Received: 23 April 2020 | Revised: 2 August 2020 | Accepted: 15 August 2020

DOI: 10.1002/jbt.22606

Beneficial effect of sodium thiosulfate extends beyond

myocardial tissue in isoproterenol model of infarction:
Implication for nootropic effects

Sriram Ravindran1 | Senthilkumar Gopalakrishnan2 | Gino A. Kurian1

1
School of Chemical and Biotechnology,
Vascular Biology Lab, SASTRA Deemed
University, Thanjavur, Tamil Nadu, India
2 One of the common negative impacts in the management of acute myocardial in-
Department of Cardiology, Thanjavur Medical
College, Thanjavur, Tamil Nadu, India
Correspondence
Dr. Gino A. Kurian, School of Chemical and
Biotechnology, Vascular Biology Lab, SASTRA
Deemed University, Thanjavur,
Tamil Nadu 613401, India.
Email: ginokurian@hotmail.com and
kurian@scbt.sastra.edu
Abstract
farction is cognitive decline. Using the rat model of isoproterenol (ISO)‐induced
myocardial infarction, we assessed the cardioprotective effect of sodium thiosulfate
(STS) and its influence on cognition. STS treatment reduced the cardiac infarct size
by 75%, injury markers (lactate dehydrogenase: 60%, creatine kinase‐muscle/brain:
44%) release in the blood, maintain the heart rate within a normal range
(365 ± 10 bpm) and minimize postinfarction hypertrophic changes in comparison
with the ISO group. At the cellular level, the heart from these rats had reduced
reactive oxygen species (ROS) (25%), caspase‐9 (60%), and improved mitochondrial
function (restored electron transport chain function and copy number) compared to
ISO hearts. The brain of STS‐treated rats also showed a reduction in ROS (45%),
caspase‐9 (37%), and improved mitochondrial function relative to the brain of the
ISO group, particularly limited to the striatum region, and these rats showed im-
proved cognitive ability. Predominantly, the STS treatment reduced the reference
memory defects observed in comparison to rats challenged by ISO. Furthermore,
elevated circulating mitochondrial DNA and ATP were found in ISO‐challenged rats,
which indicate the cardiac mitochondria linked damage‐associated patterns were
restored to the sham level when pretreated with STS. We found increased H2S, a
well‐known metabolite of STS with a neuroprotective role in the brain after STS
administration, hinting at a possible secondary defense mechanism. In conclusion,
the STS mediated cardioprotection and its nootropic effects are primarily mediated
via the improvement of mitochondrial function and reduction of oxidative stress.

KEYWORDS

cognitive impairment, isoproterenol, mitochondrial function, myocardial infarction, sodium

thiosulfate

1 | INTRODUCTION
Acute myocardial infarction (AMI) is a consequence of interrupted
blood supply through the coronary vessels, which results in pro-
longed ischemic damage to cardiac cells leading to cardiac in-
[1]
sufficiency and structural derangement of the myocardium.
impaired myocardial function has its sequel effect on other perfused
organs such as the brain, kidney, and liver mediated via the altera-
tions induced by the reduction of oxygen or depleted metabolic
substrates.[2] Cognitive decline is one of the major clinical manifes-
tations mediated by the hypoperfusion of neuronal tissue due to the
The compromised function of the heart.[3] Many prospective and

J Biochem Mol Toxicol. 2020;34:e22606. wileyonlinelibrary.com/journal/jbt © 2020 Wiley Periodicals LLC | 1 of 11

