Journal of Autoimmunity 133 (2022) 102920

Contents lists available at ScienceDirect

Journal of Autoimmunity
journal homepage: www.elsevier.com/locate/jautimm

Transcriptomic profiling of iris tissue highlights LCK signaling and T

cell-mediated immunity in Behcet’s uveitis
Yang Deng a, Yinan Zhang b, c, Tao Cai a, Qingfeng Wang a, Wanyun Zhang a, Zhijun Chen a,
Xiang Luo a, Guannan Su a, Peizeng Yang a, *
a
The First Affiliated Hospital of Chongqing Medical University, Chongqing Key Laboratory of Ophthalmology, Chongqing Eye Institute, Chongqing Branch of National
Clinical Research Center for Ocular Diseases, Chongqing, PR China
b
Department of Ophthalmology, The First Affiliated Hospital of Zhengzhou University, Henan Province Eye Hospital, Henan International Joint Research Laboratory for
Ocular Immunology and Retinal Injury Repair, Zhengzhou, PR China
c
The Academy of Medical Sciences, Zhengzhou University, Zhengzhou, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: Uveitis is the most common form of ocular lesions in Behcet’s disease, severely affecting visual function. Mo­
RNA sequencing lecular pathological changes of ocular lesions in patients with Behcet’s uveitis (BU) are largely unknown. In this
Behcet disease study, we performed the first comprehensive transcriptomic profiling of iris specimens from BU patients and
Uveitis
healthy donors to provide an insight into intraocular immunopathogenesis. The mRNA sequencing identified
T cells
LCK
1633 differentially expressed genes (DEGs) between the BU group and healthy controls. GO functional enrich­
Iris ment analysis on DEGs showed that T cell activation was the most significantly enriched biological process.
KEGG analysis of DEGs also revealed several prominently enriched T cell-related pathways, including the T cell
receptor signaling pathway, Th17 cell differentiation, and Th1 and Th2 cell differentiation. The lymphocyte-
specific protein tyrosine kinase (LCK) was identified as the key hub gene in the protein interaction network of
DEGs. Western blot analysis further showed increased expression of active LCK in the BU group, suggesting
activation of LCK signaling. Using publicly accessible single-cell RNA-sequencing data of the healthy iris, LCK
was found to be expressed in clusters of activated T cells but not in other iris cell clusters, suggesting an overt
association between LCK upregulation and T cell-mediated immune dysregulation. Additionally, 16 drugs were
predicted to be potential inhibitors of LCK. Overall, these findings not only highlighted the central role of T cell-
mediated immunity and previously unreported LCK signaling in intraocular immunopathogenesis but also
revealed the potential value of LCK as a new therapeutic target for BU patients.

1. Introduction from vision-threatening intraocular inflammation, greatly reducing

Behcet’s disease (BD) is a complex multi-system disorder with
autoimmune and autoinflammatory features [1]. It is more prevalent in
the countries along the old Silk Road, such as Turkey, Iran, Israel, Japan,
and China [2]. Recurrent oral aphthosis, genital aphthosis, ocular le­
sions, skin lesions, and other systemic lesions are the characteristic
clinical manifestations of BD [3]. Over two-thirds of BD patients suffer
their quality of life [4]. Behcet’s uveitis (BU), characterized by recurrent
bilateral non-granulomatous panuveitis, is the most common form of BD
ocular lesions [5]. Although genetic factors and peripheral immuno­
logical mechanisms have been extensively explored [6–9], intraocular
immunopathogenesis in BU patients remains poorly understood. Its
treatment also remains challenging, with approximately 25% of patients
reported to have blindness despite treatment [2]. Therefore, it is

Abbreviations: BD, Behcet’s disease; BU, Behcet’s uveitis; scRNA-seq, single-cell RNA sequencing; DEGs, differentially expressed genes; AAU, acute anterior
uveitis; VKH, Vogt-Koyanagi-Harada; KEGG, Kyoto Encyclopedia of Genes and Genomes; GO, Gene Ontology; GSEA, Gene Set Enrichment Analysis; NES, normalized
enrichment scores; FDR, false discovery rate; PPI, protein-protein interaction; MCODE, Molecular Complex Detection; DGIdb, Drug–Gene Interaction Database; PCA,
principal component analysis; t-SNE, T-Distributed Stochastic Neighbor Embedding; RT-qPCR, Real-time quantitative polymerase chain reaction; PMSF, phenyl­
methanesulfonyl fluoride; LCK, lymphocyte-specific protein tyrosine kinase.
* Corresponding author. The First Affiliated Hospital of Chongqing Medical University, Chongqing Key Laboratory of Ophthalmology and Chongqing Eye Institute,
Chongqing Branch of National Clinical Research Center for Ocular Diseases, 1 You Yi Road, Yu Zhong District, Chongqing, 400016, China.
E-mail address: peizengycmu@126.com (P. Yang).

