Biochemical and Biophysical Research Communications 412 (2011) 633–637

Contents lists available at SciVerse ScienceDirect

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier.com/locate/ybbrc

Blocking peptides against HBV: PreS1 protein selected from a phage display library
Wei Wang, Yang Liu, Xiangyang Zu, Rui Jin, Gengfu Xiao ⇑
State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, PR China

a r t i c l e i n f o a b s t r a c t

Article history: The PreS1 protein is present on the outermost part of the hepatitis B virus (HBV) surface and has been
Received 1 August 2011 shown to have a pivotal function in viral infectivity and assembly. The development of reagents with high
Available online 11 August 2011 affinity and specificity for PreS1 is of great significance for early diagnosis and treatment of HBV infection.
A phage display library of dodecapeptide was screened for interactions with purified PreS1 protein. Align-
Keywords: ment of the positive phage clones revealed a putative consensus PreS1 binding motif of HXnHXmHP/R.
Hepatitis B virus (HBV) Moreover, a peptide named P7 (KHMHWHPPALNT) was highly enriched and occurred with a surprisingly
PreS1
high frequency of 72%. A thermodynamic study revealed that P7 has a higher binding affinity to PreS1
Phage display
Peptide
than the other peptides. Furthermore, P7 was able to abrogate the binding of HBV virions to the PreS1
Blocking antibody, suggesting that P7 covers key functional sites on the native PreS1 protein. This newly isolated
peptide may, therefore, be a new therapeutic candidate for the treatment of HBV. The consensus motif
could be modified to deliver imaging, diagnostic, and therapeutic agents to tissues affected by HBV.
! 2011 Elsevier Inc. All rights reserved.

1. Introduction PreS1-interacting peptide would be both a valuable tool for the

Hepatitis B, which is caused by a small DNA virus known as the
hepatitis B virus (HBV), is a serious health threat, with chronic and
acute forms that affect more than 350 million people worldwide
and result in approximately 600,000 deaths annually [1–3]. The
most commonly used drugs, interferon-a and nucleoside analogs,
are not HBV-specific, and none of these drugs are capable of com-
pletely eradicating the virus [4–6]. Therefore, the investigation and
identification of targets and inhibitors of HBV is highly desirable.
The attachment of virions to the human hepatocyte membrane
via the interaction of the viral envelope protein with cell surface
receptors is considered to be the initial step of HBV infection [7].
The envelope of the HBV virion is formed by virally encoded small
(SHBs), middle (MHBs), and large (LHBs) surface proteins, together
with host-derived phospholipids [8]. These proteins are translated
from distinct initiation codons but share a common reading frame
and stop codon [9]. The SHBs protein contains 226 amino acids and
is the major component of the viral envelope. The MHBs protein
has 55 extra amino acids (PreS2) located at the N-terminus of
the SHBs, and the LHBs protein carries an additional 119-amino
acid (or 109-amino acid, depending on the viral subtype, PreS1)
N-terminal extension with respect to the MHBs protein. L-protein
contains the PreS1, PreS2, and S regions, which are preferentially
localized on infectious viral particles. The PreS1 region is the out-
ermost part of HBV and has been shown to have a pivotal function
in viral infectivity and assembly [10–15]. Therefore, a specific
⇑ Corresponding author. Fax: +86 27 87198685.
E-mail address: xiaogf@wh.iov.cn (G. Xiao).
study of these processes and a potential therapeutic agent against
viral infection.
In the present study, a commercial phage display (Ph.D.)-12
peptide library (NEB, Beverly, MA, USA), in which a library of pep-
tide variants is expressed on the phage surface as fusions to coat
proteins III [16–18], was used to screen for peptides that bind to
PreS1. This screening system allows for rapid partitioning based
on binding affinity to a given target molecule by an in vitro selec-
tion process called panning [19]. A major clone named P7 was se-
lected, and specific binding was confirmed by an inhibition assay.
Moreover, the scaffold of the binding peptides was determined to
be HXnHXmHP/R. The information obtained in this study may sup-
port the design of drugs against HBV.
2. Materials and methods
2.1. Preparation of PreS1 protein
The sequence coding for the PreS1 protein was amplified by PCR
from pBluescript HBV plasmid [20] using a PreS1-specific forward
primer with an NdeI site (50 - GGAATTCCATATGGGAGGTTGGTCTTC-
CAAACCT -30 ) and a reverse primer with an XhoI site (50 -
CCGCTCGAGGGCCTGAGGATGAGTGTC -30 ). The amplified DNA
fragment was inserted upstream of the His6-Tag sequence in the
pET!30a(+) expression vector (Novagen, Madison, WI) under the
control of the T7 promoter. The sequence of the constructed plas-
mid was confirmed by restriction digestion and sequencing. The
PreS1 protein was purified with Ni-NTA agarose affinity chroma-

