Journal of Traditional and Complementary Medicine 13 (2023) 245e262

Contents lists available at ScienceDirect

Journal of Traditional and Complementary Medicine

journal homepage: http://www.elsevier.com/locate/jtcme

Integrating HPLC-Q-TOF-MS/MS, network pharmacology and

experimental validation to decipher the chemical substances and
mechanism of modified Gui-shao-liu-jun-zi decoction against gastric
cancer*
Wenjie Huang a, b, 1, Fang Wen b, 1, Shuai Ruan a, b, 1, Peixing Gu a, b, Suping Gu a, b,
Siyuan Song a, b, Jiayu Zhou a, b, Ye Li a, b, Jiatong Liu a, b, Peng Shu a, b, *
a
Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, China
b
Nanjing University of Chinese Medicine, Nanjing, China

a r t i c l e i n f o a b s t r a c t

Article history: Background and aim: Gastric cancer (GC) is a common malignant tumor worldwide. Modified Gui-shao-
Received 25 July 2022 liu-jun-zi decoction (mGSLJZ) is a clinically effective traditional Chinese medicine (TCM) compound in GC
Received in revised form treatment. This study aimed to analyze main chemical substances of mGSLJZ and investigate active in-
17 December 2022
gredients and molecular mechanism of mGSLJZ against GC.
Accepted 3 January 2023
Available online 8 January 2023
Experimental procedure: HPLC-Q-TOF-MS/MS was used to analyze chemical substances of mGSLJZ, and
potential active ingredients were screened from TCMSP. The target set of mGSLJZ for GC was obtained
based on SwissTargetPrediction. The PPI network was constructed to screen out core targets. GO and
Keywords:
Modified Gui-shao-liu-jun-zi decoction
KEGG enrichment analyses were conducted to identify BPs, CCs, MFs and pathways. The "active
Gastric cancer ingredient-core target-pathway" regulatory network was constructed to obtain core substances. Sub-
HPLC-Q-TOF-MS/MS sequently, Oncomine, Proteinatlas and molecular docking were performed to validate these findings. The
Network pharmacology cell experiments were conducted to confirm the anti-GC effects of mGLSJZ.
PI3K/AKT/HIF-1 pathway Results and conclusion: Forty-one potential active ingredients were filtered out from 120 chemical
substances in mGSLJZ, including various organic acids and flavonoids. The top 10 key targets, 20 related
pathways and 6 core medicinal substances were obtained based on network pharmacology analysis.
Molecular docking results indicated that the core substances and key targets had good binding activities.
The cell experiments validated that mGSLJZ and the core substances inhibited the proliferation in
multiple GC cells and that mGLSJZ restrained the migration of GC. Meanwhile, the top 5 targets and top 2
pathways were verified. The rescue experiments demonstrated that mGSLJZ suppressed the proliferation
and migration of GC through the PI3K/AKT/HIF-1 pathway.
© 2023 Center for Food and Biomolecules, National Taiwan University. Production and hosting by Elsevier
Taiwan LLC. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/
licenses/by-nc-nd/4.0/).

1. Introduction health worldwide. According to the global cancer statistics, gastric

Gastric cancer is a common malignant tumor originating from
the gastric mucosal epithelium, and is a serious hazard to human
*
Peer review under responsibility of The Center for Food and Biomolecules,
National Taiwan University.
* Corresponding author. 155 Hanzhong Road, Nanjing, Jiangsu Province, 210000,
China.
E-mail address: shupengsp@njucm.edu.cn (P. Shu).
1
These authors contributed equally to this work.
cancer ranks fifth in the disease incidence and third in tumor-
related disease mortality.1 Currently, the clinical treatment thera-
pies for GC mainly include surgery, chemotherapy, radiotherapy,
targeted therapy and immunotherapy. The use of these compre-
hensive therapies allows gastric cancer patients to obtain clinical
benefit to a certain extent. However, its attendant drug toxicity and
side effects also cannot be ignored. The history of traditional Chi-
nese medicine in tumor treatment can be traced back more than
2000 years ago in “Huangdi Neijing”. In modern times, based on the
advantages of convenient usage, low toxicity and good efficacy,