https://doi.org/10.1016/j.jaut.2022.102920
Received 22 July 2022; Received in revised form 19 September 2022; Accepted 19 September 2022
Available online 30 September 2022
0896-8411/© 2022 Elsevier Ltd. All rights reserved.
Y. Deng et al.
clinically necessary and urgent to comprehensively clarify the BU
pathogenesis and develop more effective and targeted therapies.
Due to the limited availability of samples from intraocular inflam­
matory sites and the lack of ideal animal models, most previous studies
relied on peripheral blood samples from BU patients to explore the
pathogenic mechanism. However, analysis of samples obtained from
peripheral sites alone cannot fully disclose intraocular pathophysiolog­
ical changes. In recent years, increasing studies have focused on the
analysis of intraocular aqueous humor samples, revealing the charac­
teristic intraocular immune microenvironment [10–12]. Differences in
cytokine profiles between intraocular aqueous humor and peripheral
serum or plasma have also been reported [13,14]. However, research on
the iris, one of the key intraocular inflammatory sites, remains unex­
plored, and its investigation may improve our understanding of BU
intraocular immunopathogenesis.
The recently booming single-cell RNA sequencing (scRNA-seq)
technologies can decipher pathophysiological changes at single-cell
resolution among heterogeneous cells [15]. Additionally, growing
research has shown the potential of combined analysis of scRNA-seq and
bulk RNA-seq data to elucidate the exact cellular and molecular mech­
anism in various diseases, such as osteoarthritis, BD, and cancers
[16–18]. In this study, we performed comprehensive transcriptomic
profiling of iris specimens obtained during peripheral iridectomy in BU
patients and compared them with healthy iris specimens. Also, we in­
tegrated publicly available scRNA-seq data of the healthy iris with our
bulk RNA-seq data to reveal cellular expression patterns of differentially
expressed genes (DEGs) and provide an insight into DEGs.
2. Materials and methods
2.1. Iris sample collection
All samples were collected at the First Affiliated Hospital of
Chongqing Medical University between December 2019 and August
2022, with written informed consent obtained from each participant. All
study procedures were performed according to the Declaration of Hel­
sinki principles and were authorized by the institutional review board at
the First Affiliated Hospital of Chongqing Medical University. All of the
included BU patients met the two diagnostic criteria proposed by the
International Study Group [19] and the International Revision Team
[3]. These patients developed nearly complete posterior synechiae and
underwent a preventive peripheral iridectomy to avoid secondary
glaucoma or increased intraocular pressure. Iris samples from the pa­
tients with other two most common uveitis entities, acute anterior
uveitis (AAU) and Vogt-Koyanagi-Harada (VKH) disease, were also
collected as disease controls. The eye bank provided the age- and
sex-matched healthy iris without any history of eye disease or eye sur­
gery. These specimens as healthy controls were obtained using a similar
surgical approach. The donors’ causes of death were car accidents, ce­
rebral hemorrhage, and suicide by dichlorvos overdose. The time from
death to enucleation was 2–6 h. This study involved a total of 14 BU
patients, 10 VKH patients, 10 AAU patients and 10 healthy donors, and
collected one iris specimen from each patient and healthy individual for
analysis. The basic features of all enrolled patients are detailed in Sup­
plemental Table 1.
2.2. Bulk RNA-seq, identification of DEGs and enrichment analysis
The iris from four BU patients and four healthy controls were chosen
for the bulk RNA-seq. Bulk RNA-seq was performed by Novogene (Bei­
jing, China) under the condition that total RNA quality met library
construction and mRNA sequencing requirements. Libraries were con­
structed using the NEBNext® Ultra™ RNA Library Prep Kit for Illu­
mina®. After the Libraries were qualified, sequencing was carried out by
the Illumina NovaSeq 6000. High-quality clean data were generated by
removing unqualified reads from raw data before further analysis.
2
Journal of Autoimmunity 133 (2022) 102920
DESeq2 R package (version 1.20.0) was used to identify DEGs with
the criteria of absolute log2 (fold change) ≥1 and adjusted P-value
(padj) ≤0.05. ClusterProfiler R package (version 3.8.1) was applied to
examine DEGs enrichment in the Kyoto Encyclopedia of Genes and
Genomes (KEGG) pathways and Gene Ontology (GO) terms. A padj
≤0.05 indicated significant enrichment. Moreover, Gene Set Enrichment
Analysis (GSEA) was conducted with the KEGG and GO data sets as
previously described [20]. The threshold of GSEA on significance was
normalized enrichment scores (NES) > 1, nominal P < 0.05, or false
discovery rate (FDR) q-value<0.25 [21].
2.3. Analysis of protein-protein interaction (PPI) network and
identification of hub genes
PPI network of DEGs was obtained based on the STRING database,
and its visualization was constructed by Cytoscape software (version
3.9.1). Molecular Complex Detection (MCODE), a Cytoscape plugin
(version 2.0.0), was also used to find clusters of highly interconnected in
the network with the default settings. KEGG pathways enriched by DEGs
in clusters of interest were identified and visualized using the Cytoscape
plugin ClueGO (version 2.5.8).
Hub genes were the critical nodes in the network, identified by the
Cytoscape plugin cytoHubba (version 0.1). To optimize sensitivity and
specificity, five topological algorithms (Degree, MNC, EPC, Closeness,
and Radiality) were applied to identify their top 20 hub genes respec­
tively, and the genes located at their intersections were finally chosen as
the hub genes in this study [22].
2.4. Drug-gene interactions
Drug–Gene Interaction Database (DGIdb 4.0) was used to annotate
whether the gene of interest was targeted by any known drugs or
belonged to any putatively druggable gene categories [23]. The infor­
mation provided by DGIdb is based mainly on publications and potential
data sources such as TTD, Chembl, DrugBank, Drug Target Commons,
and PharmGKB.
2.5. scRNA-seq
The scRNA-seq data of healthy iris from a male donor aged 39 was
downloaded from the GEO database (GSE147979) and was analyzed by
the R package Seurat (version 4.0.4). Before analysis, we filtered out
cells with less than 200 genes and only considered genes detected in at
