Prevalence of Active Hepatitis C Virus
Infection in Patients with Systemic Lupus
Erythematosus
M. MUBASHIR AHMED, MD; SETH MARK BERNEY, MD; ROBERT E. WOLF, MD;
MICHELENE HEARTH-HOLMES, MD; SAMINA HAYAT, MD; EISHA MUBASHIR, MD;
HENRI VANDERHEYDE, PHD; WUN-LING CHANG, MD; JOHN W. KING, MD
ABSTRACT: Objective: Hepatitis C virus (HCV) infection is
associated with various autoimmune disorders and can
mimic systemic lupus erythematosus (SLE) clinically and
serologically. There are few reports of prevalence of HCV
infection in patients with SLE. The aim of this study was to
determine the prevalence of HCV viremia by polymerase
chain reaction (PCR) in patients with SLE. Methods: We
tested sera from 40 consecutive patients with SLE collected
from1993 to 2000. All of the patients had HCV viral load
measured by PCR. The results were compared with the
prevalence of HCV viremia in a control group of blood
donors in our geographic area as well as in United States
general population. Results: HCV was detected in 4 of 40
patients (10%). The prevalence of HCV in our area blood
donors is 130 cases per 100,000 persons (0.13%; P ⬍
S ystemic lupus erythematosus (SLE) is a common
connective tissue disease with an estimated preva-
lence of 15 to 200 cases per 100,000 people.1 It is the most
clinically and serologically diverse of the autoimmune
diseases and displays a wide spectrum of clinical and
immunologic manifestations involving all organs of the
body.2 The etiology of SLE as well as most of other
autoimmune diseases is the subject of significant inves-
tigation, and viruses have been suggested as potential
etiologic and triggering agents.3,4 Hepatitis C virus
(HCV) appears to be associated with autoimmune
From the Center of Excellence for Arthritis and Rheumatology
and from the Section of Rheumatology, Department of Medicine
(MMA, SMB, REW, MH-H, SH, EM), the Section of Infectious Diseases,
Department of Medicine (CW-L), and the Department of Microbiol-
ogy (JWK), Louisiana State University Health Sciences Center,
Shreveport, Louisiana.
Submitted for publication May 11, 2005; accepted for publica-
tion November 4, 2005. Paper presented at the Southern Regional
Meeting held in New Orleans, LA from February 12-14th, 2004.
Abstract published in Journal of Investigative Medicine, Vol. 52,
#1, January 2004.
Correspondence: Mohammed Mubashir Ahmed, MD, Assistant
Professor of Medicine, Center of Excellence for Arthritis and Rheu-
matology, LSUHSC-S, 1501 Kings Highway, Shreveport, LA
71130-3932 (E-mail: mahmed3@lsuhsc.edu).
252
0.0001). The prevalence of HCV infection in the United
States general population, screened by PCR, is 1330 cases
per 100,000 people (1.33%; P ⫽ 0.002). The prevalence of
HCV infection was significantly higher in our SLE patients
than in our area blood donors. The frequency of HCV
infection was also higher than that of the United States
general population. Conclusion: Our observations support
those of other investigators who have reported an in-
creased prevalence of HCV infection in SLE patients. Fur-
ther detailed investigation of this association may help in
understanding the pathogenesis of SLE. HCV infection
should be tested when the diagnosis of SLE is considered.
KEY INDEXING TERMS: Hepatitis C virus; Systemic lupus
erythematosus; Extrahepatic manifestation. [Am J Med Sci
2006;331(5):252–256.]