https://doi.org/10.1016/j.jtcme.2023.01.002
2225-4110/© 2023 Center for Food and Biomolecules, National Taiwan University. Production and hosting by Elsevier Taiwan LLC. This is an open access article under the CC
BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
W. Huang, F. Wen, S. Ruan et al.
List of abbreviations
HPLC-Q-TOF-MS/MS High performance liquid
chromatographyhigh performance
liquid chromatographyand Q-TOF mass
spectrometry
GC Gastric cancer
mGSLJZ Modified Gui-shao-liu-jun-zi
BPC Base Peak Chromatogram
TCM Traditional Chinese Medicine
TCMSP Traditional Chinese Medicine Systems
Pharmacology Database and Analysis Platform
BP Biological processe
CC Cellular component
MF Molecular function
OB Oral bioavailability
DL Drug-likeness
PPI Protein-protein interaction
DC Degree centrality
BC Betweenness centrality
CC Closeness centrality
TCM also plays an important role in the comprehensive tumor
treatment.
Many studies have reported that TCM therapies have significant
effects on prolonging survival period, improving life quality and
enhancing immune function in GC patients.2e4 Gui-shao-liu-jun-zi
decoction is an ancient prescription that manifests the function of
“replenishing Qi, strengthening spleen and invigorating blood cir-
culation” originating from “Bi Hua Yi Jing”. It is a classical formula
for the treatment of various gastrointestinal diseases, including
gastric cancer. Under the guidance of the basic theory of TCM and
years of clinical practice, the famous National Chinese Medicine
Practitioner Professor Shenlin Liu restructured this formula by
adding several Chinese medicines with the function of invigorating
blood circulation and eliminating stasis to enhance its curative ef-
fect against GC. The outstanding effect of mGSLJZ in prolonging the
disease-free survival period of GC patients was proven by the State
Administration of Traditional Chinese Medicine multi-center clin-
ical research program (NO. 200807022) (taking 8 years to follow up
489 patients).5 In addition, basic studies have shown that it can
inhibit the gastric cancer proliferation in vitro and in vivo,6 reduce
gastric cancer drug resistance and improve the chemotherapy
effective rate by inhibiting the expression of the DNA damage repair
enzyme FEN1.7
However, the composition of Chinese medicine herbal com-
pounds is complex, and they have multiple medicinal substances.
mGSLJZ is composed of fifteen Chinese herbal medicines. What are
the potential core substances in this prescription? What are the
core targets and pathways in its treatment for gastric cancer? Is
there a close relationship between the core substances and core
targets? There are still research vacancies for these problems,
which limits the comprehensive exploration of mGSLJZ's pharma-
codynamic mechanisms in gastric cancer and is not conducive to its
further clinical application development.
To clarify the pharmacodynamic material basis of the modified
Gui-shao-liu-jun-zi decoction in GC treatment, we used HPLC-Q-
TOF-MS/MS technology to analyze the main chemical substances
in mGSLJZ. On this basis, the network pharmacology analyses were
applied to systematically identify the core substances, essential
targets and pathways for GC treatment. Besides, a series of cell
experiments were conducted to confirm the anti-GC functions and
246
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
mechanisms of mGSLJZ. The effects of mGSLJZ and four core sub-
stances (caffeic acid, paeoniflorin, sinensetin, nobiletin, which are
currently available on the market) on the proliferation capacity of
multiple gastric cancer cell lines were observed. The inhibitory
effect of mGSLJZ on GC migration was also studied. In addition, the
expression changes in the main targets and pathways were verified.
Finally, the rescue experiments using mGSLJZ combined with the
pathway activator IGF-1 confirmed that mGSLJZ can restrain the
proliferation and migration of GC cells through the PI3K/AKT/HIF-1
pathway. The flowchart of the research procedure is shown in the
graphical abstract.
2. Materials and methods
2.1. Instruments
Ultimate 3000 high performance liquid chromatography,
1000 mm*1000 mm*1000 mm (Thermo Fisher, USA); SIL-20A XR
UFLC (Shimadzu, Japan); TripleTOF™ 5600 LC/MS/MS (AB Sciex,
USA); electronic scales (Tianjin Balance Instrument Co., Ltd., China);
SHZ - D (III) type circulating water vacuum pump (Nanjing Wenke
Instrument equipment Co., Ltd., China); KQ-500B ultrasonic cleaner
(Kunshan Ultrasonic Instrument Co., Ltd., China).
2.2. Reagents and medicinal materials
Methyl alcohol (TEDIA, USA), formic acid (TEDIA, USA) and
acetonitrile (Merch, Germany) were used in the HPLC-Q-TOF-MS/
MS analysis. Human gastric cancer cells AGS and HGC-27 were
purchased from National Collection of Authenticated Cell Cultures
(China); MKN-74 was purchased from Sunncell, Inc. (China). Cells
were cultured in RMPI1640 medium containing 10% fetal bovine
serum (FBS), 100 mg/ml ampicillin and 100 mg/ml streptomycin at
37
C with 5% CO2. Cell-Counting-Kit-8 (CCK-8) was purchased
from Jiangsu KeyGEN BioTECH, Inc. (China). HIF-1a, AKT, p-AKT and
b-actin antibodies were purchased from Proteintech, Inc (China);
PI3K and p-PI3K antibodies were purchased from Affinity, Inc
(China). HRP-labeled Goat Anti-Rabbit IgG, HRP-labeled Goat Anti-
Mouse IgG were purchased from Beyotime Biotechnology (China).
Caffeic acid, paeoniflorin, sinensetin and nobiletin were purchased
from MCE, Inc (China).
The traditional Chinese medicinal materials of mGSLJZ were
purchased from the pharmacy of the Affiliated Hospital of Nanjing
University of Chinese Medicine. The compositions of mGSLJZ were
as follows:
Astragalus mongholicus Bunge 15g; Codonopsis pilosula (Franch.)
Nannf. 15g; Citrus  acida Pers. 6g; Pinellia tuberifera Ten. 10g; Poria
cocos (Schw.) Wolf 10g; Aucklandia costus Falc. 6g; Wurfbainia uli-
ginosa (J.Koenig) Giseke 3g; Atractylodes macrocephala Koidz 10g;
Paeonia lactiflora Pall. 10g; Angelica sinensis (Oliv.) Diels 10g; Spar-
ganium stoloniferum (Buch.-Ham. ex Graebn.) Buch.-Ham. ex Juz.
10g; Curcuma aromatica Salisb. 10g; Salvia chinensis Benth. 30g;
Scleromitrion angustifolium (Cham. & Schltdl.) Benth. 30g; Glycyr-
rhiza glabra L. 5g.
The plant names have been proofed with the data in www.
theplantlist.org. The quality of all herbal medicines was identified
by professional Chinese pharmacists in the pharmacy department
to comply with the pharmacopoeia requirements.
2.3. HPLC-Q-TOF-MS/MS technology for chemical substance
analysis of mGSLJZ
The preparation of mGSLJZ samples: mGSLJZ was fully pulver-
ized and 180g dry powder was precisely weighed. 180g mGSLJZ
powder was soaked in double steam water (1:10) for 1h and was
W. Huang, F. Wen, S. Ruan et al.
reflux extracted two times (60min for the first time and 30min for
the second time). The filtrate was then dried by rotary evaporator at
70
C. Finally, the extract was obtained at a yield of 22.2% and it was
reconstituted with absolute ethanol into a 10 ml volume.
Chromatographic conditions: The chromatographic column
Hedera C18 (250 mm  4.6 mm, 5 mm). Mobile phase parameters:
0.1% formic acid(B)0.1% formic acid methanol (C), gradient elution
(0~7min, 97%e97% B; 7min ~ 15min, 97%e50% B; 15e20 min, 50%e
10% B; 20e25 min, 10%e97% B; 25e37 min, 97%e97% B); flow rate:
1 ml min1; column temperature: 30
C; injection volume: 5 ml. The
detection wavelength of DAD was 260 nm.
Mass spectrum conditions: Quality scanning range: m/z
50e1500; Ion source temperature: 550
C; Air curtain flow rate:
40 L/min. Atomization gas flow rate: 55 L/min. Auxiliary gas flow
rate: 55 L/min. Spray voltage: 4500V; declustering
potential: 100 V.
Data processing: Peakview 2.0 software (AB SCIEX, USA). Ac-
cording to the MS fragment information and precise relative mo-
lecular mass in the mass spectrum data, the fitted molecular
formula and the mass deviation range (d)  5  10-6, the possible
substances were preliminarily obtained. Then, the structures of the
substances were identified by referring to the SciFinder database,
mass spectrometry fragment information and relevant literature.
2.4. Filtration of potential active ingredients in mGSLJZ
The pharmacological effects of traditional Chinese medicinal
materials can only be achieved through the absorption, distribu-
tion, metabolism and excretion process (ADME process) in the
body. The oral bioavailability (OB) and drug-likeness (DL) indexes
are the essential pharmacokinetic characteristic in the ADME pro-
cess.8 In TCMSP database (https://tcmspw.com/tcmsp.php), OB and
DL were considered as the main parameters for screening optimal
active ingredients from the chemical substances obtained by LC/MS
analysis. And in order to screen the active ingredients as compre-
hensively as possible, the filter criteria were set as OB  25% and
DL  0.05.
2.5. Identification of candidate targets in mGSLJZ against gastric
cancer
The format of active ingredients was converted into SMILES
structural formulas through the PubChem database (https://
pubchem.ncbi.nlm.nih.gov/). And the SMILES structural formulas
were applied to predict all candidate targets of mGSLJZ based on
the SwissTargetPrediction database (http://www.
swisstargetprediction.ch/). The probability TOP50 targets pre-
dicted by each SMILES structure were collected for further analysis.
In the DisGeNET database (http://www.disgenet.org/), "gastric
cancer", "gastric carcinoma", "stomach cancer" and "stomach car-
cinoma" were used as the key search terms to screen for disease
targets of gastric cancer. At last, the targets of active ingredients and
disease targets of GC were intersected to obtain the target set of
mGSLJZ in gastric cancer treatment.
2.6. Construction of the protein-protein interaction (PPI) network
The target set of mGSLJZ for GC treatment was imported into the
String database (http://string-db.org/cgi/input.pl) for the correla-
tion analysis. A combined score 0.7 (high confidence) was set as
the filter criterion. The CytoNCA plug-in in the Cytoscape 3.7.1
software was applied to analyze the topology of the network.9 And
the median values of degree centrality (DC), betweenness centrality
(BC) and closeness centrality (CC) were calculated to filter out the
