Professional Documents
Culture Documents
Acosta-11 Predemencia en PSEN1 Familiares
Acosta-11 Predemencia en PSEN1 Familiares
Summary
Background Mild cognitive impairment (MCI) and pre-MCI have been proposed as stages preceding Alzheimer’s Lancet Neurol 2011; 10: 213–20
disease (AD) dementia. We assessed descendants of individuals with a mutation in presenilin 1 (PSEN1) that causes Published Online
familial AD, with the aim of identifying distinct stages of clinical progression to AD dementia. February 4, 2011
DOI:10.1016/S1474-
4422(10)70323-9
Methods We retrospectively studied a cohort of descendants of carriers of the PSEN1 E280A mutation. Pre-dementia
See Comment page 200
cognitive impairment was defined by a score 2 SD away from normal values in objective cognitive tests, and was
Neuroscience Group of
subdivided as follows: asymptomatic pre-MCI was defined by an absence of memory complaints and no effect on Antioquia (N Acosta-Baena MD,
activities of daily living; symptomatic pre-MCI was defined by a score on the subjective memory complaints checklist D Sepulveda-Falla MD,
higher than the mean and no effect on activities of daily living; and MCI was defined by a score on the subjective S Moreno MSc,
D C Aguirre-Acevedo MSc,
memory complaints checklist higher than the mean, with no effect on basic activities of daily living and little or no
A Saldarriaga BSc,
effect on complex daily activities. Dementia was defined according to the diagnostic and statistical manual of mental Prof F Lopera MD) and Clinical
disorders, fourth edition. Reference mean scores were those of participants who did not carry the PSEN1 E280A Epidemiology Academic Group
mutation. We used the Turnbull survival analysis method to identify ages at onset of each stage of the disease. We (GRAEPIC) (N Acosta-Baena,
D C Aguirre-Acevedo), Faculty of
measured the time from birth until onset of the three pre-dementia stages, dementia, and death, and assessed decline
Medicine, University of
in cognitive domains for each stage. Antioquia, Medellín, Colombia;
Department of Psychiatry and
Findings Follow-up was from Jan 1, 1995, to Jan 27, 2010. 1784 patients were initially identified, 449 of whom were Psychotherapy
(N Acosta-Baena) and Institute
PSEN1 E280A carriers who had complete clinical follow-up. Median age at onset was 35 years (95% CI 30–36) for
of Neuropathology
asymptomatic pre-MCI, 38 years (37–40) for symptomatic pre-MCI, 44 years (43–45) for MCI, and 49 years (49–50) (D Sepulveda-Falla), University
for dementia. The median age at death was 59 years (95% CI 58–61). The median time of progression from Medical Center
asymptomatic to symptomatic pre-MCI was 4 years (95% CI 2–8), from symptomatic pre-MCI to MCI was 6 years (4–7), Hamburg-Eppendorf,
Hamburg, Germany; and
from MCI to dementia was 5 years (4–6), and from dementia to death was 10 years (9–12). The cognitive profile was School of Statistics, Faculty of
predominantly amnestic and was associated with multiple domains. Affected domains showed variability in initial Sciences, National University
stages, with some transient recovery in symptomatic pre-MCI followed by continuous decline. of Colombia, Medellín,
Colombia
(C M Lopera-Gómez MSc,
Interpretation Clinical deterioration can be detected as measurable cognitive impairment around two decades before M C Jaramillo-Elorza MSc)
dementia onset in PSEN1 E280A carriers. Onset and progression of pre-dementia stages should be considered in the
Correspondence to:
investigation and use of therapeutic interventions for familial AD. Prof Francisco Lopera,
Neuroscience Group of
Funding Departamento Administrativo de Ciencia, Tecnología e Innovación, COLCIENCIAS, Republic of Colombia. Antioquia, Calle 62 #52–59,
Lab 412, Torre 1, Sede de
Investigación Universitaria,
Introduction subjective memory complaints that might not be detected University of Antioquia,
Alzheimer’s disease (AD) is the most prevalent in neuropsychological assessments.5 The addition of Medellín AA 1226, Colombia
neurodegenerative disorder and is the main cause of these two clinical stages to the course of AD suggests flopera@une.net.co
dementia worldwide.1 The risk of developing AD that there is a continuous cognitive decline from normal
increases with age, with incidence doubling every 5 years cognition to dementia. However, diagnostic criteria for
after age 65 years, and more than a third of all individuals the identification of pre-MCI and MCI are still not
over age 85 years worldwide have AD.1 Generally, age at universally accepted and, in sporadic AD, whether
onset of AD is defined by the age at onset of dementia, cognitive impairment is a predictor of development of
when patients present with memory impairment, other dementia is unclear.6
cognitive impairment, and loss of autonomy. During the Most people with AD have sporadic disease, but familial
past 20 years, mild cognitive impairment (MCI) has been AD is generally more severe and of earlier onset.7,8 Less
proposed to precede dementia.2 MCI has been defined as than 1% of patients with AD have mutations in the amyloid
cognitive deficits that are detectable in neuro- precursor protein, presenilin 1 (PSEN1), or presenilin 2
psychological assessments but do not affect functionality (PSEN2) genes.9 Mutations in PSEN1 account for most For more on mutations in
in daily life.3 In AD, this prodromal stage is usually cases of familial AD, and more than 180 mutations have familial AD see http://www.
