pneumoniase
b. F. Sanger (ii) Automated DNA d. Watson and Crick iv. Bacteriophages
sequencers
e. Wilkins and Franklin v. X-ray diffraction studies
c. Jacob and Monod (iii) DNA finger printing
d. Avery, Mac Leod (iv) Transforming principle (1) a-ii, b-iii, c-iv, d-i, e-v
and Mc Carty (2) a-v, b-iii, c-iv, d-i, e-v
(3) a-i, b-iii, c-iv, d-ii, e-v
(1) a–ii, b–iii, c–iv, d–i
(4) a-i, b-iv, c-iii, d-ii, e-v.
(2) a–iii, b–ii, c–i, d–iv
9. Column–I Column–II
(3) a–iii, b–ii, c–iv, d–i
a. Sigma factor i. 5' - 3'
(4) a–i, b–ii, c–iii, d–iv.
b. Capping ii. Intiation
4. Column–I Column–II c. Tailing iii. Termination
a. AUG i. Phenylalanine d. Coding strand iv. 5' end
b. UAA ii. Methionine e. Colur blindness v. 3' end
c. UUU iii. Tryptophan
(1) a–iii, b–v, c–iv, d–ii (2) a–ii, b–iv, c–v, d–i
d. UGG iv. Termination
(3) a–ii, b–v, c–iv, d–iii (4) a–iii, b–v, c–iv, d–i.
(1) a–i, b–iv, c–ii, d–iii (2) a–ii, b–iv, c–i, d–iii
(3) a–iv, b–iii, c–ii, d–i (4) a–iv, b–i, c–iii, d–ii. 10. Column–I Column–II
a. Operator site (i) Binding site for RNA
5. Column–I Column–II polymerase
a. VNTR i. Largest gene b. Promoter site (ii) Binding site for repressor
b. Introns and Exons ii. DNA fingerprinting molecule
c. Dystrophin iii. Bulk DNA c. Regulator gene (iii) Codes for protein/ enzyme
d. Satellite iv. Splicing d. Structural gene (iv) Codes for repressor molecule
(1) a–iii; b–iv; c–i; d–ii (1) a–ii, b–i, c–iii, d–iv
(2) a–ii; b–iv; c–i; d–iii (2) a–ii, b–i, c–iv, d–iii
(3) a–ii; b–i; c–iv; d–iii (3) a–iv, b–iii, c–i, d–ii
(4) a–iv; b–i; c–ii; d–iii. (4) a–ii, b–iii, c–i, d–iv.
(Previous Year Questions)
1. Which one of the following makes use of RNA as a 10. Which is not a salient feature of genetic code
template to synthesize DNA [AIPMT 2005] (AIPMT 2010)
(1) Reverse transcriptase (1) Ambiguous (2) Universal
(2) DNA dependant RNA polymerase (3) Specific (4) Degenerate
(3) DNA polymerase 11. PCR and RFLP are employed in (AIPMT 2012)
(4) RNA polymerase (1) DNA sequencing
2. Which one is correctly matched (AIPMT 2008) (2) Genetic fingerprinting
(1) AUG, ACG – start or methionine (3) Study of enzymes
(2) UUA, UCA - Leucine (4) Genetic transformation.
(3) GUU-Alanine 12. Which is not part of transcription unit (AIPMT 2012)
(4) UAG, UGA- Stop (1) Promoter (2) Terminator
3. Removal of introns and joining the exons in a defined (3) Structural gene (4) Inducer
order in a transcription unit is (AIPMT 2009) 13. Read statements a–d (AIPMT 2012)
(1) Splicing (2) Capping
(a) In transcription, adenosine pairs with uracil
(3) Tailing (4) Transformation.
(b) Regulation of lac operon by repressor is positive
4. Whose experiments cracked DNA and discovered regulation
triplet nature of genetic code (AIPMT 2009)
(c) Human genome has approximate 50,000 genes
(1) Beadle and Tatum (2) Hershey and Chase
(d) Haemophilia is sex–linked recessive disease
(3) Morgan & Sturtevant (4) Nirenberg & Matthaei.
How many of above statements are correct
5. Site of tRNA that binds to mRNA molecule is
(1) Two (2) Three
(AIPMT 2009)
(3) Four (4) One.
(1) 3' end (2) 5' end
14. Basis of DNA finger printing is (AIPMT 2012)
(3) Codon (4) Anticodon.
6. During protein synthesis in an organism, at one point (1) Double helix
the process comes to a halt. Select the group of the (2) Error in base sequence
three codons from the following, from which anyone (3) Polymorphism in sequence/RFLP/satellite DNA
of the three could bring about this halt. (AIIMS 2009) (4) DNA coiling.
(1) UUU, UCC, UAU (2) UUC, UUA, UAC 15. Select the correct option (AIPMT 2014)
