Food Chemistry 347 (2021) 129036

Contents lists available at ScienceDirect

Food Chemistry
journal homepage: www.elsevier.com/locate/foodchem

Construction of a synthetic microbial community for the biosynthesis of

volatile sulfur compound by multi-module division of labor
Rubing Du a, 1, Jun Liu a, b, 1, Jian Jiang a, Yuqiao Wang a, Xueao Ji a, Na Yang a, Qun Wu a, *,
Yan Xu a, *
a
Key Laboratory of Industrial Biotechnology of Ministry of Education, State Key Laboratory of Food Science and Technology, School of Biotechnology, Jiangnan
University, Wuxi 214122, China
b
Key Laboratory of Development and Application of Rural Renewable Energy, Ministry of Agriculture, Biogas Institute of Ministry of Agriculture, Chengdu 610041, China

A R T I C L E I N F O A B S T R A C T

Keywords: 3-(Methylthio)-1-propanol, reminiscent of cauliflower and cooked vegetable aroma, is an important sulfur
Sulfur compound compound in Baijiu. It is important to develop a method to increase 3-(methylthio)-1-propanol content to
Synthetic microbial community improve flavor quality of products. In this study, a synthetic microbial community was employed to enhance the
Culturomics
content of 3-(methylthio)-1-propanol by multi-module division of labor approach. Firstly, the synthetic pathway
Metatranscriptomic analysis
of 3-(methylthio)-1-propanol was reconstructed and classified into three modules. Later, the hyper producers in
3-(methylthio)-1-propanol
each module were isolated and negative interaction between the members was relieved. Finally, a synthetic
microbial community was constructed using three species containing one hyper producer from each module.
Furthermore, the transcription characteristics of the species in each module were validated by metatran­
scriptomic analysis. The constructed synthetic microbial community can be used to biosynthesize 3-(methylthio)-
1-propanol for Baijiu. This work provided a novel and workable strategy to design synthetic microbial com­
munity to enhance the flavor feature of other fermented foods.

1. Introduction three fundamental challenges should be addressed in order to construct

Most of the sulfur compound with low detection threshold and
potent sensorial properties are considered as important flavor compo­
nents in various fermented foods, such as cheese (Zhuang et al., 2015),
wine (Kinzurik et al., 2015), vinegar (Jian et al., 2020), beer (Lermu­
sieau & Collin, 2003) and Baijiu (Sha et al., 2017). In Baijiu, 3-(meth­
ylthio)-1-propanol exhibits the aroma of cauliflower and cooked
vegetable (Fan et al., 2015; Zheng et al., 2016) and contributes signifi­
cantly to the flavor quality. However, it is difficult to increase the con­
centration of 3-(methylthio)-1-propanol to improve the flavor feature of
the products.
With the rapid development of synthetic biology, the design and
construction of synthetic microbial communities have become a strong
tool for the efficient synthesis of biological products (Qian et al., 2020;
Sgobba & Wendisch, 2020). Thus, the construction of a synthetic mi­
crobial community is a feasible method to improve the production of 3-
(methylthio)-1-propanol for application in fermented foods. However,
a workable synthetic microbial community to be applied in food
fermentation.
The first aspect is the division of labor among different microbial
members (Thommes et al., 2019). A variety of yeasts produce 3-
(methylthio)-1-propanol via the Ehrlich pathway using methionine as
precursor (Cordente et al., 2012; Harsch & Gardner, 2013). In addition,
our previous study indicated that lactobacilli showed high transcrip­
tional activity in methyl cycle which can enhance the regeneration of
methionine that acts as a precursor of 3-(methylthio)-1-propanol (Liu
et al., 2017). However, there is insufficient regeneration of methionine.
Thus, it is important to add another member to provide methionine
required for the process. Certain Bacillus species were reported to hy­
drolyze protein into amino acids (Balaban et al., 2007; Hunt & Ottensen,
1961). As a result, this genera can be considered as a precursor-
producing microbe to construct the synthetic microbial community for
producing a higher concentrations of 3-(methylthio)-1-propanol.
Meanwhile, yeast, lactobacilli and Bacillus were reported as core

* Corresponding authors.
E-mail addresses: wuq@jiangnan.edu.cn (Q. Wu), yxu@jiangnan.edu.cn (Y. Xu).
1
Authors contributed equally to this work.