molgen.ua.ac.be/ADMutations
associated with memory impairment.4 However, been identified.10 PSEN1 is part of the γ-secretase protein
cognitive impairment might also occur before MCI in complex; PSEN1 mutations seem to increase concen-
AD. This stage, termed pre-MCI, has been defined as trations of amyloid β1–42, which alters calcium homoeostasis
in the endoplasmic reticulum and facilitates aggregation trained in dementia assessment. Neuropsychological
of amyloid β into plaques.1 The few longitudinal studies of tests were done by neuropsychologists and psychologists
clinical progression from an asymptomatic state in familial trained in neuropsychology. Medical history and
AD have identified a continuous progression of cognitive neuropsychological assessments were systematised with
impairment towards dementia,11 which might include the systematised information system for the neuroscience
MCI12 and take several years.13 Prodromal memory group of Antioquia (SISNE).
impairment has been detected in some individuals.13–15 The dementia protocol included the CERAD
Over 25 years ago, we began to follow up a kindred of (consortium to establish a registry for Alzheimer’s
around 5000 individuals who were potentially carrying a disease) neuropsychological test battery with additional
single mutation, E280A (Glu280Ala), in PSEN1.16,17 neuropsychological tests, as previously described.21 Tests
PSEN1 E280A carriers present with dementia before age were applied according to the assigned cognitive domain
65 years, although age at disease onset varies, possibly as follows. To assess attention in participants, we did the
because of environmental18 and genetic17,19 factors. The visual A cancellation test (omissions and time) and trail
clinical course includes atypical symptoms such as aphasia, making test part A (corrects and time). For memory
myoclonia, seizures, and behavioural changes.7,16 The assessments, we used the memory of three phrases test,
cognitive profile of PSEN1 E280A AD does not differ Rey-Osterrieth complex figure test (recall), list of words
substantially from that of sporadic AD, although patients tests (total corrects, total intrusions, recall, intrusions
do have slightly greater impairment in language recall, recognition “yes”, and recognition “no”), and recall
functions.20 of line drawings test. We assessed language ability with
Inherited AD is an ideal model in which to study the verbal fluency and naming test. To assess
disease progression because penetrance is complete. The constructional praxis, we used the constructional praxis
identification of early clinical features will help in test and the Rey-Osterrieth complex figure test (copy).
definition of the onset of familial AD. Here, we For abstract reasoning we used the Raven test (part A).
retrospectively assessed a cohort of descendants of We assessed participants’ calculation abilities with the
PSEN1 E280A mutation carriers with the aim of arithmetic subtest of the Wechsler adult intelligence
identifying distinct stages of clinical progression to AD scale revised. For assessment of executive function, we
dementia and estimating the onset age and duration of used the Wisconsin card sorting test (corrects, errors,
each stage until death. perseverative errors, categories, and conceptual) and
phonological verbal fluency-F test. We also completed
Methods a subjective memory complaints checklist according
Participants to answers supplied by relatives and patients;
See Online for webappendix Descendants of patients with confirmed PSEN1 E280A (webappendix p 1) and used the geriatric depression scale
mutations were enrolled into the E280A Antioquia (short version), mini-mental state examination, and
cohort study, which was done at the University of dementia functional scales (global deterioration scale,
Antioquia, Colombia. Participants were included if they functional assessment staging, Barthel index, Katz scale,
were aged over 17 years. There were no other exclusion and Lawton instrumental activities of daily living scale).