0006-291X/$ - see front matter ! 2011 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2011.08.014
634 W. Wang et al. / Biochemical and Biophysical Research Communications 412 (2011) 633–637
tography (Qiagen, Valencia, CA) and desalted with a Waters C18
column.
2.2. Library screening
The (Ph.D.)-12 peptide library was used to screen for PreS1
binding peptides by the biopanning procedure according to the
manufacturer’s protocol. In short, biopanning was carried out by
incubating the phage display library (1011 phages/ml), which ex-
pressed random peptides that were 12 amino acids in length with
the target protein. After washing away the unbound phage, a
bound phage was eluted in Tris-buffered saline (TBS) and amplified
in Escherichia coli ER2738. The amplified phage was titered to
determine the concentration and then subjected to the next round.
After five rounds of biopanning, all 39 plaques from the optimal
titering plate (plate have < 100 plaques) were picked and
amplified.
2.3. DNA sequencing
Single-stranded DNA from selected amplified phage clones was
isolated by denaturing the coat proteins with iodide buffer (10 mM
Tris–HCl, 1 mM EDTA, and 4 M NaI, pH 8.0) and precipitating with
ethanol. DNA was sequenced by Sangon Sequencing (Shanghai,
China) using the -96 gIII sequencing primer CCCTCATAGTTAGCG-
TAACG provided by NEB.
2.4. Phage enzyme-linked immunosorbent assay (ELISA)
ELISA plate wells (Greiner, Germany) were coated with the
PreS1 solution (100 lg/ml) in 0.1 M NaHCO3, pH 8.6, overnight at
4 "C and blocked with 250 ll of blocking buffer (5% BSA) for 2 h
at 4 "C. An uncoated plate was also blocked to distinguish true tar-
get binding from binding to BSA or the plastic support. Four-fold
serial dilutions of the selected phages were added to both coated
and uncoated plates starting with 1012 phages in the first well.
Plates were incubated for 2 h at room temperature and then
washed 6 times with TBST (TBS containing 0.5% Tween-20). Bound
phage was then detected with a horseradish peroxidase (HRP)-con-
jugated anti-M13 antibody (GE Healthcare). Finally, the peroxidase
activity was developed with substrate solution (0.22 mg/ml azino-
bis (3-ethylbenzthiazoline sulfonic acid) diammonium salt (ABTS)
in 50 mM citric acid, 0.05% H2O2, pH 4.0). The absorbance of the
reaction was determined at 405 nm with a Thermo Multiskan ELI-
SA reader (MA, USA).
2.5. Peptide synthesis
The selected peptides were synthesized as the C-terminus ami-
dated form by HD Biosciences (Shanghai, China). C-amidation was
used because the C-terminal residue of the displayed sequence was
fused to the phage during panning. A synthetic peptide with a free
charged carboxy terminus would introduce a negative charge,
which would likely completely abolish binding; therefore, the C-
terminal carboxylates of the synthetic peptides were amidated.
The final purity of the peptide was 98%. The peptides were dis-
solved in PBS to obtain a 50 mM stock solution. The stock solution
was stored at !70 "C.
2.6. Isothermal titration calorimetry (ITC)
ITC measurements were carried out at 25 "C using a VP-ITC
titration calorimeter (MicroCal, Northampton, MA). Degassed pep-
tide solutions were added at a concentration of 1 mM into the reac-
tion chamber containing PreS1 at a concentration of 20 lM. To
account for the thermal effects of dilution and mixing, heats deter-
