brain research 1492 (2013) 18–32

Available online at www.sciencedirect.com

www.elsevier.com/locate/brainres

Research Report

Pax2þ astrocytes in the fish optic nerve head after optic

nerve crush

M. Parrillaa,b, C. Lilloa, M.J. Herrero-Turrióna, R. Arévaloa, J. Aijóna, J.M. Laraa, A. Velascoa,n

a
Institute of Neuroscience of Castilla y Leon, University of Salamanca, Salamanca, Spain
b
Department of Molecular Neurogenetics, Max Planck Institute of Biophysics, Frankfurt am Main, Germany

ar t ic l e in f o abs tra ct

Article history: The transcription factor Pax2 actively participates in the development of the vertebrate
Accepted 10 November 2012 visual system. In adults, Pax2 expression persists in a subpopulation of Müller cells and/or
Available online 16 November 2012 astrocytes in the retina and optic nerve head (ONH), although its function remains elusive.

Keywords: In a previous work we showed that the pax2 gene expression is modified and the Pax2þ

Pax2 astrocyte population in the ONH strongly reacted during the regeneration of the retina

Optic nerve after a lesion in goldfish. In the present work we have analyzed Pax2 expression in the

Regeneration goldfish ONH after optic nerve (ON) crush. At one week post-injury, when the regenerating

Astrocyte axons arrive at the ONH, the pax2 gene expression level increases as well as the number of

Optic nerve head Pax2þ astrocytes in this region. These Pax2þ astrocytes show a higher number of

Glia Cytokeratin (Ck)þ/GFAPþ processes compared with control animals. In contrast, a different
S100þ astrocyte population is not modified and persists similar to that of controls.
Furthermore, we find a ring that surrounds the posterior ONH that is formed by highly
reactive astrocytes, positive to Pax2, GFAP, Ck, S100, GS and ZO1. In this region we also find
a source of new astrocytes Pax2þ/PCNAþ that is activated after the injury. We conclude that
Pax2þ astrocytes constitute a subpopulation of ONH astrocytes that strongly reacts after
ON crush and supports our previous results obtained after retina regeneration. Altogether,
this suggests that pax2 gene expression and Pax2þ astrocytes are probably directly involved
in the process of axonal regeneration.
& 2012 Elsevier B.V. All rights reserved.

1. Introduction Bastmeyer, 2000). Furthermore, during the development of

The ONH is the region of the ON where the retinal ganglion
cell (RGC) axons coming from the retina converge to the ON.
During vertebrate visual system development the ONH plays
an important role in the guidance of the RGC axons from
the retina to the ON (Oster et al., 2004; Stuermer and
this region, there is a ring of neuroepithelial cells, character-
ized by the expression of the paired-boxed transcription
factor Pax2, which is also directly involved in the axon-
guidance processes (Goode and Elgar, 2009; Morcillo et al.,
2006; Otteson et al., 1998). Pax2 is responsible for the choroid
fissure closure, the correct entrance of the RGC axons to the

n
Correspondence to: Institute of Neuroscience of Castilla y Leon, University of Salamanca, C/ Pintor Fernando Gallego 1, 37007
Salamanca, Spain. Fax: þ34 923294750.
E-mail addresses: mparrillamonge@gmail.com (M. Parrilla), conlillo@usal.es (C. Lillo), mjaviht@usal.es (M.J. Herrero-Turrión),
mraa@usal.es (R. Arévalo), rubi@usal.es (J. Aijón), rororo@usal.es (J.M. Lara), malmu@usal.es (A. Velasco).

0006-8993/$ - see front matter & 2012 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.brainres.2012.11.014
 brain research 1492 (2013) 18–32
ONH and the differentiation of the neuroepithelial cells
into astrocytes (Macdonald et al., 1997; Torres et al., 1996),
and the lack of this gene produces the human disease called
coloboma (Sanyanusin et al., 1995).
The ONH of adult vertebrates also has a characteristic glial
population and organization which differs in each group:
mammals (Fischer et al., 2010; Triviño et al., 1996), birds
(Fischer et al., 2010; Quesada et al., 2004; Schuck et al., 2000)
or reptiles (Casañas et al., 2011; Dávila et al., 1987). In fish, the
vitreal Müller cell processes that limit the ONH and the retina
are morphologically different to those from the rest of the
retina and are in close contact with microglial cells and
astrocytes (Lillo et al., 2002), these being slightly positive to
glial fibrillary acidic protein (GFAP) and Cytokeratin (Ck) in
contrast to mammals (Lillo et al., 2002; Parrilla et al., 2009).
Furthermore, the fish visual system is in continuous growth
and is capable of regeneration after suffering a lesion (Garcı́a
and Koke, 2009; Hitchcock and Raymond, 2004; Johns and
Easter, 1977). The ONH continuously incorporates new RGC
axons coming from a ring of stem cells located in the
periphery of the retina, denominated the peripheral growth
zone (PGZ) (Hitchcock and Raymond, 2004; Johns and Easter,
1977). This process is possible because Müller cells, astrocytes
and oligodendrocytes promote the organized entrance of the
axons to the ONH (Bunt, 1982; Easter et al., 1981; Lillo et al.,
2002) where they express and release similar axon-guidance
molecules to those expressed during development (Garcı́a
and Koke, 2009; Parrilla et al., 2009; Stuermer and Bastmeyer,
2000). Moreover, in all vertebrate groups, pax2 gene expres-
sion is maintained in the ONH during adulthood and it is
thought to participate in the maintenance of the astrocyte
phenotype of the cells that express it (Boije et al., 2010;
Casañas et al., 2011; Parrilla et al., 2009; Stanke et al., 2010).
Also, it seems that Pax2 in the ONH participates in axon-
guidance and regeneration processes in fish (Parrilla et al.,
2009,2012).
Due to its high accessibility and the fact that it is exclu-
sively composed by the RGC axons and glial cells, the ON has
been widely used to study the lesion and regeneration
processes in the central nervous system, mostly in mouse
(Mus musculus), goldfish (Carassius auratus) and lately in
zebrafish (Danio rerio) (Becker and Becker, 2008; Garcı́a and
Koke, 2009; Kolb et al., 2000; Matsukawa et al., 2004a). During
recent years, a wide number of molecules involved in this
axon regeneration has been described (Becker and Becker,
2007). For example, axon-guidance molecules, such as
netrin1 (Petrausch et al., 2000), the synthesis of retinoic acid,
an activator of pax2 gene expression, or the Pax6 expression,
an inhibitor of pax2, are modified after ON crush (Matsukawa
et al., 2004b; Nagashima et al., 2009; Rodger et al., 2006;
Ziman et al., 2001).
Although the role of the Pax2 transcription factor during
the ONH development has been widely demonstrated, little is
known about its role in adult animals (Boije et al., 2010;
Parrilla et al., 2009; Stanke et al., 2010). In a previous work, we
demonstrated that the Pax2þ population in goldfish ONH is
modified after PGZ cryolesion, increasing both the gene
expression and the number of cells when the new RGC axons
arrive at the ONH, suggesting that they may be involved
in the process of axon regeneration (Parrilla et al., 2012).
19
To further characterize Pax2þ astrocytes in the ONH during
regeneration, we have performed ON crush and analyzed
both the modifications in the pax2 gene expression level and
in the Pax2þ astrocyte population. To study the Pax2þ astro-
cytes we used several astrocyte markers whose antibody
specificity has been widely demonstrated in our laboratory
and others: Pax2 transcription factor (Macdonald et al., 1997;
Parrilla et al., 2009), GFAP and Ck intermediate filaments (Lillo
et al., 2002; Parrilla et al., 2009), glutamine synthetase (GS) an
enzyme which converts the glutamate into glutamine
(Clemente et al., 2008; Parrilla et al., 2009), zonula ocludens1
(ZO1) located in the tight junctions (Mack and Wolburg, 2006)
and S100 calcium-modulated protein (Jimeno et al., 1999;
Vecino et al., 1997; Velasco et al., 1997). Moreover, we
analyzed cell division in the ONH after ON crush and
identified a Pax2þ/PCNAþ astroblast pool in the ONH which
is activated after an injury (Parrilla et al., 2009).
2. Results
2.1. Pax2þ astrocytes in the control ONH
In a previous work, we described the distribution and char-
acterization of Pax2þ astrocytes in the ONH (Parrilla et al.,
2009). Pax2þ astrocytes were located limiting the ONH with
the retina and the central artery (CA); the last ones being
located close to the Zn8þ young axons (Fig. 1A). The nuclei of
these Pax2þ astrocytes was usually surrounded by the astro-
cyte markers GFAP, ZO1 and Ck and presumably belonging to
these Pax2þ astrocytes although not overlapping (Fig. 1B–D ),
but they never were proximal to GS labeling (Fig. 1E).
In contrast, we found another type of cells, which were S100þ,
mostly located among the RGC axons and not forming part of
the glia limitans (Fig. 1F,G), as has been described in tench and
goldfish (Lillo et al., 2002). With double immunolabeling S100
and GFAP or GS we rarely found S100þ astrocytes positive to
GFAP (Lillo et al., 2002) and only some S100þ cells, with small
somata and arranged in rows, showed co-localization with GS
(Fig. 1F,G).
Fish Müller cells are positive to GFAP and GS and they
extend from the peripheral retina to the limit of the retina
with the ONH in control animals (Fig. 1B, E–G ). Müller cells
cross the retina from the outer limiting membrane to the
vitreal surface of the retina and in the ONH. They extend
their vitreal processes to the entrance of the CA (Fig. 1B, E–G ).
A summary of the goldfish ONH in control animals is
presented in Fig. 1H.
2.2. Variations in the expression of pax2a
In some teleosts, such as zebrafish (Danio rerio), the pax2 gene
is duplicated in two genes: pax2a and pax2b. The pax2a is
more similar to the mammalian pax2 gene in its expression
pattern. The pax2b gene also participates in optic nerve
development, though its expression is delayed (Pfeffer et al.,
1998). We analyzed the modifications of the pax2a gene
expression level in the ONH during regeneration after ON
crush using RT-qPCR assays. We had previously cloned two
goldfish partial-length pax2a cDNAs corresponding to at least
20 brain research 1492 (2013) 18–32

