LWT - Food Science and Technology 155 (2022) 112937

Contents lists available at ScienceDirect

LWT
journal homepage: www.elsevier.com/locate/lwt

Enhancing the proportion of gluconic acid with a microbial community

reconstruction method to improve the taste quality of Kombucha
Ruyi Li , Yongquan Xu , Jianxin Chen , Fang Wang , Chun Zou *, Junfeng Yin **
Tea Research Institute Chinese Academy of Agricultural Sciences, National Engineering Research Center for Tea Processing, Key Laboratory of Tea Biology and Resources
Utilization, Ministry of Agriculture, 9 South Meiling Road, Hangzhou, 310008, China

A R T I C L E I N F O A B S T R A C T

Keywords: In this study, a synthetic microbial community (SMC) was used to enhance the proportion of gluconic acid in
Kombucha order to improve the taste quality of Kombucha. The sensory properties of gluconic acid were analyzed for the
Microbial community reconstruction method first time. The proportions of gluconic acid (r = 0.986, p < 0.05) and acetic acid (r = − 0.986, p < 0.05) were
Proportion of gluconic acid
significantly correlated with the taste score of Kombucha, which was confirmed by the analysis of the sensory
Taste quality
properties of organic acid monomers. Starmerella davenportii with the highest yield of ethanol and Gluconace­
tobacter intermedius with the highest yield of acetic acid were screened and used for microbial community
reconstruction to obtain Kombucha with the highest proportion of gluconic acid (74%). In addition, the sensory
quality and concentrations of the main functional metabolites in Kombucha fermented by SMC were significantly
increased compared with the traditional Kombucha. The microbial community reconstruction method effectively
improved the taste quality of Kombucha.

1. Introduction compounds that contribute to the formation of the flavor quality of

Kombucha is a functional beverage obtained by the fermentation of
sugar and tea with a symbiotic culture of bacteria and yeast. The tea
generally used for Kombucha is black tea, but sometimes green or
oolong tea is used instead (Leal, Suarez, Jayabalan, Oros, &
Escalante-Aburto, 2018). Some studies have provided evidence to sug­
gest that Kombucha has a range of health benefits, such as promoting
and improving digestion and diabetes, strengthening the immune sys­
tem, reducing blood pressure, and being beneficial for liver health (Kapp
& Sumner, 2019; Vargasa, Fabricio, & Zachia Ayub, 2021). The main
functional metabolites of Kombucha include organic acids, D-saccharic
acid-1,4-lactone (DSL), and tea polyphenols (Bhattacharya, Gachhui, &
Sil, 2013; Villarreal-Soto, Beaufort, Bouajila, Souchard, & Taillandier,
2018). These constituents, which are beneficial for health, have made
Kombucha a popular healthy beverage. It’s popularity has recently risen
in the United States of America (Chakravorty et al., 2016), and it is
predicted to reach 3.5–5 billion USD in the global market by 2025 (Kim
& Adhikari, 2020).
The main organic acids found in Kombucha include gluconic and
acetic acids (Leal et al., 2018; Sknepnek et al., 2021). They are key
Kombucha (Tran et al., 2020; Vitas, Cvetanovic, Maskovic, Svarc-Gajic,
& Malbasa, 2018). Gluconic acid contributes to the pleasant sour taste of
the beverage (Ramachandran, Fontanille, Pandey, & Larroche, 2006;
Wang et al., 2020), while acetic acid produces an astringent and acidic
off-flavor (Bartowsky & Henschke, 2008). The concentration of organic
acids is dependent on the particular acetic acid bacteria (AAB) and yeast
(Leal et al., 2018). During the early stage of fermentation (0–3 days), the
yeast converts cereal-derived sugars into ethanol and CO2. Subse­
quently, the AAB convert glucose and ethanol into several organic acids,
including gluconic, acetic, critic, succinic, and malic acids (Sknepnek
et al., 2021). The traditional culture method of Kombucha uses the
whole Kombucha layer as the starter culture, which makes it difficult to
control the microorganisms. The proper use of a suitable starter syn­
thetic microbial community (SMC) for fermentation would control the
production of organic acids, shorten the culture period, and increase the
yield of the main functional metabolites of Kombucha (Lin, Ye, Cao, Xie,
& Xu, 2015; Nguyen, Nguyen, Nguyen, & Le, 2015).
Recently, many studies have investigated the fermentation of Kom­
bucha by using SMCs, but the primary aim of most of these studies is
focused on obtaining significant amounts of nutritious components (Lin

* Corresponding author.
** Corresponding author.
E-mail addresses: ldzouchun@163.com (C. Zou), yinjf@tricaas.com (J. Yin).