mined by a reference run were subtracted from the experimental
values. Calorimetric data were analyzed using MicroCal ORIGIN
software 5.0. The amount of heat evolved upon the addition
of ligand can be represented by the equation
Q ¼ V 0 DHb ½M$t K a ½L$=ðl þ K a ½L$Þ, where V0 is the volume of the
chamber, DHb is the enthalpy of binding per mole of ligand, [M]t
is the total macromolecule concentration including bound and free
fractions, Ka is the binding constant, and [L] is the free ligand con-
centration. The enthalpy change for each injection series was cal-
culated by integrating the area under the recorded peaks for the
enthalpy changes and then subtracting the value for the control
titration.
2.7. Inhibitory activity of synthetic peptides
The inhibition activity of the synthetic peptides was evaluated
via ELISA (Fig 4A). The detection of PreS1 using a commercial diag-
nostic kit for HBV PreS1 antigen (Kehua Biotech, Shanghai, China)
was performed according to the manufacturer’s instructions.
Two-fold serial dilutions of the peptides were incubated with the
equivalent volume of positive control solution that contained
HBV virions at 37 "C for 1 h. The mixture was transferred to micro-
titer wells coated with an anti-PreS1 monoclonal antibody and
incubated for 30 min at 37 "C. The wells were washed and incu-
bated with HRP-labeled anti-HBs for 30 min at 37 "C. Color was
developed and measured as described above.
3. Results
3.1. Expression and purification of PreS1
PreS1 was found predominantly in the supernatant of the bac-
terial lysate, which indicated that PreS1 was soluble. As shown in
Fig. 1A, PreS1 could be successfully separated from the lysate mix-
ture, and a few contaminants were detected by SDS–PAGE analysis.
HPLC was used to desalt the protein and improve the purity. As
shown in Fig. 1B, a major peak eluted at approximately 34 min;
this peak was identified as PreS1 using SDS–PAGE (data not
shown). Peaks eluted at the beginning (4 min) and retention times
greater than that of PreS1 (37–43 min) were identified as salt and
contaminants, respectively. The concentration of purified PreS1,
estimated by the absorbance at 280 nm, was 2 mg/ml.
3.2. Phage ELISA
After the 5th panning round, a total of 39 phage clones were se-
lected and amplified as described above. As shown in Fig. 2, the
absorbance obtained from each phage combined with the target
protein was significantly higher than that of the control (i.e.,
BSA), and the binding efficiency was concentration-dependent
(data not shown). Because it was hard to obtain a precisely uniform
phage titer, all of the phages were assayed in the concentration
range of 1012–1013; therefore, the absorbance values did not corre-
late with the phage binding affinity. All of the positive clones spe-
cifically bound to PreS1, but the higher absorbance values might
not be indicative of stronger binding.
3.3. Sequences analysis of selected phages
The coding sequences of all 39 positive clones were determined,
and the corresponding peptide sequences were deduced. A total of
seven distinct sequences were found (Table 1), and among the 39
positive clones, P7 occurred, remarkably, 28 times. An interesting
feature of these peptides was the frequent presence of histidine
residues, implying that histidine is a common feature required
 W. Wang et al. / Biochemical and Biophysical Research Communications 412 (2011) 633–637 635