https://doi.org/10.1016/j.foodchem.2021.129036
Received 29 October 2020; Received in revised form 3 January 2021; Accepted 4 January 2021
Available online 12 January 2021
0308-8146/© 2021 Elsevier Ltd. All rights reserved.
R. Du et al.
microbes in Baijiu fermentation (Wang et al., 2018). Therefore, they can
be chosen to construct the synthetic microbial community.
The second aspect is the efficient isolation of the starters that exhibit
the best performance. However, it is challenging to screen sufficient
desirable candidates with the best performance by traditional culture
methods with relatively lower efficiency and capacity. Recently, cul­
turomics, a high-throughput culture-dependent method involving a
large number of samples and culture conditions, is applied to obtain the
maximal numbers of microbes with different characteristics (Ladle et al.,
2017; Tahmasebi et al., 2015). Then it can be used to isolate microbes
with outstanding performances for constructing synthetic microbial
community.
The third aspect is the reduction of negative microbial interaction
between the members in a synthetic microbial community. The negative
microbial interaction primarily results from the competition for re­
sources or production of toxic compounds (Hibbing et al., 2010). It was
reported that Bacillus was inhibited by S. cerevisiae (Meng et al., 2015)
and lactic acid bacteria (Karetkin et al., 2019). Therefore, it is crucial to
alleviate their negative interactions in the construction of a synthetic
microbial community.
In this study, we constructed the synthetic pathway of 3-(methyl­
thio)-1-propanol, and developed the synthetic microbial community
based on multi-module division of labor for the efficient biosynthesis of
3-(methylthio)-1-propanol. Culturomics was applied and the hyper
producers of each module were isolated to constitute the synthetic mi­
crobial community. The negative interaction between the members in
the synthetic microbial community was relieved using the compatibility
screening method. Further, a three-species synthetic microbial com­
munity was developed to efficiently biosynthesize 3-(methylthio)-1-
propanol. The function of the constructed microbial community was
comprehensively studied by metatranscriptomics analysis. This work
developed a novel strategy to design a synthetic microbial community,
and the constructed microbial community could be applied in to
enhance the production of 3-(methylthio)-1-propanol in Baijiu fermen­
tation. This strategy can also be applied to enhance the content of flavor
compounds in various fermented foods.
2. Materials and methods
2.1. Sample collection
A total of 54 samples were collected from 8 different cities in China.
The detailed description of each sample is shown in Supplementary
Table S1, including 7 Daqu (starter) samples and 47 fermented grain
samples obtained at different fermentation time. After sampling, the
hyper producers were immediately screened out from the samples.
2.2. Using culturomics to screen the hyper producers in different modules
In order to screen the hyper producers in each module, five-gram of
the samples were mixed with 45 mL sterile saline solution, and decimal
dilution solutions (10–1, 10–2, 10–3, 10–4, 10–5, and 10–6) were prepared.
The diluted solutions were coated onto different solid media. The
detailed information of the culture conditions and medium are listed in
Supplementary Table S2. In the yeast screening experiment, 0.12 mg/L
of ampicillin was added to inhibit the bacteria. In the screening exper­
iment for Bacillus and lactobacilli, 0.12 mg/L of nystatin was added to
inhibit the fungus. In order to differentiate the colony of Bacillus and
lactobacilli, the formation of protein proteolytic circle was considered as
an indicator for the colony of Bacillus strains (protease produced by the
targeted Bacillus strain degrades the protein in the skimmed milk pow­
der to form protein proteolytic circles), and the presence of discoloration
circle was found to indicate the colony of lactobacilli (acids produced by
the lactobacilli combine with bromocresol green to produce a color
change from blue-green to yellow-green or colorless). Based on their
characteristics, the single colony in each plate was picked out using the
2
Food Chemistry 347 (2021) 129036
high-throughput automatic colony picking system (QPix 420, Molecular
Devices, San Francisco, CA). Briefly, the single colony was placed in a
96-well deep well plate (10 deep well plates were used to screen Bacillus,
yeast, and lactobacilli) containing 1 mL of sorghum extract medium. To
screen the hyper producers in modules I, II, and III, the yields of 3-
(methylthio)-1-propanol produced by the yeast strain, and methionine
produced by Bacillus strains and lactobacilli, were quantified immedi­
ately after culturing for 24 h. The yield of each strain was assayed from
three biological repetitions.
To identify each of hyper producer, their genomic DNA was extracted
using the DNeasy Tissue Kit (Qiagen Sciences, Valencia, CA) according
to the manufacturer’s protocol. Further, 16S rRNA genes (bacteria) or
26S rRNA genes (fungus) were amplified using PCR with universal
primers (27F/1492R, NL1/NL4). The PCR was carried out in 25 μL
containing 12.5 μL of Green Taq Mix (Vazyme Nanjing China), 1 μmol of
each primer, 0.5 μL extracted DNA, with sterile water added to reach 25
μL. The PCR cycling conditions were as follows: 6 min initial denatur­
ation at 94 ◦ C, 30 cycles of 1 min for denaturation at 95 ◦ C, 30 s for
annealing at 55 ◦ C, and 2 min for extension at 72 ◦ C; each reaction had a
10 min stabilization step at 72 ◦ C. The obtained 16S and 26S rRNA gene
sequences were compared with the available sequences in NCBI using
the BLAST program (https://blast.ncbi.nlm.nih.gov/).
2.3. Screening Bacillus strain uninhibited by Saccharomyces and
lactobacilli using the compatibility screening method
2.3.1. Building compatibility screening system
Initially, S. cerevisiae JNY1 and Lentilactobacillus buchneri JNL1 were
activated under the YPD and MRS media at 30 ◦ C. Next, 1 × 106 CFU/mL
of S. cerevisiae JNY1 and 1 × 106 CFU/mL of L. buchneri JNL1 were
inoculated in a 250 mL shaking flask containing 50 mL sorghum extract
medium. Sorghum extract medium was prepared as previous report
(Kong et al., 2014). Briefly, the mixture of sorghum powder and
deionized water (w:v = 1:4) was steamed for 2 h, and then saccharified
at 60 ◦ C for 4 h with the addition of glucoamylase (5U/L). The mixture
was filtrated using gauze and the filtrate was centrifuged at 10000 rpm
for 15 min. The supernatant was collected and the sugar content was
adjusted to 12◦ Brix using deionized water. Sorghum extract medium
was autoclaved at 121 ◦ C for 15 min before use. The co-culture system
was cultured at 30 ◦ C for 4 h to construct a compatibility screening
system.
2.3.2. Screening targeted Bacillus strain that cannot be inhibited
The Bacillus strain was activated under the LB medium at 30 ◦ C for
24 h. Each Bacillus strain was added into the compatibility screening
system and cultured at 30 ◦ C for 24 h. The inoculation concentration of
each Bacillus strain was taken to be 1 × 106 CFU/mL. The interaction
between Bacillus, Saccharomyces and lactobacilli demonstrated on the
plates was used to screen the Bacillus strains that cannot be inhibited.
Briefly, 1 mL of fermentation broth was mixed with 9 mL of sterile saline
solution, which was further reduced to decimal dilutions using the same
diluent. The diluted solutions were coated on the sorghum extract me­
dium plate with skimmed milk powder to determine the biomass of each
Bacillus strain. The Bacillus colony was differentiated by the formation of
a protein proteolytic circle. The target Bacillus that that cannot be
inhibited by S. cerevisiae JNY1 and L. buchneri JNL1 was selected as the
candidate.
2.4. Mono- and co-culture experiments for the production of 3-
(methylthio)-1-propanol
We conducted mono-culture (S. cerevisiae JNY1) and co-culture
experiment (Bacillus velezensis JNB3, S. cerevisiae JNY1 and L. buchneri
JNL1) for the production of 3-(methylthio)-1-propanol. All the species
were grown in sorghum extract medium at 30 ◦ C for 24 h. The mono-
culture and co-culture experiments were carried out in 2 L
R. Du et al.
fermentation tanks using sorghum extract medium at 30 ◦ C for 48 h with
three parallels. The initial strain density of each species was 1 × 106
CFU/mL. The fermented samples were collected at 0, 6, 12, 18, 24, 32,
40 and 48 h. All collected samples were stored at − 80 ◦ C until analysis.
2.5. Determining the content of methionine
To determine the content of methionine in the fermentation broth,
0.5 mL sample was diluted to 5 mL with 5% trichloroacetic acid, then
ultrasonically treated at 0 ◦ C for 30 min. After 1 h’ standing, the su­
pernatant was collected after centrifugation at 4 ◦ C, 10000 rpm for 10
min. The content of methionine in the supernatant was determined using
high-performance liquid chromatography equipped with ultraviolet
detector (HPLC; Agilent 1200; Agilent, Santa Clara, CA) with Agilent
Hypersil ODS column (250 mm × 4.0 mm inner diameter, 5 μm film
thickness; Agilent, Santa Clara, CA) after OPA pre-column derivatiza­
tion. Mobile phase A (final pH = 7.2) was prepared as follows: 4.52 g
sodium acetate, 5 mL tetrahydrofuran and 0.2 mL trimethylamine were
added into 1 L H2O. Mobile phase B (final pH = 7.2) contain 4.52 g/L