(3) UAG, UGA, UAA (4) UUG, UCA, UCG. Direction of Direction of reading of
7. Lac operon consists of (AIPMT 2010) the DNA synthesis template strand RNA
(1) Four regulatory genes only (1) 3' ----> 5' 3' ----> 5'
(2) Two regulatory genes and two structural genes (2) 5' ----> 3' 3' ----> 5'
(3) Three regulatory genes and three structural genes (3) 3' ----> 5' 5' ----> 3'
(4) One regulatory gene and three structural genes. (4) 5' ----> 3' 5' ----> 3'
8. 3' – 5' phosphodiester linkage occurs between 16. Which one of the following is wrongly matched
(1) One DNA and other DNA strands (AIPMT 2010) (AIPMT 2014)
(2) One nucleoside with another nucleoside (1) Operon-Structural genes, operator and promoter.
(3) One nucleotide with another nucleotide (2) Transcription-Writing information from DNA
(4) One nitrogenous base with pentose sugar. to t-RNA.
9. Which does not follow central dogma of molecular (3) Translation-Using information in m-RNA to
biology (AIPMT 2010) make protein.
(1) Mucor (2) Chlamydomonas (4) Repressor protein-Binds to operator to stop
(3) HIV (4) Pea. enzyme synthesis.
BIOLOGY 97
17. An analysis of chromosomal DNA using the Southern 25. Which of the following nitrogenous base is double ringed
blot hybridization technique does not use (1) Guanine (2) Thymine (AMU 2016)
(AIPMT 2014) (3) Uracil (4) Cytosine.
(1) PCR (2) Electrophoresis
26. In DNA finger printing, DNA hybridisation with the
(3) Blotting (4) Autoradiography. help of specific DNA probe is done through
18. Comm on l y used vect or s for h um an genom e (AMU 2016)
sequencing are (AIPMT 2014) (1) Western blotting (2) Northern blotting
(1) T/A Cloning Vectors (2) T - DNA (3) Southern blotting (4) Eastern blotting.
(3) BAC and YAC (4) Expression Vectors. 27. Who proved experimentally that DNA is genetic
19. Identify the correct order of organisation of genetic material (AMU 2016)
material from largest to smallest (AIPMT 2015) (1) O. Avery and Colleagues
(1) Genome, chromosome, nucleotide, gene (2) J. Waston and F. Crick
(2) Genome, chromosome, gene, nucleotide (3) W. Arber and Colleagues
(3) Chromosome, genome, nucleotide, gene (4) G. Mendel.
(4) Chromosome, gene, genome, nucleotide. 28. Which one of the following is the starter codon
20. Satellite DNA is important because it (AIPMT 2015) (1) UAA (2) UAG (NEET 2016)
(1) Shows high degree of polymorphism in population (3) AUG (4) UGA.
and also the same degree of polymorphism in an
29. Which of the following is required as inducer(s) for
individual, which is heritable from parents to
the expression of Lac operon (NEET 2016)
children
(1) Lactose (2) Lactose & galactose
(2) Does not code for proteins and is same in all
members of the population (3) Glucose (4) Galactose.
(3) Codes for enzymes needed for DNA replication 30. Which of the following statements is not true for
cancer cells in relation to mutations (NEET 2016)
(4) Codes for proteins needed in cell cycle.
(1) Mutations inactivate the cell control
21. Which one of the following is not applicable to RNA
(2) Mutations inhibit production of telomerase
(1) 5' phosphoryl and 3' hydroxyl ends
(3) Mutations in proto-oncogenes accelerate the cell
(2) Heterocyclic nitrogenous bases (AIPMT 2015)
cycle
(3) Chargaff's rule
(4) Mutations destroy telomerase inhibitor.
(4) Complementary base pairing.
31. Which of the following is not required for any of the
22. The movement of a gene from one linkage group to techniques of DNA fingerprinting available at present