https://doi.org/10.1002/jbt.22606

2 of 11 | RAVINDRAN
retrospective studies have shown that postoperative cognitive dys-
function is a significant neurological sequel that occurs (25%‐80% of
[3‐5]
patients) after cardiac surgery.
Several approaches have been developed to improve the cogni-
tive function of patients such as computerized cognitive training,
vagal nerve stimulation, and physical exercise, but none of these
methods are effectively utilized in cardiac patients linked to cognitive
decline.[6] Each approach has its advantages and its limitations, and
thus suitability of these procedures varies between persons. The
improvement of cognition after cardiac surgery is complex and
challenging as there exist anatomical and functional differences be-
tween the brains of individuals undergoing cardiac surgery. Unlike
other cognitive disorders, revascularization injury plays a prominent
role in the cognitive decline observed in cardiac surgery cases, which
might show up in the long run even if not immediately after sur-
gery.[7] Also, surgery is a kind of trauma experienced by these pa-
tients, and hence the application of physical methods becomes
difficult, in which case, pharmacological treatment becomes neces-
sary. Pharmacological neuroprotection was not effectively translated
to the clinical side due to methodological discrepancies in preclinical
studies.[6] This is primarily because preclinical models have neglected
distant organ injury while studying cardioprotection or neuropro-
tection. Thus, the model's suitability in addressing the neurocognitive
decline associated with cardiac injury cannot be ruled out due to the
ability of drugs to modulate multiple target sites. The neuroin-
flammatory response following cardiac trauma triggered through
systemic circulation (via DAMPs, chemokines, and cytokines) is
[6,8]
thought to play a critical role in cognitive decline. Investigators
utilized different surgical models like abdominal surgery, cardiac
surgery, orthopedic surgery in rodents to demonstrate defects in
hippocampal neurogenesis rates and reduction in neurotrophic fac-
tors that in turn adversely affect cognitive ability.[6] Though blocking
neuroinflammation is a sought after strategy, the drug trials with
agents such as lidocaine, magnesium, acetylcholine esterase, steroids,
and dexmedetomidine met with failure or showed mixed effects in
preventing cognitive decline after cardiac surgery, indicating the
pathophysiologic complexity. Hence multitargeted interventions may
be required to achieve neuroprotection in cardiac surgery.
Hydrogen sulfide (H2S) is a multitargeted drug with an established
neuroprotective and cardioprotective role against revascularization in-
[9]
jury. Being an endogenous gasotransmitter, its biphasic dose‐
dependent action renders it toxic depending on dose and exposure
time.[10] On the other hand, its metabolite sodium thiosulfate (STS)
overcomes the shortfalls of H2S concerning dose adjustment and toxi-
city. STS is a white odorless powder already approved as an antidote for
cyanide poisoning.[11] Its high oral LD50 (4500‐5000 mg/kg) level makes
it safe for use over a wide range of doses, which is why it is already in
clinical use to treat calciphylaxis in patients with renal failure.[12] Our
previous studies on isolated rat hearts have provided evidence for the
cardioprotection by STS through its potential to act as an antioxidant,
antiapoptotic, and salvage mitochondria.[13] Moreover, STS was reported
to enhance the neurological function of mice challenged to cerebral
[14]
ischemia‐reperfusion and thereby improved their survival rate. In the
10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
ET AL.
present study, we chose to evaluate STS as a cardioprotective agent
against AMI using the isoproterenol model. Besides this, we also aimed
to study the impact of AMI and STS on the rat brain and cognition.
2 | METHO DS
2.1 | Animals
All experiments were carried out on male Wistar rats (250‐300 g)
procured from the Central Animal Facility, SASTRA Deemed Uni-
versity, Tamil Nadu, India. The rats were maintained on a 12 hour light/
dark cycle under controlled temperature conditions (25°C ± 2°C) with
access to food (1328; Altromin Gmbh, Germany) and water. The animal
experiments were conducted according to the guidelines of the Com-
mittee for conduct and supervision of experiments on animals, India,
with prior approval from the Institutional Animal Ethical Committee
(571/SASTRA/IAEC/RPP).
2.2 | Study design
Isoproterenol (ISO) hydrochloride (I5627; Sigma‐Aldrich) solutions
were freshly prepared in phosphate‐buffered saline (PBS, pH 7.4) and
two subcutaneous injections of 80 mg/kg were administered on
subsequent days.[15] The rats were trained for cognitive testing and
selected for the study. The day of the first dose was considered
day 0, which was followed by the second dose on day 1. From day 2
to 8, cognitive testing was undertaken.
The rats were assigned to three major groups (n = 10 per group):
sham (PBS injected subcutaneously), ISO, and STS + ISO (STS‐injected
intraperitoneally at a dose of 100 mg/kg, 1 hour before ISO dose). The
effective dose of STS was arrived at based on our previous study.[13]
The induction of heart failure was confirmed from the ST‐segment
elevation of the electrocardiogram (ECG) recorded by two leads using
Powerlab‐8/35 (AD Instruments, Australia) and plasma‐based bio-
chemical markers. Besides this, to rule out the negative impact of STS in
the absence of ISO, the STS alone group was included to study the
blood parameters, injury, and physiology alone. At the end of the study,
the rats were euthanized using an anesthetic overdose of halothane for
biochemical and morphological assessment.
2.3 | Blood analysis
The blood samples were collected in K3‐EDTA tubes from all rats before
the first dose of ISO, 24 hours after the second dose of ISO, and on the
day of the end of cognitive testing. Plasma was separated by centrifuging
the tubes at 3000 rpm for 10 minutes and stored at −80°C for further
analysis. The blood cells were processed for isolation of mitochondria
from peripheral blood mononuclear cells as per standard protocol.[16]
The plasma was used for the estimation of injury from lactate de-
hydrogenase (LDH) activity based on the lactate conversion to pyruvate,

