pubs.acs.

org/ac Article

Enhancing the Sensitivity of DNA and Aptamer Probes in the

Dextran/PEG Aqueous Two-Phase System
Qiaoshu Chen, Yanwen Zhang, Hui Chen, Jianbo Liu,* and Juewen Liu*
Cite This: Anal. Chem. 2021, 93, 8577−8584 Read Online

ACCESS Metrics & More Article Recommendations *

sı Supporting Information
See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

ABSTRACT: Increasing the local concentration of DNA-based

Downloaded via NANYANG TECHNOLOGICAL UNIV on June 30, 2023 at 04:32:44 (UTC).

probes is a convenient way to improve the sensitivity of biosensors.

Instead of using organic solvents or ionic liquids that phase-
separate with water based on hydrophobic interactions, we herein
studied a classic aqueous two-phase system (ATPS) comprising
polyethylene glycol (PEG) and dextran. Polymers of higher
molecular weights and higher concentrations favored phase
separation. DNA oligonucleotides are selectively enriched in the
dextran-rich phase unless the pH was increased to 12. A higher volume ratio of PEG-to-dextran and a higher concentration of PEG
also enrich more DNA probes in the dextran-rich phase. The partition efficiency of the T15 DNA was enriched around seven times in
the dextran phase when the volume ratio of dextran and PEG reached 1:10. The detection of limit improved by 3.6-fold in a
molecular beacon-based DNA detection system with the ATPS. The ATPS also increased the sensitivity for the detection of Hg2+
and adenosine triphosphate, although these target molecules alone distributed equally in the two phases. This work demonstrates a
simple method using water soluble polymers to improve biosensors.

E nrichment of analytes and probes to a small volume can

accelerate reactions, improve sensitivity, and lower
detection limits of analytical sensors, which is of great value
to early disease diagnosis, food safety, and environmental
monitoring. For this purpose, numerous methods have been
developed. One type of method relies on the immobilization of
probes on materials such as magnetic beads and hydrogels. The
high local concentration of probes would enrich target analytes
to achieve a strong local signal for detection.1−4 However,
covalent probe immobilization requires extra steps, and the
probes may be affected by the surfaces for immobilization. In
addition, detection of signals has to be carried out on solid
materials instead of in homogeneous solutions. Another type of
method takes advantage of phase separation or precipitation.
For example, conventional DNA extraction methods, such as
using phenol-chloroform (PC), ethanol, ionic liquids, CTAB
precipitation, and salt extraction, usually employ various toxic
chemicals, and they are also time consuming.5,6
An aqueous two-phase system (ATPS) represents a facile
separation technology, which is usually realized by a polymer−
polymer or polymer−salt mixture.7−10 For example, poly-
ethylene glycol (PEG) and dextran can form a classic ATPS,
where if solutes prefer to accumulate in one phase, enhanced
detection or separation can be achieved. Its simplicity,
biocompatibility, and amenability to scaling up operations
make the ATPS attractive for large-scale bioseparation of a
range of biomaterials, including plant and animal cells,11−13
microorganisms,14 fungi and their spores,15,16 membrane
vesicles,17,18 proteins,19,20 and nucleic acids.21 To date,
however, the work has been mainly focused on separation,
and its value for analytical biosensors has yet to be
demonstrated.
Aptamers are single-stranded nucleic acids with unique
secondary structures, which could selectively bind target
molecules,22 such as small molecules,23 ions,24 proteins,25
and cells.26 For example, a T−T mismatch can selectively
capture Hg2+ to form T-Hg2+-T.2,27−29 Up to now, researchers
have developed many signal amplification strategies for
aptamer-based detection, including hybridization chain reac-
tion,30−34 nuclease amplification,35 rolling circle amplifica-
tion,36 catalyzed hairpin assembly amplification,37,38 and
nanomaterial-based amplification.39,40 These strategies need a
dedicated design of DNA sequences, involve various types of
reagents, and require complex assay processes.
Since DNA is a highly negatively charged polymer, it is
interesting to study its partition in the ATPS. In this work, we
explored the feasibility to increase the sensitivity of DNA-
based probes in the PEG/dextran ATPS as illustrated in
Scheme 1. We first studied the buffer conditions to control
DNA enrichment in each phase by tuning salt, pH, and the
volume ratio of the two polymers. Under optimal conditions,
by simply mixing analytes, DNA probes, and polymers,
Received: April 2, 2021
Accepted: May 27, 2021
Published: June 8, 2021

© 2021 American Chemical Society https://doi.org/10.1021/acs.analchem.1c01419

8577 Anal. Chem. 2021, 93, 8577−8584
Analytical Chemistry pubs.acs.org/ac Article

Scheme 1. Illustration of the Formation of an ATPS and Partition of DNA Probesa

a
The ATPS was constructed by two polymers like PEG and dextran. Dextran-rich droplets formed in the PEG-rich phase after shaking. DNA
probes and some analytes tend to accumulate in the dextran-rich droplets. After standing for a while or centrifugation, the dextran-rich phase settled
to the bottom with enriched probe DNA and analytes, which can improve the sensitivity of detection.