Fig. 1 – Pax2þ and S100þ cells characterization (red) in control ONH using double immunolabeling with Zn8, GFAP, ZO1, CK
and GS markers (green). (A) Pax2þ cells (arrows) close to the Zn8þ RGC growing axons (empty arrows) and Pax2þ cells in the
limit of the ONH with the retina (arrowheads). (B) Pax2þ/GFAPþ cells (arrows) and GFAPþ Müller cell vitreal processes (empty
arrow). (C, D and E) Some Pax2þ cells are ZO1þ or CKþ (arrows) but negative to GS. GSþ Müller cell vitreal processes (empty
arrow). (F) S100þ cells with long processes (arrows), S100þ cells with small somata (arrowheads) and GFAPþ Müller cell vitreal
processes (empty arrow). (G) S100þ cells with long processes (arrows), S100þ/GSþ cells with small somata (arrowheads) and
GSþ Müller cell vitreal processes (empty arrow). CA: central artery. (H) Scheme of distribution of different glial cells in the
ONH. Scale bars: A: 100 lm; B–G: 50 lm. (For interpretation of the references to color in this figure legend, the reader is
referred to the web version of this article.)

two isoforms: pax2a_tv1 and pax2a_tv2 (Parrilla et al., 2012). chose goldfish pax2a_tv2 transcript variant to analyze its
The majority of the studies in zebrafish that analyze the expression during regeneration.
pax2a expression are carried out with the isoform pax2a_tv2, Using RT-qPCR assays we found a highly significant increase in
which is an ortholog to the rest of vertebrate pax2. Thus, we pax2a_tv2 expression levels from 2 days (d) to 30d post-injury
 brain research 1492 (2013) 18–32
Fig. 2 – Goldfish pax2a_tv2 mRNA differential gene expression.
Fold changes of pax2a_tv2 gene expression in the ONH
during regeneration of optic nerve crush. The highly
significant differences are indicated with two asterisks
(po0.01).
(nnpo0.01) (Fig. 2). The highest increase of gene expression was
reached at 2d (73.05 fold) and 7d post-injury (13.01 fold). From
15d to 30d post-injury the pax2a_tv2 expression levels underwent
the first decrease (15d: 8.22 fold; 21d: 8.38 fold; 30d: 8.27 fold). The
second decrease in gene expression level occurred from 60d to
120d post-injury (60d: 3.67 fold; 90d: 3.44 fold; 120d: 1.60 fold)
when the pax2a_tv2 expression levels are insignificant (p40.05),
although they maintain higher expression levels than those of
controls (1.05 fold) (Fig. 2).
2.3. Pax2þ astrocyte response in the ONH after ON crush
We analyzed the modifications undergone by the different
astrocyte subpopulations in the ONH after ON injury. After 7d
post-injury, we found a highly significant increase in the number
of Pax2þ astrocytes (nnpo0.01) (Fig. 3A), although they had a
similar distribution to that in control animals (Figs. 1A and 3B). In
contrast to control animals, the Zn8 immunolabeling revealed a
high amount of regenerating axons located in the growing edge
close to the CA, but also in mature regions of the ONH (Fig. 3B,C).
Pax2þ astrocytes were longitudinally arranged to the Zn8þ
growing axons from the growing edge (Fig. 3C). Furthermore,
we found a great amount of GFAPþ processes which were
significantly disorganized compared with controls (Figs. 1B, 3D).
In the optic disc the majority of these GFAPþ processes belong to
the Müller cells (description below) (Fig. 3D,E). The Pax2þ/GFAPþ
astrocytes situated in the limit between the ONH and the retina
described in controls (Fig. 1B) (Parrilla et al., 2009) also showed
GFAPþ disorganized processes (Fig. 3E). The ZO1þ immunostain-
ing did not show differences compared with controls (Figs. 1C
and 3F). Nonetheless, we detected Pax2þ/ZO1þ astrocytes in the
limit between the ONH and the retina that extend into the outer
layers of the adjacent retina (Fig. 3F,G). In contrast to the ZO1
expression we found an increase in the Ck labeling compared
with controls, which extends from the optic disc to the posterior
ONH (Figs. 1D and 3H). These Ckþ cells were also positive to
Pax2, although the cytoplasm and nucleus labeling, respectively,
did not overlap (Fig. 3H,I). In contrast to control animals, at 7d
post-injury we found Pax2þ/GSþ astrocytes located among the
RGC axons which were mostly limiting the posterior ONH
21
(Figs. 1E and 3J). On the other hand, S100þ astrocytes did not
show modifications in distribution and immunolabeling com-
pared with controls (Figs. 1F,G, 3K,L). Nonetheless, we did not
detect S100þ cells with small somata, which were previously
described in control animals (Figs. 1F,G and 3K,L).
From 15d to 30d after lesion, the number of Pax2þ astrocytes
decreased to reach control levels (p40.05) (Fig. 3A). With Zn8
immunolabeling we found regenerating axons in the growing
edge close to the CA and in the mature ONH (Fig. 4A). Pax2þ
astrocytes were distributed as in control animals, closely
located to the Zn8þ young axons (Figs. 1A, 4A). Moreover,
similarly to the results obtained at 7d post-lesion, we found a
high amount of GFAPþ processes in the optic disc and mostly
in the limit between the retina and the ONH (Fig. 4B–D ). Some
of these astrocytes were positive to Pax2 (Fig. 4C,D). With ZO1
immunolabeling we did not find differences compared with
control, but the population of Pax2þ/ZO1þ astrocytes that
extended into the retina at 7d post-injury is reduced at 15d
(Fig. 4E,F). The Ck immunostaining decreased, although Pax2þ
astrocytes whose cytoplasm was strongly labeled with Ck were
still detected (Fig. 4G,H). Similar to the 7d post-injury results,
at 15d we still detected Pax2þ/GSþ astrocytes, but they were
mostly located in the glia limitans of the posterior ONH
(Fig. 4I,J). In contrast, S100þ astrocytes maintained their dis-
tribution similar to that of control animals (Figs. 1F,G; 4K, M);
however, we detected a strong S100þ labeling in the glia
limitans of the posterior ONH forming an astrocyte ring which
co-localized with GFAP (Fig. 4K), GS and Pax2 (Fig. 4B,I).
Furthermore, the S100þ cells with small somata were detected
again and showed a distribution and a co-labeling with GS
similar to controls (Figs. 1G, 4K–M ).
From 60d to 120d survival after lesion the number of Pax2þ
astrocytes increased again to a highly significant number
(nnpo0.01) (Fig. 3A). Zn8þ regenerating axons were still
detected in both the growing edge close to the CA together
with Pax2þ astrocytes and the mature ONH (Fig. 4N). At 90d
post-injury, the amount of GFAPþ astrocyte processes
decreased, although the GFAPþ/GSþ astrocyte ring (Fig. 4O,P),
also positive to S100 (data not shown), was still detectable in
the posterior ONH. Moreover, we found Pax2þ/GSþ astrocytes
in the posterior ONH (Fig. 4P). S100þ astrocytes and cells with
small somata showed similar characteristics to control ani-
mals from 60d post-injury onwards (data not shown).
From 180d after injury onwards, the distribution and
number of Pax2þ astrocytes were similar to controls
(p40.05) (Figs. 1 and 2A). Moreover, Zn8þ growing axons were
mostly located in the growing edge with an appearance
similar to that of control animals and GFAP, ZO1, Ck and GS
immunolabeling were similar to controls (data not shown).
During this late regeneration, the appearance and organiza-
tion of the crushed area and the posterior ON was similar to
the control animals (data not shown).
At 7d post-injury we found the GFAPþ/GSþ Müller cell
vitreal processes highly disorganized and not all of them
reached the vitreal surface of the retina (Fig. 3E, I, K,L). In
contrast, from 15d to 90d post-injury, a large amount of these
GFAPþ/GSþ Müller cell vitreal processes were detected, all of
them reaching the vitreal surface of the retina (Fig. 4C, I, K,
O,P). After 180d post-injury, the Müller cells acquired an
appearance similar to that of controls (data not shown).
22 brain research 1492 (2013) 18–32