https://doi.org/10.1016/j.lwt.2021.112937
Received 4 November 2021; Received in revised form 1 December 2021; Accepted 3 December 2021
Available online 22 December 2021
0023-6438/© 2021 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
R. Li et al.
et al., 2015; Nguyen, Nguyen, Nguyen, & Le, 2015; Nguyen, Nguyen, &
Le, 2015; Wang et al., 2020). However, relatively few studies have
investigated the use of SMC to improve the taste quality of Kombucha.
Therefore, the aim of the present study was to investigate the effec­
tiveness of a microbial community reconstruction method to improve
the taste quality of Kombucha. The sensory properties of gluconic and
acetic acids were investigated systematically to identify organic acids
that promote critical improvement in the flavor of Kombucha. Strains
were screened to formulate an optimal SMC in order to enhance the
gluconic acid proportion of Kombucha. In addition, the gluconic acid
proportion and sensory qualities were compared between Kombucha
fermented with a SMC and traditional Kombucha. The results provide
guidance for the improvement of the taste quality of Kombucha and
expand on our current knowledge of the sensory properties of gluconic
and acetic acids.
2. Materials and methods
2.1. Reagents and materials
Four Kombucha starter cultures (A–D) were obtained from local
families in four different regions of China (A, Wuhu; B, Xian; C, Zhan­
jiang; D, Beijing) and preserved by the Tea Research Institute (Chinese
Academy of Agricultural Sciences, Hangzhou, China). Black tea (Kee­
mun black tea) was purchased from the Tianzhihong Co. (Huangshan,
China). Sucrose was purchased from a local market in Hangzhou, China.
Standards of organic acids (acetic, gluconic, succinic, citric, and L-
malic acids) and glucose were purchased from the Sigma–Aldrich
Shanghai Trading Co., Ltd. (Shanghai, China), and DSL was purchased
from the Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China).
High-performance liquid chromatograph (HPLC)-grade methanol was
purchased from Merck KGaA (Darmstadt, Germany). Bromophenol blue
was purchased from the Shanghai Yuanye Biotechnology Co., Ltd.
(Shanghai, China), phosphoric acid from the Shanghai Lingfeng Chem­
ical Reagent Co., Ltd. (Shanghai, China), cycloheximide from the Beijing
Runzekang Biotechnology Co., Ltd. (Beijing, China), and 2,3,5-triphe­
nyltetrazolium chloride (TTC) from the ShenzhenYibaishun Technol­
ogy Co., Ltd. (Shenzhen, China). All other chemicals were of analytical
grade and purchased from the Kunming Huangbao Trading Co., Ltd.
(Shanghai, China).
2.2. Preparation of Kombucha
A sugared tea infusion was prepared as follows: 3 L of water with
300 g of sucrose was sterilized at 121 ◦ C for 15 min. Then 18 g of black
tea were infused at 90 ◦ C for 30 min. Once cooled to room temperature
(25 ◦ C), the sugared tea infusion was inoculated with 150 g of Kombucha
starter culture and fermentation was conducted at 29 ± 1 ◦ C for 10 days.
2.3. Concentrations of organic acids, DSL, titratable acidity, and ethanol
The concentrations of organic acids (gluconic, acetic, succinic, citric,
and L-malic acids) and DSL were determined using an Agilent 1100
HPLC system (Agilent Technologies, Inc., Santa Clara, CA, USA) equip­
ped with a variable wavelength detector set at 220 nm and a ZORBAX®
SB-C18 column (4.6 × 250 mm, 5 μm). The mobile phase was a mixture
of 6 mmol/L phosphoric acid (pH 2.1) and methanol (97:3) with iso­
cratic elution. The flow rate and column temperature were maintained
at 1 mL/min and 28 ◦ C, respectively. The injection volume was 5 μL
(Vitas et al., 2018).
The ethanol concentration (μg/mL) was determined using a
biosensor analyzer (Jinan Yanhe Biotechnology Co., Ltd., Jinan, China)
as compared against a standard (25 μL) of ethanol (50 μL of 99.5% [w/
w] ethanol diluted in a 100 mL volumetric flask).
The titratable acidity was determined using the alkaline titration
method (GB/T12456-2008).
2
LWT 155 (2022) 112937
2.4. Sensory analysis and evaluation
The taste, odor, color, and overall quality of the Kombucha samples
were scored by a trained team of nine panelists (five men and four
women, 23–50 years old) from the Tea Research Institute of the Chinese
Academy of Agricultural Sciences using a nine-point hedonic scale (Zou
et al., 2021), where 1 = extremely unfavorable, 2 = greatly unfavorable,
3 = moderately unfavorable, 4 = slightly unfavorable, 5 = not favorable
or unfavorable, 6 = slightly favorable, 7 = moderately favorable, 8 =
greatly favorable, and 9 = extremely favorable.
2.5. Analysis of the sensory properties of gluconic and acetic acid
solutions
2.5.1. Sensory evaluation of the intensity of the sour taste
The intensity of the sour taste from gluconic and acetic acid solutions
of 0.078, 0.312, 1.25, 5, and 10 g/L was assessed by a trained team of 10
experts from the Tea Research Institute of the Chinese Academy of
Agricultural Sciences using a modified 10-point scale (Ibanoglu, Ains­
worth, Ozer, & Plunkett, 2006), where 8–10 = extremely strong, 6–8 =
strong, 4–6 = neutral, 2–4 = weak, and 0–2 = extremely weak. The
results were analyzed statistically to identify differences between the
mean scores of the different samples. Each evaluation was replicated
three times on different days with the order of the samples randomized
for each test.
2.5.2. Taste and odor thresholds of gluconic and acetic acid solutions
A solution containing an appropriate concentration of target com­
pound was used to spike purified water. Six sets of three glasses of water
at room temperature (one with target compound and two controls) were
tasted by 12 well-trained assessors in accordance with the ascending
method of limits (ASTM E679), as described in the American Society of
Brewing Chemists (ASBC) Methods of Analysis (Irwin, Bordeleau, &
Barker, 2018). The concentration of the target compound was doubled
from one set to the next, and the assessor was asked to identify the pair
in each triangle. The individual best estimate threshold (BET) was
calculated as the geometric mean of the highest concentration missed
and the next highest concentration. The assessments were performed up
to four times until a good estimate of the threshold was achieved by each
assessor. The BET of the whole group was calculated from the individual
results.
2.5.3. Preparation of aqueous solutions and black tea infusions with
different proportions of gluconic acid
Aqueous solutions and black tea infusions (sucrose, 83.86 g/L; black
tea, 6 g/L) with different proportions of gluconic acid (0%, 20%, 40%,
60%, 80%, and 100%) were prepared using purified water. The pro­
portion of gluconic acid was gluconic acid/total acids, and the total
acids concentration including gluconic and acetic acids, of 1.25 g/L was
selected.
2.6. Microbial community analysis
The microbial community structures of the Kombucha samples were
determined using high-throughput sequencing analysis, which was con­
ducted by the Sangon Biotech Co. Ltd. (Shanghai, China). DNA extraction
was performed using an E.Z.N.A™ Mag-Bind Soil DNA Kit (Omega Bio-
Tek, Inc., Norcross, GA, USA) according to the manufacturer’s in­
structions. The bacterial 16S rRNA V3–V4 region and fungi ITS region
were amplified using the primer pairs 341F (5′ -CCTACGGGNGGCWG­
CAG-3′ )/805R (5′ -GACTACHVGGGTATCTAATCC-3′ ) and ITS1 (5′ -
CTTGGTCATTTAGAGGAAGTAA3′ )/ITS2: (5′ -GCTGCGTTCTTCATC­
GATGC-3′ ), respectively. The obtained polymerase chain reaction (PCR)
products were sequenced using the Miseq sequencing platform (Illumina,
Inc., San Diego, CA, USA), which was conducted by the Sangon Biotech
Co. Ltd. (Zheng et al., 2019).
R. Li et al.
2.7. Isolation, purification, and screening of yeast and AAB
Serial dilutions of Kombucha fermented broth samples A and B were
prepared and cultured on yeast medium plates (sucrose, 40 g/L;
peptone, 10 g/L; yeast extract, 10 g/L; agar, 15 g/L) and AAB medium