core targets.
247
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
2.7. GO and KEGG enrichment analysis
The target set of mGSLJZ for GC treatment was imported into the
DAVID database (https://david.ncifcrf.gov/) to perform the GO and
KEGG enrichment analyses. The GO enrichment analysis was
composed of three parts: biological process (BP), cellular compo-
nent (CC) and molecular function (MF). P < 0.01 was identified as
the screening criterion in both the GO analysis and KEGG enrich-
ment analysis.
2.8. Construction of the “active ingredient-core target-pathway”
network
The core targets with related active ingredients and the top 20
signaling pathways with related core targets were imported into
Cytoscape 3.7.1 software. Then, a “active ingredient-core target-
pathway” network diagram was constructed. The interactions be-
tween the active ingredients and pathways involved in the core
targets were analyzed to predict the core pharmacodynamic sub-
stances of mGSLJZ for gastric cancer treatment.
2.9. Verification of the key target expression in gastric cancer
The Oncomine database (https://www.oncomine.org/resource/
main.html) and the Human Protein Atlas database (http://www.
proteinatlas.org) were used to obtain the mRNA and protein
expression information of the key targets. Then, the comparison of
the expression differences in these key targets between gastric
cancer tissues and normal gastric mucosa tissues was carried out.
2.10. Molecular docking verification between the core substances
and key targets
To further explore whether there is a binding effect between the
core substances and the key targets, molecular docking verification
was carried out on the 6 core substances and the 10 key targets. The
3D structures of the key target protein were downloaded from the
PBD protein database (http://www.rcsb.org), and the best protein
crystal structures with observable ligands were selected. The SDF
structures of the core substances were imported into Chem3D 18.0
software for optimization. The PDB files of the core substances and
ligand molecules were imported into AutoDock Tools to construct
the PDBQT format files. Then, AutoDock Vina was applied to dock
the receptor protein with the small molecule ligands of the core
substances and the complexes were then plotted using PyMOL 2.4.0
software.10 A binding energy <0 kJ mol1 indicated a high affinity
between the core substance and the target.
2.11. Cell experiments
CCK-8 assay Cells were seeded in 96-well plates at 5  103 cells
per well and treated with different concentrations of mGSLJZ, caf-
feic acid, paeoniflorin, sinensetin or nobiletin (and/or IGF-1) for
48h. 10 ml CCK-8 reagent was added per well, and the cells were
incubated for 1h at 37
C avoid light. The absorbance was deter-
mined at 450 nm with a microplate reader.
Wound Healing Assay Cells were cultured in six-well plates
until 100% confluence. A width wound was created in each well by a
sterile micropipette tip. Cells were incubated with low serum me-
dium containing different concentrations of mGSLJZ (and/or IGF-1).
The wound images were captured with an inverted microscope
after 48h.
Q-PCR Cells were cultured in six-well plates and exposed to
mGSLJZ for 48h. Cells were collected for the extraction of total RNA
and the reverse transcription was conducted using HiscriptIII qRT
W. Huang, F. Wen, S. Ruan et al.
SuperMix for qPCR (Vazyme, China). ChamQ Universal SYBR qPCR
Master Mix (Vazyme, China) was used for quantitative real-time
polymerase chain reaction (Q-PCR) detection. The primer se-
quences are listed as follows:
b-ACTIN-f CAGATGTGGATCAGCAAGCAGGAG
b-ACTIN-r CGCAACTAAGTCATAGTCCGCCTAG
AKT1-f TGACCATGAACGAGTTTGAGTA
AKT1-r GAGGATCTTCATGGCGTAGTAG
PI3KCA-f CGGTGACTGTGTGGGACTTATTGAG
PI3KCA-r TGTAGTGTGTGGCTGTTGAACTGC
MAPK1-f ATGGTGTGCTCTGCTTATGATA
MAPK1-r TCTTTCATTTGCTCGATGGTTG
VEGFR-f GGAGCTTAAGAATGCATCCTTG
VEGFR-r GATGCTTTCCCCAATACTTGTC
STAT3-f TCGGCTAGAAAACTGGATAACG
STAT3-r TGCAACTCCTCCAGTTTCTTAA
Western blot Cells were cultured in six-well plates and exposed
to mGSLJZ (and/or IGF-1) for 48h. The cell protein was extracted
and the protein concentrations were determined by BCA assay. The
protein was separated by SDS-PAGE and transferred to PVDF
membranes. The membranes were blocked with WB quick block
buffer and incubated with the primary antibody overnight at 4
C
and then incubated with the secondary antibody for 1h. The
enhanced chemiluminescence reagent was used to detect and
visualize protein bands.
Statistical analysis SPSS 25.0 software was used for statistical
analysis. Data was presented as the mean ± SD. An independent-
sample T test was used for the comparison between two groups
and one-way ANOVA was used for the comparison between mul-
tiple groups, and. */#P < 0.05 and **/##P < 0.01 were considered as
statistically significant.
3. Results
3.1. Chemical substances and potential active ingredients in mGSLJZ
On the basis of the above chromatographic and mass spectrum
conditions, the aqueous extract sample of mGSLJZ was detected for
chemical substance analysis. The base peak chromatogram (BPC)
demonstrated that the chromatographic peaks of mGSLJZ were
abundant in both positive (Fig. 1A) and negative (Fig. 1B) modes.
Based on the TOF-MS mass spectrum, the exact mass-to-charge
ratio (m/z) of the substances can be acquired. The second-level
fragment ion of the mass can be obtained on the product ion sec-
ondary mass spectrometry. Finally, according to the relevant liter-
ature reports and the fragmentation rules, 120 chemical substances
in mGSLJZ were identified. Among them, 41 potential active in-
gredients met the filter criteria of OB  25% and DL  0.05 in TCMSP
database. Most of the active ingredients were organic acids and
flavonoids. And there were other substances, such as amino acids,
glycosides, coumarins and alkaloids (Table 1).
3.1.1. Organic acids in mGSLJZ
mGSLJZ contained many organic acids, most of which were
phenolic acids, including danshensu, trans-caffeic acid, cis-caffeic
acid, ferulic acid and salvianolic acid J. Other organic acids included
quinic acid (a cycloaliphatic organic acid) and asiatic acid (a terpene
organic acid). The peak Rt4.63min was taken as an example to
demonstrate the structure analysis of organic acids. At a retention
time of 4.63 min, the quasi-molecular ion peak of m/z 197.0456
[MH] was acquired. The molecular formula was C9H10O5 and the
exact molecular weight error was 0.3 ppm. According to the liter-
ature reported, the ion peak was preliminarily determined to be
248
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
danshensu.13 The secondary mass spectrum was shown in Fig. 1C. In
the secondary mass spectrum, this substance produced a large
amount of [MH] ions at m/z 197, and also exhibited the m/z 179
[MH-H2O] and m/z 135[MH-H2O-CO2] fragment ions, which was
corresponded with the characteristic of danshensu that it had an O-
hydroxyl group on the aromatic ring and easily removed a molecule
of H2O and CO2. Other major ion fragments m/z 123[M-H-C2H2O3]
and m/z 109[M-H-C3H4O3]were formed by excimer ion peak m/z
197 stripping off a molecule of C2H2O3 or C3H4O3, respectively
(Fig. 2 A).
3.1.2. Flavonoids in mGSLJZ
The chemical substances in mGSLJZ contained a large number of
flavonoids. Flavonoids are characterized by easy ionization in mass
spectrometry and diverse fragment information. In addition, they
generally present the basic parent nucleus structure of C6eC3eC6.
The flavonoids with good ADME activity identified in mGSLJZ
mainly included liquiritigenin, luteolin, acacetin, kaempferol, liq-
uiritin, hesperetin, pratensein, isoliquiritigenin, calycosin, poncirin,
biochanin A, sinensetin, formononetin and nobiletin. The peak
Rt35.14min was taken as an example to demonstrate the structure
analysis of flavonoids. The quasi-molecular ion peak m/z 287.0551
[MþH]þ was obtained at the retention of 35.14min. The molecular
formula was C15H10O6 and the exact molecular error was 0.1 ppm.
Combined with the fragment ion information and the relevant lit-
eratures, it was preliminarily identified as kaempferol.30 The sec-
ondary mass spectrum was shown in Fig. 1D. The main ion
fragment m/z 153[M þ HeC8H6O2] þwas formed by the cleavage of
RDA on the quasi-molecular ion m/z 287.0551[MþH]þ C ring. The
m/z 241 [M þ HeCH2O2]þ (m/z 241 [M þ HeH2OeCO]þ) can be
formed by excimer ion m/z 287[MþH] þ removal of a molecule of
CH2O2 and by the parent ion m/z 269 removal of one molecule of
CO. (Fig. 2B).
3.1.3. Other chemical substances in mGSLJZ
In addition to the substances mentioned above, a variety of
other pharmaceutical substances in mGSLJZ were identified in our
research. There were amino acids such as tyrosine and tryptophan;
alkaloids such as codonopsine and perlolyrine; glycosides such as
trans-melilotoside, paeoniflorin and (6aR, 11aR)-9,10-
dimethoxypterocarpan-3-O-b-D-glucoside; coumarins such as
isofraxidi, 7-hydroxycoumarin and scopoletin; terpenes such as
loliolide; sesquiterpenes such as zedoalactone A; aldehydes such as
syringaldehyde; epoxides such as germacrone-4, 5-epoxide; an-
thraquinones such as alizarin; cycloketones such as curcumenone;
saponins such as astragaloside III; and lactones such as atractyle-
nolide II.
3.2. Candidate targets of mGSLJZ in gastric cancer treatment
A total of 3168 disease targets of GC were obtained through the
DisGeNET database (repeated targets were deleted according to the
UniProt ID). Then, we took the intersection of the Probability TOP50
targets of each active ingredient in mGSLJZ with the gastric cancer
disease targets and deleted the repeated targets to finally obtain
202 candidate targets of mGSLJZ in GC treatment. The Venn dia-
gram was shown in Fig. 3A.
3.3. Construction of the PPI network and filtration of core targets
The 202 candidate targets of mGSLJZ in gastric cancer treatment
were imported into the String database to construct a PPI network
(score0.7, high confidence). The PPI network data were imported
into Cytoscape 3.7.1 software, and the CytoNCA plug-in was applied
to calculate the DC, BC and CC values. The median values of DC, BC
W. Huang, F. Wen, S. Ruan et al. Journal of Traditional and Complementary Medicine 13 (2023) 245e262