least three cells. Outliers in data filtering indicators (features, counts,
and mitochondrial genes) were removed. After data quality control, the
data was normalized by the function NormalizeData. The function
FindVariableFeatures was used to find the top 2000 variable genes, and
the function ScaleData was simultaneously used to scale data. Iris data
was then investigated by principal component analysis (PCA) and
clustering analysis. We selected the top 20 principal components and set
the parameter resolution at 0.2 for clustering analysis. T-Distributed
Stochastic Neighbor Embedding (t-SNE) was performed after PCA and
clustering. For the annotation of cell types, we used the same gene
markers as reported in this scRNA-seq data [24].
2.6. Real-time quantitative polymerase chain reaction (RT-qPCR)
According to the manufacturer’s protocols, total RNA of the iris was
extracted by SteadyPure Universal RNA Extraction Kit (Accurate
Biology, China) and reverse transcribed into cDNA by RT Master Mix for
qPCR II (MCE, USA). RT-qPCR was conducted using SYBR Green qPCR
Master Mix (MCE, USA) on an ABI 7500 Real-Time PCR System (Applied
Biosystems, USA). The primers synthesized by Sangon (Shanghai, China)
are as follows: β-actin (forward primer-
ACTGGAACGGTGAAGGTGACAG and reverse primer-
GGTGGCTTTTAGGATGGCAA G), and LCK (forward primer-
Y. Deng et al.
TGGACAACGGTGGCTTCTAC and reverse primer-GCCCATCTGAA
GCATTGGTG). Relative expression was calculated using the 2− ΔΔCt
method.
2.7. Western blot
Total protein was extracted using RIPA Lysis Buffer (Beyotime,
China) supplemented with phenylmethanesulfonyl fluoride (PMSF) and
phosphatase inhibitor cocktail A. Proteins were separated on an 8%
precast gel (ACE Biotechnology, China) and transferred onto a PVDF
membrane. Membranes were blocked with NcmBlot blocking buffer
(NCM Biotech, China). The membranes were then incubated overnight
at 4 ◦ C with the following primary antibodies: rabbit polyclonal anti-
LCK (1:1000, ABclonal, A2177); rabbit polyclonal anti-Phospho-LCK-
Y394 (1:500, ABclonal, AP0182); and rabbit polyclonal anti-GAPDH
(1:20000, Affinity, AF7021). After incubation with corresponding sec­
ondary antibodies for 1 h at room temperature, the proteins were
detected on an Image Lab system (Bio-Rad, USA) using a BeyoECL Star
kit (Beyotime, China). All procedures followed the manufacturers’ in­
structions, and protein bands were quantized by ImageJ software.
2.8. Immunohistochemistry
The paraffin-embedded skin biopsy specimens were from three pa­
tients with BD-related skin lesions (erythema nodosum) and from three
age-and sex-matched healthy donors who underwent plastic surgery (C.
T.). Immunohistochemical staining of LCK (1:200) was performed
following the previously described protocol [25]. Images were acquired
by a 3DHISTECH slide scanner and its SlideViewer software (version
2.5).
3. Results
3.1. Identification of dysregulated genes in the iris of BU patients
To reveal the pathogenic molecular features in the iris of BU patients,
we performed mRNA-seq on this tissue. Principal component analysis
(PCA) showed a clear separation between the BU group and healthy
controls (Fig. 1A), indicating the presence of disease-specific gene
expression patterns. A total of 1633 dysregulated DEGs were identified,
with 1142 being upregulated (Fig. 1B). Cluster analysis on DEGs showed
that samples from BU patients and controls were grouped into distinct
Fig. 1. Comparison of gene expression profiles of the iris between BU patients and healthy controls. (A) Principal component analysis results of all mRNA-sequencing
samples (n = 8).(B) The volcano plot of the DEGs in the BU group compared with healthy controls. (C) The heat map of the DEGs between these two groups. DEGs,
differentially expressed genes; BU, Behcet’s uveitis; B, the iris sample from the Behcet’s uveitis group; C, the iris sample from healthy controls.
3
Journal of Autoimmunity 133 (2022) 102920
clusters, and samples from the same group exhibited a similar expression
pattern (Fig. 1C). Supplemental Table 2 provides information on all
DEGs in detail.
3.2. Prominence of T cell-mediated biological processes in the
pathogenesis of BU
We conducted GO and KEGG enrichment analyses to determine the
functions and potential biological roles of these DEGs. GO is a
comprehensive database documenting gene functions and comprises
three categories: biological process, cellular component, and molecular
function. The bar graph represented the ten most significantly enriched
GO items in each category (Fig. 2A). T cell activation was found to be the
most significantly enriched biological process, followed by leukocyte
migration, adaptive immune response, and lymphocyte differentiation.
T cell activation involved 111 upregulated DEGs and 7 downregulated
DEGs. The GSEA using the GO dataset further demonstrated a prominent
association of T cell activation with BU phenotype (Fig. 2B). In addition,
several T cell-related KEGG pathways, including the T cell receptor
signaling pathway, Th17 cell differentiation, and Th1 and Th2 cell dif­
ferentiation, were also markedly enriched by DEGs (Fig. 2C). Similarly,
the GSEA using the KEGG dataset confirmed that these T cell-related
KEGG pathways were largely responsible for the BU phenotype
(Fig. 2D–F). These results suggest that T cell-mediated immune re­
sponses feature prominently in the pathogenesis of BU.
3.3. Identification of important modules and hub genes in PPI network
We next explored the protein-protein interactions of these dysregu­
lated genes using the STRING database. Overall, 1014 nodes (protein-
coding genes) and 6003 edges (protein-protein interactions) were found
to constitute a vast and intricate PPI network (Fig. 3A). Two important
modules were recognized in the PPI network using the MCODE plugin in
Cytoscape software (Fig. 3B). The module 1 (score = 37.68) consisted of
38 nodes and 697 edges, and its relevant DEGs were significantly
enriched in the cytokine-related pathways such as cytokine-cytokine
receptor interaction, chemokine signaling pathway, IL-17 signaling
pathway, and TNF signaling pathway (Fig. 3C). The T cell-related
pathways, including T cell receptor signaling pathway, Th17 cell dif­
ferentiation, and Th1 and Th2 cell differentiation, were highly enriched
by DEGs in the module 2 (score = 13.13) containing 40 nodes and 256
edges (Fig. 3D). We further determined the hub genes in the PPI network
Y. Deng et al. Journal of Autoimmunity 133 (2022) 102920