another is called (AIPMT 2015) (1) Restriction enzymes (NEET 2016)
(1) Translocation (2) Crossing over
(2) DNA - DNA hybridization
(3) Inversion (4) Duplication. (3) Polymerase chain reaction
23. Gene regulation governing lactose operon of E.coli
(4) Zinc finger analysis.
that involves the lac I gene products is (AIPMT 2015)
32. A complex of ribosomes attached to a single strand
(1) Negatively and repressible because repressor
of RNA is known as (NEET 2016)
protein prevents transcription
(1) Polypeptide (2) Okazaki fragment
(2) Feedback inh ibition because excess of  -
galactosidase can switch off transcription (3) Polysome (4) Polymer.
(3) Positive and inducible because it can be induced 33. Taylor conducted the experiments to provide
by lactose semiconservative mode of chromosome replication on
(4) Negative and inducible because repressor protein (1) Drosophila melanogaster (NEET 2016)
prevents transcription. (2) E. coli
24. The following is not a character of RNA: (AMU 2016) (3) Vinca rosea
(1) RNA is unstable and degradable (4) Vicia faba
(2) RNA mutates at faster rate than DNA 34. The equivalent of a structural gene is (NEET 2016)
(3) RNA evolves slowly (1) Operon (2) Recon
(4) RNA is catalytic/reactive. (3) Muton (4) Cistron.
35. Which of the following rRNAs acts as structural RNA 43. DNA replication in bacteria occurs (NEET 2017)
as well as ribozyme in bacteria? (NEET 2016) (1) Within nucleolus
(1) 23s rRNA (2) 5.8s rRNA (2) Prior to fission
(3) 5s rRNA (4) 18s rRNA (3) Just before transcription
36. A molecule that can act as a genetic material must (4) During S-phase
fulfill the traits given below, except (NEET 2016) 44. Spliceosomes are not found in cells of (NEET 2017)
(1) It should be unstable structurally and chemically (1) Fungi (2) Animals
(2) It should provide the scope for slow changes that (3) Bacteria (4) Plants.
are required for evolution 45. The association of histone H1 with a nucleosome
(3) It should be able to express itself in the form of indicates (NEET 2017)
Mendelian characters (1) DNA replication is occurring.
(4) It should be able to generate its replica. (2) The DNA is condensed into a Chromatin Fibre.
37. DNA-dependen t RNA pol ym era se ca t a l yz es (3) The DNA double helix is exposed.
transcription on one strand of the DNA which is called (4) Transcription is occurring
the (NEET 2016) 46. Who proved that DNA is basic genetic meterial
(1) Alpha strand (1) Griffith/Avery et al (NEET 2017)
(2) Antistrand (2) Watson
(3) Template strand (3) Boveri and Sutton
(4) Coding strand (4) Hershey and Chase.
38. The final proof for DNA as the genetic material came 47. Nucleotides are building blocks of nucleic acids. Each
from the experiments of (NEET 2017) nucleotide is a composite molecule formed by
(1) Hershey and Chase (1) Base-sugar-phosphate (AIIMS 2017)
(2) Avery, Mcleod and McCarty (2) Base-sugar-OH
(3) (Base-sugar-phosphate) n
(3) Hargobind Khorana
(4) Sugar-phosphate.
(4) Griffith.
48. The experim enta l pr oof for semiconservat ive
39. DNA fragments are (NEET 2017) replication of DNA was first shown in a (NEET 2018)
(1) Negatively charged (1) Fungus
(2) Neutral (2) Bacterium
(3) Either positively or negatively charged depending (3) Plant
on their size (4) Virus
(4) Positively charged. 49. Select the correct match. (NEET 2018)
40. If there are 999 bases in an RNA that codes for a (1) Alec Jeffreys—Streptococcus pneumoniae
protein with 333 amino acids, and the base at position (2) Alfred Hershey and Martha Chase—TMV
901 is deleted such that the length of the RNA