Fig. 1. The BPC and secondary ion flow diagram of mGSLJZ. The base peak chromatogram (BPC) diagram in the positive (A) and negative (B) ion mode. (C) Secondary mass
spectrometry diagram of danshensu. (D) Secondary mass spectrometry diagram of kaempferol.

and CC were 7, 66.026911 and 0.35214, respectively. Then, 58 core
targets that met the criteria of DC  7, BC  66.026911 and
CC  0.35214 were screened out (Fig. 3B, left part). After that, the
DC value was considered as the main standard to reconstruct a new
PPI network of core targets. In this PPI network, one node repre-
sented one gene, the node degree represented the number of edges
connected to this node in the network, the node size was positively
correlated with the node degree, and each edge represented the
interaction relationship between different genes. According to the
DC value, the top 10 key targets were AKT1 (DC ¼ 51), PIK3CA
(DC ¼ 44), MAPK1 (DC ¼ 43), VEGFA (DC ¼ 42), STAT3 (DC ¼ 42),
HRAS (DC ¼ 36), EGFR (DC ¼ 35), HSP90AA1 (DC ¼ 35), FYN
(DC ¼ 34) and APP (DC ¼ 31). These key targets played an essential
regulatory role in the PPI network. (Fig. 3B right part).

249
W. Huang, F. Wen, S. Ruan et al. Journal of Traditional and Complementary Medicine 13 (2023) 245e262

Table 1
The active ingredients of mGSLJZ(OB  25%, DL  0.05).

NO tR(time) [MþH]þ [MH] (Error, Molecular MS/MS fragments (positive MS/MS Proposed Mol ID OB (%) DL Reference
(Error, ppm) formula ion mode) fragments compound
ppm) (negative ion
mode)

mGSLJZ1 0.57 e 191.0563(1.0) C7H12O6 e 171, 127, 109, Quinic acid MOL004544 63.53 0.06 Mortele  et al.,
93, 85, 59 201911
mGSLJZ2 1.4 182.0808(- e C9H11NO3 165, 147, 136, 123, 119, 107, e Tyrosine MOL000056 57.55 0.05 Liu et al.,
2.0) 95, 91, 77, 65 201312
mGSLJZ3 4.63 e 197.0456(0.3) C9H10O5 e 197, 179, Danshensu MOL007134 36.91 0.06 Wang et al.,
123,109 201813
mGSLJZ4 6.21 e 179.0353(1.8) C9H8O4 e 135, 134, 117, trans-caffeic acid MOL000223 25.76 0.05 Qian et al.,
107, 89 202014
mGSLJZ5 6.85 e 203.0833(3.4) C11H12N2O2 e 186, 159, 142, Tryptophan MOL001780 75.93 0.08 Ma et al.,
130, 116 201415
mGSLJZ6 6.92 e 181.0511(2.6) C9H10O4 e 163, 137, 135, Dihydrocaffeic MOL003088 32.79 0.05 Mortele  et al.,
119 acid 201911
mGSLJZ7 7.71 268.1533(- e C14H21NO4 161, 121, 88, 58 e Codonopsine MOL008395 45.83 0.13 Liu et al.,
3.9) 201312; Gao
et al., 201916
mGSLJZ8 9.99 e 179.0353(1.8) C9H8O4 e 135, 134, 117, cis-caffeic acid MOL000414 54.97 0.05 Qian et al.,
107, 89 202014
mGSLJZ9 18.32 e 193.0510(1.9) C10H10O4 e 178, 149, 134 Ferulic acid 39.56 0.06 Ma et al.,
201415
mGSLJZ10 18.73 e 325.0930(0.3) C15H18O8 e 163, 119, 117, Trans- MOL004101 36.85 0.26 Zengin et al.,
101 Melilotoside 201917
mGSLJZ11 20.14 e 221.0642(3.0) C11H10O5 e 206, 191, 175, Isofraxidin MOL005723 52.32 0.1 Huang et al.,
163, 135, 107, 201818
79
mGSLJZ12 20.3 163.0382(- e C9H6O3 163, 145, 135, 117, 89, 77, 63 e 7- MOL003875 25.36 0.05 Zhang et al.,
4.7) Hydroxycoumarin 201919; Von
et al., 200120
mGSLJZ13 21.96 e 195.1029(1.2) C11H16O3 e 151, 136, 135, loliolide MOL001500 44.66 0.08 Yang et al.,
120, 95 201821
mGSLJZ14 22.71 183.0650(- e C9H10O4 155, 140, 125, 123, 97, 95, 77, e Syringaldehyde MOL003177 67.06 0.05 Liu et al.,
1.0) 65, 201312
mGSLJZ15 23.03 481.1698(- e C23H28O11 319, 301, 197, 179, 161, 151, e paeoniflorin MOL001924 53.87 0.79 Yang et al.,
1.3) 133, 105 201922
mGSLJZ16 25.13 193.0491(- e C10H8O4 178, 165, 161, 150, 137, 133, e Scopoletin MOL000040 27.77 0.08 Fu et al., 202023
2.3) 122, 105
mGSLJZ17 26.96 235.1688(- e C15H22O2 217, 199, 189, 169, 161, 147, e Germacrone-4,5- MOL004272 36.48 0.11 Zhou et al.,
2.9) 133, 121, 119, 107, 105, 91, epoxide 201824
67
mGSLJZ18 27.8 e 537.1030(- C27H22O12 e 493, 313, 295, Salvianolic acid J MOL007142 43.38 0.72 Cao et al.,
1.6) 185 201825
mGSLJZ19 30.73 267.1584(- e C15H22O4 249, 231, 213, 203, 185, 173, e Zedoalactone A MOL004305 111.43 0.19 Zhou et al.,
2.6) 157, 145, 128, 119, 105, 91 201824
mGSLJZ20 31.55 e 255.0657(- C15H12O4 e 135, 119, 91 Liquiritigenin MOL001792 32.76 0.18 Li et al., 201926
2.3)
mGSLJZ21 32.79 e 199.0977(0.6) C10H16O4 e 155 camphoric acid MOL008286 99.13 0.07 Steimer et al.,
201727
mGSLJZ22 32.88 e 285.0401(- C15H10O6 e 270, 197, 150, Luteolin MOL000006 36.16 0.25 Witkowski
1.3) 149 et al., 201728
mGSLJZ23 32.89 265.0968(- e C16H12N2O2 247, 235, 219, 206, 205, 167, e Perlolyrine MOL002140 65.95 0.27 Liu et al.,
1.3) 140 201312
mGSLJZ24 34.33 e 283.0609(- C16H12O5 e 268, 239, 224, Acacetin MOL001689 34.97 0.24 Yin et al.,
1.1) 211 201929
mGSLJZ25 35.14 287.0551(- e C15H10O6 269,241, 153, 137,121 e kaempferol MOL000422 41.88 0.24 Zhou et al.,
0.1) 201330
mGSLJZ26 35.74 419.1331(- e C21H22O9 257, 239, 211, 147, 137 e Liquiritin MOL004903 65.69 0.74 Zeng et al.,
1.3) 201831
mGSLJZ27 35.74 e 301.0724(2.1) C16H14O6 e 286, 151, 107, Hesperetin MOL002341 70.31 0.27 Zeng et al.,
80 202032
mGSLJZ28 35.98 463.1583 e C23H26O10 301, 167, 152 e Methylnissolin-3- MOL000379 36.74 0.92 Liu et al.,
(3.4) O-glucoside 200933
mGSLJZ29 36.17 e 299.0555(- C16H12O6 e 284, 256, 255, pratensein MOL003398 39.06 0.28 Song et al.,
2.0) 227, 211, 183 201734
mGSLJZ30 37.82 e 255.0658(- C15H12O4 e 135, 119, 91 Isoliquiritigenin MOL001789 85.32 0.15 Li et al., 201926
1.9)
mGSLJZ31 37.89 285.0753(- e C16H12O5 270, 253, 225, 213, 197, 185, e Calycosin MOL000417 47.75 0.24 Liu et al.,
3.3) 157, 137 200933
mGSLJZ32 38.26 595.2007(- e C28H34O14 449, 433, 397, 353,287, 263, e Poncirin MOL013276 36.55 0.74 Xu et al., 201835
2.4) 195, 153
mGSLJZ33 41.96 285.0749(- e C16H12O5 270, 252, 224, 211, 196, 168, e Biochanin A MOL000510 25.21 0.24 Kuhn et al.,
3.0) 139 200336
mGSLJZ34 42.17 e C20H20O7 e Sinensetin MOL001803 50.56 0.45

250
W. Huang, F. Wen, S. Ruan et al. Journal of Traditional and Complementary Medicine 13 (2023) 245e262

Table 1 (continued )

NO tR(time) [MþH]þ [MH] (Error, Molecular MS/MS fragments (positive MS/MS Proposed Mol ID OB (%) DL Reference
(Error, ppm) formula ion mode) fragments compound
ppm) (negative ion
mode)