RAVINDRAN ET AL.
followed by the estimation of NADH at 340 nm[17] and creatine kinase‐
muscle/brain (CK‐MB) as per the kit instructions (11405007; Agappe
Diagnostics). The inflammatory activity in the plasma was probed from
the myeloperoxidase (MPO) activity using tetramethylbenzidine absor-
bance at 450 nm.[18] The occurrence of acute ischemia was verified from
the plasma levels of ischemia‐modified albumin (IMA) based on the re-
duction in binding affinity of cobalt to albumin and measured at
470 nm.[19] All spectrophotometric measurements were carried out
using the Synergy H1 multi‐mode reader (BioTek).
2.4 | Tissue preparation
The heart and brain of rats were excised immediately, and specimens
were used for assessment of reactive oxygen species (ROS), apop-
tosis, mitochondrial function, and morphological analysis using the
staining techniques of 2,3,5‐triphenyltetrazolium chloride and he-
matoxylin/eosin. The homogenization and isolation protocols are
mentioned in the Supporting Information Methods.
2.5 | Biochemical analysis
The ROS level in the heart, brain, and plasma was evaluated as a
marker for oxidative stress using 2′, 7′‐dichlorofluorescin diacetate
(D6883; Sigma‐Aldrich) and the fluorescence was measured at
Ex/Em = 485/530 nm.[20] The apoptotic activity, mainly that of
caspase‐3 and caspase‐9, was assayed from the heart and brain
homogenates using specific substrates (SCP0086 and SCP0091;
Sigma‐Aldrich) as per a previous procedure.[21] To assess the mi-
tochondrial function, the electron transport chain (ETC) enzyme
activity of complexes I to IV was performed for mitochondria
isolated from blood, heart, and brain as per the procedure of
Barrientos.[22] The level of ATP was assessed immediately after
isolation using the ATPlite Kit (PerkinElmer). The detailed proce-
dures are provided in the Supporting Information Material.
2.6 | Gene expression analysis
The expression for the mitochondrial encoded ND1 (F‐CCCTA
AAACCCGCCACATCT, R‐GAGCGATGGTGAGAGCTAAGGT) and
nuclear‐encoded HGB (F‐GTGCACCTGACTCCTGAGGAGA, R‐CCT
TGATACCAACCTGCCCAG) was analyzed using quantitative poly-
merase chain reaction (ABI7500; Thermo Fisher Scientific) from the
heart, brain, and plasma. DNA extraction was carried out using TRIzol
reagent (15596026; Thermo Fisher Scientific) as per the instructions
and gene expression was quantified using SYBR Green Chemistry
(F415; Thermo Fisher Scientific). The expression of genes was cal-
[23]
culated as per the procedure of Livak. The copy number was es-
timated based on a standard curve constructed using reference DNA
from sham rats by taking the ratio of the copy number of ND1 and
[24]
HGB as per the procedure of Zhou et al.
10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
| 3 of 11
2.7 | Behavioral assessment
The memory and learning abilities of rats administered with ISO were
evaluated using the Morris water maze (MWM), and the radial arm
maze (RAM) tests as per the standard procedures elaborated in the
Supporting Information Methods.
2.8 | Statistical analysis
Statistical analysis was carried out by Prism version 7 (GraphPad
Software Inc). One‐way analysis of variance, followed by Tukey's
post‐test, was used to analyze the data. Experimental results were
expressed as mean ± SD and a P < .05 was considered statistically
significant.
3 | RE SU LTS
3.1 | Effect of STS on blood chemistry, tissue injury,
and ECG
The plasma of ISO‐administered rats showed significantly (P < .05)
increased levels of LDH, CK‐MB, and IMA, accompanied by elevated
MPO activity and ROS levels on day 2 compared to sham rats
(Figure 1). Except for CK‐MB and ROS, the rest of the above‐
measured markers reached close to sham levels by the end of day 8.
In rats that received STS before ISO, all the above‐measured markers
seemed to be close to sham levels as measured on both days 2 and 8,
indicating alleviation from stress. Further evidence in the form of
significant (P < .05) reduction in infarct size, ST‐height, improved
heart rate, and heart weight/body weight ratio in STS‐treated rats
substantiated its role in cardioprotection from toxicity caused by ISO
(Figure 2). In rats administered with STS alone, we found that all the
above‐measured plasma indicators were close to the sham and there
were no infarcts or abnormality in ECG of these rats compared to
sham. Hence, in further experiments, the STS alone group was
excluded.
The postinfarction changes were observed from the histological
assessment of heart tissue on day 8 (Figure 3A‐C). The sham rats
showed normal fibril architecture with striations and these were
continuous with adjacent fibrils. The ISO‐administered rats had se-
vere derangement of myofibrils, loss of branched appearance with
high neutrophil infiltration, and edema. The heart sections from the
STS + ISO group had a preserved morphology of muscle fibers, which
was better than the ISO group and had minimal infiltration/edema.
3.2 | Effect of STS on cognition in rats administered
with ISO
Effects of ISO‐induced myocardial injury on learning and memory in
rats were evaluated using the RAM and MWM tests from day 2 to 8.
 10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
4 of 11 | RAVINDRAN ET AL.