improved detection could be achieved, and we demonstrated solutions were prepared and diluted using ultrapure water
highly sensitive and specific detection of DNA, Hg2+, and ATP (≥18.2 MΩ·cm).
using their DNA and aptamer probes. Instruments. Fluorescence measurements were performed

■ EXPERIMENTAL SECTION
Chemicals. PEG (molecular weights (MW) 400, 800,
on a fluorometer (FluoroMax-4, Varian). Ultraviolet−visible
(UV−vis) absorption spectra were recorded on a spectrometer
(8453A, Agilent). Fluorescence confocal images were collected
1000, 2000, 4000, 8000, and 20,000 Da) were purchased from on an A1R confocal microscope (Nikon), and the images were
Research Organics (Cleveland, OH). DNA oligonucleotides processed using Image J (National Institutes of Health,
were from Integrated DNA Technologies (IDT) (Coralville, Bethesda, MD).
IA), and the sequences of the DNA are shown in Table 1. Preparation and Characterization of the ATPS. All
partitioning experiments were performed at room temperature
Table 1. Oligonucleotide Sequences Used in this Work around 23 °C. Stock ATPS samples with a total mass of 10 g
were prepared by weighing water, PEG 8000, and dextran
DNA names sequences (5′−3′) 100,000 into buffers of various pH values. Turbidity was
T15 TTTTTTTTTTTTTTT measured by monitoring the absorbance at 500 nm using a
Cy5-T15 Cy5-TTTTTTTTTTTTTTT Tecan M1000 Pro microplate reader.
FAM- T15 FAM-TTTTTTTTTTTTTTT To characterize the droplets in an ATPS, FITC-labeled
ATP aptamer ACCTGGGGGAGTATTGCGGAGGAAGGT dextran 70,000 (1%, Ex: 488 and Em: 500−550 nm) diluted in
Dual labeled ATP FAM-ACCTGGGGGAGTATTGCGGAGGAAGGT- dextran 100,000 (16%) was mixed with PEG 8000 (10%). In a
aptamer TAMRA
typical experiment, a 10 μL dextran sample was mixed with
Molecular beacon FAM-GCGAGCCAGGTTCTCTTCACA
(MB) GATGCGCTCGC-black hole quencher 1 200 μL PEG 8000 solution. After shaking on a vortex, the
Target ACGCATCTGTGAAGAGAACCTGGG sample was imaged with a confocal microscope. For
Random 1 ACCTGGGGGAGTATGTGACATCTT determination of DNA partition in an ATPS, the Cy5-labeled
Random 2 TGCGGAGGAAGGTTGTGACATCAA DNA was added in an ATPS (Ex: 633 nm, Em; above 660−
Mis1 ACGCATCTTTGAAGAGAACCTGGG 750 nm). A 10 μL dextran sample containing the DNA was
Mis2 ACGCATCTCTGAAGAGAACCTGGG mixed with 200 μL PEG solution. After vortexing, the sample
Mis3 ACGCATCTATGAAGAGAACCTGGG was imaged with a confocal microscope.
DNA Partition in the ATPS. To quantify the enrichment
of DNA in the dextran-rich phase, 2 μL 100 μM DNA was
added to the tubes containing 200 μL dextran 100,000 (16%)
Dextran 100,000 Da, dextran-FITC 70,000 Da, SYBR Green I and 200 μL PEG 8000 of different concentrations. After
(SGI), adenosine 5′-triphosphate disodium salt hydrate centrifugation, the PEG-rich phase was removed. Then, 20 μL
(ATP), thymidine 5′-triphosphate sodium salt (TTP), cytidine dextran-rich phase solution was added to the tubes containing
5′-triphosphate disodium salt (CTP), guanosine 5′-triphos- 200 μL HEPES buffer 10 mM, pH 7.6, and the fluorescence
phate sodium salt hydrate (GTP), uridine 5′-triphosphate intensity was compared with the sample in dextran solution
trisodium salt dihydrate (UTP), sodium chloride, mercury with the same initial DNA concentration.
perchloride, copper sulfate, zinc chloride, manganese chloride, Detection of DNA. Target-mediated hybridization was
cobalt chloride, lead acetate, magnesium chloride, and calcium monitored using a molecular beacon with a carboxyfluorescein
chloride were obtained from Sigma-Aldrich. 4-(2-Hydroxyeth- (FAM) and a black hole quencher 1 (BHQ1) labeled at the 3′
yl)-piperazine-1-ethanesulfonic acid (HEPES) was obtained end and 5′ end, respectively. The molecular beacon (500 nM)
from Mandel Scientific (Guelph, ON, Canada). All of the was added to the tubes containing 400 μL dextran (16%, w/w)
8578 https://doi.org/10.1021/acs.analchem.1c01419
Anal. Chem. 2021, 93, 8577−8584
Analytical Chemistry
and PEG (20%, w/w) at a volume ratio of 1:1 and then treated
with various concentrations of the target DNA or control DNA
sequences. After gently shaking and centrifugation, 20 μL
samples were diluted in 200 μL HEPES buffer (10 mM, pH
7.6), and the fluorescence spectra (Ex: 480 nm and Em: 500−
600 nm) were recorded. All of the measurements were
performed three times and the standard deviation was plotted
as the error bars.
Detection of Hg2+. Hg2+ binding to T15 DNA was
monitored using a label-free method based on SGI staining.
T15 DNA (50 nM) was added to the each tube containing 200
μL dextran 100,000 (16%, w/w), 200 μL PEG 8000 (10%, w/
w), and 100 nM SGI and then treated with various
concentrations of the Hg2+. The samples were shaken gently
and then diluted five times for microscope imaging. To observe
under a fluorescence microscope, 10 μL of the samples were
spotted onto a glass slide and imaged using a fluorescence
microscope. The exposure time and other imaging conditions