2.4. ONH astrocyte analysis after ON crush by electron
microscopy
To better analyze the role of the different astrocyte popula-
tions in the ONH after ON crush we performed Pax2-
immunogold labeling at 7d and 21d post-injury. We found
phagocytic cells with the typical features of astrocytes:
euchromatic nuclei, intermediate filaments in their cyto-
plasm and desmosomes in their plasma membrane
(Fig. 5A,B). Some of them showed immunogold labeling
for Pax2 in their nuclei (Fig. 5A), although we also found
Pax2- phagocytic astrocytes (Fig. 5B). Furthermore, these
 brain research 1492 (2013) 18–32 23

phagocytes were distributed in diverse degenerative areas

(Fig. 5A,B).
Forming part of the glia limitans of the posterior ONH, we
found Pax2þ astrocytes, and also Pax2þ cells with a lighter
nucleus and cytoplasm than the surrounding astrocytes,
which are probably Pax2þ astroblasts (Fig. 5C). These Pax2þ
astroblasts were also detected among the RGC axons, show-
ing similar ultrastructural characteristics (Fig. 5D). Moreover,
we found cells that had lost the nuclear envelope, with
apparent chromosomes in a light cytoplasm and doughnut-
shaped mitochondria, which are typical characteristics of
dividing cells (Fig. 5E,F). Some of these cells were also positive
to Pax2 and were located among the RGC axons (Fig. 5E) and
close to the blood vessels (Fig. 5F). Furthermore, similar
results were obtained with animals at 21d post-injury (not
shown).
2.5. Proliferation in the ONH after crush
We analyzed PCNAþ proliferating cells in the ONH after ON
crush during the whole regenerative process. We found an
increase of PCNAþ cells, which was highly significant
(nnpo0.01) from 7d to 60d post-injury. At 90d post-injury,
the number of PCNAþ cells decreased significantly (npo0.05)
and from 120d post-injury onwards the number of proliferat-
ing cells was similar to that of controls (p40.05) (Fig. 6A).
We performed double Pax2-PCNA immunolabeling to try to
elucidate which of these PCNAþ cells were proliferating Pax2þ
astrocytes. From 7d to 90d post-injury we found qualitatively
more Pax2þ/PCNAþ cells than in controls (Fig. 6B,C, E). These
Pax2þ/PCNAþ astroblasts were located close to the CA among the
RGC axons and, interestingly, in the limit of the retina with the
ONH (Fig. 6C–E ). Similar analyses were performed with double
S100-PCNA immunostaining and we found again, qualitatively,
more S100þ/PCNAþ cells than in control animals from 7d to 90d
post-injury (Fig. 6F–I ). Although these cells were mainly located
among the RGC axons, we found some of them in the limit
between the retina and the ONH (Fig. 6F–H ). Even though we
found Pax2þ/PCNAþ and S100þ/PCNAþ cells during regeneration
in the ONH, the majority of the PCNAþ cells were negative to
Pax2 and S100 (Fig. 6C,D,F–H). After 120d post-injury, the PCNA
immunolabeling was similar to that of control animals (data not
shown).
3. Discussion
In the present work we show, for the first time, a substantial
characterization of Pax2þ astrocytes in the goldfish ONH
during ON crush regeneration. It is known that astrocytes
play an important role during regeneration which allows the
fish visual system to completely regenerate, but this does not
occur in mammals (Garcı́a and Koke, 2009). In teleosts the
Pax2þ astrocyte population and pax2a gene expression are
modified in the ONH after a PGZ cryolesion when the
regenerating RGC axons reach the ONH (Parrilla et al., 2012).
After ON crush we also find modifications in the ONH, but the
response is much faster and stronger probably due to the
rapid and massive RGC axon regeneration. Moreover, we
confirm the activation of a group of astroblasts located
between the retina and the ONH after lesion.
All these results taken together suggest that Pax2 plays an
important role in the ONH that is directly related with axon
regeneration and/or the axon guidance processes that occur
as a result of this regenerative process.
3.1. Expression analysis of Pax2a in the goldfish ONH
after ON crush
We demonstrated previously that at least two pax2a isoforms
are expressed in goldfish ON: pax2a_tv1 and pax2a_tv2, the
latter being more similar to other vertebrate pax2 isoforms
(Parrilla et al., 2012). In the present work, we find that
pax2a_tv2 expression levels increase during the first regen-
erative stages from 2d to 30d after ON crush. This coincides
with the massive arrival of regenerating axons to the ONH.
This result is in accordance with our previous studies which
analyzed the modifications in this pax2a_tv2 expression in
the ONH during the regeneration after a PGZ lesion, where
pax2a_tv2 is up-regulated when the young RGC axons reach
the ONH after the PGZ is regenerated (Parrilla et al., 2012).
Thus, we demonstrate that the increase of pax2a expression
is related to the arrival of regenerating RGC axons at the ONH.
Different studies have proposed that pax2 and pax6 genes,
which are involved in visual system development can parti-
cipate in ON regeneration (Cid, 2006; Rodger et al., 2006;
Ziman et al., 2001). Rodger et al., (2006) described a decrease
in Pax6 expression in zebrafish retina. This coincides with the