F I G U R E 1 The blood samples from rats were assessed for markers of injury, ischemia, inflammation, and oxidative stress, represented as (A)
lactate dehydrogenase (LDH), (B) creatine kinase‐muscle/brain (CK‐MB), (C) myeloperoxidase (MPO), (D) ischemia‐modified albumin (IMA),
and (E) reactive oxygen species (ROS). The data are presented as mean ± SD (n = 10/group). ISO, isoproterenol; RFU, relative fluorescence units;
STS, sodium thiosulfate. *P < .05 vs sham, #P < .05 vs STS + ISO

The rats were not evaluated on the day of dosing (day 0 and 1) to
provide a washout period for ISO.
The cognitive testing revealed a gradual decline in the learning
and memory tasks through days 2 to 8 in the ISO group rats com-
pared to sham (Figure 4). However, in most cases, the decline was
significant by day 8. In the STS + ISO group, the rats maintained their
cognitive ability close to the sham right from day 2 through day 8.
From the RAM, the working memory index (WMI), reference
memory errors, and reference memory index (RMI) were assessed.
During the evaluation period (days 2 to 8), the WMI reported no
significant change across all the groups (Figure 4A). However, rats in
the ISO group committed a significantly (P < .05) higher number of
reference memory errors after day 6 compared to the sham group
(Figure 4B). Unlike the ISO group, the rats from the STS + ISO group
had reference memory errors close to the sham right from day 2
through day 8. From this, the derived RMI was found to be dete-
riorated significantly (P < .05) for the ISO group on day 2 and 8 from
sham (Figure 4C). Similar to the ISO group, the rats from the STS +
ISO group showed significantly (P < .05) reduced RMI on day 2, but as
the testing days progressed, a significant (P < .05) improvement was
observed on day 8 compared to sham.
From MWM, the trajectories were assessed and the latency to
reach the platform was calculated from day 2 to 8 with a reversal of
task after day 5. The rats from the ISO group took more time to reach
the platform (latency) right from day 2, which became significant
(P < .05) by day 5 from sham (Figure 4D). A similar observation was
noted upon the reversal of task assessment in these rats from day 6
to 8. The rats from STS + ISO group could reach the platform in a
time which was as close to sham in both normal and reversal of task
assessment
3.3 | Effect of STS on apoptosis and oxidative stress
in heart and brain
The rat hearts from the ISO group showed significantly (P < .05) in-
creased apoptotic activity (caspase‐9 and caspase‐3) and ROS levels
on day 8 compared to sham (Figure 5). The STS pretreatment re-
sulted in a significant (P < .05) reduction in the caspase‐9 and ROS
levels from the ISO group but not for caspase‐3.
As we observed that reference memory was affected in the ISO
group rats prominently on day 8, and STS pretreatment maintained
the memory functions, we suspected brain injury by this day.
However, from the histological analysis, we could not observe any
severe neurodegeneration across all the groups (Figure 3). Hence,
we measured the apoptosis activation and ROS level in the brain to
 10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
RAVINDRAN ET AL. | 5 of 11

F I G U R E 2 The ISO‐induced heart failure was assessed from the (A‐C) ECG changes and myocardial injury characterized on day 2 from
ST‐elevation in (B) and the corresponding infarcted area in rat heart sections, (D) infarct size, (E) ST‐height, (F) heart rate, and (G) heart
weight/body weight ratio. The data are presented as mean ± SD (n = 10/group). ECG, electrocardiogram; ISO, isoproterenol; STS, sodium
thiosulfate. *P < .05 vs sham, #P < .05 vs ISO
 10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
6 of 11 | RAVINDRAN ET AL.

F I G U R E 3 The postinfarction changes in the heart and brain are presented through H&E‐stained images for (A) sham‐heart, (B) ISO‐heart,
(c) STS + ISO‐heart, (D) sham‐brain, (E) ISO‐brain, and (F) STS + ISO‐brain. The images are presented at ×40 magnification. *Severe necrotic
derangement of myocardium and fibrosis, the arrow indicates extensive inflammatory cell infiltration, and the arrowhead indicates normal
neuronal architecture in the hippocampal CA1 field. In the STS + ISO‐heart, very mild infiltration and fibrosis were noted. H&E, hematoxylin and
eosin; ISO, isoproterenol; STS, sodium thiosulfate

F I G U R E 4 The cognitive assessments in rats were done using radial arm maze and Morris water maze. The parameters evaluated are
presented as (A) working memory index, (B) reference memory errors, (C) reference memory index, (D) latency to reach the platform, and (E) the
representative trajectories of rats on day 1 and 5 are presented across groups in the inset. The data are presented as mean ± SD (n = 10/group).
*P < .05 vs sham at the specific time point. ISO, isoproterenol; STS, sodium thiosulfate