were set to be the same for all the samples. (Ex: 488 and Em:
500−550 nm). For detecting Hg2+ at different volume ratios,
200 μL dextran was added to each tube containing different
volumes of PEG. The final concentration of DNA (50 nM)
and SGI (100 nM) in different samples were kept the same.
The samples were gently shaken and then centrifuged. Samples
(20 μL) in the bottom phase were added to the 200 μL
HEPES buffer and then measured by a fluorimeter.
Detection of ATP. For detecting ATP, 50 nM ATP
aptamer mixed with 1 μM Thioflavin T (ThT) was added to
the tubes containing dextran and PEG, and then various
concentrations of ATP was added. After gently shaking and
centrifugation, 20 μL sample was diluted in 200 μL HEPES
buffer. The excitation wavelength was set at 425 nm, and the
emission spectra were recorded in the range from 450 to 600
nm. For the sensor calibration curve acquisition, (F0−F)/F0
was plotted as the sensor signal, where F0 is the fluorescence
intensity of the system without ATP and F is the resulting
fluorescence intensity with ATP added. All of the measure-
ments were performed three times and the standard deviation
was plotted as the error bar.
■
RESULTS AND DISCUSSION
Preparation of the ATPS. Dextran and PEG (Figure 1A)
were reported to form an ATPS.8 While both dextran and PEG
are highly soluble in water, the driving force for the phase
separation is the enthalpy associated with the interactions of
the components, which is opposed by the loss in entropy
associated with phase separation.8,41 We mixed dextran and
PEG, and first studied the effect of the PEG length. Dextran
(MW 100,000, 16%) was, respectively, incubated with PEG
200, 400, 1000, 2000, 4000, 8000, and 20,000 (all 10%, w/w),
and the turbidity of the mixtures were then measured using a
UV−vis spectrometer (Figure S1). Phase separation indicative
of the formation of the ATPS occurred only when the PEG
molecular weight was 8000 or higher and thus longer polymers
favored the phase separation. Therefore, we choose PEG 8000
in our study.
By mixing different concentrations of dextran (MW
100,000) and PEG 8000, a phase diagram was generated by
measuring the optical density of the samples at 500 nm, which
revealed a concentration-dependent contour line (Figure 1B).
The blue regions are mainly a homogeneous mixture, while
phase separation was indicated by the green, yellow, and red
regions.
8579
pubs.acs.org/ac Article
Figure 1. Formation of the two-phase system. (A) Structures of
dextran and PEG. (B) Optical density diagram indicative of formation
of the ATPS by dextran and PEG at different polymer concentrations.
A higher optical density indicates the formation of the ATPS. (C)
Brightfield and (D) confocal fluorescence images of the microdroplets
prepared by mixing FITC-dextran 70,000 and PEG 8000. Scale bar:
50 μm.
To characterize the ATPS, fluorescence imaging using
FITC-labeled dextran was performed, and droplets of ∼10
μm were observed right after mixing. The green fluorescence
from the droplets indicated that the droplet phase was rich in
dextran. Thus, the continuous phase outside the droplets was
rich in PEG. At 10 min after mixing, the droplets gradually
merged and grew to ∼90 μm. After extensive merging of the
droplets, they sank to the bottom, and a two-layered system
finally formed after about 30 min (Figure S2). The instability
of the droplets can be explained by a lack of surfactants in our
system and thus a large interfacial energy. Since we intended to
achieve bulk phase separation, instability of the droplets would
not affect our analytical results. To achieve faster detection,
this phase separation process can be accelerated by gentle
centrifugation.
We then explored the influence of pH on the formation of
the ATPS. By measuring the turbidity from pH 2 to 12 (Figure
S3), no obvious change was observed, indicating tolerance to
both acidic and basic conditions. We further explored the effect
of salt by gradually adding different concentrations of NaCl,
and the ATPS remained stable even with 1 M NaCl (Figure
S4). Therefore, this ATPS can tolerate a wide range of buffer
conditions relevant to most bioanalytical applications.
Enrichment of DNA in the Dextran-Rich Phase. After
understanding the ATPS, we then studied whether DNA
oligonucleotides can preferentially partition in a particular
phase. Previous studies successfully purified plasmid DNA
using this system, and 100% DNA recovery was achieved from
the cell lysate.42 In their studies, numerous factors were found
to affect the partition of DNA such as the type, molecular
weight, and concentration of polymers, the type and
concentration of salts, the pH value, and the phase volume
ratio.
The previous work on DNA extraction mainly used long
genomic DNA. For analytical applications, short DNA
oligonucleotides are more relevant,43 although different
https://doi.org/10.1021/acs.analchem.1c01419
Anal. Chem. 2021, 93, 8577−8584