disorders such as Sjögren syndrome, mixed cryo-
globulinemia, porphyria cutanea tarda, mem-
branoproliferative glomerulonephritis, vasculitis,
arthritis, and thyroiditis.5 Patients with chronic
HCV infections may have laboratory features as-
sociated with SLE, including a variety of autoan-
tibodies and hypocomplementemia.5,6 In addition,
treatment of HCV infection with interferon (IFN)
alpha is associated with the emergence of autoim-
mune disorders.7 Although an association between
these two conditions seems possible, few studies
have evaluated the prevalence of HCV infection in
patients with an established diagnosis of
SLE.1,4,8,9 Because SLE patients make multiple
antibodies that may cross-react with serologic
tests, including HCV antibody, the prevalence of
HCV seropositivity may be falsely elevated in pa-
tients with SLE. The purpose of this study was to
evaluate the prevalence of HCV viremia as deter-
mined by polymerase chain-reaction (PCR) of
HCV-RNA in the serum of patients with SLE.
Methods
We investigated 40 consecutive SLE patients, 38 women and 2
men (34 African-American and 6 white) seen in the lupus clinic at
May 2006 Volume 331 Number 5

Louisiana State University Health Sciences Center in Shreve-
port from 1993 to 2000. This study was approved by the
Institutional Review Board. All patients fulfilled the 1982
American College of Rheumatology revised criteria for SLE.10
All patients had documented history, physical examination
findings, and Systemic Lupus Erythematosus Disease Activity
Index (SLEDAI) scores. The clinical and serologic characteris-
tics of all patients were collected from their SLEDAI data and
sera from the same date were selected for HCV testing. All of
the patients had their HCV viral load measured by PCR from
sera that were collected, stored at -80°C, and thawed only once
prior to use. When multiple sera were available from the same
patient, the earliest available sera at the time of the patient’s
initial presentation and diagnosis with SLE was used for HCV
viral load testing. These patients had not received any immu-
nosuppressants at the time of collection of the sera used for
HCV testing. The results were compared with the prevalence of
HCV infection in a control group of blood donors in our geo-
graphic area obtained from LifeShare Blood Centers of North-
ern Louisiana. All donors were initially screened for anti-HCV
antibodies with enzyme immunoassay (EIA), and all positive
for anti-HCV antibody were subsequently confirmed with nu-
cleic acid amplification testing (NAT). In Northern Louisiana,
88,918 donors donated 149,874 units of whole blood during the
period of July 1, 2002 through June 30, 2003. There were
20,816 first-time donors. The results were also compared with
prevalence of HCV infection in United States general popula-
tion.11
Viral RNA was isolated from lupus patients’ sera using the QIAamp
(Qiagen, Valencia, CA). The levels of HCV-RNA were determined using
quantitative real time PCR with the following primers and probe:
forward primer (5=AACTACTGTCTTCACGCAGAAAGC3=), reverse
primer (5=CCCAACACTACTCGGCTAG3=), and TaqMan probe
(5=FAMTGGCGTTAGTATGAGTGTCGTGCAG3=TAMRA). The quan-
titative real time PCR technique was validated against the branched
DNA assay (Bayer, Emeryville, CA), and shown to exhibit a 10-fold
greater sensitivity with an R2 of 0.98. For each assay, a series of
Hepatitis C virus RNA standards (Accurun 405, Boston Biomedica,
West Bridgewater, MA) were analyzed (R2⫽0.99) to allow determina-
tion of copy number and as a quality control for reagents.12 Because
real-time PCR uses specific primers as well as a probe that is specific for
the PCR product, the rate of false positives for real time PCR is
virtually zero. If the primers were to amplify nonspecific DNA, then the
probe that is specific for the correct PCR product will not bind the
amplified DNA between the forward and reverse primers. Conse-
quently, the probe will not be cleaved by the Taq polymerase and
generate a fluorescent signal.
In addition, the following measurements and tests were per-
formed on patients with SLE: blood urea nitrogen, serum creat-
inine, aspartate transaminase, alanine transaminase, albumin,
complete blood cell count, urinalysis, 24-hour urine protein and
creatinine or calculation of protein-to-creatinine ratio in random
spot urine samples, antinuclear antibodies against double-
stranded DNA, precipitating antibodies to the extractable nu-
clear antigens (U1 RNP, Sm, Ro/SSA and La/SSB), complement
C3 and C4, rapid protein reagin and anticardiolipin antibodies,
lupus anticoagulant, and human immunodeficiency virus type-1
and 2 (HIV-1/HIV-2) (when appropriate).