Fig. 3 – (A) Statistical analysis of Pax2þ cell density in the ONH during regeneration after optic nerve crush. One asterisk
indicates significant differences (0.054p40.01) and two asterisks highly significant differences (po0.01). The error bars
correspond to the standard deviation. N¼ 4 animals per group. (B–L) Modifications of Pax2þ and S100þ cells (red) in the ONH
at 7d after optic nerve crush. Double immunolabeling with Zn8, GFAP, ZO1, Ck, GS (green) and DAPI (blue). (B) Numerous Zn8þ
growing axons are even located far from the growing edge (empty arrows). Square enlarged in C. (C) Pax2þ cells (arrows)
close to Zn8þ new axons in the growing edge (empty arrow). (D) Notable increase of GFAP and Pax2þ/GFAPþ cells in the ONH.
Square enlarged in E. (E) Pax2þ/GFAPþ cells in the limit of the ONH with the retina (arrows) and very disorganized GFAPþ
Müller cell vitreal processes (empty arrows). (F) Numerous Pax2þ/ZO1þ cells. Square enlarged in G. (G) Increase of Pax2þ/ZO1þ
cells in the posterior limit of the retina with the ONH compared to control (arrows). (H) Double labeling Pax2-Ck showing a
strong Ckþ labeling in the Pax2þ glia limitans of the ONH. Square enlarged in I. (I) Pax2þ/Ckþ cells (arrows) in the optic disc.
(J) Numerous Pax2þ/GSþ cells (arrows) appeared at this period post-lesion in the ONH. Disorganized GSþ Müller cell vitreal
processes (empty arrows). (K) S100þ cells with long processes (arrows) and GFAPþ Müller cell vitreal processes (empty
arrows). (L) Double labeling S100-GS shows GSþ Müller cell vitreal processes. No S100þ/GSþ cells are found. CA: central artery.
Scale bars: B, D, F, H, J, K-L: 100 lm; C, E: 50 lm; G, I: 20 lm. (For interpretation of the references to color in this figure legend,
the reader is referred to the web version of this article.)
24 brain research 1492 (2013) 18–32

high expression of pax2a in the goldfish ONH at 7d post- PGZ cryolesion (Cid, 2006). All these results together suggest
injury. In contrast, at 15d-30d post-crush, Pax6 expression that mechanisms of reciprocal inhibition between Pax2 and
increases (Rodger et al., 2006) and the pax2a gene expression Pax6 may be taking place during ON regeneration in a similar
level decreases. Similar results were obtained in goldfish after way to the processes happening during visual system
 brain research 1492 (2013) 18–32 25

development (Macdonald and Wilson, 1996; Macdonald et al.,
1997; Schwarz et al., 2000; Torres et al., 1996). Therefore, while
the increase of pax2a expression can be related to the
spontaneous RGC regeneration and their reorganization and
packaging during the first days of regeneration (Matsukawa
et al., 2004a), the late increase of Pax6 expression seems to be
related with the RGC axon arrival at the optic tectum and the
formation and refinement of the synaptic connections
(Matsukawa et al., 2004a; Rodger et al., 2006).
During visual system development retinoic acid (RA) is an
activator of Pax2 expression and the axon-guidance molecule
netrin1 is a target of Pax2 (Goode and Elgar, 2009; Macdonald
et al., 1997). Different studies using the fish ON crush as a
model demonstrate that the synthesis of RA and the expres-
sion of netrin1 are modified. The group of Matsukawa
reported that the purpurin protein is secreted by the photo-
receptors and taken by the RGC increasing the synthesis of
RA promoting their axonal growth during the first days of ON
regeneration (Matsukawa et al., 2004b; Nagashima et al., 2009;
Tanaka et al., 2007). On the other hand, Petrausch et al., (2000)
described modifications in netrin1 expression in the goldfish
retina after ON lesion. Our results show that pax2a gene
expression levels in goldfish ONH is up-regulated during the
first days of ON regeneration. We suggest that mechanisms
similar to those taking place during the development of the
visual system may be operating in regeneration processes.
Therefore, after fish ON crush the newly synthesized RA
could activate pax2 transcription and the generated Pax2
protein could promote the expression of netrin1.
3.2. Modifications in the ONH Pax2þ astrocyte population
during ON regeneration
Although we do not find modifications in the distribution of
Pax2þ astrocytes in the ONH after ON crush, we demonstrate
an increase in the number of these cells and in the expres-
sion of GFAP, Ck and GS.
The increase of the number of Pax2þ astrocytes 7d after
injury coincides with the arrival of regenerating RGC axons at
the ONH. The increase of pax2a gene expression level, sup-
ports the hypothesis that Pax2þ astrocytes actively participate
in the guidance of the regenerating RGC axons their reorgani-
zation and packaging (Garcı́a and Koke, 2009; Matsukawa
et al., 2004a). The increase in the number of Pax2þ astrocytes
and the pax2a gene expression level in the ONH has only been
described when the regenerating RGC axons reach the ONH
after 21d post-PGZ cryolesion (Parrilla et al., 2012). However,
we cannot discard that this increase of Pax2þ astrocytes can be
related with the classical astroglial reaction after an injury,
widely described in mammals (Garcı́a and Koke, 2009). At 60d
post-injury, there is a second increase in the number of Pax2þ
astrocytes that coincides with the decrease in pax2a gene
expression level. This contradictory result suggests that the
increase of pax2a gene expression level after 2–7d post-injury
is not only due to the high number of Pax2þ astrocytes, but
also to an increase in pax2a gene expression in each astrocyte.
Previous studies demonstrate that between 60 and 120d after
ON crush the axons re-myelinizate as well as refine their
connections in the optic tectum (Matsukawa et al., 2004a).
During this period the second peak of Pax2þ astrocytes occurs.
It is known that astrocytes participate in axon packing and the
recovery of the original organization after injury (Garcı́a and
Koke, 2009; Jimeno et al., 1999; Lillo et al., 2002; Mack and
Wolburg, 2006). Thus, we suggest that the second increase of
Pax2þ astrocytes in the ONH may be related to this axon
re-myelination and packing followed by the refinement of
their connections in the optic tectum (Garcı́a and Koke, 2009;
Matsukawa et al., 2004a).
With immunogold labeling we demonstrate that not all
astrocytes are positive to Pax2 as occurs in controls (Parrilla
et al., 2009). Furthermore, we show that both kinds of astro-
cytes (Pax2þ and Pax2) phagocyte the cell debris promoting a
fast regeneration (Colavincenzo and Levine, 2000; Nona, 1998).
In contrast to control animals (Parrilla et al., 2009) some
ONH Pax2þ cells express GS after ON crush. During regenera-
tion a wide glial variability has been described in the ON,
where numerous cells have ultrastructural features of both
astrocytes and oligodendrocytes (Lillo et al., 2001; Sivron and
Schwartz, 1995). It is possible that Pax2þ/GSþ cells correspond
to these intermediate cells due to the fact that optic nerve
oligodendrocytes can express GS (Domercq et al., 1999;
Parrilla et al., 2009). Nevertheless, we cannot discard the idea
that they may belong to the non-astrocytic inner retinal glia-
like cells described by Fischer et al. (2010). On the other hand,
after an injury, RGC release high amounts of glutamate to the
extracellular matrix (Vardimon, 2000). The GS protects the ON
from the neuronal degeneration transforming the glutamate
into glutamine (Vardimon, 2000). Thus, the increase in GS

Fig. 4 – Variations of Pax2þ and S100þ cells (red) in the ONH at 15–21d and 90d after optic nerve crush. Double
immunolabeling with Zn8, GFAP, ZO1, Ck, GS (green) and DAPI (blue). (A) Pax2þ cells (arrows) close to Zn8þ growing
axons (empty arrows). (B) Double labeling Pax2-GFAP showing a strong GFAPþ labeling in the Pax2þ glia limitans (arrows).
Squares enlarged in C and D. (C) Pax2þ/GFAPþ cells (arrows) and GFAPþ Müller cell vitreal processes in the optic disc (empty
arrows). (D) Pax2þ/GFAPþ cells (arrows) located in the glia limitans. (E) Numerous Pax2þ/ZO1þ cells principally located in the
limit of the optic disc. Square enlarged in F. (F) Pax2þ/ZO1þ cells (arrows) in the limit between the ONH and the retina.
(G) Double labeling Pax2-Ck. Fainter Ck labeling than at 7d post-crush. Square enlarged in H. (H) Pax2þ/Ckþ (arrows) cells in
the optic disc. (I) Pax2þ/GSþ cells (arrows) in the glia limitans. Square enlarged in J. (J) Detail of Pax2þ/GSþ cells (arrows).
(K) S100þ/GFAPþ cells in the glia limitans (arrows) with a stronger labeling than at 7d post-crush. Square enlarged in L. (L)
S100þ cells (arrowheads) with small somata in the optic disc. (M) S100þ/GSþ cells (arrowheads) with small somata appear
again at 15d after ON crush (N) Zn8þ growing axons (empty arrows) and Pax2þ cells (arrows) in the growing edge at 90d post-
injury. (O) GFAPþ processes in the limit of the ONH with the retina (arrow) and GFAPþ Müller cell vitreal processes (empty
arrows). (P) GSþ processes in the limit of the ONH with the retina (arrow), GSþ Müller cell vitreal processes (empty arrows) and
Pax2þ/GSþ cells (empty arrowheads). CA: central artery. Scale bars: A-B, E, G, I, K, M–P: 100 lm; C: 50 lm; D, F, H, J, L: 20 lm.
(For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
26 brain research 1492 (2013) 18–32