sodium acetate in mixed solvent (20% H2O, 40% methanol and 40%
acetonitrile). The gradient elution was as follows: initial 8% mobile
phase B was increased to 50% within 17 min, further increased to 100%
within 3 min, and then decreased to 0% within 4 min. The UV detection
wavelength was 338 nm.
2.6. Determining the content of 3-(methylthio)-1-propanol
To analyze the 3-(methylthio)-1-propanol content in the fermenta­
tion broth, 1 mL sample was centrifuged at 4 ◦ C, 10000 rpm for 10 min
and the supernatant was collected. The 3-(methylthio)-1-propanol
content in the supernatant was determined using headspace solid-phase
microextraction gas chromatography-pulsed flame photometric detec­
tion (HS-SPME-GC-PFPD) as previously described (Sha, Chen, Qian,
Wang, & Xu, 2017). Briefly, the GC-PFPD analysis was performed on an
Agilent 7890A gas chromatograph equipped with a pulsed flame
photometric detector (OI Analytical model 5380, OI Analytical Co.,
College Station, TX). The GC-PFPD conditions were set on a DB-FFAP
column (30 mm × 0.32 mm inner diameter, 1 μm film thickness; J&W
Scientific, Folsom, CA).
2.7. Biomass determination by quantitative PCR (qPCR) analysis
Genomic DNA was extracted using the DNeasy Tissue Kit (Qiagen
Sciences, Valencia, CA) according to the manufacturer’s protocol. qPCR
was performed in a real-time PCR system with the StepOne real-time
PCR detection system and StepOne v2.0 software (Applied Biosystems,
Foster City, CA). Species-specific qPCR was used to detect the biomass of
each species in mono-culture and co-culture experiment. The informa­
tion of species-specific primers were listed in the Table 1. The serial
dilutions of genomic DNA were used to construct the standard quanti­
fication curves. Amplification of each dilution by qPCR was performed
in quintuplicate reactions. The standard curves were generated via
plotting mean Ct values against the log10 of the number of CFU per
milliliter. Each reaction was performed in a 20 μL volume containing
8.2 μL double distilled water, 10 μL SYBR Premix ExTaq (Takara,
Table 1
The information of primers used in this study.
Primers Species Sequence of primer (5′ -3′ )
SC1 Saccharomyces cerevisiae GGACTCTGGACATGCAAGAT
SC2 ATACCCTTCTTAACACCTGGC
LB1 Lentilactobacillus buchneri GGACCAATGCAGCAACTGAA
LB2 AGATTACTGACGCATTGGTTACCA
BV1 Bacillus velezensis CTCAACGCTTTGGAACTGGC
BV2 TACGCAACCGTTCGTTTTCC
*
x is the log10 CFU/mL; y is the Ct value.
3
Food Chemistry 347 (2021) 129036
Daliang, China), 0.4 μL of each primer (20 μM), 1 μL of template. The
amplification conditions as follows: preheating at 95 ◦ C for 60 s, 40
cycles of 95 ◦ C for 30 s, 60 ◦ C for 30 s, and increases of 0.5 ◦ C every 5 s
from 60 ◦ C to 95 ◦ C for melting curve analysis to confirm the specificity
of the amplification.
2.8. Total RNA extraction and sequencing
Total RNA was extracted using E.Z.N.A. Total RNA Kit I (Omega Bio-
Tek, Norcross, GA) following the manufacturer’s protocol. Residual
DNA was removed using RNase-Free DNase (Qiagen, Hilden, Germany)
according to the manufacturer’s protocol. The quality and concentra­
tions of total RNA were assessed using NanoDrop ND-1000 UV–Vis
Spectrophotometer (Thermo Fisher Scientific, Waltham, MA) and
agarose gel electrophoresis. Ribosomal RNA (rRNA) was removed using
the Ribo-Zero rRNA Removal Kit (Illumina, San Diego, CA) and Ribo-
Zero rRNA Removal Kit (Epicenter Biotechnologies, Madison, WI) ac­
cording to the manufacturer’s protocol. Thereafter, the mRNA was pu­
rified using a Ribo-Zero Magnetic Kit (Qiagen, Hilden, Germany).
Library preparation was performed using the TruSeq RNATM Sample
Prep Kit according to the TruSeq sample preparation guide. The quality
of the library was assessed on 2100 Bioanalyzer (Agilent Technologies,
Santa Clara, CA). Sequencing was performed on the Illumina MiSeq
4000 for 2 × 150 bp paired-end sequencing (Illumina, San Diego, CA).
2.9. Sequence processing
The FastQC toolkit was used to assess the raw reads quality (Phred
scores). The reads with poor quality (Phred score < 20), reads with ‘N’
bases or adapter were removed from raw data. In addition, rRNA reads
were removed using SortMeRNA to align databases of SILVA SSU (16S/
18S) and SILVA LSU (23S/28S) (Kopylova et al., 2012). Clear reads were
assembled de novo using the Trinity RNA-Seq assembly algorithm (Haas
et al., 2013). The open reading frame (ORF) of genes was predicted using
TransGeneScan software (Ismail et al., 2014). Non-redundant gene
catalog was constructed using CD-HIT software with mapping criteria of
> 95% identity and > 90% coverage (Li and Godzik, 2006). Gene
expression levels were estimated by fragments per kilobase of transcript
per million fragments mapped (FPKM) using RNA-Seq by Expectation
Maximization (RSEM) software (Li & Dewey, 2011). Taxonomic classi­
fication was performed using BLASTP program against NCBI NR data­
base (e-value <10− 5). Functional annotation was performed using the
Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations. The
metabolic pathways of 3-(methylthio)-propanol were constructed ac­
cording to KEGG pathway database https://www.kegg.jp/kegg/path
way.html) and MetaCyc Metabolic Pathway Database (https://met
acyc.org/). The raw sequence data of metatranscriptomic sequencing
were submitted to the DNA Data Bank of Japan (DDBJ) under the
accession number DRA010373.
Standard curve* Reference or source
2
y = − 3.30 × + 39.34R = 0.99 (Liu et al., 2019)
2
y = -3.44 × + 40.10R = 0.99 (Stevenson et al., 2006)
2
y = -3.26 × + 41.07R = 0.99 This study
R. Du et al.
3. Results
3.1. Rational design of the multi-module division of labor for the
biosynthesis of 3-(methylthio)-1-propanol
Based on the synthetic pathway of 3-(methylthio)-1-propanol, a
synthetic microbial community was developed using three modules for
the efficient biosynthesis of 3-(methylthio)-1-propanol (Fig. 1). On the
hydrolysis of protein by protease, methionine was provided in module I.
Bacillus was chosen as the protein-degrading microbes to provide
methionine. In module II, 3-(methylthio)-1-propanol was produced
using methionine as precursor (Deed et al., 2019). Yeast was selected as
the 3-(methylthio)-1-propanol-producing microbes. In module III,
methionine was regenerated via methyl cycle (Nixon et al., 2014).
Lactobacilli was selected as the functional microbes to strengthen the
regeneration of methionine.
3.2. Screening the hyper producers in each module by culturomics
The culturomics technique was performed on 54 fermentation sam­
ples under 48 culture conditions to screen the hyper producers in each
module. (Fig. 2A, 2B).
The colonies of 960 Bacillus, yeast, and lactobacilli were cultured in
the sorghum extract medium to analyze their performances (Fig. 2C). A
total of 65 Bacillus strains produced methionine in yields ranging from
2.04 ± 0.12 to 94.43 ± 1.71 mg/L. Additionally, 15 strains
produced>50 mg/L of methionine, and Bacillus lincheniformis JNB1
yielded the highest concentration of methionine (94.43 ± 1.71 mg/L)
Fig. 1. Rational design of the multi-module division of labor for the biosynthesis of 3-(methylthio)-1-propanol. Module I (precursor methionine-producing modules)
was aimed to enhance the methionine production by Bacillus. Module II (3-(methylthio)-1-propanol-producing module) was applied to produce volatile sulfur
compounds by yeast. Module III (methyl cycle-enhancing module) was used to increase the regeneration of methionine by lactobacilli. The information about each
gene involved in the pathway is shown at the bottom of the figure.
4
Food Chemistry 347 (2021) 129036
(Fig. 2C). A total of 87 yeast strains produced 3-(methylthio)-1-propanol
in yields ranging from 0.2 ± 0.02 to 128.52 ± 15.25 µg/L. In addition,
18 strains produced over 60 µg/L of 3-(methylthio)-1-propanol.
S. cerevisiae JNY1 generated the highest concentration of 3-(methyl­
thio)-1-propanol (128.52 ± 15.25 µg/L). A total of 96 lactobacilli pro­
duced methionine with a yield ranging from 1.71 ± 0.98 to 24.76 ±
5.90 mg/L, and 26 strains produced>10 mg/L of methionine. L. buchneri
JNL1 produced the highest concentration of methionine (24.76 ± 5.90
mg/L). These 59 hyper producers belonged to 8 Bacillus species, 7 yeast
species and 3 lactobacilli species (Fig. 2D) (Supplementary Table S3).
The highest producers were chosen as initial members to construct the
synthetic microbial community (Fig. 2E).
3.3. Alleviating the negative interaction between the hyper producers in
different modules using the compatibility screening method
In order to obtain the Bacillus strain that is not severely inhibited in
the synthetic microbial community, the highest producers in module II
and III, namely S. cerevisiae JNY1 and L. buchneri JNL1, were used to
devise the compatibility screening system (Fig. 3A). 15 Bacillus hyper
producers of methionine were co-cultured with the mixture of
S. cerevisiae JNY1 and L. buchneri JNL1, respectively. Bacillus strain
whose cell count number close to that of S. cerevisiae JNY1 and
L. buchneri JNL1 were picked out. As shown in Fig. 3B, the biomass of 14
Bacillus strains were<7.5 log10 CFU/mL in the compatibility screening
system, except for B. velezensis JNB3, exhibiting the highest biomass
(7.83 ± 0.59 log10 CFU/mL). B. velezensis JNB3 can produce 88.84 ±
3.19 mg/L methionine (Fig. 3C). Therefore, it was selected as a member
R. Du et al. Food Chemistry 347 (2021) 129036