Statistical Analysis
We used the Fisher exact test to analyze differences in fre-
quency. A P-value of less than 0.05 was taken to indicate statis-
tical significance.
Results
Hepatitis C virus was detected in 4 of our 40 lupus
patients (10%). One hundred forty LifeShare Blood
donors were initially found to be positive for anti-
HCV antibodies by EIA, and 113 were subsequently
THE AMERICAN JOURNAL OF THE MEDICAL SCIENCES
Ahmed et al
confirmed with NAT for the presence of HCV-RNA.
The prevalence of HCV in our area blood donors was
130 per 100,000 donors (0.13%; P ⬍ 0.0001) relative
to SLE patients. Among the 20,816 first-time do-
nors, 114 were positive for anti-HCV antibody by
EIA and 92 first-time donors were found positive for
HCV-RNA by NAT for a prevalence of 440 per
100,000 donors (0.44%; P ⬍ 0.0001) compared to
SLE patients. The prevalence of chronic HCV infec-
tion in the United States general population,
screened by PCR, is 1330 per 100,000 persons
(1.33%; P ⫽ 0.002) relative to our SLE patients
(Table 1).
Clinical, immunologic, and serologic characteris-
tics of the four SLE patients positive for active HCV
infection by PCR are summarized in Table 2. All
four patients were female. Their risk factors for
HCV infection were unknown. Their transaminase
levels were normal and remained normal for a long
period after the diagnosis of SLE. There were no
clinical signs of hepatopathy.
Clinical, immunologic features, and Systemic Lu-
pus Erythematosus Disease Activity Index (SLE-
DAI) in patients with and without chronic HCV
infection are summarized in Table 3. There was no
difference in the SLEDAI between HCV-positive and
HCV-negative SLE patients. All of the patients re-
ceived standard treatment as indicated by their pre-
dominant disease manifestations and the extent of
the organ involvement including steroids, azathio-
prine, cyclophosphamide, hydroxychlorquine, meth-
otrexate, and nonsteroidal anti-inflammatory drugs.
Discussion
Viruses have been suggested as potential etiologic
and triggering agents in the pathogenesis of sys-
temic autoimmune diseases.3,4 HCV infection ap-
pears to be associated with several autoimmune
disorders and can mimic SLE clinically and serolog-
ically.5,6 Although the major risks of HCV infection
are the development of cirrhosis in up to 20% of
chronically infected patients and the risk for hepa-
tocellular carcinoma and liver failure, numerous ex-
trahepatic manifestations have been reported with
HCV infection including Sjögren syndrome,13,14
cryoglobulinemia, vasculitis, arthritis, thyroiditis,
sialadenitis, lichen planus, porphyria cutanea tarda,
Table 1. Prevalence of HCV Viremia in SLE Patients, Area
Blood Donors, and US Population
Group HCV Positive, % P-valuea
LSUHSC-S SLE Patients 10.00 —
Area Blood Donors 0.13 ⬍ 0.0001
First-Time Area Blood Donors 0.44 ⬍ 0.0001
US Population 1.33 ⬍ 0.002
a
Versus LSUHSC-S SLE patients using Fisher exact test.