373.1269(- 358, 343, 328, 315, 271, 211, Zheng et al.,

3.4) 183 201937
mGSLJZ35 42.28 e 239.0348(- C14H8O4 e 211, 195, 183, Alizarin MOL006160 32.67 0.19 Witkowski
0.8) 167 et al., 201728
mGSLJZ36 42.31 235.1683(- e C15H22O2 217, 199, 189, 175, 161, 147, e Curcumenone MOL000898 34.17 0.11 Zhou et al.,
4.1) 133, 119, 107, 105, 91, 67 201824
mGSLJZ37 43.04 489.3565(- e C30H48O5 471, 453, 425, 407, 247, 219, e asiatic acid MOL006861 41.38 0.71 Gajbhiye et al.,
1.9) 205, 201, 189, 187, 177, 175, 201638
145, 133, 119
mGSLJZ38 44.81 269.0802(- e C16H12O4 254, 253, 237, 226, 213, 197, e formononetin MOL000392 66.39 0.21 Zuo et al.,
2.4) 181, 169, 152, 118 201939
mGSLJZ39 46.65 403.1378(- e C21H22O8 388, 373, 358, 355, 330, 327, e Nobiletin MOL005828 61.67 0.52 Zheng et al.,
2.3) 301, 211, 183 201937
mGSLJZ40 47.06 785.4662(- e C41H68O14 605, 587, 473, 455, 437, 419, e Astragaloside III MOL000405 31.83 0.1 Liu et al.,
2.5) 143 201312; Liu
et al., 200933
mGSLJZ41 47.55 233.1527(- e C15H20O2 215, 197, 187,177, 159, 151, e Atractylenolide II MOL000044 47.5 0.15 Ma et al.,
2.6) 145, 131, 105 201415

Fig. 2. The fragmentation pathway of danshensu and kaempferol. (A) The fragmentation pathway of danshensu. (B) The fragmentation pathway of kaempferol.

3.4. GO and KEGG enrichment analysis autophosphorylation, response to hypoxia, negative regulation of
apoptotic process and positive regulation of transcription from the
The GO and KEGG enrichment analyses revealed that mGSLJZ RNA polymerase II promoter to exert its therapeutic effect on
was involved in 210 biological processes (BPs), 43 cellular compo- gastric cancer by reacting on the cytosol, plasma membrane, inte-
nents (CCs), 63 molecular functions (MFs) and 85 pathways in gral component of plasma membrane, cytoplasm, extracellular
gastric cancer treatment (P < 0.05). And the bubble diagram was exosome and other cellular components. The effects on molecular
illustrated with R 3.6.3 software (Fig. 3CeF). The GO enrichment functions mainly included ATP binding, enzyme binding, steroid
analysis indicated that mGSLJZ mainly affected the biological pro- hormone receptor activity, RNA polymerase II transcription factor
cesses of peptidyl-tyrosine phosphorylation, protein activity, ligand-activated sequence-specific DNA binding, and
251
W. Huang, F. Wen, S. Ruan et al. Journal of Traditional and Complementary Medicine 13 (2023) 245e262