Analytical Chemistry
sequences may behave differently. 44 We first studied
polythymine (poly-T) DNA as a model, since it can be used
in the detection of Hg2+ and melamine.24,45 A FAM-labeled
T15 DNA (15 thymine bases) was added into the PEG/dextran
ATPS, and the fluorescence was found to distribute evenly in
the tube. After a gentle centrifugation, the DNA accumulated
mainly in the dextran-rich phase at the bottom (Figure 2A).
Figure 2. Localization of DNA oligonucleotides in two-phase systems.
(A) Fluorescence photographs of FAM-T15 partitioned in the dextran-
rich bottom phase after centrifugation. (B) Confocal fluorescence
images of the overlapping dextran-rich microdroplet (green
fluorescence) and the Cy5-labeled DNA (red fluorescence). Scale
bar: 50 μm.
A Cy5-labeled T15 DNA and FITC-dextran were then used
to further confirm this observation. The red fluorescence from
DNA overlapped perfectly with the green fluorescence from
the FAM-labeled dextran, confirming the accumulation of the
DNA in the dextran-rich phase (Figure 2B).
Optimization of DNA Enrichment Conditions. We then
studied the effect of pH on DNA partition using the FAM-
labeled T15 DNA. Since the fluorescence intensity of the DNA
was the same when dispersed in water, PEG, or dextran, the
fluorescence intensity could reflect the concentration of the
DNA (Figure S5). The FAM-DNA, dextran, and PEG were
mixed in buffers of different pH values. After shaking and
gentle centrifugation, the DNA concentration in the dextran-
rich phase was compared with that in the buffer with the same
initial DNA concentration (Figure 3A). From pH 6 to 10, the
DNA mainly stayed in the dextran phase, while at pH 12, the
DNA accumulated in the PEG phase.
There is a partial negative charge on the oxygen atoms in
PEG molecules.46,47 In contrast, dextran can weakly adsorb
DNA due to hydrogen bonding between the phosphate groups
and the glycosidic and hydroxylic acceptor sites in the
repeating glucose units of the polysaccharide.48 These factors
might be the reason for the DNA staying in the dextran phase
at pH below 10. At pH 12, dextran has weak acidity through
the dissociation of the −OH groups on C-2, C-3, and C-4 (pKa
12). Therefore, at high pH, dextran became strongly negatively
charged to repel the DNA, whereas the charge on PEG did not
change much.48
Since the partition coefficient is a constant at a certain
condition, we suspected that the concentration of DNA in the
8580
pubs.acs.org/ac Article
Figure 3. DNA accumulated in different phases under different
conditions. (A) Fold of enrichment of DNA in the dextran-rich phase
at different pH values. (B) Effect of the volume ratio of dextran and
PEG. (C) Comparison of DNA concentration in buffer and dextran
and in the dextran-rich phase when dextran (16%) was mixed with 10,
15, 20, 25, and 30% PEG8000, respectively, at pH 8.(D) Partition in
the dextran-rich phase when dextran mixed with PEG in different
concentrations of NaCl.
dextran phase may be further increased as the PEG-to-dextran
volume ratio was increased. Indeed, when the same
concentration of DNA was incubated with the ATPS of
different volume ratios, more DNA accumulated in the dextran
phase at higher ratios (Figure 3B). At a fixed volume ratio, a
higher concentration of PEG also led to a higher concentration
of DNA in the dextran phase (Figure 3C), which can be
explained by a more repulsive force exerted by the PEG phase.
At the same time, longer PEG also promoted the enrichment
of the DNA in the dextran-rich phase (Figure S6). Therefore,
we can improve DNA enrichment by tuning the concentration,
molecular weight, and volume of the PEG phase.
As shown above, the formation of the ATPS was not affected
by the NaCl concentration. Here, we also found that salt had
little effect on the partition of DNA. The DNA was still
concentrated in the dextran phase with only about 20%
increase in 500 mM NaCl compared with DNA accumulation
in the same ATPS without NaCl (Figure 3D).
Detection of DNA. Based on the above observations, we
used the ATPS to enrich DNA probes for biosensor
applications (Scheme 1). We first tested a molecular beacon
(MB), where a fluorophore and a quencher were labeled on
the ends of a DNA hairpin, and the closed beacon showed low
fluorescence. Upon hybridization with the target DNA, the
fluorescence would recover (Figure 4A). Since both the probe
and target analyte are DNA oligonucleotides, they are prone to
accumulate in the dextran-rich phase. Target DNA detection in
the ATPS containing dextran (MW100,000, 16%, w/w) and
PEG 8000 (20%, w/w) was compared with that in the buffer
without these polymers, and the concentration of the MB and
targets were the same in these two detection systems. A
gradual increase in the target concentration led to higher
https://doi.org/10.1021/acs.analchem.1c01419
Anal. Chem. 2021, 93, 8577−8584
Analytical Chemistry pubs.acs.org/ac Article