Fig. 2. Workflow for the construction of the synthetic microbial community. (A) Collecting samples from different sampling sites, including fermented grains and
Daqu (a type of starter). (B) 12 isolation media and 4 culture conditions. M1 - M12 represent the 12 media: M1: WL; M2: YPD; M3, M7, M11: GLZ; M4, M8, M12: JP;
M5: MRS; M6: MC; M9: LB; M10: DB. The detailed information of each media and culture conditions are shown in Supplementary Table S2. (C) The screening of
hyper producers in different modules using the high-throughput screening method. (D) Identification of stains. Only the hyper producers in each module were
identified (Bacillus: yield of methionine > 50 mg/L; yeast: yield of 3-(methylthio)-propanol > 60 µg/L; lactobacilli: yield of methionine > 10 mg/L). (E) Metabolic
profile of the synthetic microbial community.

of the synthetic microbial community to enhance the production of 3-
(methylthio)-1-propanol.
3.4. Construction of synthetic microbial community for the efficient
biosynthesis of 3-(methylthio)-1-propanol
B. velezensis JNB3 (module I), S. cerevisiae JNY1 (module II), and
L. buchneri JNL1 (module III) were used to construct the synthetic
microbial community. The growth dynamics of each strain in mono- and
co-cultures are shown in Fig. 4. B. velezensis JNB3 reached the maximum
population within 16 h (Fig. 4A). S. cerevisiae JNY1 achieved the
maximum population in 32 h (Fig. 4B). L. buchneri JNL1 attained the
maximum population in 24 h (Fig. 4C). Meanwhile, there was no sig­
nificant (P > 0.05) negative interaction on the growth of the members
observed in mono- and co-cultures (Fig. 4A, B, and C). The mono-culture
of S. cerevisiae JNY1 produced the highest yield of 173.30 ± 12.65 µg/L