A M 1 B
Table 1
Enrichment and analysis of PreS1-specific phages by biopanning.

No. Phage clones Frequency Deduced amino

acid sequences
P1 52, 57, 518 3/39 HWGNHSKSHPQR
P2 56, 58 2/39 HTLHRQVPKHWL
P3 515, 521 2/39 HYQHNTHHPSRW
P4 53 1/39 HSSSASDRSRPL
P5 522 1/39 STHHRHYHDTLA
P6 59, 67 2/39 GHIHSMRHHRPT
15 P7 51, 54, 55, 510, 511, 512, 513, 514, 28/39
* 516, 517, 519, 520, 523, 524, 525,
KHMHWHPPALNT

10 526, 527, 528, 529, 530, 61, 62, 63,

Fig. 1. Expression and purification of PreS1. (A) SDS–PAGE analysis of PreS1. Lane
M: protein marker (the molecular weight is indicated on the left); Lane 1: PreS1
(13.4 kDa) is indicated with an asterisk. (B) HPLC analysis: fragments were eluted
using a linear water/acetonitrile/0.1% TFA gradient ranging from 5% to 95%
acetonitrile in 60 min.
for PreS1 binding among these peptides. Alignment of the peptides
revealed a putative PreS1 binding consensus motif: HXnHXmHP/R
(X represents a random amino acid, and n and m may be 1, 2, or 3).
The three histidine residues were highly conserved among the se-
ven sequences except in P4. Neutral amino acids, such as trypto-
phan/serine/methionine, were observed next to the first and
second histidines. In contrast, the position adjacent to the last his-
tidine showed a preference for the basic amino acid arginine or the
amide acid proline.
3.4. Thermodynamic characterization of synthetic peptides
ITC is the most quantitative means available for measuring the
thermodynamic properties of a protein–protein interaction. This
method detects the heat absorbed or released during the binding
reaction (i.e., the binding enthalpy) [21,22]. In our study, binding
equilibrium data were confirmed directly by measuring the heat
evolved upon the association of a ligand peptide with its target
binding protein. As the ligand concentration increased, the associ-
ation reaction became saturated, and subsequently, less heat was
evolved or absorbed upon further addition of the material under
titration. ITC is a universal method that has been applied to a wide
range of chemical and biochemical binding interactions [23–25].
Numerous examples of antibody–antigen binding have been
characterized by ITC. Very tight binding complexes, such as anti-
body–antigen interactions, yield Ka values in the range of 109–
1010 M !1, while complexes of strong-to-medium strength give Ka
values in the range of 104–106 M !1, and complexes with low
binding affinities yield Ka values of less than 102 M !1 [22]. We
64, 65, 66, 68, 69
Consensus motif HXnHXmHP/R
determined the binding abilities of seven peptides for PreS1
(Fig. 3). The value of Ka obtained from P7 was the highest, indicat-
ing that P7 has the highest affinity for PreS1 among the seven pep-
tides. Our experimental results provide evidence of a strong
binding interaction between P7 and the PreS1 protein.
3.5. P7 blocking HBV attachment
As the most enriched peptide and having the tightest binding
abilities, P7 was hypothesized to block the attachment of HBV
effectively. This attachment was analyzed by ELISA. As shown in
Fig. 4A, when preincubated with HBV virions, P7 shielded the key
sites of PreS1 and prevented HBV from binding with the PreS1 anti-
body. With higher concentrations of P7, more virus was blocked
and absorbance values were lower. As shown in Fig. 4B, treatment
with 0.02–25 mM peptide clearly inhibited the binding of HBV to
the PreS1 antibody in a dose-dependent manner, which indicated
that this peptide could effectively block the relevant epitope of
PreS1.
4. Discussion
Inhibition of HBV infection of hepatocytes is a rational target for
the treatment of hepatitis B. Molecules or ligands that specifically
bind to HBV will likely interfere with viral attachment and hence
reduce or block infection. It has been reported that several
preS1-derived lipo-peptides exhibit great inhibitory activity
against HBV infection [10,26–30]. However, the lipo-peptides
interfere with HBV infection via interacting with hepatocyte recep-
tors, whereas the phage-display-derived peptides interact with the
virus directly. Meanwhile, these lipo-peptides, analogs of the preS1
fragment, generally contain approximately 40 amino residues with