(3) Matthew Meselson and F. Stahl—Pisum sativum
becomes 998 bases, how many codons will be altered?
(4) Francois Jacob and Jacques Monod—Lac operon
(1) 11 (2) 33 (NEET 2017)
50. AGGTATCCCAT is a sequence from the coding
(3) 333 (4) 1. strand of a gene. What will be the corresponding
41. During DNA replication, Okazaki fragments are used sequence of the transcribed mRNA? (NEET 2018)
to elongate: (NEET 2017) (1) AGGUAUCGCAU
(1) The lagging strand towards replication fork. (2) UGGTUTCGCAT
(2) The leading strand away from replication fork. (3) ACCUAUGCGAU
(3) The lagging strand away from the replication fork. (4) UCCAUAGCGUA.
(4) The leading strand towards replication fork. 51. All of the following are part of an operon except
42. Which of the following RNAs should be most (1) An operator (NEET 2018)
abundant in animal cell? (NEET 2017) (2) Structural genes
(1) t-RNA (2) m-RNA (3) An enhancer
(3) mi-RNA (4) r-RNA (4) A promoter.
BIOLOGY 99
52. What will be the sequence of mRNA produced by the 59. Expressed Sequence Tags (ESTs) refers to
following stretch of DNA ? (NEET 2019) (1) Polypeptide expression (NEET 2019)
3' ATGCATGCATGCATG5' TEMPLATE STRAND (2) DNA polymorphism
5' TACGTACGTACGTAC3' CODING STRAND (3) Novel DNA sequences
(1) 3' AUGCAUGCAUGCAUG 5' (4) Gene expressed as RNA.
(2) 5' UACGUACGUACGUAC 3' 60. Match the following genes of the Lac Operon with
(3) 3' UACGUACGUACGUAC 5' their respective products (NEET 2019)
(4) 5' AUGCAUGCAUGCAUG 3' (a) i gene (i)  - galactosidase
53. Match the following RNA polymerase with their (b) z gene (ii) Permease
transcribed products : (NEET 2019) (c) a gene (iii) Repressor
(a) RNA polymerase I (i) tRNA (d) y gene (iv) Transacetylase
(b) RNA polymerase II (ii) rRNA Select the correct option:-
(c) RNA polymerase III (iii) hnRNA (1) a-(iii), b-(i), c-(ii), d-(iv)
Select the correct option from the following : (2) a-(iii), b-(i), c-(iv), d-(ii)
(1) a-i, b-iii, c-ii (2) a-i, b-ii, c-iii (3) a-(iii), b-(iv), c-(i), d-(ii)
(3) a-ii, b-iii, c-i (4) a-iii, b-ii, c-i (4) a-(i), b-(iii), c-(ii), d-(iv).
54. From the following, identify the correct combination 61. E. Coli has only 4.6×10 6 base pairs and completes
of salient features of Genetic Code (NEET 2019) the process of replication within 18 minutes; then the
(1) Universal, Non-ambiguous, Overlapping average rate of polymerisation is approximately
(2) Degenerate, Overlapping, Commaless (1) 1000 base pairs/second (NEET 2020)
(3) Universal, Ambiguous, Degenerate (2) 2000 base pairs/second
(4) Degenerate, Non-overlapping, Non-ambiguous (3) 3000 base pairs/second
55. Which scientist experimentally proved that DNA is (4) 4000 base pairs/second.
the sole genetic material in bacteriophage ? 62. Which is the basis of genetic mapping of human
(NEET 2019) genome as well as DNA finger printing?(NEET 2020)
(1) Beadle and Tautum (2) Messelson and Stahl (1) Polymorphism in RNA sequence
(3) Hershey and Chase (4) Jacob and Monod (2) Polymorphism in DNA sequence
56. In the process of transcription in Eukaryotes, the RNA (3) Single nucleotide polymorphism
polymerase I transcribes :- (NEET 2019) (4) Polymorphism in hnRNA sequence
(1) mRNA with additional processing, capping and 63. The term ‘Nuclein’ for the genetic material was used
tailing by (NEET 2020)
(2) tRNA, 5 SrRNA and snRNAs (1) Mendel (2) Franklin
(3) rRNAs.28 S, 18 S and 5.8 S (3) Meischer (4) Chargaff.
(4) Precursor of mRNA, hnRNA 64. In the polynucleotide chain of DNA, a nitrogenous