252
W. Huang, F. Wen, S. Ruan et al.
transmembrane receptor protein tyrosine kinase activity.
The KEGG enrichment analysis reflected the main signaling
pathways of mGSLJZ against GC. Combined with the literature re-
ports, the top 20 pathways with statistical significance were as
follows: HIF-1 signaling pathway,(hsa04066), Pathways in can-
cer(hsa05200), PI3K-Akt signaling pathway (hsa04151), Ras
signaling pathway (hsa04014), Sphingolipid signaling pathway
(hsa04071), Rap1 signaling pathway (hsa04015), T cell receptor
signaling pathway (hsa04660), B cell receptor signaling pathway
(hsa04662), VEGF signaling pathway (hsa04370), Focal adhesion
(hsa04510), Toll-like receptor signaling pathway (hsa04620),
Adherens junction (hsa04520), Apoptosis (hsa04210), ErbB
signaling pathway (hsa04012), TNF signaling pathway (hsa04668),
FoxO signaling pathway (hsa04068), mTOR signaling pathway
(hsa04150), Chemical carcinogenesis (hsa05204), Natural killer cell
mediated cytotoxicity (hsa04650), Viral carcinogenesis (hsa05203),
and Central carbon metabolism in cancer (has05230).
3.5. Construction of the “active ingredient-core target-pathway”
network
The 58 core targets and their related active ingredients, as well
as the top 20 pathways and their involved core targets were im-
ported into Cytoscape 3.7.1 software to construct the “active
ingredient-core target-pathway” network (Fig. 4). The results
demonstrated that there were 117 nodes and 473 edges in the
network, including 40 compounds (perlolyrine was not involved),
58 targets and 19 pathways (chemical carcinogenesis was not
involved). From the perspective of active ingredients, each sub-
stance was correlated with 5.38 targets on average, and 67.5% of the
active ingredients were connected to more than 5 core targets.
Among them, the substances that connected to 8 or more core
targets included trans-caffeic acid (mGSLJZ4), cis-caffeic acid
(mGSLJZ8), paeoniflorin (mGSLJZ15), zedoalactone A (mGSLJZ19),
sinensetin (mGSLJZ34) and nobiletin (mGSLJZ39). These in-
gredients may be the core pharmacological substances of mGSLJZ in
GC treatment. Except for zedoalactone A, others all presented
therapeutic effects for gastric cancer in the relevant literature.40e43
From the perspective of core targets, each target was correlated
with 3.74 active ingredients on average, and 20% of the core targets
were connected to more than 5 active ingredients. Among them,
EGFR was connected to 18 substances, ESR1 was connected to 19
substances and ESR2 was connected to 23 substances. The more
active ingredients the target connected to represented the stronger
regulatory effect of mGSLJZ on this target. From the perspective of
pathways, there were an average of 13.53 core targets in each
pathway, and 68.4% of the pathways were connected to more than
10 core targets. As shown in the network diagram, there was a
phenomenon that one core substance can regulate multiple path-
ways through various targets, and different substances can influ-
ence the same target and pathway, which was consistent with the
regulatory mechanism of multi-substance, multi-target and multi-
pathway interaction in Chinese medicine compounds.
3.6. Verification of key target expression in gastric cancer
Based on the above analysis, we have basically derived the core
substances, key targets and pathways of mGSLJZ in gastric cancer
treatment. Then, we selected the top 10 core targets to verify their
Fig. 3. The targets and GO/KEGG enrichment analysis for mGSLJZ in gastric cancer treatment. (A) The Venn diagram of the targets for mGSLJZ in gastric cancer treatment (202
targets in total). (B) The PPI network diagram of mGSLJZ in gastric cancer treatment was constructed based on String database. And CytoNCA plug-in was applied to filtrate core
targets according to the DC, BC and CC values. According to the P Value, the bubble diagram demonstrated the top 20 biological process(C), cellular components(D), molecular
function(E) and KEGG pathways(F) of mGSLJZ in gastric cancer treatment. The bubble size represented the number of enrichment genes, and the bubble color represented the levels
of gene enrichment.
253
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
expression in gastric cancer tissues and normal gastric mucosal
tissues so as to further provide clinical evidence for mGSLJZ in GC
treatment. The mRNA expression levels of AKT1, PIK3CA, MAPK1,
VEGFA, STAT3, HRAS, EGFR, HSP90AA1, FYN and APP in gastric
cancer tissues and normal gastric mucosal tissues were reported to
significantly different (P < 0.05). As shown in the boxplots (Fig. 5A),
the gene expression levels of the key targets were significantly
upregulated in gastric cancer tissues. The protein expression status
of the key targets was collected in the Human Protein Atlas data-
base. Compared with the normal gastric mucosal tissues, the pro-
tein expressions of these targets were also increased according to
the immunohistochemical staining images (Fig. 5B).
3.7. Molecular docking between the core substances and the key
targets
In the molecular docking process, the lower value of confor-
mational stability of the ligand binding to the receptor represents
the stronger binding possibility between two ingredients. Usually, a
binding energy <0 indicates that the two substances can sponta-
neously bind to each other. We conducted molecular docking be-
tween the top 10 key targets and the 8 core substances obtained in
the“active ingredient-core target-pathway” network. The results
showed that all the binding energies were lower
than 4.5 kJ mol1, indicating that these core substances had
excellent binding activity with the key targets (Fig. 6A). Then,
PyMOL 2.3.4 software was used to plot the optimal binding pattern
as shown in Fig. 6BeG.
3.8. Verification of the anti-GC effect of mGSLJZ and core substances
To verify the anti-gastric cancer effects of mGSLJZ and the core
substances, cell proliferation experiments were first carried out.
We observed the effects of mGSLJZ and the four core substances
(caffeic acid, paeoniflorin, sinensetin and nobiletin, which were
currently available on the market) on the cell viability rates of three
gastric cancer cell lines (AGS, HGC-27 and MKN-74). The results
exhibited that mGSLJZ and these four core substances can signifi-
cantly inhibit the proliferation of gastric cancer cells (Fig. 7A). The
relevant IC50 was shown in Fig. 7B and it was considered as the
appropriate administration concentration in the following experi-
ments. This indicated that mGSLJZ and its core substances can
effectively suppress the proliferation of gastric cancer in multiple
GC cell lines.
In addition, in order to better evaluate the cytotoxicity of these
drugs, we treated gastric epithelial cells GES-1 with the highest
IC50 of each drug among the three cell lines. As shown in Fig. 7C,
with the separate interventions of mGSLJZ, caffeic acid, paeoni-
florin, sinensetin and nobiletin, the cell viability of GES-1 was
97.72 ± 3.56%, 85.17 ± 8.57%, 92.84 ± 2.81%, 96.02 ± 2.93% and
94.72 ± 5,33%. There was no statistical difference between the
administration group and the control group. This showed that
mGSLJZ and the core substances have no obvious toxic on normal
gastric epithelial cells while suppressing gastric cancer.
Since cell migration was the basis of tumor metastasis and is an
important tumor malignant behavior in addition to proliferation,
we observed the effect of mGSLJZ on the migration of gastric cancer
cells. As shown in Fig. 7D, in the AGS, HGC-27 and MKN-74 cell
lines, the relative migration rates after mGSLJZ intervention were
W. Huang, F. Wen, S. Ruan et al.
Fig. 4. The interactive network diagram of “Active ingredient-core target-pathway”. The green nodes represented 40 active ingredients (perlolyrine was not involved); The pink
nodes represented 58 core targets; The blue nodes represented 19 pathways (chemical carcinogenesis was not involved). The more edges a node connected, the more important its
role in the interactive network.
36.18 ± 2.23%, 38.72 ± 3.98% and 25.90 ± 5.00%, respectively. These
results indicated that mGSLJZ can significantly restrain the migra-
tion ability of gastric cancer cells.
3.9. Validation of targets and pathways of mGSLJZ in GC treatment
On the basis of proving that mGSLJZ had significant anti-gastric
cancer effects, to further validate the feasibility of targets and
pathways predicted by pharmacology network analysis, Q-PCR was
applied to examine the expression of the top 5 key targets in PPI
network. As shown in Fig. 8A, the relative mRNA expression of
AKT1, PI3KCA, MAPK1, VEGFA and STAT3 was obviously decreased
after mGSLJZ intervention. Then, Western blot was used to detect
the changes of the top 2 pathways predicted by KEGG analysis. On
account of that PI3K/AKT and HIF-1 pathway were the top 2
pathways in the KEGG analysis, and the current literature sug-
gested44,45 that PI3K/AKT was the upstream pathway of HIF-1. The
results demonstrated that mGSLJZ restrained the protein expres-
sion of p-PI3K/AKT and p-AKT/AKT and HIF-1a, which indicated
that mGSLJZ can inhibit the activation of the PI3K/AKT/HIF-1
pathway (Fig. 8B).
3.10. Rescue experiments of mGSLJZ combined with IGF-1 on the
PI3K/AKT/HIF-1 pathway
In the above study, we found that mGSLJZ can deactivate the
PI3K/AKT/HIF-1 pathway. To further verify the pathway more
accurately, we used the upstream activator IGF-1 of the PI3K/AKT to
intervene the GC cells in combination with mGLSJZ, and further
observed the changes in the pathway protein expression. The re-
sults demonstrated that, among the three gastric cancer cell lines,
the protein expression levels of p-PI3K/AKT and p-AKT/AKT and
HIF-1a in the mGSLJZ þ IGF-1 group were significantly restored
compared with those in the mGSLJZ alone group (Fig. 9) . It was
suggested that HIF-1 was the downstream pathway of PI3K/AKT.
And the exact inhibitory effect of mGSLJZ on PI3K/AKT/HIF-1
pathway was further proved.
3.11. Validation of the anti-GC effect of mGLJSZ through the PI3K/
AKT/HIF-1 pathway
Based on the above results, we explored whether mGSLJZ
inhibited the proliferation and migration of gastric cancer cells
through the PI3K/AKT/HIF-1 pathway. After the intervention of
mGSLJZ combined with IGF-1, the restoration effects of cell prolif-
eration and migration were observed. The results showed that in
these three gastric cancer cell lines, the cell viability of the
254
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
mGSLJZ þ IGF-1 group tended to increase compared with that of
the mGSLJZ group (Fig. 10A). Similarly, the cell migration rate of the
mGSLJZ þ IGF-1 group was higher than that of the mGSLJZ group
(Fig. 10B). The above experiments revealed that IGF-1 can partially
counteract the inhibitory effect of mGSLJZ on the proliferation and
migration of gastric cancer, which confirmed that mGSLJZ had an
anti-GC effect through the PI3K/AKT/HIF-1 pathway.
4. Discussion
Gastric cancer is one of the most common malignant tumors
that threatens people's lives and health worldwide. Traditional
Chinese medicine plays an important role in the treatment of GC.
Modified Gui-shao-liu-jun-zi decoction was derived from the
famous classical TCM prescription “Gui-shao-liu-jun-zi decoction”
which plays an important role in the treatment of multiple
gastrointestinal diseases. The famous National Chinese Medicine
Practitioner Professor Shenlin Liu created this formula based on
decades of clinical experience with TCM treatment in gastric can-
cer. A multi-center clinical study (NO.200807022) demonstrated
that the combination therapy of mGSLJZ and chemotherapy can
decrease the recurrence rate of stage II and III gastric cancer
(P ¼ 0.0042).5Meanwhile, the basic scientific studies revealed that
this formula suppressed the MDR1 medicated drug resistance in
gastric cancer through the PI3K/AKT pathway and reduced the
expression of FEN1 to inhibit the DNA damage repair in drug
resistant GC cells.7,46 However, the composition of the traditional
Chinese medicine compound is complex, and current researches
are far from fully explaining the complete mechanisms of this
prescription in GC treatment. Therefore, the discovery of the po-
tential core substances and targets in mGSLJZ against GC has great
significance for optimizing the prescription and further exploring
its mechanisms in GC treatment.
In this study, HPLC-Q-TOF-MS/MS technology was applied to
obtain high-resolution and high-precision mass spectrometric data
of mGSLJZ. According to the structure and corresponding frag-
mentation pattern of the substance, the related chemical constit-
uent can be accurately identified. This technology provides a
reliable method for the multiple substance identification in tradi-
tional Chinese medicine compounds and has broad application
prospects.47 In this research, mass spectrometric data demon-
strated the abundant chromatographic peaks in both positive and
negative ion modes, laying the foundation for the accurate quali-
tative identification of the chemical substances in mGSLJZ. Based on
the acquisition of the primary mass spectrometric data, the con-
ditions of the secondary mass spectrometry can be optimized.
Finally, a total of 120 chemical substances, including a large number
W. Huang, F. Wen, S. Ruan et al. Journal of Traditional and Complementary Medicine 13 (2023) 245e262

Fig. 5. The expression of the key targets in gastric cancer and normal gastric tissues. (A) The mRNA expression levels of the key targets in gastric cancer and normal gastric tissues.
(B) The immunohistochemical images of the protein expression of the key targets in gastric cancer and normal gastric tissues.

255
W. Huang, F. Wen, S. Ruan et al. Journal of Traditional and Complementary Medicine 13 (2023) 245e262

Fig. 6. The heat map of molecular docking scores (kcal/mol1) and the optimal binding pattern of the core substances combined with the key targets. (A) The binding ability scores
between the core substances and the key targets were demonstrated in the heat map. The color of the legend varied with the absolute value of the binding index. The shade of the
label color represented the strength of the binding ability. (B) Trans-caffeic acid combined with HSP90AA1; (C) Cis-caffeic acid combined with FYN; (D) Paeoniflorin combined with
AKT1; (E)Zedoalactone A combined with FYN; (F) Sinensetin combined with AKT1; (G)Nobiletin combined with AKT1.

of organic acids and flavonoids, were identified in mGSLJZ. This sensitivity, which laid a solid foundation for the quality control and
method exhibited the characteristics of rapid, simple and high pharmacological study of this prescription.