5
R. Du et al. Food Chemistry 347 (2021) 129036

Fig. 3. Alleviation of the negative interaction between Saccharomyces- lactobacilli and Bacillus. Compatibility screening method: The Bacillus clones that grow closely
with S. cerevisiae JNY1 and L. buchneri JNL1 were selected as candidates, which is marked in red (A). Microbial biomass of the Bacillus strain that was co-cultured with
S. cerevisiae JNY1 and L. buchneri JNL1 (B). The corresponding methionine production of each Bacillus strains (C). (For interpretation of the references to color in this
figure legend, the reader is referred to the web version of this article.)

3-(methylthio)-1-propanol. The co-culture produced the maximum yield
of 446.14 ± 39.83 µg/L 3-(methylthio)-1-propanol, this was signifi­
cantly higher (P < 0.05) than that in the mono-culture.
3.5. Characteristics of the synthetic microbial community in the
biosynthesis of 3-(methylthio)-1-propanol using the metatranscriptomic
analysis
The metatranscriptomic analysis was used to reveal the transcrip­
tional activity of the three members in 24 h (with the highest production
rate of 3-(methylthio)-1-propanol). The raw sequencing data of the
metatranscriptomic analysis are summarized in Supplementary
Table S4. Among the three species, L. buchneri JNL1 showed the highest
relative transcript abundance (48.60%), followed by S. cerevisiae JNY1
(35.44%) and B. velezensis JNB3 (15.95%) (Fig. 5A).
In addition, the transcription characteristics of each member in the
three modules were revealed (Fig. 5B). In module I, B. velezensis JNB3
showed the highest transcript abundance of genes encoding proteinases
(54.91%). In module II, S. cerevisiae JNY1 possessed the highest tran­
script abundance of 97.31%. The other two members in module II
showed limited transcriptional activities. To be more specific,
S. cerevisiae JNY1 possessed the highest transcript abundances of genes
encoding aromatic amino acid aminotransferase II (M1), pyruvate
decarboxylase (M2), and alcohol dehydrogenase (NADP + )/alcohol
dehydrogenase (M3). The other two members showed no transcriptional
activity in the production of 3-(methylthio)-1-propanol. In module III,
S. cerevisiae JNY1 (60.06%) and L. buchneri JNL1 (37.92%) showed
higher transcriptional activities than B. velezensis JNB3. Particularly,
L. buchneri JNL1 possessed the highest transcript abundance of genes
encoding DNA (cytosine-5-)-methyltransferase (C2) and adenosylho­
mocysteine nucleosidase (C4), which enhanced the metabolic pathway
for the conversion of S-adenosylmethionine to S-ribosyl-L-homocysteine.
This result suggested that L. buchneri JNL1 enhanced the regeneration of
methionine and is like a stress-reducing player by consuming the S-
adenosylmethionine. Also, B. velezensis JNB1 was found to exhibit the
high transcript abundance of genes encoding S-ribosylhomocysteine
lyase (C5).
4. Discussion
In this work, a novel strategy was developed to construct a synthetic
microbial community for the enhancement of flavor quality in fer­
mented foods. We also validated the effectiveness of the strategy.
Compared to the mono-culture of S. cerevisiae JNY1, the production of 3-
(methylthio)-1-propanol in the synthetic microbial community was
significantly increased by approximately 157.4%. Based on the