criteria for medical and neuropsychological monitoring. This expanded CERAD neuropsychological protocol
All participants (both carriers and non-carriers of was validated for the Colombian population in
PSEN1 E280A) or their guardians provided written participants over 50 years of age22 but we needed to
informed consent for participation in the study; if the establish normal parameters for participants under
physician thought that a participant had dementia, their 50 years of age because of the early age at onset of familial
guardian provided written informed consent. All AD. We analysed data from PSEN1 E280A non-carriers
assessed participants with no evident dementia and from the same kindred to obtain normal parameters for
examiners were masked to genetic status throughout cognitive tests. Mean scores were calculated for each test
monitoring. The study was approved by the medical from the first neuropsychological assessment done while
ethics board of the University of Antioquia. the participant was under 50 years of age. These data
were then grouped according to age and education
Procedures (webappendix p 3).
Participants were followed up every 2 years. Initially, we Patients with MCI or dementia also had MRI and blood
started to monitor participants from around the third chemistry analyses; concentrations of vitamin B12, folic
decade of life to detect early dementia. Follow-up acid, creatinine, and glucose were measured, and thyroid
examinations included medical and neuropsychological tests, lipid profiles, and HIV and syphilis serological tests
assessments, which focused on registration of memory were done to rule out other causes of cognitive
complaints and their effect on the everyday life, family impairment that was reported in neurological and
life, social life, and working life of participants. Clinical neuropsychological assessments.
history was taken and medical and neurological For genetic analyses, genomic DNA was extracted from
examinations were done by a neurologist or a physician blood by standard protocols, and PSEN1 E280A
MCI=mild cognitive impairment. DSM-IV=diagnostic and statistical manual of mental disorders, fourth edition. *Neuropsychological test scores 2 SD or more away from the
mean normal value score for non-carriers in at least one test on any cognitive domain, adjusted for age and education. †Benign forgetfulness but with normal score in the
subjective memory complaints checklist (any score less than the mean score of non-carriers and adjusted for age and education) and supported by reports from patients or
families. ‡High score in the subjective memory complaints checklist (any score more than the mean score of non-carriers and adjusted for age and education) and supported
by medical reports from patients or families. §Measured with the Lawton instrumental activities of daily living and functional assessment staging scales. ¶Minimum need of
assistance on the Lawton instrumental activities of daily living scale and a score of 3 on the functional assessment staging scale. ||According to scores on the functional
assessment staging, global deterioration, and Katz scales, and the Barthel index.
characterisation was done as previously described.19 checklist results and medical report from the patient
Genomic DNA was amplified with the primers PS1-S 5´ differed from those of family members, results from family
AACAGCTCAGGAGAGGAATG 3´ and PS1-AS 5´ members were classed as more reliable.
GATGAGACAAGTNCCNTGAA 3´. We used the
restriction enzyme BsmI for restriction fragment length Statistical analysis
polymorphism analysis. We did survival analyses to estimate age of onset and
All PSEN1 E280A carriers were classified retrospectively progression rate of each stage. All individuals were
at the end of the study into the stages of pre-MCI, MCI, analysed from date of birth until date of onset of each of
dementia, or death (table 1), according to results from all the five stages (asymptomatic pre-MCI, symptomatic pre-
medical assessments, neuropsychological tests, and MCI, MCI, dementia, and death). The end of follow-up
subjective memory complaints checklists obtained for every outcome was at diagnosis of the outcome or at
throughout the study. These stages and their criteria were the last assessment date. Each stage was determined
defined before analysis. Pre-MCI was further divided into separately.
asymptomatic and symptomatic after we identified We used the survival analysis method proposed by
individuals who did not have memory complaints but Turnbull,24 with arbitrary censoring of data. We used age
who did have objective cognitive decline, but before as the time scale. Age of onset was classified according to
formal analyses (table 1). Death attributed to AD was exact time to reach a stage, or as left, interval, or right
defined as death from complications associated with
advanced dementia, according to basic activities of daily
1784 participants enrolled
living scales.