57. What initiation and termination factors are involved base is linked to the –OH of (NEET 2020)
in transcription in Eukaryotes ? (1) 1 C pentose sugar (2) 2 C pentose sugar
(1)  and , respectively (NEET 2019) (3) 3 C pentose sugar (4) 5 C pentose sugar.
(2)  and , respectively 65. The first phase of translation is (NEET 2020)
(3)  and , respectively (1) Binding of mRNA to ribosome
(4)  and , respectively. (2) Recognition of DNA molecule
58. Under which of the following conditions will there (3) Aminoacylation of tRNA
be no change in the reading frame of following (4) Recognition of an anti-codon.
mRNA? (NEET 2019) 66. If the distance between two consecutive base pairs is
5' AACAGCGGUGCUAUU 3' 0.34 nm and the total number of base pairs of a DNA
(1) Deletion of G from 5th position double helix in a typical mammalian cell in 6.6 ×10 9
(2) Insertion of A and G at 4 th and 5 th positions bp, then the length of the DNA is approximately:
respectively (NEET 2020)
(3) Deletion of GGU from 7 th, 8th and 9th positions (1) 2.0 meters (2) 2.5 meters
(4) Insertion of G at 5th position. (3) 2.2 meters (4) 2.4 meters.
67. Name the enzyme that facilitates opening of DNA 74. What is the role of RNA polymerase III in the process
helix during transcription. (NEET 2020) of transcription in eukaryotes ? (NEET 2021)
(1) DNA ligase (2) DNA helicase (1) Transcribes rRNAs (28S, 18S and 5.8S)
(3) DNA polymerase (4) RNA polymerase (2) Transcribes tRNA, 5s rRNA and snRNA
68. Which of the following statements is correct? (3) Transcribes precursor of mRNA
(NEET 2020) (4) Transcribes only snRNAs.
(1) Adenine pairs with thymine through two H-bonds. 75. Which one of the following statements about Histones
(2) Adenine pairs with thymine through one H-bond. is wrong? (NEET 2021)
(3) Adenine pairs with thymine through three H-Bonds. (1) Histones are organized to form a unit of 8
(4) Adenine does not pair with thymine. molecules.
69. If Adenine makes 30% of the DNA molecule, what (2) The pH of histones is slightly acidic.
will be the percentage of Thymine, Guanine and (3) Histones are rich in amino acids - Lysine and
Cytosine in it ? (NEET 2021) Arginine.
(1) T : 20 ; G : 30 ; C : 20 (4) Histones carry positive charge in the side chain.
(2) T : 20 ; G : 20 ; C : 30 76. Identify the correct statement. (NEET 2021)
(3) T : 30 ; G : 20 ; C : 20 (1) In capping, methyl guanosine triphosphate is
(4) T : 20 ; G : 25 ; C : 25. added to the 3' end of hnRNA.
70. Which of the following RNAs is not required for the (2) RNA polymerase binds with Rho factor to
synthesis of protein ? (NEET 2021) terminate the process of transcription in bacteria.
(1) mRNA (2) tRNA (3) The coding strand in a transcription unit is copied
(3) rRNA (4) siRNA. to an mRNA.
71. Statement I : The condon 'AUG' codes for methionine (4) Split gene arrangement is characteristic of
and phenylalanine. (NEET 2021) prokaryotes.
Statement II : 'AAA' and 'AAG' both codons code for 77. DNA fingerprinting involves identifying differences
the amino acid lysine. in some specific regions in DNA sequence, called as:
In the light of the above statements, choose the correct (NEET 2021)
answer from the options given below. (1) Satellite DNA (2) Repetitive DNA
(1) Both statement I and Statement II are true. (3) Single nucleotides (4) Polymorphic DNA.
(2) Both Statement I and Statement II are false 78. DNA polymorphism forms the basis of:
(3) Statement I is correct but Statement II is false (NEET 2022)
(4) Statement I is incorrect but Statement II is true. (1) Both genetic mapping and DNA finger printing