plates (glucose, 10 g/L; yeast extract, 10 g/L; agar, 20 g/L; ethanol, 3.0%
[v/v]; cycloheximide, 10 mg/L), respectively. Then, the plates were
incubated at 28 ◦ C for 72–96 h. The single colonies with different shapes
and colors were selected from the medium plates. The selected colonies
were cultured on yeast medium plates and AAB purification medium
plates (glucose, 10 g/L; yeast extract, 10 g/L; agar, 20 g/L; ethanol, 3.0%
[v/v]) and incubated at 28 ◦ C for 48 h. The purification process was
continuously repeated until each yeast cell and the Gram-stain color and
size of each bacterial cell were the same as observed under a microscope.
Then, a single colony was selected from each plate for further analysis.
The cell morphologies of the strains were observed and imaged under a
microscope (BM2000; Nanjing Jiangnan Novel Optics Co., Ltd., Nanjing,
China) (Xiao, Huang, Yang, Zhang, & Quan, 2015).
The isolated yeasts were cultured on yeast medium plates at 25 ◦ C for
72 h, and then the TTC upper medium (glucose, 5 g/L; agar, 15 g/L; TTC,
0.5 g/L) was added to the yeast medium plates. After that, the plates
were incubated at 25 ◦ C for 3 h. The red-colored yeast colonies with
strong ethanol production ability were preliminarily screened (Huang,
2019). Finally, the yeast (inoculum size, ~3% [v/v]) with strong ethanol
production ability was cultured on yeast liquid medium (sucrose, 40
g/L; peptone, 10 g/L; yeast extract, 10 g/L) for 5 days at 30 ◦ C. The
samples were collected daily to determine the ethanol concentration in
order to screen and obtain the yeast with the highest yield of ethanol for
identification.
The isolated AAB were cultured on primary screening medium
(glucose, 10 g/L; yeast extract, 10 g/L; agar, 20 g/L; ethanol, 3.0% [v/
v]) containing 0.2 g/L of bromocresol blue (pH indicator) to determine
the acid production ability at 28 ◦ C for 72 h. A yellow zone surrounding
the colonies indicated low pH and high acid production ability (Nguyen,
Nguyen, Nguyen, & Le, 2015). Therefore, an aliquot of the AAB (~5%
[v/v]) with high acid production ability was cultured on AAB liquid
medium (glucose, 10 g/L; yeast extract, 10 g/L; ethanol, 3.0% [v/v]) for
9 days at 30 ◦ C. The samples were collected on days 0, 3, 6, and 9 to
determine the concentrations of acetic acid, gluconic acid, and DSL.
Finally, the AAB with the highest yield of acetic acid, gluconic acid, and
DSL were screened for identification.
2.8. Identification of yeast and AAB isolates
The AAB and yeast isolates were identified by PCR analysis. For the
AAB, the 16S rDNA gene was amplified using the universal primers 27F
(5′ -AGTTTGATCMTGGCTCAG-3′ ) and 1492R (5′ -GGTTACCTTGTTAC­
GACTT-3′ ). For the yeast, the 26S rDNA gene was amplified using the
primer pair NL-1 (5′ -GCATATCAATAAGCGGAGGAAAAG-3′ )/NL4 (5′ -
GGTCCGTGTTTCAAGACGG-3′ ). The PCR products were purified and
sequenced by the Sangon Biotech Co. Ltd. The resulting sequences with
the primer sequences removed were compared against the GenBank
database (https://www.ncbi.nlm.nih.gov/genbank/) using the Basic
Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi).
A phylogenetic tree was constructed using the Molecular Evolutionary
Genetics Analysis software (version 6.0) based on the neighbor-joining
method.
2.9. Optimization of the strain combination, inoculum ratio, and
inoculum size
Aliquots of samples B13, A26, A36, and A41 (~6% [v/v]) were
cultured on Kombucha medium (black tea, 6 g/L; sucrose, 10 g/L) at a
yeast:AAB ratio of 1:1 according to the different strain combinations
(SC1:B13A26, SC2:B13A41, SC3:B13A36, SC4:B13A26A41, SC5:
B13A26A36, SC6:B13A36A41, and SC7:B13A26A36A41) at 29 ± 1 ◦ C
3
LWT 155 (2022) 112937
for 9 days. The samples were collected on days 0, 3, 6, and 9 to deter­
mine the concentrations of DSL and total acids (acetic, gluconic, L-malic,
citric, and succinic acids). Measurements of each sample were con­
ducted in triplicate. The sample with the highest total acid concentration
(marked as SC1, SC2, SC3, SC4, SC5, SC6, and SC7) was selected for
further use and analysis.
Aliquots of samples B13 and A36 (~6% [v/v]) were cultured on
Kombucha medium (black tea, 6 g/L; sucrose, 10 g/L) at different
inoculum ratios (4Y1A, 4:1; 3Y1A, 3:1; 2Y1A, 2:1; 1Y1A, 1:1; 1Y2A, 1:2;
1Y3A, 1:3; and 1Y4A, 1:4) at 29 ± 1 ◦ C for 9 days. Samples were
collected on days 0, 3, 6, and 9 to determine the concentrations of DSL
and total acid (acetic, gluconic, L-malic, citric, and succinic acids).
Measurements of each sample were conducted in triplicate. The sample
with the highest total acid concentration (mark as 4Y1A, 3Y1A, 2Y1A,
1Y1A, 1Y2A, 1Y3A, and 1Y4A (Y, yeast; A, AAB)) was selected for
further use and analysis.
Aliquots of samples B13 and A36 (2%, 4%, 6%, 8%, and 10% [v/v])
were cultured on Kombucha medium (black tea, 6 g/L; sucrose, 10 g/L)
at an inoculum ratio of 1Y3A at 29 ± 1 ◦ C for 9 days. Samples were
collected on days 0, 3, 6, and 9 to determine the concentrations of DSL
and total acid (acetic, gluconic, L-malic, citric, and succinic acids).
Measurements of each sample were conducted in triplicate. The sample
with the highest total acid concentration (mark as 2%, 4%, 6%, 8%, and
10%) was selected for further use and analysis.
2.10. Statistical analysis
All results are presented as the mean ± standard deviation of three
replicates. The differences between two groups were determined by T-
test, and the differences among three or more groups were analyzed by
one-way analysis of variance followed by Duncan’s multiple comparison
test (P < 0.05). All statistical analyses were conducted using SPSS sta­
tistics software for Microsoft Windows version 21.0. (IBM Corporation,
Armonk, NY, USA). Graphs were generated using Origin 2018 software
(OriginLab Corporation, Northampton, MA, USA) and analyzed using
Microsoft Excel 2016 software (Microsoft Corporation Redmond, WA,
USA).
3. Results and discussion
3.1. Correlation analysis between the proportion of gluconic and acetic
acid and the taste score of traditional Kombucha
Gluconic and acetic acid are the main organic acids found in Kom­
bucha (Leal et al., 2018; Sknepnek et al., 2021), and they greatly in­
fluence its taste (Vitas et al., 2018; Tran et al., 2020). The changes in the
concentrations of gluconic and acetic acid in the four types of traditional
Kombucha (A–D) during fermentation are shown in Figs. S1a and S1b.
The gluconic acid concentrations were increased with prolonged
fermentation time in all four Kombucha samples. The maximum glu­
conic acid concentration of 6.11 g/L was obtained from A, which was
1.81-, 1.68-, and 1.17-fold greater than that obtained from B, C, and D,
respectively. The maximum acetic acid concentration of 15.56 g/L was
obtained from B, which was 1.24-, 13.4-, and 16.7-fold greater than that
obtained from A, C, and D, respectively. The results indicated that A and
B produced higher concentrations of the main organic acids compared to
C and D, which would be used for the screening of strains in further
experiments. Generally organic acid formation is dependent on the va­
riety of microorganisms in the symbiotic culture, fermentation time, and
substrates used in the initial tea (Jakubczyk, Gutowska, Antoniewicz, &
Janda, 2021). In this study, Starmerella were the dominant fungi
(Fig. S1c) for A and B, but not C and D, while members from Komaga­
taeibacter were the dominant bacteria (Fig. S1d) for all four Kombucha
samples. Therefore, the difference in the microorganisms was an
important factor that caused the difference in the main organic acid
concentrations among the four Kombucha samples.
R. Li et al.
Taste, odor, color, and overall acceptability of the four Kombucha
samples at optimal sensory quality were evaluated (Fig. S2a). The taste
score of Kombucha C (7.0) was highest followed by D (6.8), A (5.0), and