Abs
2.5 PreS1
BSA
2

1.5

0.5

0
c1 c3 c5 c7 c9 c11 c13 c15 c17 c19 c21 c23 c25 c27 c29 c31 c33 c35 c37 c39

Fig. 2. Binding capacity of the selected phage against PreS1. Data are expressed as means ± SD.
636 W. Wang et al. / Biochemical and Biophysical Research Communications 412 (2011) 633–637

A B

Ka

P1 7081±1693

P2 1433±542.8

P3 532.2±1030

P4 1527 ±1344

P5 3121±117

P6 6437±1342

P7 7.21×104±4.15×104

Fig. 3. ITC profiles of the binding of peptides to PreS1. (A) Ka values of seven peptides, among which the values for P7 was the highest. (B) Top: data obtained from 28
automatic injections of sequential 10 ll aliquots of a 1 mM P7 solution injected into a 20 lM PreS1 solution. Bottom: the integrated curve of enthalpy generation showing
points (squares) and the best fit (line). Plot of the heat evolved per mole of P7 added against the molar ratio of peptide to PreS1.

three histidine residues. The amino acid following the first histi-
A dine was most commonly methionine (M). In some cases, this po-
sition was occupied by amino acids containing a hydroxyl group
(threonine (T), tyrosine (Y) and serine (S)). In the position next to
the second histidine, tryptophan (W) was most frequently ob-
served. Proline was also conserved among the selected peptides,
although a preference for the basic amino acids arginine (R) was
also observed. Proline is more conformationally restricted than
other amino acids. Because its cyclically bonded structure fixes
its conformational degrees of freedom, proline-containing peptides
possess the ability to turn and reorient to produce the required
compact structure in a relatively stable manner [31].
B 120 Among the 39 positive phages, 28 (72%) contained a consensus
Abs (% of positive control)

100 sequence, KHMHWHPPALNT, which implies that this sequence was

80
60
40
20
0 ing of HBV PreS1-positive sera to the antibody of PreS1 suggesting
25.00 12.50 6.25 3.13 1.56 0.78 0.39
P7, mM
Fig. 4. P7 prevents PreS1 from binding to antibody. (A) Schematic of the inhibition
ELISA. (B) P7 blocked HBV attachment in a dose-dependent manner.
a molecular weight of approximately 4.5 kDa, making these pep-
tides more likely to promote an immune response. A group of
HBV PreS1 binding peptides were identified in this study by
screening a phage display library of random peptides. All of the se-
lected phages showed PreS1 binding activity in phage ELISA. A
remarkable feature of these peptides was the high frequency of
histidine residues, which may mediate the interaction of proteins
with lipid/water interfaces due to this residue’s positive charge.
Alignment of the peptides led to the discovery of a short consensus
motif, HXnHXmHP/R. The backbone motif structure contained
highly enriched. Another feature of P7 was its ability to block HBV
virions in addition to blocking the single recombinant protein. The
viral particle bears natural and intact conformational immuno-
genic determinants. Thus, viral particles are better for the identifi-
cation of neutralizing inhibitors rather than a single PreS1 protein.
The blocking ELISA showed that P7 was able to abrogate the bind-
0.20 0.10 0.05 0.02 that P7 covered key functional sites of native HBV virions.
Our data showed that P7 could successfully recognize and block
the PreS1 attachment. Furthermore, the conserved motif
HXnHXmHP/R, which was preferentially selected in the screen,
was identified. Additional modification of this scaffold to facilitate
even higher affinity should allow it to serve as a delivery vehicle for
imaging, diagnostics, and therapeutic agents to tissues affected by
HBV.
Acknowledgments
This study was supported by National Key Scientific Program
(the 973 program, 2010CB530100), the Knowledge Innovation Pro-
gram of the Chinese Academy of Sciences (KSCX2-YW-R-147), and
China Mega-Project for Infectious Diseases grants (2008ZX10002-
009).
 W. Wang et al. / Biochemical and Biophysical Research Communications 412 (2011) 633–637 637