RAVINDRAN ET AL.
F I G U R E 5 The apoptotic activity and oxidative stress
experienced by the regions of brain and heart tissues are
represented by (A) caspase‐9 activity, (B) caspase‐3 activity, and
(D) ROS levels. The data are presented as sham normalized values
(mean ± SD; n = 10/group). ISO, isoproterenol; ROS, reactive oxygen
species; STS, sodium thiosulfate. *P < .05 vs sham, #P < .05 vs ISO
verify the protective role of STS on brain regions. Similar to the
heart, ISO rats had significantly (P < .05) higher caspase activity and
ROS levels in both the brain regions (cortex and striatum) com-
pared to sham. In the STS + ISO group, the brain activity of cas-
pases and ROS reduced significantly (P < .05) compared to ISO in
both regions.
3.4 | Effect of STS on mitochondrial function
in heart and brain
We aimed to verify if the STS acted through the preservation of
mitochondria in the present model. We observed a significant
(P < .05) reduction in the complex‐I, ‐II, and ‐IV activities of
10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
| 7 of 11
mitochondria from the heart of rats in the ISO group, which resulted
in declined ATP levels compared to sham by day 8 (Figure 6A).
Pretreating with STS before ISO administration resulted in a sig-
nificant (P < .05) recovery of the above complex enzyme activities
along with improved ATP levels in the cardiac mitochondria com-
pared to the ISO group.
From the result in Figure 3, it was prominent that the fold in-
crease in ROS was higher in the brain (cortex: ≈4.5‐fold and striatum:
≈3‐fold) than the heart (2‐fold) in the ISO group on day 8 and STS
pretreatment reduced this elevation. As mitochondria are one of the
key sources of ROS, the brain mitochondrial function was assessed.
The cortex mitochondria showed a significant (P < .05) decline only
for complex‐II activity in the ISO group (Figure 6B) while the striatum
mitochondria showed a significant decline (P < .05) in complex‐I, ‐II
and ‐III activities in the ISO group compared to sham (Figure 6C).
However, the brain of the STS + ISO group showed significant
(P < .05) improvement in all the mitochondrial complexes activities of
both cortex and striatum regions when compared to the ISO group.
Moreover, the significantly (P < .05) declined ATP level which was
observed in the striatum region of the ISO group (Figure 6C) was
restored (P < .05) in the STS + ISO group when compared with the
ISO group.
We noted that in the STS + ISO group, the mitochondrial
function of the striatum region was meagerly improved, while
those of the heart and cortex recovered close to sham. Hence, we
checked the mitochondrial copy number in the rat tissues
and noticed their significant (P < .05) reduction in the heart (20%)
and brain (cortex: 11% and striatum: 11%) of ISO group rats
compared to sham (Figure 6D). The STS pretreatment significantly
(P < .05) restored the mitochondrial copy number close to sham
only in the heart and cortex region of the brain compared to the
ISO group.
3.5 | Effect of STS on blood mitochondrial function
and release of circulating mitochondrial
damage‐associated molecular patterns
The myocardial damage caused by ISO results in the release of
damage‐associated molecular patterns (DAMPs such as mitochondria
DNA and ATP), which can be measured in the blood of these rats. The
ATP level and mitochondrial copy number in the ISO group on day 8
were significantly (P < .05) elevated compared to sham (Figures 7
and 6D). In the STS + ISO group, these parameters were significantly
(P < .05) reduced compared to ISO group and were close to sham
levels.
The impact of released DAMPs that trigger systemic responses
(elevated blood MPO activity in Figure 1D) was measured from the
damaged pattern of ETC complexes in the blood of ISO‐administered
rats (Figure 7). A significant (P < .05) reduction in the complex‐I, ‐II, ‐III,
and ‐IV was noted in the ISO group compared to sham. In STS
pretreated rats, a significant (P < .05) improvement in the ETC activity
was observed from the ISO group.
 10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
8 of 11 | RAVINDRAN ET AL.

F I G U R E 6 The mitochondrial functional activity of complex‐I to ‐IV and the ATP levels are measured and reported in the rats from their
(A) heart, and brain regions of (B) cortex and (D) striatum. D, The mitochondrial copy number in this tissue and blood. The data are presented as fold
change from the sham group (mean ± SD; n = 10/group). *P < .05 vs sham, #P < .05 vs ISO. The unit of measurement is represented for complex‐I as
nM NADH oxidized/min/mg, complex‐II as nM DCPICP reduced/min/mg, complex‐III as µM cytochrome‐c reduced/min/mg, complex‐IV as µM
cytochrome‐c oxidized/min/mg, ATP as nM/mg, and copy number as ND1/HGB ratio. ISO, isoproterenol; STS, sodium thiosulfate

4 | D I S C U S SI O N brain). Mitochondrial dysfunction was the cardinal AMI‐associated