6
R. Du et al.
Fig. 4. Improving the concentration of 3-(methylthio)-1-propanol using synthetic microbial community. (A) Biomass of B. velezensis in mono- and co-culture ex­
periments. (B) Biomass of S. cerevisiae in mono- and co-culture experiments. (C) Biomass of L. buchneri in mono- and co-culture experiments. (D) The concentration of
3-(methylthio)-1-propanol in mono- and co-culture experiments.
metatranscriptomic analysis, B. velezensis JNB3 was featured as a
protein-degrading microbe, while S. cerevisiae JNY1 was considered to
be the 3-(methylthio)-1-propanol-producing microbe, and L. buchneri
JNL1 was the microbe that enhanced the methyl cycle. This observation
was in accordance with the rational design. It was reported that Bacillus
could not only secrete a variety of enzymes including protease (Wang
et al., 2020), but also be related with the production of a variety of flavor
compounds in Baijiu fermentation (Yang et al., 2020). In this study, we
found B. velezensis JNB3 was also active in transcription of genes asso­
ciated with the regeneration of methionine, particularly the gene
encoding S-ribosylhomocysteine lyase (C5). This result expanded the
function of Bacillus in food fermentation.
Nowadays, culturomics is mainly used to isolate uncultured or hard-
to-cultured microorganisms (Lagier et al., 2016). This method could also
greatly increase the number of cultivable microorganisms. We finally
obtained a total of 59 hyper producers using culturomics method. It
suggested that culturomics could remarkably increase the screening
reservoir capacity for the targeted microorganisms.
Growth inhibition was found to exist between the microbes. The
inhibition between the members in the synthetic microbial community
should be avoided to achieve a higher yield of products. This inhibition
among members might be caused by the primary or secondary metab­
olites produced by one of the members in the synthetic microbial com­
munity, such as ethanol (Zhou et al., 2015), short-chain fatty acids
7
Food Chemistry 347 (2021) 129036
(Karetkin et al., 2019), or bacteriocin (Alvarez-Sieiro et al., 2016; Cotelo
et al., 2013). However, the existing methods, such as the optimization of
inoculum ratio, growth conditions, or construction of sophisticated
mathematical models, may not alleviate the negative interaction be­
tween the members in the synthetic microbial community. The result
obtained in this study demonstrated that the application of the
compatibility screening method in the screening targets is one of the
most direct and effective methods for the alleviation of negative inter­
action. This strategy also can be extensively applied in different syn­
thetic microbial communities.
The synthetic microbial community has become an effective tool for
the synthesis of biological products (McCarty & Ledesma-Amaro, 2019).
In this study, a synthetic microbial community was constructed using
the microbes isolated from fermented food fermentation in order to
avoid the application of genetically modified strains. Single functional
microbes have been widely used to improve the quality of fermented
foods. For example, Kluyveromyces marxianus was used to increase the
concentrations of benzyl alcohol, phenethyl alcohol, benzyl acetate, and
phenethyl acetate in the chocolate manufacturing processes (Crafack
et al., 2014), and Hanseniaspora vineae was used in the wine-making
process to enhance the flavor diversity (Medina et al., 2013).
Compared to single species, the multi-species may have better envi­
ronmental adaptability to colonize and contribute to the spontaneous
fermentation of food. For example, the cross-feeding among the
R. Du et al. Food Chemistry 347 (2021) 129036

Fig. 5. The metabolic capacity of yeast, Bacillus, and lactobacilli associated with the formation of 3-methylthio-1-propanol. (A) Transcript abundance of each
microbe in the three-species synthetic microbial community. (B) Transcript abundance of each microbe in different modules. (C) The heat map shows the gene
transcription level; Z score is used for the data standardization of different genes; color depth represents the gene expression levels. The information of each gene is
shown in Fig. 1.

members of the synthetic microbial community enhances the growth of
the microorganisms (Xu et al., 2019). Therefore, this synthetic microbial
community shows great potential for the enhancement of the production
of 3-(methylthio)-1-propanol to improve food quality.
In conclusion, we classified the synthetic pathway of 3-(methylthio)-
1-propanol into three modules. We isolated the hyper producers of each
module using culturomics method. The negative interaction between the
members in the synthetic microbial community was relieved using the
compatibility screening method. Finally, S. cerevisiae JNY1, B. velezensis
JNB3 and L. buchneri JNL1 were used to construct a synthetic microbial
community for efficient biosynthesis of volatile sulfur compound. In the
future study, the constructed synthetic microbial community will be
used as an additional starter for the fermentation of Baijiu to enhance the
production of sulfur compound.
CRediT authorship contribution statement
Rubing Du: Investigation, Writing - original draft, Writing - review