Fig. 2. Functional enrichment analyses. (A) The GO enrichment analysis of all DEGs. The bar graph shows the ten most significantly enriched GO items in each
category, including biological process (BP), cellular component (CC), and molecular function (MF). (B) The GSEA enrichment plot for the most significantly enriched
GO item marked by red rectangle in (A). The NES = 2.18, nominal P < 0.001, and FDR q-value<0.001. (C) The KEGG enrichment analysis of all DEGs. The bubble
plot shows all significantly enriched KEGG pathways. (D–F) The GSEA enrichment plots for the significantly enriched T cell-related KEGG pathways marked by red
rectangle in (C). The NES = 1.66, nominal P < 0.001, and FDR q-value = 0.009 in (D); The NES = 1.90, nominal P < 0.001, and FDR q-value<0.001 in (E); The NES
= 1.80, nominal P < 0.001, and FDR q-value = 0.002 in (F). DEGs, differentially expressed genes; GSEA, Gene Set Enrichment Analysis; NES, normalized enrichment
scores; FDR, false discovery rate. GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

by choosing overlapping genes obtained by 5 algorithms in the cyto­
Hubba (Fig. 3E). A total of 7 hub genes, with 6 being upregulated, were
identified. The Cytoscape was used to visualize these hub genes ac­
cording to their significance of differential expression between the BU
patients and healthy controls (Fig. 3F). Table 1 provides details on these
7 hub genes. We found that the top two hub genes, CD8A and
lymphocyte-specific protein tyrosine kinase (LCK), were closely related
to T cell functions [26], further suggesting an important role of T cells in
BU pathogenesis. Finally, we chose LCK as the key hub gene for the
following studies because difference of LCK expression between these
two groups was the most significant among all identified hub genes.
phosphorylation level of LCK at Y394, an indicator of activation.
Western blot results showed an increased phosphorylation level in the
BU group (Fig. 4C–F), indicating the presence of abundantly activated
LCK in the iris of BU patients. The LCK upregulation, including its
mRNA, total protein, and active protein levels, was also observed in the
iris from AAU and VKH patients (Supplemental Fig. 1). Additionally,
immunohistochemical staining results also showed a distinctly increased
LCK expression in the BD-related skin lesions (Supplemental Fig. 2).
3.5. Analysis on LCK combined with the scRNA-seq data

We analyzed the cellular expression patterns of DEGs in the healthy

3.4. Validation of the key hub gene LCK
To verify the reliability of the RNA-seq results, we performed RT-
qPCR and Western blot to detect LCK expression in the iris of another
cohort containing 10 BU patients and 5 healthy controls. Consistent with
the RNA-seq data, RT-qPCR results showed that LCK mRNA level in the
BU group was substantially higher than that in the controls (Fig. 4A and
B). Western blot analysis also confirmed an obviously increased LCK
protein level in the BU group (Fig. 4C–F). Furthermore, we examined the
iris using the scRNA-seq data to determine which cell types constitu­
tively express LCK. The tSNE plots of the scRNA-seq data showed eight
distinct iris cell clusters, including fibroblasts, melanocytes, smooth
muscle cells, activated T cells, monocytes, Schwann cells, putative stem
cells, and cytotoxic T cells (Fig. 5A). In these iris cell clusters, we found
that the DEGs mainly exhibited five types of distribution features. Type 1
referred to those genes that were not constitutively expressed in almost
all clusters (Fig. 5B). Type 2 exhibited sporadic distribution of the DEGs
(Fig. 5C). Type 3 showed a preferred distribution in one or more clusters

4
Y. Deng et al. Journal of Autoimmunity 133 (2022) 102920

Fig. 3. Analysis of PPI network of the DEGs. (A) The overview of the PPI network. Pink nodes represent up-regulated DEGs in the BU group, dark blue nodes
represent down-regulated DEGs in the BU group, and light blue nodes denote non-DEGs predicted to interact with the DEGs. (B) The overview of two modules in the
PPI network. All genes in the module 1 (left side) and module 2 (right side) are shown. (C–D) KEGG pathways enriched by genes in the module 1 (C) and module 2
(D), respectively. The size of the pathway node indicates the number of mapped genes, and its color denotes the significance of the pathway enrichment, with dark
brown representing a P value less than 0.0005 and red representing a P value less than 0.05 but greater than 0.005. (E) Venn diagram showing overlapping hub genes
identified by 5 algorithms in the cytoHubba. (F) PPI network of the 7 overlapping hub genes. The node size represents the significance level of the differential
expression of hub genes between the BU patients and healthy controls; the larger the node, the more significant it is. PPI, protein-protein interaction; DEGs,
differentially expressed genes; BU, Behcet’s uveitis.

(Fig. 5D). Type 4 referred to those genes expressed almost exclusively in
one cluster (Fig. 5E). Type 5 represented widespread distribution in
almost all clusters (Fig. 5F). We found that LCK, a representative of type
4, was only expressed in clusters of activated T cells (Fig. 5E).
3.6. Screening of potential drugs that target LCK
Given that LCK could be implicated in BU development, we therefore
searched the DGIdb database to explore whether it could be targeted by
drugs or belonged to putatively druggable genes. The result showed that

5
Y. Deng et al. Journal of Autoimmunity 133 (2022) 102920

Table 1
The information of seven hub genes.
Hub genes Degree Closeness EPC MNC Radiality Total Rank log2 Padj
Score Score Score Score Score Score Fold Change
CD8A 120 482.7 73.7 115 10.4 801.8 1 3.48 7.84E-09
LCK 109 480.1 68.4 109 10.4 776.9 2 4.08 1.68E-18
TNF 99 477.2 67.1 97 10.4 750.7 3 3.83 2.56E-05
EGFR 103 482.6 59.2 95 10.4 750.3 4 − 1.44 2.22E-05
MYC 83 469.0 58.8 76 10.4 697.2 5 4.09 0.0009
CXCL12 78 452.2 71.8 75 10.3 687.3 6 1.62 0.005
SYK 81 453.5 58.0 79 10.3 681.8 7 1.94 2.94E-05

Fig. 4. Validation of the key hub gene LCK. (A) LCK expression level based on mRNA sequencing data (n = 4).(B) Quantification of LCK mRNA level by RT-qPCR (n
= 5). (C) Representative Western blot images of LCK protein and its phosphorylation. (D–F) Quantification of the Western blot data of LCK protein level and its
phosphorylation level (n = 5). BU, Behcet’s uveitis; HC, healthy controls.