A rationale for therapy for adverse neurological outcomes in cardi-
ovascular disease patients continues to evolve to improve post-
surgical patient life.[25] As a part of the effort, we used a preclinical
rat model to induce myocardial infarction (MI) and subsequent‐
associated neurological changes. We investigated the impact of STS
administration on myocardial damage in rats induced by the admin-
istration of ISO. The reduced infarct size, restoration of physiological
changes in ECG, and heart histology‐affirmed cardioprotection
against AMI. At the cellular level, ISO induced mitochondrial dys-
function and elevated oxidative stress in the myocardium was alle-
viated by STS. The beneficial effect of STS was extended to the brain,
where it reversed the AMI‐linked cognitive decline and cellular me-
tabolic alterations. Blood and its components play a critical role in
communication between the organs. Therefore the released cue from
the damaged organ (in the present study, the heart) can trigger ad-
verse cellular events in a distant organ (in the present study, the
change in the heart and brain, which was reflected in peripheral
blood mitochondria too. STS administration imparted significant im-
provement in mitochondrial functional activity in the heart and brain
with subsequent reduced release of mitochondria linked DAMPs. The
improved neurocognitive function along with elevated H2S level in
the brain tissue of STS‐treated rats emphasizes that STS not only
mediates direct cardioprotection but also facilitates secondary pro-
tective effects via H2S.
The ISO‐induced cardiac injury relates to catecholamine cardio-
toxicity, which is associated with similar metabolic and structural
aberrations comparable to AMI events in humans.[26] In the present
study, we measured ISO‐linked damage not only via infarct size,
histology and plasma markers (LDH, CK‐MB, IMA, MPO, and ROS)
but also through the cellular oxidative stress (ROS and caspase ac-
tivity) and mitochondrial function (ETC complex activity, ATP and
mitochondrial copy number). From our results, STS pretreatment of
ISO rats reduced the levels of the above plasma markers, infarct size,

RAVINDRAN ET AL.
F I G U R E 7 The blood mitochondrial functional activity is
presented from complex‐I to ‐IV and the ATP level from rats
administered with ISO and those pretreated with STS. The data are
presented as fold change from the sham group (mean ± SD; n = 10/
group). *P < .05 vs sham, #P < .05 vs ISO. The unit of measurement is
represented for complex‐I as µM NADH oxidized/min/mg, complex‐II
as µM DCPICP reduced/min/mg, complex‐III as mM cytochrome‐c
reduced/min/mg, complex‐IV as mM Cytochrome‐c oxidized/min/mg,
and ATP as µM/L. ISO, isoproterenol; STS, sodium thiosulfate
and preserved the myocardial architecture as a result of visible im-
provement in cardiac mitochondrial function and copy number. The
observed cardioprotective effect of STS was in agreement with our
previous study on an isolated rat heart model, where the direct im-
pact of STS on the myocardium was evaluated in the absence of
[13]
neurohumoral influence. Many investigations including ours had
shown that STS can modulate mitochondrial functional activity be-
sides acting as a calcium chelator and ROS scavenger.[27] Besides STS
can modulate the phosphatidylinositol 3‐kinase pathway, a cardio-
protective prosurvival kinase that can render cardioprotection
against myocardial injury.[28,29] Moreover, STS was reported to im-
prove the expression of PGC1α, the critical mediator of mitochon-
[30]
drial biogenesis. All this supportive data linked to the present
study results confirm the cardioprotective effect of STS against AMI.
F I G U R E 8 The leakage of the blood‐brain barrier in rats administered with ISO was measured on day 8 for (A) Evans blue (high molecular
weight) and (B) sodium fluorescein (low molecular weight). ISO, isoproterenol. *P < .05 vs sham
10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
| 9 of 11
The neurocognitive decline after cardiac surgery on MI in pa-
tients is a common and most overlooked problem due to slow
progressive pathology.[25] But depending on the nature of the co-
existing disease, the progression may be fast and express its phe-
notype.[6] Cardiac surgery or infarction linked cognitive functional
deterioration are associated with the cues derived from the da-
maged myocardium or hypoperfusion of the brain region. The cel-
lular contents released from the damaged myocardium are referred
to by several authors as DAMPs, which aid in recovery from the
damage.[31] Besides this, the DAMPs are also recognized as
proinflammatory mediators that act as signaling molecules to in-
itiate neuroinflammation.[8] Many studies report increased DAMPs
in systemic circulation following MI.[32,33] Accordingly, we focussed
on elevated mitochondrial DNA and ATP as DAMPs in the blood of
ISO‐challenged rats possibly released from the damaged heart
cells. Also, peripheral blood ETC enzymes were declined which can
contribute to oxidative stress. Thus, elevated proinflammatory
signals via DAMP and increased oxidative stress can trigger neu-
roinflammatory response and subsequently compromise brain
function which can reflect in the cognitive behavior of ISO‐
challenged rats. Accordingly, the present study demonstrated the
loss of spatial learning and memory with ISO‐challenged rats
measured via RAM and MWM. The major biochemical changes
associated with the brain include impaired BBB permeability for
low molecular weight proteins (Figure 8), reduced ETC enzyme
activity, and low mitochondrial copy number in the brain. Fur-
thermore, biochemical analysis in brain tissue distinct concerning
the cortex and striatum demonstrated a compromised mitochon-
drial function in the striatal region than the cortex. The brain
striatum is mainly concerned with the reference memory[34]
(measured via RAM), which was found to be low in rats from the
ISO group. To address the biases introduced by procedural memory
in measuring the reference memory through the RAM proce-
dure,[35] we measured the reversal of the task assessment by using
the MWM test that reaffirmed the impaired reference memory in
the ISO rats.
 10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
10 of 11 | RAVINDRAN ET AL.