253
Prevalence of HCV in SLE
Table 2. Clinical and Immunologic Features of Patients with Systemic Lupus Erythematosus and Chronic Hepatitis C Virus
Age, y SLE criteria ANA
44 Arthritis, Nephritis, Hemo, 640
43 Arthritis, Nephritis, Discoid 320
28 Arthritis, Nephritis, Serositis 1280
44 Arthritis, Nephritis, Oral ulcers 640
ACL, anticardiolipin antibodies; ANA, antinuclear antibodies; dsDNA, anti-double stranded DNA; Hemo, hemocytopenias; HIV, human
immunodeficiency virus; Hypocomp, hypocomplimentia; N, normal; ND, not done; - , absent; ⫹, present.
mesangiocapillary glomerulonephritis , type II dia-
betes mellitus, celiac sprue,15 myocarditis,16 and B-
cell non-Hodgkin lymphoma.17,18 Several of the most
frequent extrahepatic manifestations of HCV infec-
tion such as arthralgia, myalgia, sicca syndrome,
and antinuclear antibodies may mimic a true con-
nective tissue disease, particularly SLE. Patients
with chronic HCV infections are frequently positive
for autoantibodies, such as antinuclear antibodies
(10-30%), anti-dsDNA at low titers, anticardiolipin
antibodies, antithyroidal antibodies, anti-smooth
muscle antibodies, anti-liver/kidney microsome type
1 antibodies,19 cryoglobulins, rheumatoid factor
(75%), and hypocomplementemia, all features seen
in patients with SLE. In addition, there is a case
report of a patient with chronic HCV infection who
presented with nephrotic syndrome in whom kidney
biopsy was diagnostic of lupus membranous nephri-
tis and serologic studies confirmed the diagnosis of
SLE.20
Some authors have analyzed the prevalence of
HCV infection in SLE patients based on the pres-
ence of anti-HCV antibodies,8,9,21 and case reports of
their association have also been published.22,23 Ca-
coub et al21 found anti-HCV antibodies (by ELISA-2)
in 7 (11%) of 62 SLE patients, but only two had
detectable HCV-RNA (3%). In another study, Kowd-
ley et al9 found anti-HCV antibodies (by ELISA-2) in
5 (12%) of 42 SLE patients, but only three patients
(7%) were antibody positive in the immunoblot anal-
ysis and two (5%) were positive by PCR. None of
these patients had chronic liver disease symptoms,
and only one had abnormal findings in the liver. In
a recent study, Ramos-Casals et al5 investigated 134
SLE patients and found antibodies to HCV in 18
lupus patients (13%) and in 2 of 200 (1%) blood
donors studied. Among the anti-HCV–positive
group, HCV viremia was confirmed (by RIBA-3 and
polymerase chain reaction) in 15 SLE patients (11%)
and in the two blood donors (1%) (P ⬍ 0.001). This
prevalence is significantly higher than the preva-
lence of HCV infection found in the control group
(1%) of blood donors from the same geographic area
and in the general population in Catalonia (1.2%),24
and the authors suggested a possible link between
HCV infection and SLE.
In the present study, we looked at the prevalence
254
Infection
dsDNA Anti Sm ACL Hypocomp ALT SSAßSB HIV
⫺ ⫺ ⫹ ⫹ N ⫹/⫹ ⫺
⫺ ⫺ ⫹ ⫹ N ⫹/⫹ ND
⫹ ⫺ ⫺ ⫹ N ⫺/⫺ ND
⫺ ⫺ ND ⫺ N ⫺/⫹ ⫺
of HCV viremia as evidenced by PCR detection of
HCV-RNA in the serum of patients with SLE. We
found active HCV infection in 10% of our unselected
SLE patients, similar to the prevalence noted in the
study by Ramos-Casals et al.5 This prevalence is
significantly higher than the prevalence of active
HCV infection in the blood donors, including the
first-time donors in our geographic area as well as
compared with prevalence of HCV infection in
United States general population. There was no
difference in the SLEDAI between HCV-positive and
HCV-negative SLE patients in our study.