detection (LOD) in the ATPS improved by 3.6 times (Figure

Figure 4. Detection of target DNA in an ATPS. (A) Principle of
detecting target DNA based on an MB fluorescence assay. (B) Sensor
calibration curve for detection in pH 7 buffer and the ATPS. (C)
Initial linear response for detecting ATP in the two systems.(D)
Selectivity of the MB probe in the ATPS.
fluorescence both in the buffer and in the ATPS, and the
fluorescence intensity increased more in the ATPS (Figure
4B). Since the DNA was concentrated in the dextran phase,
the final fluorescence intensity for the ATPS was around 3.8-
fold higher than that in the buffer. We also compared the slope
of the initial linear region of the two systems, and the limit of
4C). Finally, the fluorescence increase was due to the specific
hybridization with the target DNA, since noncomplementary
DNA did not cause any signal change (Figure 4D). Meanwhile,
the MB was also able to discriminate single base mismatches in
the ATPS (Figure S7).
In this experiment, the volume ratio of the two phases in the
ATPS was 1:1. As shown in Figure 3B, by using a higher
volume ratio, more enrichment in the dextran can be achieved.
Since the detection was based on the bulk solutions, such
volume-based enhancement was limited. If the detection takes
places in the individual droplets (e.g., Figure 2B), even higher
signal enhancement can be achieved.
Detection of Hg2+. In the above example, since both the
DNA probe and DNA target can be enriched in the same
phase, this ATPS is ideal for the detection of DNA. A more
general question is what if a target analyte has no preference in
either phase and can the enriched DNA still enhance the
sensitivity? For this purpose, we then used Hg2+ as a target
analyte.
Since poly-T DNA has a strong affinity for Hg2+ ions, we
first used T15 for the detection of Hg2+. A label-free method
based on SGI staining was employed. The presence of Hg2+
leads to the formation of a duplex region, and SGI can be
intercalated in the minor groove of the duplex, leading to
enhanced SGI fluorescence.49 In the ATPS, Hg2+ was evenly
distributed in the dextran-rich phase and the PEG-rich phase
(Figure 5B). Different concentrations of Hg2+ were added and
imaged by a microscope immediately after mixing (Figure

Figure 5. Detection of Hg2+ in the ATPS. (A) Principle of detecting Hg2+ by a poly-T DNA and SGI staining. (B) Equal distribution of Hg2+ in the
dextran-rich and PEG-rich phases. (C) Fluorescence micrographs and (D) quantified intensity cross the dashed lines of single droplets in different
concentrations of Hg2+. (E) Detection of Hg2+ at different volume ratios of dextran and PEG. (F) Initial linear response for detecting Hg2+ in the
buffer and the ATPS. (G) Selectivity of detection of 1 μM different metal ions in the ATPS made with dextran (16%) and PEG 8000 (10%) at a
volume ratio of 1:1. Scale bar: 5 μm.