LCK could be a potentially druggable gene, with 59 drugs possibly tar­
geting it. Fig. 6 presents drugs having a well-defined interaction (in­
hibitor) with LCK. A total of 16 drugs could act as its inhibitors, of which
JNJ-26483327 and NINTEDANIB were the top two with the highest
interaction score.
4. Discussion
This study, for the first time, presents comprehensive transcriptomic
profiling of the iris obtained from BU patients and healthy controls. Bulk
RNA-seq data showed 1633 dysregulated genes in the BU group.
Enrichment analyses (KEGG, GO, and GSEA) highlighted the involve­
ment of T cell-mediated biological processes and their association with
the BU phenotype. LCK was identified as the key hub gene in the PPI
network, and its phosphorylation level at Y394 was increased in the BU
group. Additionally, we revealed five cellular expression patterns of
DEGs in the healthy iris using the scRNA-seq data. LCK was expressed in
clusters of activated T cells but not in other iris cell clusters, suggesting
that LCK dysregulation was related to disturbance of T cell homeostasis.
The BU is one of the most severe entities of uveitis, primarily
affecting the retina and the uvea [27]. Considering the almost inacces­
sibility of other intraocular tissues such as the retina, ciliary body, and
choroid, we focused on the iris of BU patients to explore intraocular
immunopathogenesis of this disease. In this study, the bulk RNA-seq of
the iris identified 1633 DEGs between the BU group and controls,
suggesting numerous molecular pathological changes occurring in
ocular lesions. The GO, KEGG, and PPI network analyses for these DEGs
highlighted T cell-mediated biological processes, suggesting an active
participation of T cells in disease progression. The GSEA further indi­
cated that these T cell-mediated immune responses were closely related
to the development of intraocular inflammation. These results are
principally consistent with histopathological findings reported by
George et al. They showed a predominant infiltration of T cells in the
retina and uvea from an enucleated BU eye [28]. Previous studies also
reported that T cells were the main infiltrating cells in the aqueous
humor of BU patients [29,30]. Moreover, our previous studies revealed
that active BU patients had hyperactive Th1 and Th17 responses in their
peripheral blood [31,32]. Other studies of peripheral inflammatory sites
also underlined additional contributors to BU pathogenesis, such as
CD68+ macrophages, neutrophils, and natural killer cells [33–35].
These studies on different inflammatory sites collectively unravel the
complicated pathogenesis of BU.
Compared with CD4+ T cells, the contribution of CD8+ T cells in BD
pathogenesis is less investigated. In agreement with previous studies
[36,37], our PPI network analysis for DEGs also provided evidence for
the participation of CD8+ T cells in intraocular immunopathogenesis.
We found that CD8A was the top-ranked hub gene in the PPI network,
suggesting that CD8+ T cells may play a pivotal role in the development
of intraocular inflammation. One previous study also demonstrated that
CD8+ T cells were the predominant infiltrating cells in the aqueous