Fig. 5 – Pax2 immunogold labeling (circles) in the ONH at 7d post-injury. (A) Phagocytic Pax2þ astrocyte surrounded by
degenerating tissue (empty arrows). (B) Phagocytic Pax2 astrocyte with desmosomes (arrowheads). (C) Pax2þ astrocytes
with dark (As1) and light nuclei (As2) in the glia limitans. (D) Immature Pax2þ cell with desmosomes (arrowheads). (E) Mitotic
Pax2þ cell. (F) Mitotic Pax2þ cell close to a blood vessel. As: astrocyte; bv: blood vessel; ch: chromosomes; f: intermediate
filaments; In: indentations; BL: basal lamina; mit: mitochondria; Nuc: nucleolus; P: phagosome; V: vesicle. Scale bars: A–D:
1000 nm; E,F: 2500 nm.

expression is necessary to control the glutamate toxicity and In contrast to Pax2 protein S100 protein is expressed by
protect the tissue from cell death (Eddleston and Mucke, astrocytes and oligodendrocyte cells in fish ON (Nona et al.,
1993). This has also been described in mouse (Politis and 2000; Velasco et al., 1997). Our results in control animals
Miller, 1985) and lizard (Romero-Aleman et al., 2010). suggests that Pax2þ and S100þ astrocytes form different
 brain research 1492 (2013) 18–32
subpopulations in fish ONH (Lillo et al., 2002; Parrilla et al.,
2009). Our results and others show that the ONH S100þ
astrocyte population does not undergo modifications after
ON crush (Vecino et al., 1997), while the Pax2þ astrocytes
react strongly, supporting the idea that they are two astrocyte
populations. This S100þ astrocyte behavior in the ONH after
ON crush differs from that following PGZ cryolesion, when
there is a strong reaction after the injury (Jimeno et al., 1999;
Parrilla et al., 2012). This can be explained by the different
kind of injury. During PGZ cryolesion the peripheral ganglion
cell soma is removed with their consequent axon degenera-
tion (Parrilla et al., 2012); in ON crushed animals, the ganglion
cell soma remains intact (Garcı́a and Koke, 2009; Rodger et al.,
2006). Thus, astrocytes have to face, in the beginning, a
degenerative process in the first case similar to mammals
and a fast regenerative process in the second case (Garcı́a and
Koke, 2009). This suggests that while S100þ astrocytes react in
the same way as the classical glial reaction in mammals,
Pax2þ astrocytes are reacting more in accordance with the
regenerative and axon guidance processes (Parrilla et al.,
2012).
GFAP expression is a typical characteristic of reactive
astrocytes after injury in mammals (Garcı́a and Koke, 2009)
and has been previously described in teleost ON after crush
(Stafford et al., 1990). On the other hand, the maintenance of
keratin expression in the ON during fish adulthood seems to
be related to the continuous growth and regeneration pro-
cesses due to the fact that they confer immature character-
istics to the astrocytes and plasticity to the system (Druger
et al., 1992, 1994; Giordano et al., 1989, 1990; Maggs and
Scholes, 1990). Our results also show an increase of GFAP and
Ck immunolabeling in the goldfish ONH after ON crush
supporting the observations from these previous studies.
Finally, we detect a strong reaction of astrocytes surround-
ing the posterior ONH after ON crush which are positive to
Pax2, GFAP, S100, GS and ZO1. This astrocyte ring has only
been described previously in the ONH after PGZ cryolesion
(Parrilla et al., 2012) and is located in a similar region to the
lamina cribosa in birds and mammals (Dávila et al., 1987;
Fujita et al., 2000). GFAP and Ck are structural proteins that
confer rigidity and protection to the RGC axons (Giordano
et al., 1989; Lillo et al., 2002; Maggs and Scholes, 1990; Triviño
et al., 1996) and form part of the fish ONH glia limitans (Lillo
et al., 2002; Parrilla et al., 2009).
3.3. Proliferation in the ONH after ON crush
We find an increase in proliferating cells in the ONH similar
to that described in the ON after crush (Nona, 1995) or in the
ONH after PGZ cryolesion (Jimeno et al., 1999; Parrilla et al.,
2012). There is a qualitative increase in Pax2þ/PCNAþ cells
during regeneration. This increase remains high even after
30d post-injury when the number of Pax2þ cells is similar to
controls (Fig. 6E). This could be due to the fact that the
amount of non-proliferative Pax2þ cells is lower while the
Pax2þ/PCNAþ cells remains high. On the other hand, this
visible amount of Pax2þ/PCNAþ cells at 30d (Fig. 6E) post-
crush and the next regenerative stages 60–90d (not shown)
could constitute the source of the high increase of Pax2þ cell
numbers during the second peak after 60d post-injury.
27
With immunogold labeling we support our results that they
are dividing immature astrocytes. Pax2þ/PCNAþ astroblasts and
Pax2þ immunogold labeled astroblasts are mostly located in the
limit of the retina with the ONH, although we can also detect
them distributed among the RGC axons and close to the CA.
Similar results were obtained in the ONH after PGZ cryolesion
with regard to the S100þ/PCNAþ cells (Parrilla et al., 2012). This
particular source of astroblasts has been described in the
development of the mammal visual system (Chan-Ling et al.,
2009; Chu et al., 2001), suggesting that in teleosts not only is this
maintained during adulthood (Parrilla et al., 2009), but is also
activated during regeneration (Parrilla et al., 2012).
It is known that during the development of the visual system
Pax2 has a triple function in the cells that are expressing this
factor: (1) Promote their survival (Mi and Barres, 1999; Torban
et al., 2000), (2) assure their astrocytic identity (Macdonald et al.,
1997; Soukkarieh et al., 2007; Stanke et al., 2010; Torres et al.,
1996) and (3) avoid their differentiation into pigmented cells
(Macdonald et al., 1997; Torres et al., 1996). We think that all
these Pax2 functions may be necessary to maintain due to high
proliferation during regeneration. Finally, the majority of the
proliferative cells in the ONH negative to Pax2 and S100 are
probably microglial cells and macrophages whose presence
have been widely reported in teleost ONH during regeneration
(Jimeno et al., 1999).
4. Experimental procedures
4.1. Animals
In this work we employed 77 adult goldfish (Carassius aur-
atus), 8–12 cm in body length obtained from commercial
suppliers. All animals were kept in aquaria at 1871 1C in a
12 h light/dark cycle and, previous to any analysis, they were
anesthetized with 0.03% tricaine methane sulfonate diluted
in water (MS-222; SIGMA, St. Louis, MO).
All procedures used in this work were in accordance
with the guidelines of the European communities Council
Directive (86/609/EEC and 2003/65/EC) and current Spanish
legislation for the use and care of animals (RD 1201/2005).
4.2. Optic nerve crush
The ON crush was carried out on 68 goldfish as previously
described (Velasco et al., 1997). The fish were sacrificed at
survival times of 2, 7, 15, 21, 30, 60, 90, 120, 180 and 210 days
(d) post-injury.
4.3. Immunohistochemistry
For the immunohistochemistry (IHC) experiments the ani-
mals were perfused transcardially with an NaCl solution
followed by 4% paraformaldehyde and 0.2% picric acid in
phosphate buffer 0.1 M, pH 7.4 (PB). The eyes were dissected
out and post-fixed for 2 h at room temperature (RT) in the
same fixative solution. They were later cryoprotected in 50%
sucrose, embedded in OCT and cut in sections 14 mm thick on
a cryostat.
28 brain research 1492 (2013) 18–32

After washes with phosphate-buffered saline 0.1 M pH 7.4 quenched with 2.5 g/l NaBH4 (Sigma) in PBS. The immunola-
with 0.02% Triton Tx-100 (PBS–Tx), sections were post-fixed beling protocol was carried out as described in (Parrilla et al.,
with 100% methanol for 5 min and auto-fluorescence was 2009) and the concentration of each antibody used in this
 brain research 1492 (2013) 18–32 29

Table 1 – Antibodies used for immunohistochemistry assays.