B (4.8). Kombucha B obtained the highest score for odor (8.5), and
Kombucha C obtained the highest score for color (8.3). Meanwhile,
Kombucha B had the highest overall acceptability score (6.7) among the
four Kombucha samples.
Analysis of the proportion of main organic acids of the Kombucha
samples at optimal sensory quality (Fig. S2b) showed that the highest
proportion of gluconic acid was obtained from C (73%), followed by D
(71%), A (58%), and B (52%), while the highest proportion of acetic acid
was obtained from B (48%), followed by A (42%), D (29%), and C
(27%). The taste score was highest in Kombucha samples containing the
highest proportion of gluconic acid and was the lowest in Kombucha
samples with the highest proportion of acetic acid. Further analysis re­
sults showed that the proportion of gluconic acid (r = 0.986, p < 0.05)
and acetic acid (r = − 0.986, p < 0.05) was significantly correlated with
the taste score (Table 1), indicating that the proportion of gluconic and
acetic acids may affect the taste of Kombucha. Hence, the sensory
properties of gluconic and acetic acids were further analyzed.
3.2. Analysis of the sensory properties of gluconic and acetic acid
solutions
3.2.1. Differences in the intensity of sour taste, taste, and odor thresholds
between the gluconic and acetic acid solutions
In order to elucidate the sensory properties of gluconic and acetic
acid that significantly affected the sensory quality of Kombucha, the
intensity of sour taste, flavor characteristics, and taste and odor
thresholds of the gluconic and acetic acid solutions were determined.
The intensity of the sour taste and flavor characteristics of the acetic and
gluconic acid solutions at 0.078, 0.312, 1.25, 5, and 10 g/L are shown in
Fig. 1a, Tables S1 and S2. The results showed that the intensity of sour
taste increased with increasing concentrations of acetic or gluconic acid
in solution. Acetic acid solutions had a higher intensity of sour taste
compared to the gluconic acid solutions at the same concentration.
Sensory analysis results showed that the sour taste of gluconic acid was
soft and refreshing at 0.312 g/L, while acetic acid had an astringent taste
and pungent odor at 0.078 and 1.25 g/L, respectively. The results
indicated that acetic acids significantly affected the sour taste but also
significantly impacted the astringency and odds at the same time,
especially at high concentrations, whereas gluconic acid had positive
effects on sourness without impacting the astringency and odds tests
(Table 2). Therefore, gluconic acid contributed to the pleasant sour taste
of the beverage. Similar results have been reported in previous studies
(Bartowsky et al., 2008; Ramachandran et al., 2006; Wang et al., 2020).
Subsequently, the taste and odor thresholds of gluconic and acetic
acid were determined (Table 2). The taste thresholds were 65.8 mg/L for
gluconic acid and only 13.2 mg/L for acetic acid, while the odor
thresholds were 154 g/L for gluconic acid and only 0.21 g/L for acetic
acid. The results indicated that human taste is more sensitive to acetic
acid. The odor threshold of acetic acid in this study was close to previous
study about 0.19 g/L (Moreno-Garcia, Garcia-Martinez, Carmen Millan,
Carlos Mauricio, & Moreno, 2015). In addition, this is the first report of
the sour taste and odor thresholds of gluconic acid.
Table 1
Correlation analysis between the proportion of organic acids and the taste
score of four Kombucha samples.
The proportion of main organic acids Taste score
gluconic acid 0.986*
acetic acid − 0.986*
Note: *p < 0.05.
4
LWT 155 (2022) 112937
3.2.2. Effect of the proportion of gluconic acid on the taste of aqueous
solutions and black tea infusions
In order to understand the effects of gluconic acid proportion on the
taste of Kombucha, aqueous solutions and black tea infusions with
different proportions of gluconic acid (0%, 20%, 40%, 60%, 80%, and
100%) were prepared. As shown in Fig. 1b, the taste score of aqueous
solutions increased with an increase in the proportion of gluconic acid,
meanwhile the intensity of the sour taste was decreased. The high in­
tensity of the sour taste in the solutions produced strong irritation. The
aqueous solutions with lower proportions of gluconic acid had stronger
astringency because acetic acid produces an astringent taste (Bartowsky
et al., 2008).
Since Kombucha is produced by the fermentation of sugar and tea
(Leal et al., 2018), the effects of the gluconic acid proportion on the taste
of the black tea infusion (sucrose, 83.86 g/L; black tea, 6 g/L) were
further analyzed. As shown in Fig. 1c, the taste score of the black tea
infusion increased with an increase in the proportion of gluconic acid
and reached the maximum score when the proportion of gluconic acid
was up to 80%, after which it started to decline. A higher proportion of
gluconic acid produced a stronger sweet taste. The intensity of the sour
taste of the black tea infusion decreased with an increase in the pro­
portion of gluconic acid but was lower than that of the aqueous solutions
because of the addition of sucrose. The results indicated that the high
proportion of gluconic acid improved the taste of Kombucha. Therefore,
a high proportion of gluconic acid of Kombucha would be obtained in
further investigation.
3.3. Isolation, screening, and identification of yeast and AAB
To obtain high quality Kombucha, strains with the highest produc­
tion of the main functional metabolites were selected. Throughout the
processes of isolation, purification, and screening, four strains with
strong abilities to produce ethanol, gluconic acid, acetic acid, and DSL
were obtained from Kombucha A and B. After isolation, purification, and
preliminary screening, 11 and 16 yeasts with red color by TTC staining
were obtained from Kombucha A and B, respectively, which inferred
that the yeast exhibited a strong ability to produce ethanol (Huang,
2019) (Fig. 2a). Meanwhile, 42 and 22 bacteria with obvious yellow
areas were obtained from Kombucha A and B, respectively, which
indicated that the AAB had a high acid production ability (Nguyen,
Nguyen, Nguyen, & Le, 2015) (Fig. 2b). As shown in Tables S3 and S4,
after further screening, four strains (B13, A26, A36, and A41) had the
highest yield of ethanol, gluconic acid, acetic acid, and DSL at 2.81,
7.68, 27.6, and 1.90 g/L, respectively. Morphologically, the yeast cells
(B13) exhibited an oval shape with an irregular arrangement (Fig. 2c).
All bacteria (A26, A36, and A41) were visually homogeneous with rod
shapes and colored pink by Gram staining (Fig. 2d). Then, the genes of
B13, A26, A36, and A41 were amplified by PCR and the products were
sequenced. The sequencing results showed that the length of the 26S
rDNA sequence of B13 (GenBank accession no. OK336361) was 446 bp
and the 16S rDNA sequence lengths of A26 (GenBank accession no.
OK335813-OK335815), A36 (GenBank accession no. OK335813-OK33
5815), and A41 (GenBank accession no. OK335813-OK335815) were
1426, 1427, and 1436 bp, respectively (Fig. S3). By comparing the se­
quences of the samples with known sequences in the GenBank database
(Table S5) and constructing a neighbor-joining phylogenetic tree
(Fig. 2e and f), B13, A26, A36 and A41 were identified as Starmerella
davenportii, Komagataeibacter saccharivorans, Gluconacetobacter inter­
medius, and G. intermedius, respectively.
Starmerella has received increased attention in research due to its
good fermentation properties, such as a strong ability to produce organic
acids, ferment products with rich fragrance, and strong tolerance to­
wards high-sucrose, low pH, and the intestinal environment (De Graeve,
De Maeseneire, Roelants, & Soetaert, 2018; Tu et al., 2020). As initially
proposed by Yamada in 2012, the results indicated that Komagataei­
bacter spp. oxidized ethanol to acetic acid, and were the main AAB
R. Li et al. LWT 155 (2022) 112937