72. Which is the "Only enzyme" that has "Capability" to (2) Translation
catalyse Initiation, Elongation and Termination in the
process of transcription in prokaryotes ?(NEET 2021) (3) Genetic mapping
(1) DNA dependent DNA polymerase (4) DNA finger printing
(2) DNA dependent RNA polymerase 79. The process of translation of mRNA to proteins begins
(3) DNA Ligase as soon as: (NEET 2022)
(4) DNase. (1) Both the subunits join together to bind with
73. Complete the flow chart on central dogma. mRNA
(NEET 2021) (2) The tRNA is activated and the larger subunit of
(b) (c) ribosome encounters mRNA
(a) DNA mRNA (d)
(3) The small subunit of ribosome encounters mRNA
(1) (a )-Repli ca t ion ; (b)-Tr a n scr i pt ion ; (c)- (4) The larger subunit of ribosome encounters
Transduction; (d)-Protein mRNA
(2) (a )-Tr a nsl a t i on ; (b)-Repl i ca t ion ; (c)-
80. If the length of a DNA molecule is 1.1 metres, what
Transcription; (d)-Transduction
will be the approximate number of base pairs?
(3) (a )-Repli ca t ion ; (b)-Tr a n scr i pt ion ; (c)-
(NEET 2022)
Translation; (d)-Protein
6
(4) (a )-Tr a n sduct ion ; (b)-Tr an sl a ti on ; (c)- (1) 133 × 10 bp (2) 6.6 × 106 bp
Replication; (d)-Protein. (3) 3.3 × 109 bp (4) 6.6 × 109 bp
BIOLOGY 101
81. Read the following statements and choose the set of 86. Given below are two statements: (NEET 2022)
correct statements: (NEET 2022) St at em ent I: DNA pol ym era ses ca t a lyse
(a) Euchromatin is loosely packed chromatin polymerisation only in one direction, that is 5'  3'
(b) Heterochromatin is transcriptionally active Statement II: During replication of DNA, on one
(c) Histone octomer is wrapped by negatively strand the replication is continuous while on other
strand it is discontinuous.
charged DNA in nucleosome
In the light of the above statements, choose the
(d) Histones are rich in lysine and arginine
correct answer from the options given below :
(e) A typical nucleosome contains 400 bp of DNA
(1) Both Statement I and Statement II are correct
helix
(2) Both Statement I and Statement II are incorrect
Choose the correct answer from the options given
(3) Statement I is correct but Statement II is incorrect
below:
(4) Statement I is incorrect but Statement II is correct
(1) (b), (e) Only (2) (a), (c), (e) Only
87. Match List–I with List–II : (NEET 2022)
(3) (b), (d), (e) Only (4) (a), (c), (d) Only
List–I List–II
82. In an E. Coli strain i gene gets mutated and its product
(a) Bacteriophage   174 (i) 48502 base pairs
can not bind the inducer molecule. If growth medium
is provided with lactose, what will be the outcome? (b) Bacteriophage lambda (ii) 5386 nucleotides
(NEET 2022) (c) Escherichia coli (iii) 3.3×109 base pairs
(1) z, y, a genes will not be translated (d) Haploid content (iv) 4.6×106 base pairs
(2) RNA polymerase will bind the promoter region of human DNA.
(3) Only z gene will get transcribed Choose the correct answer from the options given
below:
(4) z, y, a genes will be transcribed.
(1) (a)–(i), (b)–(ii), (c)–(iii), (d)–(iv)
83. Ten E.coli cells with 15N - dsDNA are incubated in
(2) (a)–(ii), (b)–(iv), (c)–(i), (d)–(iii)
medium containing 14N nucleotide. After 60 minutes,
how many E.coli cells will have DNA totally free (3) (a)–(ii), (b)–(i), (c)–(iv), (d)–(iii)
from 15N? (NEET 2022) (4) (a)–(i), (b)–(ii), (c)–(iv), (d)–(iii)
(1) 60 cells (2) 80 cells 88. If DNA contained sulphur instead of phosphorus and
proteins contained phosphorus instead of sulfur, what
(3) 20 cells (4) 40 cells would have been the outcome of Hershey and Chase