The treatment of HCV infection with interferon-
alpha is associated with the development of autoim-
mune disorders in 4% to 19% of patients receiving
interferon-alpha, though SLE-like syndromes are
only seen in 0.15% to 0.7%.7 Clinical and laboratory
features of SLE in this setting, including arthralgia/
arthritis, serositis, headaches, alopecia, positive an-
tinuclear antibodies, and dsDNA, resemble idio-
pathic disease, typically with a good outcome after
discontinuation of the drug. Recently, Fuyukawa et
al.25 reported a patient who developed SLE after
receiving alpha2-interferon therapy for HCV infec-
tion, and reviewed 11 additional cases that had been
previously reported. Other autoimmune disorders
have been reported to develop after treatment with
type 1 interferon.26 –33
The role of other viruses (including retroviruses)
as potential etiologic and triggering agents in some
genetically susceptible individuals has been pro-
posed.3,4 Patients with HIV infection and SLE show
marked overlap with respect to the characteristics of
their immune response, and the clinical manifesta-
tions of both diseases can sometimes be indistin-
guishable. Nevertheless, HIV infection and SLE are
rarely seen in the same patient. It has also been
reported that treatment of one condition may cause
the other to become worse in patients with both
diseases. Two of the four HCV-positive SLE patients
in our study were HIV-negative. The HIV status of
other two patients is not known. All of these patients
had long-standing SLE with major organ involve-
ment including nephritis and have received various
immunosuppressants including steroids and cyclo-
phosphamide over time after their sera collection
dates (the sera used for HCV-RNA testing). Both
May 2006 Volume 331 Number 5
 Ahmed et al

Table 3. Clinical, Immunologic Features, and Systemic Lupus infection by this agent might also account for SLE at
Erythematosus Disease Activity Index (SLEDAI) in Patients least in some patients.
with and without Chronic Hepatitis C Virus infectiona
The prevalence of HCV infection as determined by
SLE patients SLE patients PCR was significantly higher in our SLE patients
without HCV, with HCV, than in the healthy blood donors in our geographic
Manifestation n ⫽ 36 n⫽4 P-value area. The frequency of HCV infection in our patients
was also significantly higher compared to the U.S.
Neurologicb 6 (17) 0 (0) ⬎0.99
Arthritis 9 (25) 4 (100) 0.008 general population. Larger studies are needed to
Myositis 3 (8) 0 (0) ⬎0.99 determine whether the higher prevalence of HCV
Cutaneousc 10 (28) 0 (0) 0.56 infection seen in our SLE patients is seen in other
Mucosal ulcers 5 (14) 0 (0) ⬎0.99 SLE populations, and whether treatment of the
Serositis 2 (6) 1 (25) 0.28
Nephropathyd 17 (47) 4 (100) 0.11
HCV with interferon and ribavirin will have an
Hemocytopenias 4 (11) 0 (0) ⬎0.99 impact on the patient’s disease. Patients with SLE
ANA 36 (100) 4 (100) — should be evaluated for possible HCV infection. Fur-
DsDNA 12 (33) 1 (25) ⬎0.99 ther detailed investigation of this association may
Anti Sm 9 (25) 0 (0) ⬎0.99 help in understanding the pathogenesis of SLE.
Low C3 23 (64) 3 (75) ⬎0.56
Low C4 10 (28) 1 (25) 0.99
SLEDAI at the time 9.6 10.5 0.93 Acknowledgments
Of HCV testing
(mean) The authors are grateful to Mrs. Jane Carroll,
Manager Shreveport Center, LifeShare Blood Cen-
ANA, antinuclear antibodies; dsDNA, anti-double stranded DNA;
Hemo, hemocytopenias; SLEDAI, Systemic Lupus Erythematosus
ters, for her assistance with the data collection.
Disease Activity Index.
a
Values represent the number (%) of patients. References
b
Neurologic: presence of seizure, psychosis, organic brain syn-
drome, cranial neuropathy, lupus headache, and/or cerebrovas- 1. Perlemuter G, Cacoub P, Sbai A, et al. Hepatitis C virus
cular accident. in SLE. J Rheumatol 2003;30:1473–8.
c
Cutaneous: malar rash, discoid lesions, subacute cutaneous le- 2. Cacoub P, Renou C, Rosenthal E, et al. Extrahepatic
sions, and/or photosensitivity. manifestations associated with hepatitis C virus infection: a
d
Nephropathy: presence of heme granular casts, hematuria, pro- prospective multicenter study of 321 patients. Medicine (Bal-
teinuria ⬎ 0.5 g/24 hrs and/or sterile pyuria.
timore) 2000;79:47–56.