Fig. 1. The intensity of the sensory sour taste of

gluconic (pink) and acetic (purple) acid solutions at
different concentrations (a), and the taste score
(pink) and intensity of the sour taste (purple) of
different proportions of gluconic acid of aqueous
solutions (b) and black tea infusion (c). a, b, c, d, e
Different letters in the same column indicate sig­
nificant differences between mean values (p <
0.05). **p < 0.01 and ***p < 0.001 indicate sig­
nificant differences between the gluconic and acetic
acid solutions at the same concentration.

inoculum size. Total acid content was the major parameter to determine
Table 2
the fermentation end point, which may be related to the survival and
Chemical and sensory properties of gluconic and acetic acid.
activity of specfic AAB strains (Sknepnek et al., 2021). The total acids
Acid MW Taste Odor Sensory quality mainly included gluconic and acetic acids during the optimization
threshold (mg/ threshold (g/L
process, which was used as an index of optimization to obtain Kombucha
L water) water)
with a strong ability to produce main organic acids and contribute to the
Gluconic 196.16 65.8 154 Sweet aftertaste, soft,
preparation of Kombucha with a high proportion of gluconic acid. As
acid refreshing taste
Acetic 60 13.2 0.21 Tart and astringent shown in Fig. 3a, SC2 exhibited the highest proportion of gluconic acid
acid taste, pungent and (51%), but the total acid concentration (9.08 g/L) was significantly
vinegar odor lower than other remaining strain combinations, thus, SC2 was indi­
cated as being unsuitable for fermentation and was excluded from
further analysis. SC3 showed the highest concentration of total acids
involved in the production of high-acid vinegars (Yamada et al., 2012).
(52.7 g/L) with the second highest proportion of gluconic acid (49%).
In addition, Komagataeibacter spp. are reported to have better resistance
Therefore, SC3 was identified as the optimal strain combination
to acetic acid (15–20%) than other AAB (Andres-Barrao et al., 2016; Zhu
involved in further study. In terms of the inoculum ratio (Fig. 3b), the
et al., 2018). Gluconacetobacter spp. participated in the production of
results showed that 1Y3A exhibited the highest proportion of gluconic
gluconic and glucuronic acids and have strong abilities to produce DSL
acid (61%) and was close to the highest total acid concentration (60.8
(Ramachandran et al., 2006; Yang et al., 2010). Furthermore,
g/L, which was slightly less than that of 1Y3A at 61.6 g/L), thus, the
G. intermedius has been used in a wide range of food, pharmaceutical,
ratio of 1Y3A (yeast:bacteria = 1:3) was identified as the optimal
and industrial applications due to its high tolerance toward ethanol and
inoculum ratio. An inoculum size of 4% (Fig. 3c) had the highest pro­
acetic acid (Kose, Sunagawa, Yoshida, & Tajima, 2013). Therefore, four
portion of gluconic acid and the total acid concentration (74% and 57.9
strains that were the predominant contributors towards the formation of
g/L, respectively), thus, the optimal inoculum size was 4%. Therefore, as
organic acids were used for microbial community reconstruction in
indicated in Fig. 3d, the optimal SMC at conditions of the strain com­
further experiments.
bination was SC3, the inoculum ratio was 1Y3A, and the inoculum size
was 4%. The proportion of gluconic acid significantly increased when
3.4. Microbial community reconstruction method to improve the gluconic Kombucha was fermented by SMC at optimized conditions. The results
acid proportion of Kombucha concluded that the microbial community reconstruction method effec­
tively enhanced the gluconic acid proportion of Kombucha.
In order to obtain Kombucha with the highest proportion of gluconic As reported previously, the strain combination (Villarreal-Soto et al.,
acid, four strains (B13, A26, A36, and A41) were reconstructed 2020), original ratio between yeast and AAB (Hibbing, Fuqua, Parsek, &
sequentially from strain combination to the inoculum ratio to the

Fig. 2. Staining results of yeast (a) and AAB (b). Cellular morphology of yeast (c) and AAB (d). A phylogenic tree of B13 based on 26S rDNA gene sequences (e). A
phylogenic tree of A26, A36, and A41 based on 16S rDNA gene sequences (f).