84. In lac operon, z gene codes for : (NEET 2022) experiment? (NEET 2022)
(1)  -galactosidase (2) Permease (1) No radioactive sulfur in bacterial cells
(3) Repressor (4) Transacetylase (2) Both radioactive sulfur and phosphorus in
85. Match List–I with List–II : (NEET 2022) bacterial cells
List–I List–II (3) Radioactive sulfur in bacterial cells
(a) In lac operon i gene (i) transacetylase (4) Radioactive phosphorus in bacterial cells
codes for 89. Against the codon 5' UAC 3', what would be the
(b) In lac operon z gene (ii) permease sequence of anticodon on tRNA ? (NEET 2022)
codes for (1) 5' AUG 3'
(c) In lac operon y gene (iii)  -galactosidase (2) 5' ATG 3'
codes for (3) 5' GTA 3'
(d) In lac operon a gene (iv) Repressor (4) 5' GUA 3'
codes for 90. If A and C make 30% and 20% of DNA, respectively,
Choose the correct answer from the options given what will be the percentage composition of T and G?
below : (NEET 2022)
(1) (a)–(iii), (b)–(ii), (c)–(i), (d)–(iv) (1) T : 20%, G : 30%
(2) (a)–(iv), (b)–(iii), (c)–(ii), (d)–(i) (2) T : 30%, G : 20%
(3) (a)–(iv), (b)–(i), (c)–(iii), (d)–(ii) (3) T : 30%, G : 30%
(4) (a)–(iii), (b)–(i), (c)–(iv), (d)–(ii) (4) T : 20%, G : 20%
DAILY PRACTICE PAPER–01 21. (3) 22. (4) 23. (1) 24. (1) 25. (1)
1. (3) 2. (1) 3. (2) 4. (2) 5. (2) 26. (2) 27. (3) 28. (1) 29. (3) 30. (1)
6. (2) 7. (2) 8. (4) 9. (3) 10. (1) 31. (1) 32. (1) 33. (3) 34. (1) 35. (2)
36. (1) 37. (4) 38. (2) 39. (2) 40. (4)
11. (3) 12. (4) 13. (4) 14. (3) 15. (3) 46. (2) 47. (2) 48. (2) 49. (3) 50. (3)
16. (4) 17. (2) 18. (4) 19. (3) 20. (3)
NCERT EXEMPLAR
21. (3) 22. (2) 23. (4) 24. (4) 25. (2) 6. (2) 7. (4) 8. (4) 9. (4) 10. (2)
26. (2) 27. (2) 28. (4) 29. (4) 30. (3) 11. (4) 12. (2) 13. (2) 14. (2) 15. (2)
16. (4) 17. (4) 18. (2) 19. (3) 20. (4)
DAILY PRACTICE PAPER–04
21. (1) 22. (4) 23. (2) 24. (2) 25. (1)
31. (4) 32. (1) 33. (3) 34. (4) 35. (1) 26. (1) 27. (1) 28. (3)
36. (1) 37. (4) 38. (4) 39. (4) 40. (2)
ASSERTION–REASON & STATEMENT QUESTIONS
1. (1) 2. (1) 3. (1) 4. (2) 5. (1)
41. (2) 42. (3) 43. (3) 44. (2) 45. (3) 6. (4) 7. (1) 8. (2) 9. (4) 10. (1)
46. (4) 47. (3) 48. (2) 49. (4) 50. (3)
11. (1) 12. (1) 13. (2) 14. (2) 15. (2)
MATRIX TYPE QUESTIONS
51. (2) 52. (4) 53. (3) 54. (2) 55. (2)
1. (1) 2. (4) 3. (2) 4. (2) 5. (2)
56. (4) 57. (1) 58. (3) 59. (4) 60. (1)
6. (3) 7. (2) 8. (1) 9. (2) 10. (2)
ARCHIVE QUESTIONS
61. (4) 62. (4) 63. (3) 64. (1) 65. (4)
1. (1) 2. (4) 3. (1) 4. (4) 5. (4)
66. (2) 67. (2) 68. (3) 69. (2) 70. (1)
6. (3) 7. (4) 8. (3) 9. (3) 10. (1)
71. (3) 72. (1) 73. (3) 74. (4) 75. (1) 16. (1) 17. (1) 18. (3) 19. (2) 20. (1)
76. (1) 77. (4) 78. (2) 79. (2) 80. (1) 21. (3) 22. (1) 23. (4) 24. (3) 25. (1)
26. (3) 27. (1) 28. (3) 29. (1) 30. (2)
81. (2) 82. (3) 83. (4) 84. (1) 85. (4) 36. (1) 37. (3) 38. (1) 39. (1) 40. (2)
86. (1) 87. (3) 88. (2) 89. (3) 90. (4) 41. (3) 42. (4) 43. (2) 44. (3) 45. (2)
46. (4) 47. (1) 48. (2) 49. (4) 50. (1)
51. (3) 52. (2) 53. (3) 54. (4) 55. (3)
91. (4) 92. (2) 93. (1) 94. (2) 95. (4) 56. (3) 57. (1) 58. (3) 59. (4) 60. (2)
96. (2) 97. (4) 98. (2) 199. (1) 100. (3) 61. (2) 62. (2) 63. (3) 64. (1) 65. (3)
MISCELLANEOUS FROM NCERT 66. (3) 67. (3) 68. (1) 69. (3) 70. (4)
71. (4) 72. (2) 73. (3) 74. (2) 75. (2)
1. (4) 2. (3) 3. (2) 4. (1) 5. (4)
76. (2) 77. (2) 78. (1) 79. (3) 80. (3)
6. (4) 7. (4) 8. (2) 9. (3) 10. (3)
81. (4) 82. (1) 83. (4) 84. (1) 85. (2)
11. (2) 12. (4) 13. (3) 14. (2) 15. (2)
86. (1) 87. (3) 88. (3) 89. (4) 90. (2)
16. (4) 17. (2) 18. (1) 19. (3) 20. (3)