3. Denman AM. Systemic lupus erythematosus: is a viral eti-
ology a credible hypothesis? J Infect 2000;40:229–33.
4. Obermayer-Straub P, Manns M. Hepatitis C and D: retro-
patients whose HIV status is not known were diag- viruses and autoimmune manifestations. Autoimmun 2001;
nosed with SLE prior to 1993 and have been fol- 16:275–285.
lowed at our clinic since then. Their SLE is in re- 5. Ramos-Casals M, Font J, Garcia-Carrasco M, et al. Hep-
mission and there were no clinical manifestations of atitis C virus infection mimicking systemic lupus erythema-
HIV coinfection. tosus. Arthritis Rheum 2000;43:2801–6.
6. Cacoub P, Poynard T, Ghallani P, et al. Extrahepatic
manifestations of chronic hepatitis C. MULTIVIRC Group.
Conclusion Multidepartment Virus C Arthritis Rheum 1999;42:2204–12.
7. Wilson LE, Widman D, Dickman SH, et al. Autoimmune
Hepatitis C virus infection is associated with var- disease complicating antiviral therapy for hepatitis C virus
ious autoimmune disorders and can mimic SLE clin- infection. Semin Arthritis Rheum 2002;32:163–73.
ically and serologically. Patients presenting with 8. Marchesoni A, Battafarano N, Podico M, et al. Hepatitis
arthritis, arthralgia, myalgia, sicca symptoms, or C virus antibodies and systemic lupus erythematosus [letter].
leucopenia who are suspected of SLE should be Clin Exp Rheumatol 1995;13:267.
tested for chronic HCV infection. Conversely, pa- 9. Kowdley KV, Subler DE, Scheffel J, et al. Hepatitis C
tients with chronic HCV infection and extrahepatic virus antibodies in systemic lupus erythematosus. J Clin
Gastroenterol 1997;25:437–9.
manifestations mimicking SLE should be tested for 10. Tan EM, Cohen AS, Fries JF, et al. The 1982 revised
highly specific antibodies for SLE such as anti-Sm, criteria for the classification of systemic lupus erythemato-
anti-dsDNA, and anti-nucleosome antibodies to be sus. Arthritis Rheum 1982;25:1271–7.
considered as having definite SLE. Although there is 11. Alter M, Kruszon-Moran D, Nainan O, et al. The preva-
no established role of HCV in the pathogenesis of lence of hepatitis C virus in United States, 1988 through
SLE, the possibility that viral and other microbio- 1994. N Engl J Med. 1999 Aug 19;341:556–62.
12. Jorgensen PA, Neuwald PD. Standardized hepatitis C
logic agents may act as triggering factors in some
virus RNA panels for nucleic acid testing assays. J Clin Virol
genetically susceptible individuals has been dis- 2001;20:35–40.
cussed.3–5 The extraordinary association between 13. Ramos-Casals M, Garcia-Carrasco M, Cervera R, et al.
HCV infection and mixed cryoglobulinemia, often in Hepatitis C virus mimicking primary Sjogren’s syndrome: a
association with vasculitis and with other autoim- clinical and immunologic description of 35 cases. Medicine
mune diseases, has encouraged the suspicion that 2001;80:1–8.

THE AMERICAN JOURNAL OF THE MEDICAL SCIENCES 255

Prevalence of HCV in SLE
14. Ramos-Casals M, Garcı́a-Carrasco M, Cervera R, et al.
Sjögren’s syndrome and hepatitis C virus. Clin Rheumatol
1999;18:93–100.