F I G U R E 9 In rats administered with sodium thiosulfate (STS) intraperitoneally, the metabolism was evaluated from the levels of STS, H2S,
and its metabolic enzymes cystathionine beta‐synthase (CBS), cystathionine gamma‐lyase (CSE), and rhodanase in the rat brain taken on day 2.
Data are presented as mean ± SD of three rats per group. *P < .05 vs sham. STS administration elevated the levels of H2S in the brain
significantly without affecting the enzymes in the metabolic pathway indicating the nonenzymatic release of H2S from STS.
STS, sodium thiosulfate

Our previous study demonstrated the cardioprotective effect of AC KNO WL EDG M EN T

STS against myocardial ischemia‐reperfusion injury. In the present
study, we provide evidence for its protection to the myocardium and
brain tissue when the animal was subjected to ISO‐induced MI. Altered
mitochondrial function, the common pathological feature linked to MI,
and its associated cognitive decline proved in the present study, were
significantly improved by STS administration to the animal. Many in-
vestigators including our group had shown that STS can provide mi-
tochondrial protection in the heart[27] and brain.[36,37]
administration to the animal also reduced DAMP release into the blood
and indicated the protective influence of STS on distant organ injury
impact. However, this made us ask the question of whether STS‐
mediated cognitive improvement is a secondary impact of its action on
the heart or its direct influence on the brain. Towards that, we checked
the level of thiosulfate and H2S in brain tissue where we found an
elevated H2S level (Figure 9). H2S is a metabolite of STS and many
studies have attributed the cellular protection mediated by thiosulfate
to H2S release,[14] however, the debate on this issue continues.
Based on the above results, we conclude that STS mediated
cardioprotection and its associated nootropic effect are linked to the
improvement of mitochondrial function and reduction of oxidative
stress.
The authors would like to acknowledge the grant from the Depart-
ment of Science and Technology, India (#EMR/2017/000669)
through which the centrifuge for mitochondria isolation and the
chemicals used in the study were purchased.
CON F LI CT OF IN TE RES T S
The authors declare that there are no conflict of interests.
STS
ORCI D
Gino A. Kurian http://orcid.org/0000-0003-2051-2399
R E F E R E N CE S
[1] J. L. Anderson, D. A. Morrow, N. Engl. J. Med. 2017, 376, 2053.
[2] V. P. Harjola, W. Mullens, M. Banaszewski, J. Bauersachs, H. P.
Brunner‐La Rocca, O. Chioncel, S. P. Collins, W. Doehner, G. S.
Filippatos, A. J. Flammer, V. Fuhrmann, M. Lainscak, J. Lassus, M.
Legrand, J. Masip, C. Mueller, Z. Papp, J. Parissis, E. Platz, A. Rudiger,
F. Ruschitzka, A. Schäfer, P. M. Seferovic, H. Skouri, M. B. Yilmaz,
A. Mebazaa, Eur. J. Heart Failure 2017, 19, 821.
[3] L. Leto, M. Feola, J. Geriatr. Cardiol. 2014, 11, 316.
[4] K. Deckers, S. H. J. Schievink, M. M. F. Rodriquez, R. J. van Oostenbrugge,
M. P. J. van Boxtel, F. R. J. Verhey, S. Kohler, PLoS One 2017, 12,
e0184244.