6
Y. Deng et al.
Fig. 5. Constitutive expression pattern of the DEGs in the distinct iris cell clusters. (A) The tSNE plots of the scRNA-seq data of the healthy iris showing eight distinct
iris cell clusters. (B–F) Representative tSNE plots exhibiting five types of distribution features of the DEGs in the distinct iris cell clusters. Purple intensity denotes the
normalized gene expression level. Dark purple corresponds to high expression, grey indicates no expression. DEGs, differentially expressed genes.
Fig. 6. Drugs inhibiting LCK based on the Drug–Gene Interaction Database.
humor of patients with active BU, whereas CD4+ T cells were mostly
observed in patients with other noninfectious uveitis such as VKH and
idiopathic uveitis [37]. They speculated that the distinct predominance
7
Journal of Autoimmunity 133 (2022) 102920
and cytotoxic potential of CD8+ T cells might partially explain the severe
intraocular destructive property of BU as compared with other nonin­
fectious uveitis. Recently, Vural et al. reported that CD8+ T cells were
the predominant T-cell subset and the main IL-17A-producing cells in
papulopustular skin lesions of BD patients, contributing to recruitment
and activation of neutrophils [38]. However, the specific functions of
CD8+ T cells and their interactions with other inflammatory infiltrating
cells in the ocular lesions of BU patients remain unclear, which need to
be clarified in future studies.
Another intriguing result in our PPI network analysis was the iden­
tification of a previously undescribed LCK in the BU. LCK, a tyrosine
kinase belonging to the non-receptor Src family, has been shown to be
expressed in a variety of cell types, such as T cells, B cells, NK cells,
neurons, and tumor cells, and is essential for activating signaling cas­
cades downstream of multiple receptors [39–41]. LCK overexpression
has been demonstrated to be strongly correlated with the development
of other autoimmune or chronic inflammatory diseases, such as psori­
asis, Type 1 diabetes, asthma, rheumatoid arthritis, inflammatory bowel
diseases, atherosclerosis, systemic lupus erythematosus, and dermato­
myositis [42]. In this study, we also found that LCK expression was
evidently upregulated in the iris of BU patients, along with a consider­
able increase in its activity. Its upregulation was also observed in the iris
of AAU and VKH patients and in the BD-related skin lesions. These
findings indicate that LCK signaling may be a crucial molecular pathway
shared by the above diseases. Interestingly, our scRNA-seq results
revealed that LCK was expressed in clusters of activated T cells but not in
Y. Deng et al.
other iris cell clusters, suggesting a close association between LCK dys­
regulation and disturbance of T cell homeostasis in the inflamed iris. It is
worth pointing out that LCK has been widely recognized to have a
critical role in T cell-mediated biological processes such as T cell
development, differentiation, and function [42]. Moreover, a recent
study showed that suppression of LCK signaling improved psoriatic
symptoms by reducing Th1/Th17 immune responses and increasing
Treg cells [43]. Likewise, Luo et al. reported that LCK inhibition
significantly alleviated pulmonary inflammation and improved lung
function by lowering Th2 cytokines production in asthma mice [44].
These results further suggest that LCK blockade may also have beneficial
effects on the reduction of BU intraocular inflammation by influencing
various T cell-mediated immune responses. Therefore, our study may
provide a new and promising target for the study of BU treatment, which
deserves future confirmation.
Our study has several limitations. Firstly, the sample size used in this
study was limited due to the small number of BU patients receiving the
preventive peripheral iridectomy. Secondly, as this study only included
the patients with a relatively long course of disease, our results did not
address the immunopathogenesis of the entire disease course. Finally,
these enrolled patients were on systemic corticosteroids and immuno­
suppressants before surgery to achieve a clinically quiescent status,
which could have influenced our transcriptome data.
In conclusion, our study highlighted the involvement of T cell-
mediated immunity and LCK signaling in intraocular immunopatho­
genesis of BU patients. Our results also provide evidence that LCK
upregulation may be related to T cell-mediated immune dysregulation.
Therefore, LCK inhibition might serve as a new therapeutic strategy to
improve intraocular inflammation for BU patients.
Author contributions
Yang Deng: Conceptualization, Formal analysis, Investigation, Data
Curation, Writing - Original Draft, Writing - Review & Editing. Yinan
Zhang: Formal analysis, Investigation. Tao Cai: Data Curation, Writing -
Review & Editing. Qingfeng Wang: Formal analysis, Writing - Review &
Editing. Wanyun Zhang: Formal analysis. Zhijun Chen: Investigation.
Xiang Luo: Investigation. Guannan Su: Writing - Review & Editing.
Peizeng Yang: Conceptualization, Resources, Supervision, Writing -
Review & Editing, Funding acquisition.
Funding
This work was supported by the Natural Science Foundation Major
International (Regional) Joint Research Project [grant numbers
81720108009]; the National Natural Science Foundation Key Program
[grant numbers 81930023]; the Chongqing Outstanding Science Project
[grant numbers 2019]; the Chongqing Chief Medical Scientist Project
[grant numbers 2018]; the Chongqing Key Laboratory of Ophthal­
mology [grant numbers CSTC, 2008CA5003]; the Chongqing Science &
Technology Platform and Base Construction Program [grant numbers
cstc2014pt-sy10002]; and the Key Project of Chongqing Science and
Technology Bureau [grant numbers CSTC2021jscx-gksb-N0010]. The
funding organization had no role in the design or conduct of this
research.
Declaration of competing interest
No conflicting relationship exists for any author.
Data availability