References [17] J.K. Scott, G.P. Smith, Searching for peptide ligands with an epitope library,
Science 249 (1990) 386–390.
[18] G. Castel, M. Chtéoui, B. Heyd, N. Tordo, Phage display of combinatorial peptide
[1] D. Ganem, A.M. Prince, Hepatitis B virus infection-natural history and clinical
libraries: application to antiviral research, Molecules 16 (2011) 3499–3518.
consequences, New England Journal of Medicine 350 (2004) 1118–1129.
[19] S.F. Parmley, G.P. Smith, Antibody-selectable filamentous fd phage vectors:
[2] B. Rehermann, M. Nascimbeni, Immunology of hepatitis B virus and hepatitis C
affinity purification of target genes, Gene 73 (1988) 305–318.
virus infection, Nature Reviews Immunology 5 (2005) 215–229.
[20] K.L. Wu, X. Zhang, J. Zhang, Y. Yang, Y.X. Mu, M. Liu, L. Lu, Y. Li, Y. Zhu, J. Wu,
[3] T.L. Wright, Introduction to chronic hepatitis B infection, American Journal of
Inhibition of Hepatitis B virus gene expression by single and dual small
Gastroenterology 101 (2006) S1–6.
interfering RNA treatment, Virus Research 112 (2005) 100–107.
[4] E. Cholongitas, J. Goulis, E. Akriviadis, G.V. Papatheodoridis, Hepatitis B
[21] S. Majumdar, A. Hajduczki, R. Vithayathil, T.J. Olsen, R.M. Spitler, A.S. Mendez,
immunoglobulin and/or nucleos(t)ide analog(s) for prophylaxis from
T.D. Thompson, G.A. Weiss, In vitro evolution of ligands to the membrane
hepatitis B virus recurrence after liver transplantation: a systematic review,
protein caveolin, Journal of the American Chemical Society 133 (2011) 9855–
Liver Transplantation (2011). doi: 10.1002/lt.22354.
9862.
[5] M. Viganò, P. Lampertico, Antiviral drugs for HBV liver disease, Expert Opinion
[22] G. Zolotnitsky, U. Cogan, N. Adir, V. Solomon, G. Shoham, Y. Shoham, Mapping
on Biological Therapy 11 (2011) 285–300.
glycoside hydrolase substrate subsites by isothermal titration calorimetry,
[6] P. Marcellin, T. Asselah, N. Boyer, Treatment of chronic hepatitis B, Journal of
Proceedings of the National Academy of Sciences of the United States of
Viral Hepatitis 12 (2005) 333–345.
America 101 (2004) 11275–11280.
[7] Q. Deng, J.W. Zhai, M.L. Michel, J. Zhang, J. Qin, Y.Y. Kong, X.X. Zhang, A.
[23] H.Y. Wu, X.L. Zhang, Q. Pan, J. Wu, Functional selection of a type IV pili-binding
Budkowska, P. Tiollais, Y. Wang, Y.H. Xie, Identification and characterization of
peptide that specifically inhibits Salmonella Typhi adhesion to/invasion of
peptides that interact with hepatitis B virus via the putative receptor binding
human monocytic cells, Peptides 26 (2005) 2057–2063.
site, Journal of Virology 81 (2007) 4244–4254.
[24] J. Tao, J.J. Xiang, D. Li, N. Deng, H. Wang, Y.P. Gong, Selection and
[8] V. Bruss, D. Ganem, The role of envelope proteins in hepatitis B virus assembly,
characterization of a human neutralizing antibody to human fibroblast
Proceedings of the National Academy of Sciences of the United States of
growth factor-2, Biochemical and Biophysical Research Communications 394
America 88 (1991) 1059–1063.
(2010) 767–773.