5
R. Li et al. LWT 155 (2022) 112937

Fig. 3. The proportion of gluconic acid (purple) and the total acid concentration (orange) of different strain combinations (a), inoculum ratios (b), inoculum sizes (c),
and optimal SMC (d). Y, yeast; A, AAB. Total acids included gluconic, acetic, citric, L-malic, and succinic acids. a, b, c, d, e, f Different letters in the same column
indicate significant differences between the mean values (p < 0.05).

Peterson, 2010), and inoculum size (Sen & Swaminathan, 2004) are
critical factors for optimal production of the main functional metabolites
of Kombucha. The use of the proposed microbial community recon­
struction method significantly increased the proportion of gluconic acids
of Kombucha, which was higher in the present study compared to that in
previous studies (Chakravorty et al., 2016; Conton et al., 2017). This
method could provide a reference for the quality control of Kombucha.
3.5. Comparison of Kombucha fermented by SMC and traditional
Kombucha
The proportion of gluconic acid and main functional metabolite
concentrations of Kombucha fermented by SMC (sample H) and tradi­
tional Kombucha (samples A and B) are shown in Fig. 4a. The highest
proportion of gluconic acid (74%) was found in sample H and was 2.26-
and 4.15-fold greater than samples A and B, respectively. The total acid
concentration was the major parameter for determining the fermenta­
tion end point (Sknepnek et al., 2021). In this study, the total acid
concentration of sample H was 57.9 g/L, which was 3.10- and 3.06-fold
greater than that of samples A and B, respectively. The DSL concentra­
tion of sample H was 2.94 g/L, which was 2.01- and 3.09-fold greater
than that of samples A and B, respectively. The acid production intensity
of sample H was 6.1 g/day, which was 3.26- and 3.23-fold greater than
that of samples A and B, respectively. Thus, the results suggested that the
new SMC effectively improved the gluconic acid proportion and pro­
duction of the main functional metabolites of Kombucha compared with
the traditional Kombucha.
Three Kombucha SMC fermented samples (H) and traditional sam­
ples (A and B) were blended and had the same concentrations of
titratable acidity (as acetic acid), tea polyphenols, and total sugar. The
taste, odor, color, and overall acceptability of the three Kombucha
samples were evaluated, and the results are presented in Fig. 4b. In
terms of taste, all three Kombucha samples had appropriate sweet and
sour tastes, while the taste of sample H was softer compared to samples
A and B. This may be attributed to the high proportion of gluconic acid
in the SMC fermented sample H. Moreover, sample H had the highest
taste score (8.8), which was 1.3- and 1.4-fold greater than that of sam­
ples A and B, respectively. No significant difference was found in the
color score (8.1) among the three Kombucha samples. The results
showed that the sample H also had the highest odor and overall
acceptability scores among the three Kombucha samples. The overall
acceptability score of sample H was 1.25- and 1.45-fold greater than that
of samples A and B, respectively.
The optimized microbial community reconstruction method signifi­
cantly increased the sensory quality and production of the main func­
tional metabolites of Kombucha fermented by SMC compared with

Fig. 4. The proportion of gluconic acid (purple), the total acid concentration (green), the DSL concentration (pink) and the acid production intensity (gray) of three
Kombucha samples (a), and the sensory property evaluation of samples A (square), B (circle), and H (star) (b). Note: samples A and B are traditional Kombucha, and
sample H is Kombucha fermented by SMC. a, b, c Different letters in the same column indicate significant differences between mean values (p < 0.05).