256
W. Huang, F. Wen, S. Ruan et al. Journal of Traditional and Complementary Medicine 13 (2023) 245e262

Fig. 7. The inhibitory effects of mGSLJZ and core substances on the proliferation and migration of GC. (AeB) The cell viability and IC50 of different GC cell lines (AGS, HGC-27 and
MKN-74) after mGSLJZ, Caffeic acid, Paeoniflorin, Sinensetin and Nobiletin administration for 48h. (C) The cell viability of the gastric epithelial cells GES-1 with the highest IC50 of
each drug among the three cell lines. (D) The wounding healing images and migration rates of GC cells with the intervention of mGSLJZ for 48h (The concentration of mGSLJZ was
IC50 in each cell line).

Pharmacokinetic properties are vital factors for drug screening
and design. Drugs cannot reach the target organs to exert their
therapeutic effects without suitable pharmacokinetic properties.48
Therefore, we further selected 41 substances with good ADME ac-
tivity based on the main parameters of oral bioavailability and
drug-likeness indexes using the TCMSP platform. In addition, 202
candidate targets of mGSLJZ active ingredients for gastric cancer
treatment were obtained. Through the network topology analysis,
10 key targets were identified, namely AKT1, PIK3CA, MAPK1,
VEGFA, STAT3, HRAS, EGFR, HSP90AA1, FYN and APP, which were at

257
W. Huang, F. Wen, S. Ruan et al.
Fig. 8. The expressions of the core targets and pathways with mGSLJZ intervention. (A) The mRNA expression of the top 5 core targets (AKT1, PI3KCA, MAPK1, VEGFA, STAT3) after
mGSLJZ intervention for 48h. (B) The protein expression of the top 2 core pathways (PI3K/AKT and HIF-1) after mGSLJZ intervention for 48h.
the core position in the PPI network. KEGG enrichment analysis
showed that the signaling pathways of mGSLJZ in gastric cancer
treatment mainly included HIF-1 and PI3K-Akt, etc. To further
verify the prediction results of network pharmacology analysis, a
series of experiments were conducted to investigate the thera-
peutic effect of mGSLJZ against GC. We first explored the effect of
mGSLJZ on GC biological behavior, and found that mGSLJZ can
significantly suppress GC cell proliferation and migration, which
confirming the anti-GC effect of mGSLJZ. Then, the anti-GC mech-
anisms of mGSLJZ were further revealed in combination with the
predicted targets and pathways in network pharmacology. We
found that the gene expression levels of the core targets AKT1,
PIK3CA, MAPK1, VEGFA and STAT3 were downregulated with
mGSLJZ intervention. PI3K/AKT and HIF-1 were the top 2 pathways
in the KEGG analysis, and the current literature44,45 suggested that
PI3K/AKT was the upstream pathway of HIF-1. The results
demonstrated that mGSLJZ blocked the HIF-1 pathway by reducing
HIF-1a expression, and inhibited the activation of the PI3K/AKT
pathway. The hypoxic microenvironment represented by the HIF-1
pathway is one of the microenvironmental characteristics of the
solid tumors. Gastric cancer acquires the biological characteristics
258
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
of rapid tissue growth and large energy requirements. During the
tumor growth process, the tumor tissues gradually appear hypoxia
status. HIF-1a is an essential oxygen regulatory protein of HIF-1
that plays a decisive role in the activity of the HIF-1 pathway.49
The hypoxic microenvironment increases glycolysis and changes
the way of tumor energy metabolism, therefore further affecting
the gene stability. Various oncogenes, including VEGF, are signifi-
cantly upregulated, which makes tumor cells more invasive and
proliferative.50 Current studies have found that the PI3K/Akt
signaling pathway is involved in the regulation of proliferation,
migration, metastasis, angiogenesis and apoptosis of multiple tu-
mor cells.51 The activation of this pathway upregulates the
expression of HIF-1a and VEGF, thus allowing endothelial cell
migrating to form new blood vessels and promoting the vascular
permeability, which provides a favorable environment for the cell
proliferation and migration.52 On the basis of confirming that
mGSLJZ can inhibit HIF-1 and PI3K/AKT, respectively, we performed
a series of rescue experiments with the PI3K/AKT activator IGF-1. It
was found that the addition of IGF-1 could weaken the inhibition
effect of mGSLJZ on the PI3K/AKT/HIF-1 pathway, as well as its
suppression on the cell proliferation and migration. On the one
W. Huang, F. Wen, S. Ruan et al.
Fig. 9. The expression of the PI3K/AKT/HIF-1 pathway with the combined intervention of mGSLJZ and IGF-1. The protein of the PI3K, p-PI3K, AKT, p-AKT, HIF-1a proteins after
mGSLJZ/mGSLJZ þ IGF-1 intervention for 48.
hand, these results confirmed that HIF-1 can be the downstream
pathway of PI3K/AKT. On the other hand, it was rigorously
confirmed that mGSLJZ suppressed the proliferation and migration
of gastric cancer cells through the PI3K/AKT/HIF-1 pathway.
Certainly, this was just one of the comparatively important mech-
anisms for mGSLJZ in gastric cancer treatment. According to the
analysis results of our network pharmacology and the relevant
literature, this prescription also exerted an antitumor effect in
gastric cancer by inhibiting the conduction of the SphK/S1P/S1PR
axis in the sphingolipid signaling pathway,53 reducing the expres-
sion of Rap1GAP in the Rap1 signaling pathway to inhibit the in-
vasion and metastasis of gastric cancer,54 and participating in the
antitumor immune response by intervening in the immune regu-
lation pathway mediated by the T cell receptor and so on.55 Even-
tually, it constituted a regulatory network of mGSLJZ in gastric
cancer treatment, which was also consistent with the multi-target
and multi-pathway characteristics of traditional Chinese medicine
compounds.
Therefore, what were the main substances by which mGSLJZ
exerted its anti-GC effect? By constructing a network diagram of
the “active ingredient-core target-pathway”, we obtained the core
pharmacodynamic substances of mGSLJZ for GC treatment and the
259
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
top 6 substances were trans-caffeic acid, cis-caffeic acid, paeoni-
florin, zedoalactone A, sinensetin and nobiletin. Among the six core
active ingredients, except for zedoalactone A, all the other chemical
compounds have been reported to have antitumor effects,
including for gastric cancer. Trans-caffeic acid and cis-caffeic acid
were two different isomers of caffeic acid. Although no study has
compared the antitumor effect of the two isomers, caffeic acid has
been reported to suppress the development and progression of
liver cancer,56 colorectal cancer,57 cervical cancer and other tu-
mors.58 Paeoniflorin has a wide spectrum of antitumor activities,
including inhibition of tumor cell proliferation, neovascularization,
invasion and metastasis and induction of apoptosis.59 In gastric
cancer, paeoniflorin can inhibit the migration and invasion of
gastric cancer associated fibroblasts43 and inhibit GC cell prolifer-
ation through the upregulation of microRNA-124 and suppression
of the PI3K/Akt and STAT3 signaling pathways.60 The anti-cancer
activities of sinensetin mainly involved its interaction with p-
glycoprotein and breast cancer resistance protein (ABCG2/BCRP).
And the anti-inflammatory, anti-proliferation and anti-
angiogenesis effects of sinensetin have also been widely dis-
cussed.61 It can inhibit human MGC-803 gastric cancer cell prolif-
eration and induce cell cycle blockade in G2/M phase.40 Nobiletin
W. Huang, F. Wen, S. Ruan et al. Journal of Traditional and Complementary Medicine 13 (2023) 245e262

Fig. 10. The proliferation and migration rates of GC cells with the combined intervention of mGSLJZ and IGF-1. (A) The cell viability of GC cells after mGSLJZ/mGSLJZ þ IGF-1
intervention for 48. (B) The wounding healing images and migration rates of GC cells after mGSLJZ/mGSLJZ þ IGF-1 intervention for 48.

can suppress the development of thoracic cancer, gynecological
cancer, urological cancer, gastrointestinal cancer and hematological
cancer.62 It inhibited Helicobacter pylori infection-induced gastric
carcinogenic signaling by blocking inflammation, apoptosis and
mitogen-activated protein kinase events in gastric epithelial-
1 cells.42 According to these studies, we selected four core sub-
stances (caffeic acid, paeoniflorin, sinensetin and nobiletin)
currently can be available on the market to verify their anti-gastric
cancer effects. The results revealed that these substances could
effectively inhibit the proliferation of multiple GC cells in a dose-