[9] V. Bruss, Hepatitis B virus morphogenesis, World Journal of Gastroenterology
[25] X. Zhou, R.M. Kini, J. Sivaraman, Application of isothermal titration calorimetry
13 (2007) 65–73.
and column chromatography for identification of biomolecular targets, Nature
[10] J. Petersen, M. Dandri, W. Mier, M. Lütgehetmann, T. Volz, F. von Weizsäcker,
Protocols 6 (2011) 158–165.
U. Haberkorn, L. Fischer, J.M. Pollok, B. Erbes, S. Seitz, S. Urban, Prevention of
[26] P. Gripon, S.J. Le, S. Rumin, C. Guguen-Guillouzo, Myristylation of the hepatitis
hepatitis B virus infection in vivo by entry inhibitors derived from the large
B virus large surface protein is essential for viral infectivity, Virology 213
envelope protein, Nature Biotechnology 26 (2007) 335–341.
(1995) 292–299.
[11] P. Gripon, J. Le Seyec, S. Rumin, C. Guguen-Guillouzo, Myristylation of the
[27] J. LeSeyec, P. Chouteau, I. Cannie, C. Guguen-Guillouzo, P. Gripon, Infection
hepatitis B virus large surface protein is essential for viral infectivity, Virology
process of the hepatitis B virus depends on the presence of a defined sequence
213 (1995) 292–299.
in the pre-S1 domain, Journal of Virology 73 (1999) 2052–2057.
[12] J. Le Seyec, P. Chouteau, I. Cannie, C. Guguen-Guillouzo, P. Gripon, Infection
[28] A. Barrera, B. Guerra, L. Notvall, R.E. Lanford, Mapping of the hepatitis B virus
process of the hepatitis B virus depends on the presence of a defined sequence
pre-S1 domain involved in receptor recognition, Journal of Virology 79 (2005)
in the preS1 domain, Journal of Virology 73 (1999) 2052–2057.
9786–9798.
[13] A. Barrera, B. Guerra, L. Notvall, R.E. Lanford, Mapping of the hepatitis B virus
[29] D. Glebe, S. Urban, E.V. Knoop, N. Cag, P. Krass, S. Grun, A. Bulavaite, K.
pre-S1 domain involved in receptor recognition, Journal of Virology 79 (2005)
Sasnauskas, W.H. Gerlich, Mapping of the hepatitis B virus attachment site by
9786–9798.
use of infection-inhibiting preS1 lipopeptides and tupaia hepatocytes,
[14] D. Glebe, S. Urban, E.V. Knoop, N. Cag, P. Krass, S. Grün, A. Bulavaite, K.
Gastroenterology 129 (2005) 234–245.
Sasnauskas, W.H. Gerlich, Mapping of the hepatitis B virus attachment site by
[30] D.H. Kim, Y. Ni, S.H. Lee, S. Urban, K.H. Han, An anti-viral peptide derived from
use of infection-inhibiting preS1 lipopeptides and tupaia hepatocytes,
the preS1 surface protein of hepatitis B virus, BMB Reports 41 (2008) 640–644.
Gastroenterology 129 (2005) 234–245.
[31] H.B. Lowman, Y.M. Chen, N.J. Skelton, D.L. Mortensen, E.E. Tomlinson, M.D.
[15] M. Engelke, K. Mills, S. Seitz, P. Simon, P. Gripon, M. Schnölzer, S. Urban,
Sadick, I.C. Robinson, R.G. Clark, Molecular mimics of insulin-like growth factor
Characterization of a hepatitis B and hepatitis delta virus receptor binding site,
1 (IGF-1) for inhibiting IGF-1: IGF-binding protein interactions, Biochemistry
Hepatology 43 (2006) 750–760.
37 (1998) 8870–8878.
[16] S.S. Sidhu, Phage display in pharmaceutical biotechnology, Current Opinion in
Biotechnology 11 (2000) 610–616.