8581 https://doi.org/10.1021/acs.analchem.1c01419
Anal. Chem. 2021, 93, 8577−8584
Analytical Chemistry
Figure 6. Detection of ATP using its aptamer. (A) Principle of detecting ATP based on the ThT staining of the aptamer. (B) Fluorescence spectra
of ThT with the ATP aptamer in different solutions. (C) Sensor calibration curve and (D) initial linear regions for detecting ATP in the pH 7
buffer and in the ATPS. (E) Selectivity of the ATP probe in the ATPS.
5C,D). The fluorescence inside the droplets was increased in a
Hg2+-dependent way, indicating that the ATPS could be used
as a mercury detection system based on the poly-T DNA
probe.
After confirming the feasibility, we varied the volume ratio of
dextran to PEG (Vd:Vp) gradually from 1:1 to 1:5, (Figure 5E).
When treated with 5 μM Hg2+, the fluorescence increased 3.2
times, and the LOD decreased from 10.4 to 4.2 nM (Figure
5F). This result showed that the LOD could be lower by
simply modulating the volume ratio of the two polymers. We
also performed the detection of Hg2+ in the ATPS by changing
the PEG concentration from 10 to 20%, and the LOD dropped
by nearly twofold as well (Figure S8). We reason that the
enriched DNA attracted more Hg2+ into the dextran-rich
phase, although Hg 2+ ions alone had no enrichment.
Therefore, this method can be used to detect analytes beyond
DNA.
Finally, we tested the selectivity of this sensor, and the
fluorescence signal from different metal ions was compared in
the ATPS. The results showed that the sensor still retained the
selectivity of the DNA probe (Figure 5G).
Detection of ATP. To test if the ATPS can also be applied
to the detection of small molecules, an ATP aptamer was used
to detect ATP. ThT can intercalate into the 27-mer ATP
aptamer leading to the enhancement of ThT fluorescence,
whereas the binding of ATP to its aptamer leads to the release
of ThT and decreased fluorescence (Figure 6A).50 This
sensing method was then used to detect ATP in the ATPS.
The partition of the ATP aptamer at different pH values,
PEG concentrations, and volume ratios were evaluated
(Figures S9−S11). Compared to the T15 DNA, the ATP
aptamer is rich in guanine and adenine, and it showed an even
8582
pubs.acs.org/ac Article
higher partition coefficient in the dextran phase, which may be
attributed to the longer strand of the ATP aptamer or its base
composition. We also examined the distribution of ATP in the
two phases. Similar to Hg2+, ATP also evenly partitioned in the
two phases (Figure S12).
We then evaluated the fluorescence of ThT in the presence
of the ATP aptamer (Figure 6B), where the fluorescence of
ThT greatly improved when the ATP aptamer and ThT were
mixed. The fluorescence was further enhanced when it was
concentrated by the ATPS. A fluorescence decrease was
observed by increased concentration of ATP (Figure 6C). At a
Vd to Vp ratio of 1:1 (16% dextran mixed with 20% PEG), the
LOD of ATP was 0.017 μM, which was six times lower than
that in the buffer (Figure 6D). Meanwhile, this probe in the
ATPS also retained its selectivity. In the presence of TTP,
CTP, and GTP, no obvious fluorescence decrease was
observed even though their concentration was 10 times higher
than that of ATP (Figure 6E).
Finally, we tested whether the secondary structure of the
aptamer might change in different media. For this purpose, we
labeled the ATP aptamer with an FAM and a TAMRA,
respectively, at the two ends so that folding of the aptamer can
be monitored by fluorescence resonance energy transfer
(FRET) (Figure S13). We kept the concentrations of the
FRET aptamer and ATP same in the buffer and in the dextran-
rich phase. When we excited the FAM at 480 nm, the
fluorescence spectra of the dual-labeled aptamer were nearly
identical in the buffer and the dextran-rich phase, indicating
that the secondary structure of the aptamer was not changed in
the dextran-rich phase. In both solutions, a similar fluorescence
increase of the normalized TAMRA peak was observed upon
adding ATP. Therefore, the ATPS did not change the
https://doi.org/10.1021/acs.analchem.1c01419
Anal. Chem. 2021, 93, 8577−8584
Analytical Chemistry
conformation of the aptamer, and the recognition ability of the
aptamer in the dextran-rich phase was also preserved.51,52
■ CONCLUSIONS
In summary, a classic ATPS was used to study the partition of
DNA oligonucleotides, and various buffer conditions were
examined. Partition of DNA probes in the dextran phase can
be modulated by pH, the volume ratio of dextran to PEG, and
the concentration of PEG, while the effect on ionic strength
was very small. For the first time, such ATPS was used to
improve DNA-based analytical biosensors, and three examples
were demonstrated for the detection of complementary DNA,
Hg2+, and ATP, respectively. Even though Hg2+ and ATP did
not have a preference of partition in either phase, the enriched
DNA still allowed for more sensitive detection of both. This is
the first demonstration of using an ATPS to improve the
sensitivity of DNA probes, and it can be applied to a broad
range of target analytes. By introducing different signal
amplification strategies, the ATPS might achieve even higher