6
R. Li et al.
traditional Kombucha, and were also higher than those in previous re­
ports (Chakravorty et al., 2016; Lin et al., 2015; Sknepnek et al., 2021;
Suna, Ciftci, & Tamer, 2020; Wang et al., 2020; Wang, Gan, Tang, Wang,
& Tan, 2010; Yildiz, Guldas, & Gurbuz, 2021). The Kombucha samples
with a high proportion of gluconic acid achieved a high taste score,
indicating that enhancing the proportion of gluconic acid could improve
the taste quality of Kombucha.
4. Conclusions
The proportion of gluconic acid was significantly positively corre­
lated with the taste score of Kombucha, thus, increasing the proportion
of gluconic acid can improve the taste of Kombucha. S. davenportii and
G. intermedius were screened and used for microbial community recon­
struction to enhance the proportion of gluconic acid, which was an
effective method to improve the taste quality of Kombucha. Moreover,
fermentation via the microbial community reconstruction method
significantly increased the concentration of the main functional me­
tabolites of Kombucha as compared with the traditional Kombucha. The
results of the present study provide guidance for improving the taste
quality and quality control of Kombucha.
CRediT authorship contribution statement
Ruyi Li: Conceptualization, Methodology, Formal analysis, Investi­
gation, Visualization, Data curation, Writing – original draft. Yongquan
Xu: Conceptualization, Methodology, Investigation, Writing – review &
editing. Jianxin Chen: Validation, Investigation. Fang Wang: Valida­
tion, Investigation. Chun Zou: Conceptualization, Methodology, Formal
analysis, Writing – review & editing, Supervision, Investigation, Fund­
ing acquisition. Junfeng Yin: Conceptualization, Methodology, Writing
– review & editing, Supervision, Funding acquisition, Project
administration.
Declaration of competing interest
All authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgements
This research was funded by China Agriculture Research System of
MOF and MARA (grant no. CARS-19), the Zhejiang Provincial Key
Research and Development Project (grant no. 2019C02072), the Na­
tional Natural Science Foundation of China (grant no. 32002094), the
Zhejiang Provincial Innovation Leadership Program in Sciences and
Technologies Project (grant no. 2018R52024), and the Innovation
Project for Chinese Academy of Agricultural Sciences (grant no. CAAS-
ASTIP-TRICAAS).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.lwt.2021.112937.
References
Andres-Barrao, C., Saad, M. M., Ferrete, E. C., Bravo, D., Chappuis, M. L., Perez, R. O.,
et al. (2016). Metaproteomics and ultrastructure characterization of
Komagataeibacter spp. involved in high-acid spirit vinegar production. Food
Microbiology, 55, 112–122. https://doi.org/10.1016/j.fm.2015.10.012
Bartowsky, E. J., & Henschke, P. A. (2008). Acetic acid bacteria spoilage of bottled red
wine-A review. International Journal of Food Microbiology, 125(1), 60–70. https://doi.
org/10.1016/j.ijfoodmicro.2007.10.016
Bhattacharya, S., Gachhui, R., & Sil, P. C. (2013). The prophylactic role of D-saccharic
acid-1,4-lactone against hyperglycemia-induced hepatic apoptosis via inhibition of
7
LWT 155 (2022) 112937
both extrinsic and intrinsic pathways in diabetic rats. Food & Function, 4(2),
283–296. https://doi.org/10.1039/c2fo30145h
Chakravorty, S., Bhattacharya, S., Chatzinotas, A., Chakraborty, W., Bhattacharya, D., &
Gachhui, R. (2016). Kombucha tea fermentation: Microbial and biochemical
dynamics. International Journal of Food Microbiology, 220, 63–72. https://doi.org/
10.1016/j.ijfoodmicro.2015.12.015
Conton, M., Pawtowski, A., Taminiau, B., Burgaud, G., Deniel, F., Coulloumme-
Labarthe, L., et al. (2017). Unraveling microbial ecology of industrial-scale
Kombucha fermentations by metabarcoding and culture-based methods. FEMS
Microbiology Ecology, 93(5), 1–16. https://doi.org/10.1093/femsec/fix048
De Graeve, M., De Maeseneire, S. L., Roelants, S. L. K. W., & Soetaert, W. (2018).
Starmerella bombicola, an industrially relevant, yet fundamentally underexplored
yeast. FEMS Yeast Research, 18(7), 1–13. https://doi.org/10.1093/femsyr/foy072
Hibbing, M. E., Fuqua, C., Parsek, M. R., & Peterson, S. B. (2010). Bacterial competition:
Surviving and thriving in the microbial jungle. Nature Reviews Microbiology, 8(1),
15–25. https://doi.org/10.1038/nrmicro2259
Huang, Y. Y. (2019). Screening of yeast strains and comparison of their fermentation
performance. Liquor-making Science & Technology, (2), 40–43. https://doi.org/
10.13746/j.njkj.2018252
Ibanoglu, S., Ainsworth, P., Ozer, E. A., & Plunkett, A. (2006). Physical and sensory
evaluation of a nutritionally balanced gluten-free extruded snack. Journal of Food
Engineering, 75(4), 469–472. https://doi.org/10.1016/j.jfoodeng.2005.04.060
Irwin, A. J., Bordeleau, L., & Barker, R. L. (2018). Model studies and flavor threshold
determination of 3-Methyl-2-Butene-1-Thiol in beer. Journal of the American Society
of Brewing Chemists, 51(1), 1–3. https://doi.org/10.1094/asbcj-51-0001
Jakubczyk, K., Gutowska, I., Antoniewicz, J., & Janda, K. (2021). Evaluation of fluoride
and selected chemical parameters in Kombucha derived from white, green, black and
red tea. Biological Trace Element Research, 199(9), 3547–3552. https://doi.org/
10.1007/s12011-020-02445-9
Kapp, J. M., & Sumner, M. (2019). Kombucha: A systematic review of the empirical
evidence of human health benefit. Annals of Epidemiology, 30, 66–70. https://doi.
org/10.1016/j.annepidem.2018.11.001
Kim, J., & Adhikari, K. (2020). Current trends in Kombucha: Marketing perspectives and
the need for improved sensory research. Beverages, 6(1). https://doi.org/10.3390/
beverages6010015
Kose, R., Sunagawa, N., Yoshida, M., & Tajima, K. (2013). One-step production of
nanofibrillated bacterial cellulose (NFBC) from waste glycerol using
Gluconacetobacter intermedius NEDO-01. Cellulose, 20(6), 2971–2979. https://doi.
org/10.1007/s10570-013-0050-0
Leal, J. M., Suarez, L. V., Jayabalan, R., Oros, J. H., & Escalante-Aburto, A. (2018).
A review on health benefits of Kombucha nutritional compounds and metabolites.
CyTA - Journal of Food, 16(1), 390–399. https://doi.org/10.1080/
19476337.2017.1410499
Lin, J., Ye, X. Y., Cao, Z. L., Xie, F. Y., & Xu, M. A. (2015). Isolation of microorganisms in
"Kombucha" and production of pure bacteria mixed fermentation. Journal of Chinese
Institute of Food Science and Technology, 15(2), 39–48. https://doi.org/10.16429/
j.1009-7848.2015.02.007