8
R. Du et al.
& editing. Jun Liu: Data curation, Writing - original draft, Writing -
review & editing. Jian Jiang: Data curation. Yuqiao Wang: Data
curation. Xueao Ji: Data curation. Na Yang: Data curation. Qun Wu:
Writing - review & editing, Supervision. Yan Xu: Writing - review &
editing, Supervision.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgments
Funding.
This work was supported by the National Natural Science Foundation
of China (31530055), the National Key R&D Program of China
(2018YFD0400402), Jiangsu Province Science and Technology Project
(BE2017705), China Postdoctoral Science Foundation (2017M611702),
National First-Class Discipline Program of Light Industry Technology
and Engineering (LITE2018-12), the Priority Academic Program
Development of Jiangsu Higher Education Institutions, the 111 Project
(No. 111-2-06).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.foodchem.2021.129036.
References
Alvarez-Sieiro, P., Montalbán-López, M., Mu, D., & Kuipers, O. P. (2016). Bacteriocins of
lactic acid bacteria: Extending the family. Applied Microbiology and Biotechnology,
100(7), 2939–2951.
Balaban, N. P., Malikova, L. A., Mardanova, A. M., Rudenskaya, G. N., & Sharipova, M. R.
(2007). Purification and characterization of a subtilisin-like proteinases secreted in
the stationary growth phase of Bacillus amyloliquefaciens H2. Biochemistry Moscow, 72
(4), 459–465.
Cordente, A. G., Curtin, C. D., Varela, C., & Pretorius, I. S. (2012). Flavour-active wine
yeasts. Applied Microbiology and Biotechnology, 96(3), 601–618.
Cotelo, M. F., Schein, K. P., Salvo, S. S. G., Abirad, P. M. Z., & Techera, S. B. C. (2013).
Antimicrobial properties of lactic acid bacteria isolated from Uruguayan artisan
cheese. Food Science and Technology, 33(4), 801–804. https://doi.org/10.1590/
S0101-20612013000400029.
Crafack, M., Keul, H., Eskildsen, C. E., Petersen, M. A., Saerens, S., Blennow, A.,
Skovmand-Larsen, M., Swiegers, J. H., Petersen, G. B., Heimdal, H., & Nielsen, D. S.
(2014). Impact of starter cultures and fermentation techniques on the volatile aroma
and sensory profile of chocolate. Food Research International, 63, 306–316.
Deed, R. C., Hou, R. Y., Kinzurik, M. I., Gardner, R. C., & Fedrizzi, B. (2019). The role of
yeast ARO8, ARO9 and ARO1O genes in the biosynthesis of 3-(methylthio)-1-
propanol from L-methionine during fermentation in synthetic grape medium. FEMS
Yeast Research, 19(2), 9. https://doi.org/10.1093/femsyr/foy109.
Fan, H., Fan, W., & Xu, Y. (2015). Characterization of Key Odorants in Chinese Chixiang
Aroma-Type Liquor by Gas Chromatography–Olfactometry, Quantitative
Measurements, Aroma Recombination, and Omission Studies. Journal of Agriculture
and Food Chemistry, 63(14), 3660–3668.
Haas, B. J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P. D., Bowden, J.,
Couger, M. B., Eccles, D., Li, B.o., Lieber, M., MacManes, M. D., Ott, M., Orvis, J.,
Pochet, N., Strozzi, F., Weeks, N., Westerman, R., William, T., Dewey, C. N.,
Henschel, R., LeDuc, R. D., Friedman, N., & Regev, A. (2013). De novo transcript
sequence reconstruction from RNA-seq using the Trinity platform for reference
generation and analysis. Nature Protocols, 8(8), 1494–1512.
Harsch, M. J., & Gardner, R. C. (2013). Yeast genes involved in sulfur and nitrogen
metabolism affect the production of volatile thiols from Sauvignon Blanc musts.
Applied Microbiology and Biotechnology, 97(1), 223–235.
Hibbing, M. E., Fuqua, C., Parsek, M. R., & Peterson, S. B. (2010). Bacterial competition:
Surviving and thriving in the microbial jungle. Nature Reviews Microbiology, 8(1),
15–25.
Hunt, J. A., & Ottesen, M. (1961). A comparison of three proteinases from various strains
of Bacillus subtilis. Biochimica et Biophysica Acta, 48(2), 411–412.
Ismail, W., Ye, Y., & Tang, H. (2014). Gene finding in metatranscriptomic sequences.
BMC Bioinformatics, 15(Suppl 9), S8. https://doi.org/10.1186/1471-2105-15-S9-S8.
Jian, D., Zhou, Z., Gong, M., Jiang, Z., Zhu, S., Li, X., et al. (2020). Study on the effect of
temperature and oxygen on volatile flavor compounds of Zhenjiang aromatic vinegar
during aging. Food and Fermentation Industries, 7, 75–82. https://doi.org/10.7506/
spkx1002-6630-201516024.
9
Food Chemistry 347 (2021) 129036
Karetkin, B. A., Guseva, E. V., Evdokimova, S. A., Mishchenko, A. S., Khabibulina, N. V.,
Grosheva, V. D., Menshutina, N. V., & Panfilov, V. I. (2019). A quantitative model of
Bacillus cereus ATCC 9634 growth inhibition by bifidobacteria for synbiotic effect
evaluation. World Journal of Microbiology & Biotechnology, 35(6). https://doi.org/
10.1007/s11274-019-2665-2.
Kinzurik, M. I., Herbst-Johnstone, M., Gardner, R. C., & Fedrizzi, B. (2015). Evolution of
Volatile Sulfur Compounds during Wine Fermentation. Journal of Agriculture and
Food Chemistry, 63(36), 8017–8024.
Kong, Y., Wu, Q., Zhang, Y., et al. (2014). In situ analysis of metabolic characteristics
reveals the key yeast in the spontaneous and solid-state fermentation process of
Chinese light-style liquor. Applied and Environmental Microbiology, 80(12),
3667–3676. https://doi.org/10.1128/AEM.04219-1.
Kopylova, E., Noe, L., & Touzet, H. (2012). SortMeRNA: fast and accurate filtering of
ribosomal RNAs in metatranscriptomic data. Bioinformatics, 28(24), 3211-3217.
https://doi.org/10.1093/bioinformatics/bts611.
Ladle, R. J., Jepson, P., Correia, R. A., & Malhado, A. CM. (2017). The power and the
promise of culturomics. Frontiers in Ecology and the Environment, 15(6), 290–291.
Lagier, J.-C., Khelaifia, S., Alou, M. T., Ndongo, S., Dione, N., Hugon, P., Caputo, A.,
Cadoret, F., Traore, S. I., Seck, E. H., Dubourg, G., Durand, G., Mourembou, G.,
Guilhot, E., Togo, A., Bellali, S., Bachar, D., Cassir, N., Bittar, F., Delerce, J.,