Antigen Antiserum Source Catalog number Dilution

Cytokeratin Anti-IgG mouse Sigma C2562 1:100

GFAP Anti-IgG mouse Sigma G6171 1:400
GS Anti-IgG mouse Chemicon MAB302 1:1000
Pax2 Anti-IgG rabbit Covance PRB-276P 1:900 (for fluorescence) 1:200 (for electron microscopy)
PCNA Anti-IgG mouse Santa Cruz Biotech. Sc-56 1:500
S100 Anti-IgG rabbit Dako Z0311 1:1500
Zn8 Anti-IgG mouse Hybridoma Bank 1:300
ZO1 Anti-IgG mouse Invitrogen 33-9100 1:100

study is described in Table 1. Sections were mounted with an
anti-fading mixture (Parrilla et al., 2009).
For the statistical analysis of the ONH we counted cells
from 2 to 6 slides randomly selected from four control and
injured animals of each survival time analyzed (2–210d). We
counted all labeled cells from the area located between the
two edges of the neural retina near the ONH excluding the CA
(Parrilla et al., 2009). All cell counts were performed with
ImageJ software (http://rsb.info.nih.gov/ij/index.html). The
statistical analysis was performed using ANOVA and the
subsequent post hoc Dunnett’s t-test to compare animals of
different survival time with control ones.
4.4. Immunogold labeling
The animals were transcardially perfused with NaCl solution
followed by 4% paraformaldehyde, 0.2% picric acid and 0.25%
glutaraldehyde in PB. The ONH were dissected out and post-
fixed with 4% paraformaldehyde and 0.25% glutaraldehyde in
PB for 2 h at RT. After washes in PB ONH were cryoprotected
in 25% sucrose and 10% glycerol in PB, frozen and thawed
three times and washed with PB. Immunolabeling was
performed as described by Parrilla et al. (2009). The concen-
tration of the polyclonal anti-Pax2 antibody is described in
Table 1 and the ultra-small gold-conjugated goat anti-rabbit
secondary antibody (Aurion, NL) was diluted at 1:100. After-
wards ONH were dehydrated at 4 1C and flat-embedded in
Epon 12 resin (EMS). Finally, ultrathin sections were stained
with 2% aqueous uranyl acetate and lead citrate.
4.5. Photomicrographs
Some of the light microscopy images were obtained with an
Olympus Apogee digital camera coupled to an Olympus AX-
70 photomicroscope. The rest of the fluorescent images were
obtained with a laser scanning spectral confocal microscope
(Leica TCS SP2). The ultrathin sections were observed in a
Zeiss EM900 electron microscope and pictures were taken
with a digital camera connected to the microscope using the
ImageSP software. Original pictures were further processed
with Adobe Photoshop CS4 software improving the bright-
ness and contrast.
4.6. Isolation of RNA, RT-PCR and quantitative reverse
transcription real time PCR
ONH from 27 control and injured animals from 2-120d
survival times were mechanically homogenized separately.
Each sample of total RNA was extracted in accordance with
the RNeasys Mini Kit protocol (Qiagen) and purified from
TM
genomic DNA with TURBO DNA-free Kit (Applied Biosys-
tems). The quantification of RNA and posterior cDNA was
carried out using a nanoPhotometer (Implen GmbH).
Total RNA, primed with random primers, was reverse-
transcribed into cDNA using the first-strand cDNA synthesis
kit (ImProm-II Reverse-Transcriptase System; Promega) in
accordance with the manufacturer’s instructions. An RNA-free
(negative) control sample was used in these experiments. The
resulting cDNA was diluted and stored for use in quantitative
reverse transcription real time PCR (RT-qPCR) assays.
The EF1a endogenous gene was used as the housekeeping
gene (Tang et al., 2007). The primers to quantify pax2a_tv2
gene expression and the housekeeping gene were taken from
our previous paper (Table 2) (Parrilla et al., 2012).
RT-qPCRs were performed using the SYBR-Green method, with
a 2X Master Mix (Applied Biosystems), which includes SYBR-
Green dye, dNTPs, passive reference (ROX) and AmpliTaq1 Gold
DNA polymerase. Each reaction contained 10 ml of Master Mix,
0.4 ml of each primer (Table 2), 1–3 ml of cDNA in a different serial
total cDNA quantity for each gene and MilliQ water up to 20 ml.
A standard curve was constructed for each gene and each
experiment. The amplification reaction took place in an ABI