Clinically significant cognitive decline was defined as
neuropsychological test scores 2 SD away from the mean 603 not genotyped*
score of non-carriers in at least one test on any cognitive
domain, adjusted for age and education. Memory
1181 genotyped
complaints were subdivided into those with or without
effect: memory complaints with effect, which distinguish
MCI from symptomatic pre-MCI, were defined as a score 722 non-carriers†
0
and colleagues,28 in our definition of MCI we excluded
participants with dementia and included only those who
Abstract reasoning
Praxis
showed preserved basic activities of daily living and no
–0·50
Calculation or minimum impairment in complex instrumental
Language functions, as recommended by the International Working
Memory
Executive function Group on MCI.3 We gave more weight to the effect of
–1·00
Attention memory complaints than to neuropsychological test
results for the definition of MCI because memory
Healthy Asymptomatic Symptomatic MCI Dementia
carriers pre-MCI pre-MCI (n=117) (n=173)
impairment might be more clinically relevant. A previous
(n=162) (n=17) (n=102) study in this population,21 which used the same memory
checklist and neuropsychological battery that we used
Figure 4: Variability of cognitive domains during clinical progression in here, reported that subjective memory complaints were
PSEN1 E280A carriers the earliest sign of AD onset. Also, because of the
MCI=mild cognitive impairment.
observed amnestic profile in PSEN1 E280A carriers,
almost all patients who were classed as having MCI also
and webappendix p 10). Executive function was inversely reported objective memory impairment on the memory
up and down with respect to other cognitive domains complaints checklist.
during clinical progression; however, this variability was Pre-MCI has been defined as subjective memory
not significant. Attention decreased continuously, but this complaints associated with other symptoms but with
was statistically significant only from symptomatic pre- normal neuropsychological assessments.5,29 An alternative
MCI onwards. definition of pre-MCI was based on objective assessment
of verbal memory impairment with PET-detected
Discussion hypometabolism in the absence of symptoms.31 In
In this cohort study, neuropsychological assessment and PSEN1 E280A carriers, we identified two stages in pre-
classification of memory complaints has allowed us to MCI, both with measurable cognitive dysfunction and
describe distinct stages of cognitive decline, including differentiated by the presence of memory complaints in
two pre-MCI stages, in PSEN1 E280A carriers (panel). symptomatic pre-MCI. The distribution of age at first
MCI has been proposed as the first stage in AD27,28 but assessment (mean age of carriers 36·93 years and that of
this theory has been challenged by several researchers non-carriers 31·45 years) might have had an effect on the
because some patients recover from MCI and do not classification of asymptomatic pre-MCI.
develop dementia, and MCI is still classed as a separate This study was a retrospective analysis, which might
clinical entity.6 During the 1990s, MCI referred to people be a methodological limitation. Also, the dementia
who were at stage 3 on the global deterioration scale protocol used in this population was originally designed
(GDS) or 0·5 on the clinical dementia rating (CDR) to detect dementia; therefore, tests might not be sensitive
scale.2,29 In 1999, Petersen and colleagues28 suggested a enough for detection of pre-MCI and some participants
clinical continuum from normal ageing, through MCI, to might have been misdiagnosed. Knowledge of family
AD. They highlighted that GDS and CDR are severity history might have affected the reporting of memory
rating scales and not diagnostic instruments. A GDS complaints by participants and their families. A possible
score of 3 or a CDR score of 0·5 might correspond to selection bias was introduced because 603 non-genotyped
MCI or very mild dementia.30 When we started follow-up individuals were not included in the final analysis. Those
of the PSEN1 E280A population 15 years ago, MCI was from this group who presented with dementia had
not a widespread idea. However, we noticed a cognitive similar ages at onset of dementia and death to the
decline that preceded the onset of AD, mainly in memory genotyped studied sample (webappendix p 9) and thus
function, which was supported by results from periodic this population is probably comparable to genotyped
neuropsychological assessments and the subjective participants.
memory complaints checklist, which were the methods Carriers overall had low education (1–5 years in 48%;
available for assessing cognitive decline. Pre-MCI was table 2), which might have influenced the reported age at
separated into asymptomatic and symptomatic after detection and progression rates between stages. The age
preliminary analyses, when, retrospectively, cognitive of onset ranges were wide for all stages, which might be
impairment was evident in asymptomatic patients. We because of individual genetic or epigenetic factors, or