RAVINDRAN ET AL.
[5] J. Čelutkienė, A. Vaitkevičius, S. Jakštienė, D. Jatužis, Card. Failure Rev.
2016, 2, 106.
[6] M. Berger, N. Terrando, S. K. Smith, J. N. Browndyke, M. F. Newman,
J. P. Mathew, Anesthesiology 2018, 129, 829.
[7] A. Salameh, S. Dhein, Front. Pharmacol. 2015, 6, 296.
[8] A. Mathew, T. A. Lindsley, A. Sheridan, D. L. Bhoiwala, S. F. Hushmendy,
E. J. Yager, E. A. Ruggiero, D. R. Crawford, J. Alzheimer's Dis. 2012, 30,
617.
[9] C. Szabo, Nat. Rev. Drug Discovery 2007, 6, 917.
[10] S. Jeddi, S. Gheibi, K. Kashfi, M. Carlström, A. Ghasemi, Int. J. Mol. Sci.
2020, 21, 1415.
[11] A. S. Hume, J. R. Mozingo, B. McIntyre, I. K. Ho, J. Toxicol., Clin.
Toxicol. 1995, 33, 721.
[12] M. Brucculeri, J. Cheigh, G. Bauer, D. Serur, Semin. Dial. 2005, 18,
431.
[13] S. Ravindran, S. R. Boovarahan, K. Shanmugam, R. C. Vedarathinam,
G. A. Kurian, Cardiovasc. Drugs Ther. 2017, 31, 511.
[14] E. Marutani, M. Yamada, T. Ida, K. Tokuda, K. Ikeda, S. Kai, K. Shirozu,
K. Hayashida, S. Kosugi, K. Hanaoka, M. Kaneki, T. Akaike, F. Ichinose,
J. Am. Heart Assoc. 2015, 4, e002125.
[15] B. Guo, Y. Li, R. Han, S. Yang, Y. Shi, D. Han, H. Zhou, M. Wang, Acta
Pharmacol. Sin. 2011, 32, 449.
[16] F. Tajik Bahram Pooreydy, J. Paramed. Sci. 2013, 4, 79.
[17] R. E. Vanderlinde, Ann. Clin. Lab. Sci. 1985, 15, 13.
[18] B. Pulli, M. Ali, R. Forghani, S. Schob, K. L. C. Hsieh, G. Wojtkiewicz,
J. J. Linnoila, J. W. Chen, R. Johnson, PLoS One 2013, 8, e67976.
[19] D. Bar‐Or, E. Lau, J. V. Winkler, J. Emerg. Med. 2000, 19, 311.
[20] S. Dikalov, K. K. Griendling, D. G. Harrison, Hypertension 2007, 49,
717.
[21] V. Kaushal, C. Herzog, R. S. Haun, G. P. Kaushal, Methods Mol. Biol.
2014, 1133, 141.
[22] F. Fontanesi, F. Diaz, A. Barrientos, Curr. Protoc. Hum. Genet. 2009,
63, 19.5.1.
[23] K. J. Livak, T. D. Schmittgen, Methods 2001, 25, 402.
[24] W. Zhou, M. Zhu, M. Gui, L. Huang, Z. Long, L. Wang, H. Chen, Y. Yin,
X. Jiang, Y. Dai, Y. Tang, L. He, K. Zhong, PLoS One 2014, 9, e109470.
10990461, 2020, 12, Downloaded from https://onlinelibrary.wiley.com/doi/10.1002/jbt.22606 by Egyptian National Sti. Network (Enstinet), Wiley Online Library on [19/09/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
| 11 of 11
[25] N. Scherbakov, W. Doehner, Card. Failure Rev. 2018, 4, 87.
[26] G. Rona, J. Mol. Cell. Cardiol. 1985, 17, 291.
[27] S. Ravindran, G. A. Kurian, J. Bioenerg. Biomembr. 2019, 51, 189.
[28] U. Sen, T. P. Vacek, W. M. Hughes, M. Kumar, K. S. Moshal, N. Tyagi,
N. Metreveli, M. R. Hayden, S. C. Tyagi, Pharmacology 2008, 82, 201.
[29] Y. Hu, X. Chen, T. T. Pan, K. L. Neo, S. W. Lee, E. S. Khin, P. K. Moore,
J. S. Bian, Pflugers Arch. 2008, 455, 607.
[30] S. Ravindran, S. Jahir Hussain, S. R. Boovarahan, G. A. Kurian, Chem.‐Biol.
Interact. 2017, 274, 24.
[31] S. Grazioli, J. Pugin, Front. Immunol. 2018, 9, 832.
[32] T. Ide, H. Tsutsui, S. Hayashidani, D. Kang, N. Suematsu, K. Nakamura,
H. Utsumi, N. Hamasaki, A. Takeshita, Circ. Res. 2001, 88, 529.
[33] P. Yue, S. Jing, L. Liu, F. Ma, Y. Zhang, C. Wang, H. Duan, K. Zhou,
Y. Hua, G. Wu, Y. Li, PLoS One 2018, 13, e0206003.
[34] K. I. Tsutsui, K. Oyama, S. Nakamura, T. Iijima, Front. Syst. Neurosci.
2016, 10, 99.
[35] C. V. Vorhees, M. T. Williams, ILAR. J. 2014, 55, 310.
[36] N. Subhash, R. Sriram, G. A. Kurian, Neurochem. Int. 2015, 90, 193.
[37] M. Lee, E. G. McGeer, P. L. McGeer, J. Neuroinflammation 2016, 13,
32.
SUPPO RTING IN F ORMATION
Additional supporting information may be found online in the
Supporting Information section.
How to cite this article: Ravindran S, Gopalakrishnan S,
Kurian GA. Beneficial effect of sodium thiosulfate extends
beyond myocardial tissue in isoproterenol model of infarction:
Implication for nootropic effects. J Biochem Mol Toxicol.
2020;34:e22606. https://doi.org/10.1002/jbt.22606