detection efficiencies.
■
ASSOCIATED CONTENT
*
sı Supporting Information
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acs.analchem.1c01419.
The turbidity of dextran-rich droplets formed by dextran
and different molecular weights of PEG; the turbidity of
dextran-rich droplets formed by dextran and PEG8000
at different pH values and different concentrations of
NaCl; the fold of enrichment of the ATP aptamer in the
dextran-rich phase under the different pH values, volume
ratios of dextran to PEG, and PEG concentrations
(PDF)
■
AUTHOR INFORMATION
Corresponding Authors
Jianbo Liu − State Key Laboratory of Chemo/Biosensing and
Chemometrics, College of Chemistry and Chemical
Engineering, Key Laboratory for Bio-Nanotechnology and
Molecular Engineering of Hunan Province, Hunan University,
Changsha 410082, P. R. China; Email: liujianbo@
hnu.edu.cn
Juewen Liu − Department of Chemistry, Waterloo Institute for
Nanotechnology, University of Waterloo, Waterloo, Ontario
N2L 3G1, Canada; orcid.org/0000-0001-5918-9336;
Email: liujw@uwaterloo.ca
Authors
Qiaoshu Chen − State Key Laboratory of Chemo/Biosensing
and Chemometrics, College of Chemistry and Chemical
Engineering, Key Laboratory for Bio-Nanotechnology and
Molecular Engineering of Hunan Province, Hunan University,
Changsha 410082, P. R. China; Department of Chemistry,
Waterloo Institute for Nanotechnology, University of
Waterloo, Waterloo, Ontario N2L 3G1, Canada
Yanwen Zhang − State Key Laboratory of Chemo/Biosensing
and Chemometrics, College of Chemistry and Chemical
Engineering, Key Laboratory for Bio-Nanotechnology and
Molecular Engineering of Hunan Province, Hunan University,
Changsha 410082, P. R. China
Hui Chen − State Key Laboratory of Chemo/Biosensing and
Chemometrics, College of Chemistry and Chemical
8583
pubs.acs.org/ac Article
Engineering, Key Laboratory for Bio-Nanotechnology and
Molecular Engineering of Hunan Province, Hunan University,
Changsha 410082, P. R. China
Complete contact information is available at:
https://pubs.acs.org/10.1021/acs.analchem.1c01419
Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS
Funding for this work was from the Natural Sciences and
Engineering Research Council of Canada (NSERC) and the
financial support of the Natural Science Foundation of China
(No. 21735002, 21575037, 21778016, 21675046, and
21877030). Q.C. was supported by a China Scholarship
Council (CSC) scholarship to visit the University of Waterloo.
■ REFERENCES
(1) Liu, Y.; Chen, Q.; Liu, J.; Yang, X.; Guo, Q.; Li, L.; Liu, W.;
Wang, K. Anal. Chem. 2017, 89, 3590−3596.
(2) Dave, N.; Chan, M. Y.; Huang, P.-J. J.; Smith, B. D.; Liu, J. J. Am.
Chem. Soc. 2010, 132, 12668−12673.
(3) Si, Y.; Li, L.; Wang, N.; Zheng, J.; Yang, R.; Li, J. ACS Appl.
Mater. Interfaces 2019, 11, 7792−7799.
(4) Xiong, Y.; Zhang, J.; Yang, Z.; Mou, Q.; Ma, Y.; Xiong, Y.; Lu, Y.
J. Am. Chem. Soc. 2020, 142, 207−213.
(5) Sajali, N.; Wong, S. C.; Hanapi, U. K.; Abu Bakar Jamaluddin, S.;
Tasrip, N. A.; Mohd Desa, M. N. J. Food Sci. 2018, 83, 2409−2414.
(6) Wang, J. H.; Cheng, D. H.; Chen, X. W.; Du, Z.; Fang, Z. L.
Anal. Chem. 2007, 79, 620−625.
(7) Iqbal, M.; Tao, Y.; Xie, S.; Zhu, Y.; Chen, D.; Wang, X.; Huang,
L.; Peng, D.; Sattar, A.; Shabbir, M. A. B.; Hussain, H. I.; Ahmed, S.;
Yuan, Z. Biol. Proced. Online 2016, 18, 18.
(8) Hatti-Kaul, R. Mol. Biotechnol. 2001, 19, 269−278.
(9) Chao, Y.; Shum, H. C. Chem. Soc. Rev. 2020, 49, 114−142.
(10) Pereira, J. F. B.; Freire, M. G.; Coutinho, J. A. P. Fluid Phase
Equilib. 2020, 505, No. 112341.
(11) Teixeira, A. G.; Agarwal, R.; Ko, K. R.; Grant-Burt, J.; Leung, B.
M.; Frampton, J. P. Adv. Healthcare Mater. 2018, 7, No. 1701036.
(12) Atefi, E.; Joshi, R.; Mann, J. A., Jr.; Tavana, H. ACS Appl. Mater.
Interfaces 2015, 7, 21305−21314.
(13) Cabral, J. M. S. Cell Partitioning in Aqueous Two-Phase
Polymer Systems. In Cell Separation: Fundamentals, Analytical and
Preparative Methods. Cell Separation, 2007, Springer, Berlin,
Heidelberg, 2007; 151−171.
(14) Lantz, P.-G.; Tjerneld, F.; Hahn-Hägerdal, B.; Rådström, P. J.
Chromatogr., B: Biomed. Sci. Appl. 1996, 680, 165−170.
(15) Park, O. J.; Holland, H. L.; Khan, J. A.; Vulfson, E. N. Enzyme
Microb. Technol. 2000, 26, 235−242.
(16) Nascimento, T. P.; Sales, A. E.; Porto, C. S.; Brandão, R. M. P.;
de Campos-Takaki, G. M.; Teixeira, J. A. C.; Porto, T. S.; Porto, A. L.
F.; Converti, A. J. Chromatogr., B 2016, 1025, 16−24.
(17) Larsson, C.; Kjellbom, P.; Widell, S.; Lundborg, T. FEBS Lett.
1984, 171, 271−276.
(18) Shin, H.; Han, C.; Labuz, J. M.; Kim, J.; Kim, J.; Cho, S.; Gho,
Y. S.; Takayama, S.; Park, J. Sci. Rep. 2015, 5, No. 13103.
(19) Asenjo, J. A.; Andrews, B. A. J. Chromatogr. A 2011, 1218,
8826−8835.
(20) Asenjo, J. A.; Andrews, B. A. J. Chromatogr. A 2012, 1238, 1−
10.
(21) Luechau, F.; Ling, T. C.; Lyddiatt, A. Sep. Purif. Technol. 2009,
66, 202−207.
(22) Farzin, L.; Shamsipur, M.; Sheibani, S. Talanta 2017, 174,
619−627.
(23) Zhang, S.; Wang, L.; Liu, M.; Qiu, Y.; Wang, M.; Liu, X.; Shen,
G.; Yu, R. Anal. Methods 2016, 8, 3740−3746.
https://doi.org/10.1021/acs.analchem.1c01419
Anal. Chem. 2021, 93, 8577−8584
Analytical Chemistry pubs.acs.org/ac Article