Fig. 6 – Analysis of the proliferation in the ONH during optic nerve crush regeneration using double immunolabeling for Pax2
or S100 (red) with PCNA (green). (A) Statistical analysis of PCNAþ cell density in the ONH during regeneration after optic nerve
crush. One asterisk indicates significant differences (0.054p40.01) and two asterisks highly significant differences
(po0.01). The error bars correspond to the standard deviation. N ¼4 animals per group. (B) Double Pax2-PCNA labeling in
control animals. (C) Increase of Pax2þ/PCNAþ cells (arrows) at 7d after ON crush. Square enlarged in D. (D) Detail of Pax2þ/
PCNAþ cells (arrows). (E) Numerous Pax2þ/PCNAþ cells (arrows) at 30d post-lesion. (F) S100þ/PCNAþ cells (arrows) in control
animals. (G) Similar amount of the S100þ/PCNAþ cells (arrows) at 7d post-crush and in controls. (H) The amount of the S100þ/
PCNAþ cells (arrows) at 15d post-lesion is similar to controls. The asterisk indicates a similar region enlarged in I. (I) Detail of
an S100þ/PCNAþ cell. CA: central artery. Scale bars: B,C, E–H: 100 lm; D, I: 10 lm. (For interpretation of the references to color
in this figure legend, the reader is referred to the web version of this article.)
30 brain research 1492 (2013) 18–32
Table 2 – Primers used in PCR assays.
Target Genebank number
Pax2a_tv2
EF1a http://AB056104.1
18s rRNA http://EF189737
Prism 7300 detection system (Applied Biosystems) in the follow-
ing conditions: 10 min at 95 1C followed by 40 cycles of 15 s at
95 1C and 1 min at 60–63 1C depending on each pair of primers
and the results were analyzed using the Dissociation Curve
program (Applied Biosystems). The melting point curves were
included to confirm that only one product was formed. Three
PCR reactions were performed for each sample per plate and
each experiment was repeated at least twice.
The comparative threshold cycle (Ct) method was used for
presenting quantitative data (Schmittgen and Livak, 2008).
Following the removal of outliers, raw fluorescence data were
used to determine the PCR amplification efficiency (E) accord-
ing to the formula E¼[10(1/slope)1]  100. All amplifications
had an E value of 100710%, the E value close to 100% being an
indicator of efficient amplification. The relative gene expres-
sion value (‘‘fold change’’) for each transcript was calculated
according to the equation E(DCt ‘‘condition 1’’ - DCt ‘‘condition 2’’),
where ‘‘condition 1’’ corresponds to experimental samples
(1–90d), ‘‘condition 2’’ to samples of control animals, and DCt
of each ‘‘condition’’ is Ct ‘‘experimental gene’’–Ct ‘‘endogenous gene’’
(Livak and Schmittgen, 2001; Schmittgen and Livak, 2008).
A standard error for each relative gene expression value was
calculated as a measure of data variation. One-way ANOVA
and the Dunnett’s t-test were applied to establish the statis-
tical significance of differences.
Acknowledgments
We thank Dr. D. Jimeno for the confocal microscope assis-
tance, Ms. M. Sánchez for technical assistance and Mr. G.H.
Jenkins for revising the English version of the manuscript. We
acknowledge the support of the MICINN (BFU-2009-11179)
and Junta de Castilla y León SAN.
references
Becker, C.G., Becker, T., 2007. Growth and pathfinding of regener-
ating axons in the optic projection of adult fish. J. Neurosci.
Res. 85, 2793–2799.
Becker, C.G., Becker, T., 2008. Adult zebrafish as a model for
successful central nervous system regeneration. Restor. Neu-
rol. Neurosci. 26, 71–80.
Boije, H., Ring, H., Lopez-Gallardo, M., Prada, C., Hallbook, F., 2010.
Pax2 is expressed in a subpopulation of Muller cells in the
central chick retina. Dev. Dyn. 239, 1858–1866.
Bunt, S.M., 1982. Retinotopic and temporal organization of the
optic nerve and tracts in the adult goldfish. J. Comp. Neurol.
206, 209–226.
Primer sequence 50 –30 Gene position
F: CCCGTGGGGTCCTACTCTAT 100–119
R: AGCCATCTGAACCATCATCA 171–190
F: ATGGTGACAACATGCTGGAG 625–644
R: TCCAGGGCATCAAGAAGAGT 714–733
F: ATGGCCGTTCTTAGTTGGTG 991
R: AACGCCACTTGTCCCTCTAA 1118
Casañas, M.N., Santos, E., Yanes, C., Romero-Alemán, M.M.,
Viñoly, R., Alfayate, M.C., Monzón-Mayor, M., 2011. Develop-
ment of astroglia heterogeneously expressing Pax2, vimentin
and GFAP during the ontogeny of the optic pathway of the
lizard (Gallotia galloti): an immunohistochemical and ultra-
structural study. Cell Tissue Res. 345, 295–311.
Chan-Ling, T., Chu, Y., Baxter, L., Weible, Ii, M., Hughes, S., 2009.
In vivo characterization of astrocyte precursor cells (APCs) and
astrocytes in developing rat retinae: differentiation, prolifera-
tion, and apoptosis. Glia 57, 39–53.
Chu, Y., Hughes, S., Chan-Ling, T., 2001. Differentiation and migration
of astrocyte precursor cells and astrocytes in human fetal retina:
relevance to optic nerve coloboma. FASEB J 15, 2013–2015.
Cid, E., 2006. Participación de las poblaciones proliferativas y de
factores de transcripción en el crecimiento continuado
y la regeneración del sistema visual de teleósteos. Doctoral
Thesis, Universidad de Salamanca.
Clemente, D., Porteros, A., Arenzana, F.J., Aijon, J., Parrilla, M.,
Santos-Ledo, A., Arevalo, R., 2008. Characterization of NADPH-
diaphorase-positive glial cells of the tench optic nerve after
axotomy. Arch. Ital. Biol. 146, 35–52.
Colavincenzo, J., Levine, R.L., 2000. Myelin debris clearance during
Wallerian degeneration in the goldfish visual system. J. Neu-
rosci. Res. 59, 47–62.
Dávila, J.C., Guirado, S., de la Calle, A., Marı́n-Girón, F., 1987. The
intra-ocular portion of the optic nerve in the turtle Mauremys
caspica. J. Anat. 151, 189–198.
Domercq, M., Sanchez-Gomez, M.V., Areso, P., Matute, C., 1999.
Expression of glutamate transporters in rat optic nerve oligo-
dendrocytes. Eur. J. Neurosci. 11, 2226–2236.
Druger, R.K., Levine, E.M., Glasgow, E., Jones, P.S., Schechter, N.,
1992. Cloning of a type I keratin from goldfish optic nerve:
differential expression of keratins during regeneration. Differ-
entiation 52, 33–43.
Druger, R.K., Glasgow, E., Fuchs, C., Levine, E.M., Matthews, J.P.,
Park, C.Y., Schechter, N., 1994. Complex expression of keratins
in goldfish optic nerve. J. Comp. Neurol. 340, 269–280.
Easter Jr., S.S., Rusoff, A.C., Kish, P.E., 1981. The growth and
organization of the optic nerve and tract in juvenile and adult
goldfish. J. Neurosci. 1, 793–811.
Eddleston, M., Mucke, L., 1993. Molecular profile of reactive
astrocytes—implications for their role in neurologic disease.
Neuroscience 54, 15–36.
Fischer, A.J., Zelinka, C., Scott, M.A., 2010. Heterogeneity of glia in
the retina and optic nerve of birds and mammals. PLoS One 5,
e10774.
Fujita, Y., Imagawa, T., Uehara, M., 2000. Comparative study of the
lamina cribrosa and the pial septa in the vertebrate optic
nerve and their relationship to the myelinated axons. Tissue
Cell 32, 293–301.
Garcı́a, D.M., Koke, J.R., 2009. Astrocytes as gate-keepers in optic
nerve regeneration—a mini-review. Comp. Biochem. Physiol.
A Mol. Integr. Physiol. 152, 135–138.
Giordano, S., Glasgow, E., Tesser, P., Schechter, N., 1989. A type II
keratin is expressed in glial cells of the goldfish visual path-
way. Neuron 2, 1507–1516.
 brain research 1492 (2013) 18–32
Giordano, S., Hall, C., Quitschke, W., Glasgow, E., Schechter, N.,
1990. Keratin 8 of simple epithelia is expressed in glia of the
goldfish nervous system. Differentiation 44, 163–172.
Goode, D.K., Elgar, G., 2009. The PAX258 gene subfamily: a
comparative perspective. Dev. Dyn. 238, 2951–2974.
Hitchcock, P.F., Raymond, P.A., 2004. The teleost retina as a model
for developmental and regeneration biology. Zebrafish 1,
257–271.
Jimeno, D., Velasco, A., Lillo, C., Lara, J.M., Aijón, J., 1999. Response
of microglial cells after a cryolesion in the peripheral prolif-
erative retina of tench. Brain Res. 816, 175–189.
Johns, P.R., Easter Jr., S.S., 1977. Growth of the adult goldfish eye. II.
Increase in retinal cell number. J. Comp. Neurol. 176, 331–341.
Kolb, H., Fernández, E., Nelson, R., 2000. Webvision.