Data will be made available on request.
8
Journal of Autoimmunity 133 (2022) 102920
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.jaut.2022.102920.
References
[1] A. Hedayatfar, Behçet’s disease: autoimmune or autoinflammatory? J. Ophthalmic
Vis. Res. 8 (2013) 291–293.
[2] A. Greco, A. De Virgilio, M. Ralli, A. Ciofalo, P. Mancini, G. Attanasio, M. de
Vincentiis, A. Lambiase, Behçet’s disease: new insights into pathophysiology,
clinical features and treatment options, Autoimmun. Rev. 17 (2018) 567–575,
https://doi.org/10.1016/j.autrev.2017.12.006.
[3] The International Criteria for Behçet’s Disease (ICBD), A collaborative study of 27
countries on the sensitivity and specificity of the new criteria, J. Eur. Acad.
Dermatol. Venereol. 28 (2014) 338–347, https://doi.org/10.1111/jdv.12107.
[4] E.T. Cunningham Jr., I. Tugal-Tutkun, M. Khairallah, A.A. Okada, B. Bodaghi,
M. Zierhut, Behçet Uveitis. Ocul Immunol Inflamm. 25 (2017) 2–6, https://doi.
org/10.1080/09273948.2017.1279840.
[5] T. Özgürtaş, Ç. Yücel, E. Sertoğlu, Y. Hayran, S. Çolak, E. Tekgöz, A. Omma, A.
H. Durukan, Evaluation of the relationship of lymphangiogenesis markers with
disease pathogenesis in patients with Behçet’s uveitis, Acta Clin. Belg. 77 (2022)
387–395, https://doi.org/10.1080/17843286.2021.1890451.
[6] S. Hou, D. Liao, J. Zhang, J. Fang, L. Chen, J. Qi, Q. Zhang, Y. Liu, L. Bai, Y. Zhou,
A. Kijlstra, P. Yang, Genetic variations of IL17F and IL23A show associations with
Behçet’s disease and Vogt-Koyanagi-Harada syndrome, Ophthalmology 122 (2015)
518–523, https://doi.org/10.1016/j.ophtha.2014.09.025.
[7] Z. Zhong, G. Su, A. Kijlstra, P. Yang, Activation of the interleukin-23/interleukin-
17 signalling pathway in autoinflammatory and autoimmune uveitis, Prog. Retin.
Eye Res. 80 (2021), 100866, https://doi.org/10.1016/j.preteyeres.2020.100866.
[8] X.F. Huang, M.A. Brown, Progress in the genetics of uveitis, Gene Immun. 23
(2022) 57–65, https://doi.org/10.1038/s41435-022-00168-6.
[9] J. Shan, P. Zhou, Z. Liu, K. Zheng, X. Jin, L. Du, Association of miRNA-146a gene
polymorphism Rs2910164 with Behcet’s disease: a meta-analysis, Ocul. Immunol.
Inflamm. (2021) 1–7, https://doi.org/10.1080/09273948.2021.1968002.
[10] A.M. Abu El-Asrar, N. Berghmans, S.A. Al-Obeidan, P.W. Gikandi, G. Opdenakker,
J. Van Damme, S. Struyf, Local cytokine expression profiling in patients with
specific autoimmune uveitic entities, Ocul. Immunol. Inflamm. 28 (2020) 453–462,
https://doi.org/10.1080/09273948.2019.1604974.
[11] J. Xu, Y. Qin, R. Chang, H. Tan, Q. Wang, G. Su, Q. Cao, A. Kijlstra, P. Yang,
Aqueous cytokine levels in four common uveitis entities, Int. Immunopharm. 78
(2020), 106021, https://doi.org/10.1016/j.intimp.2019.106021.
[12] L. Wildschütz, D. Ackermann, A. Witten, M. Kasper, M. Busch, S. Glander,
H. Melkonyan, K. Walscheid, C. Tappeiner, S. Thanos, A. Barysenka, J. Koch,
C. Heinz, B. Laffer, D. Bauer, M. Stoll, S. König, A. Heiligenhaus, Transcriptomic
and proteomic analysis of iris tissue and aqueous humor in juvenile idiopathic
arthritis-associated uveitis, J. Autoimmun. 100 (2019) 75–83, https://doi.org/
10.1016/j.jaut.2019.03.004.
[13] M.H. Errera, A. Pratas, S. Fisson, T. Manicom, M. Boubaya, N. Sedira, E. Héron,
L. Merabet, A. Kobal, V. Levy, J.M. Warnet, C. Chaumeil, F. Brignole-Baudouin, J.
A. Sahel, P. Goldschmidt, B. Bodaghi, C. Bloch-Queyrat, Cytokines, chemokines
and growth factors profile in human aqueous humor in idiopathic uveitis, PLoS
One 17 (2022), e0254972, https://doi.org/10.1371/journal.pone.0254972.
[14] M. Bonacini, A. Soriano, L. Cimino, L. De Simone, E. Bolletta, F. Gozzi, F. Muratore,
M. Nicastro, L. Belloni, A. Zerbini, L. Fontana, C. Salvarani, S. Croci, Cytokine
profiling in aqueous humor samples from patients with non-infectious uveitis
associated with systemic inflammatory diseases, Front. Immunol. 11 (2020) 358,
https://doi.org/10.3389/fimmu.2020.00358.
[15] Y. Lei, R. Tang, J. Xu, W. Wang, B. Zhang, J. Liu, X. Yu, S. Shi, Applications of
single-cell sequencing in cancer research: progress and perspectives, J. Hematol.
Oncol. 14 (2021) 91, https://doi.org/10.1186/s13045-021-01105-2.
[16] X. Li, Z. Liao, Z. Deng, N. Chen, L. Zhao, Combining bulk and single-cell RNA-
sequencing data to reveal gene expression pattern of chondrocytes in the
osteoarthritic knee, Bioengineered 12 (2021) 997–1007, https://doi.org/10.1080/
21655979.2021.1903207.
[17] L. Liang, J. Yu, J. Li, N. Li, J. Liu, L. Xiu, J. Zeng, T. Wang, L. Wu, Integration of
scRNA-seq and bulk RNA-seq to analyse the heterogeneity of ovarian cancer
immune cells and establish a molecular risk model, Front. Oncol. 11 (2021),
711020, https://doi.org/10.3389/fonc.2021.711020.
[18] W. Zheng, X. Wang, J. Liu, X. Yu, L. Li, H. Wang, J. Yu, X. Pei, C. Li, Z. Wang,
M. Zhang, X. Zeng, F. Zhang, C. Wang, H. Chen, H.Z. Chen, Single-cell analyses
highlight the proinflammatory contribution of C1q-high monocytes to Behçet’s
disease, Proc. Natl. Acad. Sci. U. S. A. 119 (2022), e2204289119, https://doi.org/
10.1073/pnas.2204289119.
[19] Criteria for diagnosis of behçet’s disease. International study group for behçet’s
disease, Lancet 335 (1990) 1078–1080.
[20] A. Subramanian, P. Tamayo, V.K. Mootha, S. Mukherjee, B.L. Ebert, M.A. Gillette,
A. Paulovich, S.L. Pomeroy, T.R. Golub, E.S. Lander, J.P. Mesirov, Gene set
enrichment analysis: a knowledge-based approach for interpreting genome-wide
expression profiles, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 15545–15550,
https://doi.org/10.1073/pnas.0506580102.
[21] N. Fenouille, C.F. Bassil, I. Ben-Sahra, L. Benajiba, G. Alexe, A. Ramos, Y. Pikman,
A.S. Conway, M.R. Burgess, Q. Li, F. Luciano, P. Auberger, I. Galinsky, D.
J. DeAngelo, R.M. Stone, Y. Zhang, A.S. Perkins, K. Shannon, M.T. Hemann,
Y. Deng et al.
A. Puissant, K. Stegmaier, The creatine kinase pathway is a metabolic vulnerability
in EVI1-positive acute myeloid leukemia, Nat. Med. 23 (2017) 301–313, https://
doi.org/10.1038/nm.4283.