Mailhe, M., Ricaboni, D., Bilen, M., Dangui Nieko, N. P. M., Dia Badiane, N. M.,
Valles, C., Mouelhi, D., Diop, K., Million, M., Musso, D., Abrahão, J., Azhar, E. I.,
Bibi, F., Yasir, M., Diallo, A., Sokhna, C., Djossou, F., Vitton, V., Robert, C.,
Rolain, J. M., La Scola, B., Fournier, P.-E., Levasseur, A., & Raoult, D. (2016). Culture
of previously uncultured members of the human gut microbiota by culturomics.
Nature Microbiology, 1(12). https://doi.org/10.1038/nmicrobiol.2016.203.
Lermusieau, G., & Collin, S. (2003). Volatile Sulfur Compounds in Hops and Residual
Concentrations in Beer—A Review. Journal of the American Society of Brewing
Chemists, 61(3), 109–113.
Li, B.o., & Dewey, C. N. (2011). RSEM: Accurate transcript quantification from RNA-Seq
data with or without a reference genome. BMC Bioinformatics, 12(1). https://doi.
org/10.1186/1471-2105-12-323.
Li, W., & Godzik, A. (2006). Cd-hit: A fast program for clustering and comparing large
sets of protein or nucleotide sequences. Bioinformatics, 22(13), 1658–1659.
Liu, C., Feng, S., Wu, Q., Huang, H., Chen, Z., Li, S., & Xu, Y. (2019). Raw material
regulates flavor formation via driving microbiota in Chinese liquor fermentation.
Frontiers in Microbiology, 10, 1520. https://doi.org/10.3389/fmicb.2019.01520.
Liu, J., Wu, Q., Wang, P., Lin, J., Huang, L., Xu, Y., & Pettinari, M. J. (2017). Synergistic
Effect in Core Microbiota Associated with Sulfur Metabolism in Spontaneous Chinese
Liquor Fermentation. Applied and Environmental Microbiology, 83(24). https://doi.
org/10.1128/AEM.01475-17.
McCarty, N. S., & Ledesma-Amaro, R. (2019). Synthetic Biology Tools to Engineer
Microbial Communities for Biotechnology. Trends in Biotechnology, 37(2), 181–197.
Medina, K., Boido, E., Fariña, L., Gioia, O., Gomez, M. E., Barquet, M., Gaggero, C.,
Dellacassa, E., & Carrau, F. (2013). Increased flavour diversity of Chardonnay wines
by spontaneous fermentation and co-fermentation with Hanseniaspora vineae. Food
Chemistry, 141(3), 2513–2521.
Meng, X., Wu, Q., Wang, L.i., Wang, D., Chen, L., & Xu, Y. (2015). Improving flavor
metabolism of Saccharomyces cerevisiae by mixed culture with Bacillus licheniformis
for Chinese Maotai-flavor liquor making. Journal of Industrial Microbiology and
Biotechnology, 42(12), 1601–1608.
Nixon, M., Saionz, K., Koo, M.-S., Szymonifka, M., Jung, H., Roberts, J., Nandakumar, M.,
Kumar, A., Liao, R., Rustad, T., Sacchettini, J., Rhee, K., Freundlich, J., &
Sherman, D. (2014). Folate Pathway Disruption Leads to Critical Disruption of
Methionine Derivatives in Mycobacterium tuberculosis. Chemistry & Biology, 21(7),
819–830.
Qian, X., Chen, L., Sui, Y., Chen, C., Zhang, W., Zhou, J., Dong, W., Jiang, M., Xin, F., &
Ochsenreither, K. (2020). Biotechnological potential and applications of microbial
consortia. Biotechnology Advances, 40, 107500. https://doi.org/10.1016/j.
biotechadv.2019.107500.
Sgobba, E., & Wendisch, V. F. (2020). Synthetic microbial consortia for small molecule
production. Current Opinion in Biotechnology, 62, 72–79.
Sha, S., Chen, S., Qian, M., Wang, C., & Xu, Y. (2017). Characterization of the Typical
Potent Odorants in Chinese Roasted Sesame-like Flavor Type Liquor by Headspace
Solid Phase Microextraction–Aroma Extract Dilution Analysis, with Special Emphasis
on Sulfur-Containing Odorants. Journal of Agriculture and Food Chemistry, 65(1),
123–131.
Stevenson, D. M., Muck, R. E., Shinners, K. J., & Weimer, P. J. (2006). Use of real time
PCR to determine population profiles of individual species of lactic acid bacteria in
alfalfa silage and stored corn stover. Applied Microbiology and Biotechnology, 71(3),
329–338.
Tahmasebi, N., Borin, L., Capannini, G., Dubhashi, D., Exner, P., Forsberg, M., Gossen, G.,
Johansson, F. D., Johansson, R., Kågebäck, M., Mogren, O., Nugues, P., & Risse, T.
(2015). Visions and open challenges for a knowledge-based culturomics.
International Journal on Digital Libraries, 15(2-4), 169–187.
Thommes, M., Wang, T., Zhao, Q., Paschalidis, I. C., & Segre, D. (2019). Designing
metabolic division of labor in microbial communities. mSystems, 4(2),
e00263–00218. https://doi.org/10.1128/mSystems.00263-18.
Wang, P., Wu, Q., & Xu, Y. (2018). Core microbiota in Chinese liquor fermentation and
associations with environmental factors. Acta Microbiologica Sinica, 58(1), 142–153.
https://doi.org/10.13343/j.cnki.wsxb.20170060.
Xu, X., Zarecki, R., Medina, S., Ofaim, S., Liu, X., Chen, C., Hu, S., Brom, D., Gat, D.,
Porob, S., Eizenberg, H., Ronen, Z., Jiang, J., & Freilich, S. (2019). Modeling
microbial communities from atrazine contaminated soils promotes the development
of biostimulation solutions. ISME Journal, 13(2), 494–508.
R. Du et al.
Yang, F., Liu, Y., Chen, L., Li, J., Wang, L.i., & Du, G. (2020). Genome sequencing and
flavor compound biosynthesis pathway analyses of Bacillus licheniformis isolated
from Chinese Maotai -flavor liquor-brewing microbiome. Food Biotechnology, 34(3),
193–211.
Zheng, Y., Sun, B., Zhao, M., Zheng, F., Huang, M., Sun, J., Sun, X., & Li, H. (2016).
Characterization of the Key Odorants in Chinese Zhima Aroma-Type Baijiu by Gas
Chromatography–Olfactometry, Quantitative Measurements, Aroma Recombination,
and Omission Studies. Journal of Agriculture and Food Chemistry, 64(26), 5367–5374.
10
Food Chemistry 347 (2021) 129036
Zhou, K., Qiao, K., Edgar, S., & Stephanopoulos, G. (2015). Distributing a metabolic
pathway among a microbial consortium enhances production of natural products.
Nature Biotechnology, 33(4), 377–383. https://doi.org/10.1038/nbt.3095.
Zhuang, Y., Guo, B., Sun, F., Sun, J., Chen, H., Zhang, Y., et al. (2015). Analysis of
volatile flavor compounds in blue cheese. Food Science China, 36(16), 132–136.
https://doi.org/10.7506/spkx1002-6630-201516024.