(24) Zhou, W.; Ding, J.; Liu, J. Biosens. Bioelectron. 2017, 87, 171−
177.
(25) Amouzadeh Tabrizi, M.; Shamsipur, M.; Farzin, L. Biosens.
Bioelectron. 2015, 74, 764−769.
(26) Mir, T. A.; Yoon, J.-H.; Gurudatt, N. G.; Won, M.-S.; Shim, Y.-
B. Biosens. Bioelectron. 2015, 74, 594−600.
(27) Miyake, Y.; Togashi, H.; Tashiro, M.; Yamaguchi, H.; Oda, S.;
Kudo, M.; Tanaka, Y.; Kondo, Y.; Sawa, R.; Fujimoto, T.; Machinami,
T.; Ono, A. J. Am. Chem. Soc. 2006, 128, 2172−2173.
(28) Pi, K.; Liu, J.; Van Cappellen, P. Environ. Sci. Technol. 2020, 54,
13680−13689.
(29) Helwa, Y.; Dave, N.; Froidevaux, R.; Samadi, A.; Liu, J. ACS
Appl. Mater. Interfaces 2012, 4, 2228−2233.
(30) Evanko, D. Nat. Methods 2004, 1, 186−186.
(31) Liu, P.; Yang, X.; Sun, S.; Wang, Q.; Wang, K.; Huang, J.; Liu,
J.; He, L. Anal. Chem. 2013, 85, 7689−7695.
(32) Tang, J.; Lei, Y.; He, X.; Liu, J.; Shi, H.; Wang, K. Anal. Chem.
2020, 92, 10839−10846.
(33) Yuan, B.; Chen, Y.; Sun, Y.; Guo, Q.; Huang, J.; Liu, J.; Meng,
X.; Yang, X.; Wen, X.; Li, Z.; Li, L.; Wang, K. Anal. Chem. 2018, 90,
6131−6137.
(34) Huang, J.; Wu, Y.; Chen, Y.; Zhu, Z.; Yang, X.; Yang, C. J.;
Wang, K.; Tan, W. Angew. Chem., Int. Ed. 2011, 50, 401−404.
(35) Qing, T.; He, D.; He, X.; Wang, K.; Xu, F.; Wen, L.;
Shangguan, J.; Mao, Z.; Lei, Y. Anal. Bioanal. Chem. 2016, 408, 2793−
2811.
(36) Luo, X.; Zhao, J.; Xie, X.; Liu, F.; Zeng, P.; Lei, C.; Nie, Z. Anal.
Chem. 2020, 92, 16314−16321.
(37) Gu, J.; Qiao, Z.; He, X.; Yu, Y.; Lei, Y.; Tang, J.; Shi, H.; He, D.;
Wang, K. Analyst 2020, 145, 5194−5199.
(38) Wang, J.; Li, J.; Liu, S.; Meng, X.; Yang, X.; Huang, J.; Wang, K.
Chem. Commun. 2020, 56, 11267−11270.
(39) Ou, M.; Huang, J.; Yang, X.; He, X.; Quan, K.; Yang, Y.; Xie,
N.; Li, J.; Wang, K. ChemBioChem 2018, 19, 147−152.
(40) Wang, Q.; Liu, R.; Yang, X.; Wang, K.; Zhu, J.; He, L.; Li, Q.
Sens. Actuators B: Chem. 2016, 223, 613−620.
(41) Dignon, G. L.; Best, R. B.; Mittal, J. Annu. Rev. Phys. Chem.
2020, 71, 53−75.
(42) Abdulrahman, A.; Ghanem, A. Anal. Chim. Acta 2018, 1025,
41−57.
(43) Strulson, C. A.; Molden, R. C.; Keating, C. D.; Bevilacqua, P. C.
Nat. Chem. 2012, 4, 941−946.
(44) Walter, H., Partitioning in aqueous two−phase system: theory,
methods, uses, and applications to biotechnology. Elsevier: 2012.
(45) He, F.; Shen, Y.; Liu, J. Analyst 2021, 146, 1642−1649.
(46) Henry, M.; Jolivet, J. P.; Livage, J., Aqueous chemistry of metal
cations: Hydrolysis, condensation and complexation. In Chemistry,
Spectroscopy and Applications of Sol-Gel Glasses, Reisfeld, R.;
Jjørgensen, C. K., Eds. Springer, Berlin, Heidelberg, 1992; 153−206.
(47) Ensing, B.; Tiwari, A.; Tros, M.; Hunger, J.; Domingos, S. R.;
Pérez, C.; Smits, G.; Bonn, M.; Bonn, D.; Woutersen, S. Nat.
Commun. 2019, 10, 2893.
(48) Zeng, X.; Osseo-Asare, K. Colloids Surf., A: Physiochem. Eng.
Asp. 2003, 226, 45−54.
(49) Wang, J.; Liu, B. Chem. Commun. 2008, 4759−4761.
(50) Zhang, F.; Huang, P.-J. J.; Liu, J. ACS Sensors 2020, 5, 2885−
2893.
(51) Huang, M.; Song, J.; Huang, P.; Chen, X.; Wang, W.; Zhu, Z.;
Song, Y.; Yang, C. Anal. Chem. 2019, 91, 10879−10886.
(52) Roloff, A.; Carlini, A. S.; Callmann, C. E.; Gianneschi, N. C. J.
Am. Chem. Soc. 2017, 139, 16442−16445.

8584 https://doi.org/10.1021/acs.analchem.1c01419
Anal. Chem. 2021, 93, 8577−8584