[22] X. Li, X. Liu, X. Pang, Y. Yin, H. Yu, Y. Yuan, B. Li, Transcriptomic analysis reveals
hub genes and subnetworks related to ROS metabolism in Hylocereus undatus
through novel superoxide scavenger trypsin treatment during storage, BMC
Genom. 21 (2020) 437, https://doi.org/10.1186/s12864-020-06850-1.
[23] S.L. Freshour, S. Kiwala, K.C. Cotto, A.C. Coffman, J.F. McMichael, J.J. Song,
M. Griffith, O.L. Griffith, A.H. Wagner, Integration of the drug-gene interaction
database (DGIdb 4.0) with open crowdsource efforts, Nucleic Acids Res. 49 (2021)
D1144–d1151, https://doi.org/10.1093/nar/gkaa1084.
[24] P. Gautam, K. Hamashima, Y. Chen, Y. Zeng, B. Makovoz, B.H. Parikh, H.Y. Lee, K.
A. Lau, X. Su, R.C.B. Wong, W.K. Chan, H. Li, T.A. Blenkinsop, Y.H. Loh, Multi-
species single-cell transcriptomic analysis of ocular compartment regulons, Nat.
Commun. 12 (2021) 5675, https://doi.org/10.1038/s41467-021-25968-8.
[25] Y. Deng, Y. Fu, L. Sheng, Y. Hu, L. Su, J. Luo, C. Yan, W. Chi, The regulatory NOD-
like receptor NLRC5 promotes ganglion cell death in ischemic retinopathy by
inducing microglial pyroptosis, Front. Cell Dev. Biol. 9 (2021), 669696, https://
doi.org/10.3389/fcell.2021.669696.
[26] C.E. Rudd, How the discovery of the CD4/CD8-p56(lck) complexes changed
immunology and immunotherapy, Front. Cell Dev. Biol. 9 (2021), 626095, https://
doi.org/10.3389/fcell.2021.626095.
[27] P. Yang, Z. Zhang, H. Zhou, B. Li, X. Huang, Y. Gao, L. Zhu, Y. Ren, J. Klooster,
A. Kijlstra, Clinical patterns and characteristics of uveitis in a tertiary center for
uveitis in China, Curr. Eye Res. 30 (2005) 943–948, https://doi.org/10.1080/
02713680500263606.
[28] R.K. George, C.C. Chan, S.M. Whitcup, R.B. Nussenblatt, Ocular immunopathology
of Behçet’s disease, Surv. Ophthalmol. 42 (1997) 157–162, https://doi.org/
10.1016/s0039-6257(97)00026-x.
[29] R. Belfort Jr., N.C. Moura, N.F. Mendes, T and B lymphocytes in the aqueous humor
of patients with uveitis, Arch. Ophthalmol. 100 (1982) 465–467, https://doi.org/
10.1001/archopht.1982.01030030467019.
[30] H. Keino, J. Sakai, K. Nishioka, T. Sumida, M. Usui, Clonally accumulating T cells
in the anterior chamber of Behçet disease, Am. J. Ophthalmol. 130 (2000)
243–245, https://doi.org/10.1016/s0002-9394(00)00498-0.
[31] W. Chi, X. Zhu, P. Yang, X. Liu, X. Lin, H. Zhou, X. Huang, A. Kijlstra, Upregulated
IL-23 and IL-17 in Behçet patients with active uveitis, Invest. Ophthalmol. Vis. Sci.
49 (2008) 3058–3064, https://doi.org/10.1167/iovs.07-1390.
[32] Z. Ye, B. Deng, C. Wang, D. Zhang, A. Kijlstra, P. Yang, Decreased B and T
lymphocyte attenuator in Behcet’s disease may trigger abnormal Th17 and Th1
immune responses, Sci. Rep. 6 (2016), 20401, https://doi.org/10.1038/srep20401.
[33] S. Cho, J. Kim, S.B. Cho, Z. Zheng, M.J. Choi, D.Y. Kim, D. Bang,
Immunopathogenic characterization of cutaneous inflammation in Behçet’s
disease, J. Eur. Acad. Dermatol. Venereol. 28 (2014) 51–57, https://doi.org/
10.1111/jdv.12054.
Journal of Autoimmunity 133 (2022) 102920
[34] K.M. Verrou, N.I. Vlachogiannis, G. Ampatziadis-Michailidis, P. Moulos, G.
A. Pavlopoulos, P. Hatzis, G. Kollias, P.P. Sfikakis, Distinct transcriptional profile of
blood mononuclear cells in Behçet’s disease: insights into the central role of
neutrophil chemotaxis, Rheumatology 60 (2021) 4910–4919, https://doi.org/
10.1093/rheumatology/keab052.
[35] U.C. Kucuksezer, E. Aktas-Cetin, S. Bilgic-Gazioglu, I. Tugal-Tutkun, A. Gül,
G. Deniz, Natural killer cells dominate a Th-1 polarized response in Behçet’s
disease patients with uveitis, Clin. Exp. Rheumatol. 33 (2015) S24–S29.
[36] J.K. Ahn, H.G. Yu, H. Chung, Y.G. Park, Intraocular cytokine environment in active
Behçet uveitis, Am. J. Ophthalmol. 142 (2006) 429–434, https://doi.org/10.1016/
j.ajo.2006.04.016.
[37] H.G. Yu, D.S. Lee, J.M. Seo, J.K. Ahn, Y.S. Yu, W.J. Lee, H. Chung, The number of
CD8+ T cells and NKT cells increases in the aqueous humor of patients with
Behçet’s uveitis, Clin. Exp. Immunol. 137 (2004) 437–443, https://doi.org/
10.1111/j.1365-2249.2004.02536.x.
[38] S. Vural, K. Kerl, P. Ertop Doğan, S. Vollmer, U. Puchta, M. He, Y. Arakawa, A.
O. Heper, A. Karal-Öktem, D. Hartmann, A. Boyvat, J.C. Prinz, A. Arakawa,
Lesional activation of T(c) 17 cells in Behçet disease and psoriasis supports HLA
class I-mediated autoimmune responses, Br. J. Dermatol. 185 (2021) 1209–1220,
https://doi.org/10.1111/bjd.20643.
[39] U. Bommhardt, B. Schraven, L. Simeoni, Beyond TCR signaling: emerging functions
of lck in cancer and immunotherapy, Int. J. Mol. Sci. 20 (2019), https://doi.org/
10.3390/ijms20143500.
[40] S.J. Bozso, J.J.H. Kang, J. Nagendran, The role of competing mechanisms on Lck
regulation, Immunol. Res. 68 (2020) 289–295, https://doi.org/10.1007/s12026-
020-09148-2.
[41] A. Elkamhawy, E.M.H. Ali, K. Lee, New horizons in drug discovery of lymphocyte-
specific protein tyrosine kinase (Lck) inhibitors: a decade review (2011-2021)
focussing on structure-activity relationship (SAR) and docking insights, J. Enzym.
Inhib. Med. Chem. 36 (2021) 1574–1602, https://doi.org/10.1080/
14756366.2021.1937143.
[42] P. Kumar Singh, A. Kashyap, O. Silakari, Exploration of the therapeutic aspects of
Lck: a kinase target in inflammatory mediated pathological conditions, Biomed.
Pharmacother. 108 (2018) 1565–1571, https://doi.org/10.1016/j.
biopha.2018.10.002.
[43] N.O. Al-Harbi, S.F. Ahmad, M. Almutairi, A.Z. Alanazi, K.E. Ibrahim, S.A. Alqarni,
F. Alqahtani, K. Alhazzani, M. Alharbi, F. Alasmari, A. Nadeem, Lck signaling
inhibition causes improvement in clinical features of psoriatic inflammation
through reduction in inflammatory cytokines in CD4+ T cells in imiquimod mouse
model, Cell. Immunol. 376 (2022), 104531, https://doi.org/10.1016/j.
cellimm.2022.104531.
[44] S. Zhang, R. Yang, Y. Zheng, The effect of siRNA-mediated lymphocyte-specific
protein tyrosine kinase (Lck) inhibition on pulmonary inflammation in a mouse
model of asthma, Int. J. Clin. Exp. Med. 8 (2015) 15146–15154.