Lillo, C., Velasco, A., Jimeno, D., Cid, E., Aijón, J., Lara, J.M., 2001.
Non-neuronal cells involved in the degeneration and regen-
eration of the fish retina. J. Neurocytol. 30, 475–491.
Lillo, C., Velasco, A., Jimeno, D., Cid, E., Lara, J.M., Aijón, J., 2002.
The glial design of a teleost optic nerve head supporting
continuous growth. J Histochem Cytochem. 50, 1289–1302.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the 2
(-Delta Delta C(T)) Method. Methods 25, 402–408.
Macdonald, R., Wilson, S.W., 1996. Pax proteins and eye development.
Curr. Opin. Neurobiol. 6, 49–56.
Macdonald, R., Scholes, J., Strahle, U., Brennan, C., Holder, N.,
Brand, M., Wilson, S.W., 1997. The Pax protein Noi is required
for commissural axon pathway formation in the rostral
forebrain. Development 124, 2397–2408.
Mack, A.F., Wolburg, H., 2006. Growing axons in fish optic nerve
are accompanied by astrocytes interconnected by tight junc-
tions. Brain Res. 1103, 25–31.
Maggs, A., Scholes, J., 1990. Reticular astrocytes in the fish optic
nerve: macroglia with epithelial characteristics form an axi-
ally repeated lacework pattern, to which nodes of Ranvier are
apposed. J. Neurosci 10, 1600–1614.
Matsukawa, T., Arai, K., Koriyama, Y., Liu, Z., Kato, S., 2004a.
Axonal regeneration of fish optic nerve after injury. Biol.
Pharm. Bull. 27, 445–451.
Matsukawa, T., Sugitani, K., Mawatari, K., Koriyama, Y., Liu, Z.,
Tanaka, M., Kato, S., 2004b. Role of purpurin as a retinol-
binding protein in goldfish retina during the early stage of
optic nerve regeneration: its priming action on neurite out-
growth. J. Neurosci. 24, 8346–8353.
Mi, H., Barres, B.A., 1999. Purification and characterization of
astrocyte precursor cells in the developing rat optic nerve. J.
Neurosci. 19, 1049–1061.
Morcillo, J., Martinez-Morales, J.R., Trousse, F., Fermin, Y.,
Sowden, J.C., Bovolenta, P., 2006. Proper patterning of the optic
fissure requires the sequential activity of BMP7 and SHH.
Development 133, 3179–3190.
Nagashima, M., Sakurai, H., Mawatari, K., Koriyama, Y., Matsu-
kawa, T., Kato, S., 2009. Involvement of retinoic acid signaling
in goldfish optic nerve regeneration. Neurochem. Int. 54,
229–236.
Nona, S., 1995. Regeneration in the Goldfish Visual System.
Nona, S.N., 1998. Invited review: repair in goldfish central nervous
system. Restor. Neurol. Neurosci. 12, 1–11.
Nona, S.N., Thomlinson, A.M., Bartlett, C.A., Scholes, J., 2000.
Schwann cells in the regenerating fish optic nerve: evidence
that CNS axons, not the glia, determine when myelin forma-
tion begins. J. Neurocytol. 29, 285–300.
Oster, S.F., Deiner, M., Birgbauer, E., Sretavan, D.W., 2004. Ganglion
cell axon pathfinding in the retina and optic nerve. Semin.
Cell Dev. Biol. 15, 125–136.
Otteson, D.C., Shelden, E., Jones, J.M., Kameoka, J., Hitchcock, P.F.,
1998. Pax2 expression and retinal morphogenesis in the
normal and Krd mouse. Dev. Biol. 193, 209–224.
31
Parrilla, M., Lillo, C., Herrero-Turrión, M.J., Arévalo, R., Lara, J.M.,
Aijón, J., Velasco, A., 2009. Pax2 in the optic nerve of the
goldfish, a model of continuous growth. Brain Res. 1255, 75–88.
Parrilla, M., Lillo, C., Herrero-Turrion, M.J., Arevalo, R., Aijon, J.,
Lara, J.M., Velasco, A., 2012. Characterization of Pax2 expres-
sion in the goldfish optic nerve head during retina regenera-
tion. PLoS One 7, e32348.
Petrausch, B., Jung, M., Leppert, C.A., Stuermer, C.A., 2000. Lesion-
induced regulation of netrin receptors and modification of
netrin-1 expression in the retina of fish and grafted rats. Mol.
Cell Neurosci 16, 350–364.
Pfeffer, P.L., Gerster, T., Lun, K., Brand, M., Busslinger, M., 1998.
Characterization of three novel members of the zebrafish
Pax2/5/8 family: dependency of Pax5 and Pax8 expression on
the Pax2.1 (noi) function. Development 125, 3063–3074.
Politis, M.J., Miller, J.E., 1985. Post-traumatic alterations in gluta-
mine synthetase activity in peripheral and central nerves.
Brain Res. 359, 183–186.
Quesada, A., Prada, F.A., Aguilera, Y., Espinar, A., Carmona, A.,
Prada, C., 2004. Peripapillary glial cells in the chick retina: a
special glial cell type expressing astrocyte, radial glia, neuron,
and oligodendrocyte markers throughout development. Glia
46, 346–355.
Rodger, J., King, C.E., Lukehurst, S., Chen, P.B., Dunlop, S.A.,
Beazley, L.D., Ziman, M.R., 2006. Changing Pax6 expression
correlates with axon outgrowth and restoration of topography
during optic nerve regeneration. Neuroscience 142, 1043–1054.
Romero-Aleman, M.M., Monzon-Mayor, M., Santos, E., Yanes, C.,
2010. Expression of neuronal markers, synaptic proteins, and
glutamine synthetase in the control and regenerating lizard
visual system. J. Comp. Neurol. 518, 4067–4087.
Sanyanusin, P., Schimmenti, L.A., McNoe, L.A., Ward, T.A.,
Pierpont, M.E., Sullivan, M.J., Dobyns, W.B., Eccles, M.R., 1995.
Mutation of the PAX2 gene in a family with optic nerve
colobomas, renal anomalies and vesicoureteral reflux. Nat.
Genet. 9, 358–364.
Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data
by the comparative C(T) method. Nat. Protoc. 3, 1101–1108.
Schuck, J., Gerhardt, H., Wolburg, H., 2000. The peripapillary glia
of the optic nerve head in the chicken retina. Anat. Rec. 259,
263–275.
Schwarz, M., Cecconi, F., Bernier, G., Andrejewski, N., Kammandel, B.,
Wagner, M., Gruss, P., 2000. Spatial specification of mammalian
eye territories by reciprocal transcriptional repression of Pax2 and
Pax6. Development 127, 4325–4334.
Sivron, T., Schwartz, M., 1995. Glial cell types, lineages, and
response to injury in rat and fish: implications for regenera-
tion. Glia 13, 157–165.
Soukkarieh, C., Agius, E., Soula, C., Cochard, P., 2007. Pax2
regulates neuronal-glial cell fate choice in the embryonic
optic nerve. Dev Biol. 303, 800–813.
Stafford, C.A., Shehab, S.A., Nona, S.N., Cronly-Dillon, J.R., 1990.
Expression of glial fibrillary acidic protein (GFAP) in goldfish
optic nerve following injury. Glia 3, 33–42.
Stanke, J., Moose, H.E., El-Hodiri, H.M., Fischer, A.J., 2010. Com-
parative study of Pax2 expression in glial cells in the retina
and optic nerve of birds and mammals. J. Comp. Neurol. 518,
2316–2333.
Stuermer, C.A., Bastmeyer, M., 2000. The retinal axon’s pathfinding
to the optic disk. Prog. Neurobiol. 62, 197–214.
Tanaka, M., Murayama, D., Nagashima, M., Higashi, T., Mawatari, K.,
Matsukawa, T., Kato, S., 2007. Purpurin expression in the
zebrafish retina during early development and after optic
nerve lesion in adults. Brain Res. 1153, 34–42.
Tang, R., Dodd, A., Lai, D., McNabb, W.C., Love, D.R., 2007.
Validation of zebrafish (Danio rerio) reference genes for quan-
titative real-time RT-PCR normalization. Acta Biochim. Bio-
phys. Sin (Shanghai) 39, 384–390.
32 brain research 1492 (2013) 18–32
Torban, E., Eccles, M.R., Favor, J., Goodyer, P.R., 2000. PAX2
suppresses apoptosis in renal collecting duct cells. Am. J.
Pathol. 157, 833–842.
Torres, M., Gomez-Pardo, E., Gruss, P., 1996. Pax2 contributes to inner
ear patterning and optic nerve trajectory. Development 122,
3381–3391.
Triviño, A., Ramirez, J.M., Salazar, J.J., Ramirez, A.I., Garcia-
Sanchez, J., 1996. Immunohistochemical study of human optic
nerve head astroglia. Vision Res. 36, 2015–2028.
Vardimon, L., 2000. Neuroprotection by glutamine synthetase. Isr.
Med. Assoc. J. (Suppl. 2), S46–S51.
Vecino, E., Velasco, A., Caminos, E., Aijón, J., 1997. Distribution of
S100 immunoreactivity in the retina and optic nerve head of
the teleost Tinca tinca L. Microsc. Res. Tech. 36, 17–25.
Velasco, A., Briñón, J.G., Caminos, E., Lara, J.M., Aijón, J., 1997.
S-100-positive glial cells are involved in the regeneration
of the visual pathway of teleosts. Brain Res Bull. 43,
327–336.
Ziman, M.R., Rodger, J., Chen, P., Papadimitriou, J.M., Dunlop, S.A.,
Beazley, L.D., 2001. Pax genes in development and maturation
of the vertebrate visual system: implications for optic nerve
regeneration. Histol. Histopathol. 16, 239–249.