Moreno-Garcia, J., Garcia-Martinez, T., Carmen Millan, M., Carlos Mauricio, J., &
Moreno, J. (2015). Proteins involved in wine aroma compounds metabolism by a
Saccharomyces cerevisiae flor-velum yeast strain grown in two conditions. Food
Microbiology, 51, 1–9. https://doi.org/10.1016/j.fm.2015.04.005
Nguyen, N. K., Nguyen, H. T., & Le, P. H. (2015). Effects of Lactobacillus casei and
alterations in fermentation conditions on biosynthesis of glucuronic acid by a
Dekkera bruxellensis-Gluconacetobacter intermedius Kombucha symbiosis model
system. Food Biotechnology, 29(4), 356–370. https://doi.org/10.1080/
08905436.2015.1092446
Nguyen, K. N., Nguyen, P. B., Nguyen, H. T., & Le, P. H. (2015). Screening the optimal
ratio of symbiosis between isolated yeast and acetic acid bacteria strain from
traditional Kombucha for high-level production of glucuronic acid. Lwt-Food Science
and Technology, 64(2), 1149–1155. https://doi.org/10.1016/j.lwt.2015.07.018
Ramachandran, S., Fontanille, P., Pandey, A., & Larroche, C. (2006). Gluconic acid:
Properties, applications and microbial production. Food Technology and
Biotechnology, 44(2), 185–195. https://www.researchgate.net/publication/
228342155.
Sen, R., & Swaminathan, I. (2004). Response surface modeling and optimization to
elucidate and analyze the effects of inoculum age and size on surfactin production.
Biochemical Engineering Journal, 21(2), 141–148. https://doi.org/10.1016/j.
bej.2004.06.006
Sknepnek, A., Tomic, S., Miletic, D., Levic, S., Colic, M., Nedovic, V., et al. (2021).
Fermentation characteristics of novel coriolus versicolor and lentinus edodes
Kombucha beverages and immunomodulatory potential of their polysaccharide
extracts. Food Chemistry, 342, 1–10. https://doi.org/10.1016/j.
foodchem.2020.128344
Suna, S., Ciftci, K., & Tamer, C. E. (2020). Determination of physicochemical and sensory
properties of Kombucha beverage prepared with saffron. Gida-Journal of Food, 45(1),
20–30. https://doi.org/10.15237/gida.GD19139
Tran, T., Grandvalet, C., Verdier, F., Martin, A., Alexandre, H., & Tourdot-Marechal, R.
(2020). Microbiological and technological parameters impacting the chemical
composition and sensory quality of Kombucha. Comprehensive Reviews in Food Science
and Food Safety, 19(4), 2050–2070. https://doi.org/10.1111/1541-4337.12574
Tu, C. H., Hu, W. X., Tang, S. J., Meng, L., Huang, Z. H., Xu, X., et al. (2020). Isolation
and identification of Starmerella davenportii strain Do18 and its application in black
tea beverage fermentation. Food Science and Human Wellness, 9(4), 355–362. https://
doi.org/10.1016/j.fshw.2020.04.010
R. Li et al.
Vargasa, B. K., Fabricio, M. F., & Zachia Ayub, M. A. (2021). Health effects and probiotic
and prebiotic potential of Kombucha: A bibliometric and systematic review. Food
Bioscience, 44, 1–12. https://doi.org/10.1016/j.fbio.2021.101332
Villarreal-Soto, S. A., Beaufort, S., Bouajila, J., Souchard, J. P., & Taillandier, P. (2018).
Understanding Kombucha tea fermentation: A review. Journal of Food Science, 83(3),
580–588. https://doi.org/10.1111/1750-3841.14068
Villarreal-Soto, S. A., Bouajila, J., Pace, M., Leech, J., Cotter, P. D., Souchard, J. P., et al.
(2020). Metabolome-microbiome signatures in the fermented beverage, Kombucha.
International Journal of Food Microbiology, 333, 1–13. https://doi.org/10.1016/j.
ijfoodmicro.2020.108778
Vitas, J. S., Cvetanovic, A. D., Maskovic, P. Z., Svarc-Gajic, J. V., & Malbasa, R. V. (2018).
Chemical composition and biological activity of novel types of Kombucha beverages
with yarrow. Journal of Functional Foods, 44, 95–102. https://doi.org/10.1016/j.
jff.2018.02.019
Wang, K., Gan, X. H., Tang, X. Y., Wang, S., & Tan, H. R. (2010). Determination of D-
saccharic acid-1,4-lactone from brewed Kombucha broth by high-performance
capillary electrophoresis. Journal of Chromatography B-Analytical Technologies in the
Biomedical and Life Sciences, 878(3–4), 371–374. https://doi.org/10.1016/j.
jchromb.2009.12.003
Wang, S., Zhang, L. M., Qi, L. B., Liang, H. P., Lin, X. P., Li, S. J., et al. (2020). Effect of
synthetic microbial community on nutraceutical and sensory qualities of Kombucha.
International Journal of Food Science and Technology, 55(10), 3327–3333. https://doi.
org/10.1111/ijfs.14596
Xiao, P., Huang, Y. Y., Yang, W. P., Zhang, B. W., & Quan, X. X. (2015). Screening lactic
acid bacteria with high yielding-acid capacity from pickled tea for their potential
uses of inoculating to ferment tea products. Journal of Food Science and Technology-
Mysore, 52(10), 6727–6734. https://doi.org/10.1007/s13197-015-1803-6
LWT 155 (2022) 112937
Yamada, Y., Yukphan, P., Huong, T. L. V., Muramatsu, Y., Ochaikul, D., & Nakagawa, Y.
(2012). Subdivision of the genus Gluconacetobacter Yamada, Hoshino and Ishikawa
1998: The proposal of Komagatabacter gen. Nov., for strains accommodated to the
Gluconacetobacter xylinus group in the alpha-proteobacteria. Annals of Microbiology,
62(2), 849–859. https://doi.org/10.1007/s13213-011-0288-4
Yang, Z. W., Zhou, F., Ji, B. P., Li, B., Luo, Y. C., Yang, L., et al. (2010). Symbiosis
between microorganisms from Kombucha and Kefir: Potential significance to the
enhancement of Kombucha function. Applied Biochemistry and Biotechnology, 160(2),
446–455. https://doi.org/10.1007/s12010-008-8361-6
Yildiz, E., Guldas, M., & Gurbuz, O. (2021). Determination of in-vitro phenolics,
antioxidant capacity and bio-accessibility Kombucha tea produced from black carrot
varieties grown in Turkey. Food Science and Technology, 41(1), 180–187. https://doi.
org/10.1590/fst.00320
Zheng, M. Q., Han, Y. X., Han, H. J., Xu, C. Y., Zhang, Z. W., & Ma, W. C. (2019).
Synergistic degradation on phenolic compounds of coal pyrolysis wastewater (CPW)
by lignite activated coke-active sludge (LAC-AS) process: Insights into succession of
microbial community under selective pressure. Bioresource Technology, 281,
126–134. https://doi.org/10.1016/j.biortech.2019.02.074
Zhu, Y. P., Zhang, F. F., Zhang, C. N., Yang, L., Fan, G. S., Xu, Y. Q., et al. (2018).
Dynamic microbial succession of Shanxi aged vinegar and its correlation with flavor
metabolites during different stages of acetic acid fermentation. Scientific Reports, 8,
1–10. https://doi.org/10.1038/s41598-018-26787-6
Zou, C., Li, R. Y., Chen, J. X., Wang, F., Gao, Y., Fu, Y. Q., et al. (2021). Zijuan tea-based
Kombucha: Physicochemical, sensorial, and antioxidant profile. Food Chemistry, 363,
1–8. https://doi.org/10.1016/j.foodchem.2021.130322