15. Fine KD, Ogunji F, Saloum Y, et al. Celiac sprue: another
autoimmune syndrome associated with hepatitis C. Am J
Gastroenterol 2001;96:138–45.
16. Frustaci , Calabrese F, Chimenti C, et al. Lone hepatitis
C virus myocarditis responsive to immunosuppressive ther-
apy. Chest 2002;122:1348–56.
17. Starkebaum G, Sasso E. Hepatitis C and B cells: induction
of autoimmunity and lymphoproliferation may reflect chronic
stimulation through cell-surface receptors [editorial]. J Rheu-
matol 2004;31:416–8.
18. Ramos-Casals M, Trejo O, Garcia-Carrasco M, et al. Triple
association between HCV infection, systemic autoimmune dis-
eases, and B cell lymphoma. J Rheumatol 2004;31:495–9.
19. Lunel F, Cacoub P. Treatment of autoimmune and extra-
hepatic manifestations of HCV infection. Ann Med Interne
2000;151:58–64.
20. Danesh FR, Lynch P, Kanwar YS. Lupus membranous
glomerulonephritis mimicking hepatitis C-associated ne-
phropathy. Am J Kidney Dis 2002;39:E19.
21. Cacoub P, Lunel F, Huong LT. Polyarteritis nodosa and hepa-
titis C virus infection [letter]. Ann Intern Med 1992;116:605–6.
22. Marvisi M. A case of systemic lupus erythematosus or hep-
atitis C virus? [letter] Chest 1998;113:1146.
23. Nepveu K, Libman B. Hepatitis C virus as another possible
cause of porphyria cutanea tarda and systemic lupus ery-
thematosus. Arthritis Rheum 1996;39:352–4.
24. Sanchez-Tapias JM, Barrera JM, Costa J, et al. Hepati-
tis C virus infection in patients with nonalcoholic chronic
liver disease. Ann Intern Med 1990;112:921–4.
256
25. Fuyukawa S, Kajiwara E, Suzuki N, et al. Systemic lupus
erythematosus after interferon therapy for chronic hepatitis
C: a case report and review of the literature. Am J Gastroen-
terol 2000;95:310–2.
26. Cacoub P, Sbai A, Frances C, et al. Systemic sarcoidosis
during interferon-alpha therapy for chronic hepatitis C virus
infection. Gastroenterol Clin Biol 2000;24:364–6.
27. Sanchez-Pobre P, Gonzalez C, Paz E, et al. Chronic
hepatitis C and autoimmune cholangitis: a case study and
literature review. Dig Dis Sci 2002;47:1224–9.
28. Gurtubay IG, Morales G, Arechaga O, et al. Development
of myasthenia gravis after interferon alpha therapy. Electro-
myogr Clin Neurophysiol 1999;39:75–8.
29. Eibl N, Gschwantler M, Ferenci P, et al. Development of
insulin-dependent diabetes mellitus in a patient with chronic
hepatitis C during therapy with interferon-alpha. Eur J Gas-
troenterol Hepatol 2001;13:295–8.
30. Passos de Sousa E, Evangelista Segundo PT, Jose FF,
et al. Rheumatoid arthritis induced by alpha-interferon ther-
apy. Clin Rheumatol 2001;20:297–9.
31. Ward DL, Bing-You RG. Autoimmune thyroid dysfunction
induced by interferon-alpha treatment for chronic hepatitis
C: screening and monitoring recommendations. Endocr Pract
2001;7:52–8.
32. Parana R, Cruz M, Santos-Jesus R, et al. Thyroid disease
in HCV carriers undergoing antiviral therapy with interferon
plus ribavirin. Braz J Infect Dis 2000;4:284–90.
33. Bell TM, Bansal AS, Shorthouse C, et al. Low-titer auto-
antibodies predicts autoimmune disease during interferon-
alpha treatment of chronic hepatitis C. J Gastroenterol Hepa-
tol 1999;14:419–22.
May 2006 Volume 331 Number 5