Molecular Basis of Inheritance

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Molecular Basis of Inheritance

Uploaded by

Copyright:

Available Formats

Active site edutech- 9844532971

Percentage of Questions in Last 34 Years’ in NEET / AIPMT from this Chapter

WHAT DO YOU WANT TO KNOW 6.6 GENETIC CODE

6.4 REPLICATION 6.11 SYNOPSIS

52 Molecular Basis of Inheritance

6.0 INTRODUCTION NCERT P. No. 95-96

6.1 THE DNA NCERT P. No. 96-100

6.1.1 Structure of Polynucleotide Chain

• More nucleotides can be joined in such a manner to form a polynucleotide chain.

54 Molecular Basis of Inheritance

• Also, if each strand from a DNA (let us call it as a parental

4. Purines of DNA are represented by

56 Molecular Basis of Inheritance

6.1.2 Packaging of DNA Helix

• Correct sequence of organization of genetic material from smallest to largest is as

15. Identify parts labelled A,B, and C in the given diagram

58 Molecular Basis of Inheritance

6.2 THE SEARCH FOR GENETIC MATERIAL NCERT P. No. 100-104

6.2.1 The Genetic Material is DNA

• In 1928, Frederick Griffith, in a series of experiments with Streptococcus pneumoniae (bacterium

Biochemical Characterisation of Transforming Principle

The Genetic Material is DNA

60 Molecular Basis of Inheritance

• Similarly, viruses grown on radioactive

6.2.2 Properties of Genetic Material (DNA versus RNA)

6.3 RNA WORLD NCERT P. No. 104

22. The result of which of the following reaction experiments

62 Molecular Basis of Inheritance

6.4 REPLICATION NCERT P. No. 104-107

6.4.1 The Experimental Proof

(ii) Then they transferred the cells into a medium with

64 Molecular Basis of Inheritance

6.4.2 The Machinery and the Enzymes

3. Takes place in the cytoplasm 3. Takes place in the nucleus

4. DNA is circular and double-stranded 4. DNA is linear and double-stranded

Consists of a single origin of replication

7. DNA gyrase is required 7. DNA gyrase is not required

35. Replication of DNA is in

66 Molecular Basis of Inheritance

6.5 TRANSCRIPTION NCERT P. No. 107-111

Note • Antisense Technology : Use of complementary RNA to stop expression of a specific

6.5.1 Transcription Unit

6.5.2 Transcription Unit and the Gene

• Term cistron, recon and muton were given by Benzer.

6.5.3 Types of RNA and the process of Transcription

68 Molecular Basis of Inheritance

• In bacteria, there are three major

• In eukaryotes, there are two additional complexities

• The RNA polymerase I transcribes rRNAs (28S, 18S, and 5.8S).

• The significance of such complexities is now beginning to be understood. The split-

43. Mark the incorrect differences between eukaryotic and

70 Molecular Basis of Inheritance

6.6 GENETIC CODE NCERT P. No. 111-114

Salient Features of Genetic Code

• 61 codons code for 20 amino acids, this is degeneracy.

• Genetic code are always read in 5  3 direction.

72 Molecular Basis of Inheritance

6.6.1 Mutations and Genetic Code

53. Which is wrong

6.6.2 tRNA– the Adapter Molecule NCERT P. No. - 114

74 Molecular Basis of Inheritance

6.7 TRANSLATION NCERT P. No. 114-115

62. Which one of the following pairs is correctly matched

76 Molecular Basis of Inheritance