260
W. Huang, F. Wen, S. Ruan et al.
dependent manner. More importantly, to verify the cytotoxicity of
mGSLJZ and the core substances, we intervened gastric epithelial
cells GES-1 with the highest IC50 among the three GC cell lines. It
was found that there was no obvious proliferation toxicity on
normal gastric epithelial cells at the effective concentration for
suppressing the gastric cancer cells.
In addition, the molecular docking demonstrated good binding
efficiency between these core substances and key targets, which
further verified the central “substance-target” basis of mGSLJZ for
gastric cancer treatment. Based on the fact that these key targets
(AKT1, PIK3CA, MAPK1, VEGFA, STAT3, HRAS, EGFR, HSP90AA1, FYN
and APP) were oncogenes in most current studies, their high
expression or the existence of mutants promoted tumor progres-
sion. In our study, the overexpression status of these genes was also
found in gastric cancer tissues compared with normal gastric mu-
cosa tissues. As the core substances of the anti-GC compound
mGSLJZ, trans-caffeic acid, cis-caffeic acid, paeoniflorin, zedoa-
lactone A, sinensetin and nobiletin can be considered potential
inhibitors of these targets. The current literature also reported the
antitumor effect of these substances based on these key targets.
Caffeic acid suppressed UVB-induced skin carcinogenesis by
directly inhibiting FYN kinase activity.63 Zheng YB's research
proved that paeoniflorin inhibited GC cell proliferation partially
through the suppression of STAT3 phosphorylation.60 Sp N et al.
found that nobiletin suppressed STAT3 expression in a CD36
dependent manner to inhibit tumor angiogenesis, migration and
invasion.64 Nobiletin inhibited PD-L1 expression to reduce anti-
immune evasion through the inhibition of the EGFR/JAK2/STAT3
signaling pathway.65
However, due to the complexity constitute of traditional Chinese
medicine prescriptions and the limitations of network pharma-
cology analysis, this study was only a qualitative analysis of the
active ingredients in mGSLJZ. We obtained the mechanism of
mGSLJZ in GC treatment based on various tumor and pharmacology
databases, and some cell experiments were carried out to verify the
above results. Further studies on the quantitative analysis of the
core substances and the in vivo metabolomics studies of mGSLJZ
are still needed in the future to elucidate the basis of this pre-
scription in the treatment of gastric cancer.
5. Conclusions
mGSLJZ was rich in active ingredients, containing 41 chemical
substances with good ADME activity including various organic
acids and flavonoids. Among them, trans-caffeic acid, cis-caffeic
acid, paeoniflorin, zedoalactone A, sinensetin and nobiletin may be
the core pharmacodynamic substances for GC treatment. Both
mGSLJZ and these core substances can suppress the proliferation
and migration of multiple GC cells. mGSLJZ restrained the activity of
key targets such as AKT1, PIK3CA, MAPK1 and VEGFA. And it
exerted its effect on the inhibition of tumor proliferation and
migration through the PI3K/AKT/HIF-1 pathway. The above find-
ings were consistent with the therapeutic features of “multi-
constitute, multi-target and multi-pathway” in traditional Chinese
medicine compounds. And it provided a solid foundation for the
further pharmacodynamic studies of this prescription against GC in
the future.
Author contributions
Conception and design: Peng Shu; Administrative support: Peng
Shu; Provision of study materials: Peng Shu, Jiatong Liu; Collection
and assembly of data: Wenjie Huang, Fang Wen, Peixing Gu, Suping
Gu, Ye Li, Siyuan Song, Jiayu Zhou; Data analysis and interpretation:
Wenjie Huang, Fang Wen and Shuai Ruan; Manuscript writing:
261
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
Wenjie Huang; Final approval of manuscript: All authors. Wenjie
Huang, Fang Wen, Shuai Ruan contributed equally to this work and
are first authors.
Funding
This study was supported by the 2019 Project of Building Evi-
dence Based Practice Capacity for TCM (2019XZZX-ZL003), the
Special Fund for Base Construction of Gastric Cancer of National
Administration of Traditional Chinese Medicine (Y2020CX58) and
the Jiangsu Province Graduate Research and Practice Innovation
program (SJCX22_0768).
Declaration of competing interest
The authors declare that they have no competing interests.
Acknowledgments
Not applicable.
References
1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer
statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for
36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394e424.
2. Chen Y, Zhang G, Chen X, et al. Jianpi Bushen, a traditional Chinese medicine
therapy, combined with chemotherapy for gastric cancer treatment: a meta-
analysis of randomized controlled trials, 2018 Evid Based Complement Alternat
Med. 2018, 4924279.
3. Hung KF, Hsu CP, Chiang JH, et al. Complementary Chinese herbal medicine
therapy improves survival of patients with gastric cancer in Taiwan: a
nationwide retrospective matched-cohort study. J Ethnopharmacol. 2017;199:
168e174.
4. Liu X, Xiu LJ, Jiao JP, et al. Traditional Chinese medicine integrated with
chemotherapy for stage IV non-surgical gastric cancer: a retrospective clinical
analysis. J Integrat Med. 2017;15(6):469e475.
5. Shu P, Tang H, Zhou B, et al. Effect of Yiqi Huayu Jiedu decoction on stages II and
III gastric cancer: a multicenter, prospective, cohort study. Medicine (Baltim).
2019;98(47), e17875.
6. Tang H, Huang W, Yang Q, Lin Y, Chen Y, Shu P. Jianpi Yangwei decoction
promotes apoptosis and suppresses proliferation of 5-fluorouracil resistant
gastric cancer cells in vitro and in vivo. BMC Complement Med Ther. 2020;20(1):
337.
7. Huang W, Tang H, Wen F, Lu X, Li Q, Shu P. Jianpi-yangwei decoction inhibits
DNA damage repair in the drug resistance of gastric cancer by reducing FEN1
expression. BMC Complement Med Ther. 2020;20(1):196.
8. Kim MT, Sedykh A, Chakravarti SK, Saiakhov RD, Zhu H. Critical evaluation of
human oral bioavailability for pharmaceutical drugs by using various chem-
informatics approaches. Pharmaceut Res. 2014;31(4):1002e1014.
9. Tang Y, Li M, Wang J, Pan Y, Wu FX. CytoNCA: a cytoscape plugin for centrality
analysis and evaluation of protein interaction networks. Biosystems. 2015;127:
67e72.
10. Trott O, Olson AJ. AutoDock Vina: improving the speed and accuracy of docking
with a new scoring function, efficient optimization, and multithreading.
J Comput Chem. 2010;31(2):455e461.
11. Mortele  O, Iturrospe E, Breynaert A, et al. Optimization of an in vitro gut
microbiome biotransformation platform with chlorogenic acid as model
compound: from fecal sample to biotransformation product identification.
J Pharm Biomed Anal. 2019;175, 112768.
12. Liu MH, Tong X, Wang JX, Zou W, Cao H, Su WW. Rapid separation and iden-
tification of multiple constituents in traditional Chinese medicine formula
Shenqi Fuzheng Injection by ultra-fast liquid chromatography combined with
quadrupole-time-of-flight mass spectrometry. J Pharm Biomed Anal. 2013;74:
141e155.
13. Wang YQ, Zhuang G, Li SJ. Multiple on-line screening and identification
methods for hydroxyl radical scavengers in Yudanshen. J Pharm Biomed Anal.
2018;156:278e283.
14. Qian W, Wu W, Kang Y, et al. Comprehensive identification of minor compo-
nents and bioassay-guided isolation of an unusual antioxidant from Azolla
imbricata using ultra-high performance liquid chromatography-quadrupole
time-of-flight mass spectrometry combined with multicomponent knockout
and bioactivity evaluation. J Chromatogr A. 2020;1609, 460435.
15. Ma XQ, Leung AK, Chan CL, et al. UHPLC UHD Q-TOF MS/MS analysis of the
impact of sulfur fumigation on the chemical profile of Codonopsis Radix
(Dangshen). The Analyst. 2014;139(2):505e516.
16. Gao S, Liu J, Wang M, et al. Exploring on the bioactive markers of Codonopsis
Radix by correlation analysis between chemical constituents and
W. Huang, F. Wen, S. Ruan et al.
pharmacological effects. J Ethnopharmacol. 2019;236:31e41.
17. Zengin G, Mahomoodally MF, Paksoy MY, et al. Phytochemical characterization
and bioactivities of five Apiaceae species: natural sources for novel ingredients.
Ind Crop Prod. 2019;135:107e121.
18. Huang WP, Tan T, Li ZF, et al. Structural characterization and discrimination of
Chimonanthus nitens Oliv. leaf from different geographical origins based on
multiple chromatographic analysis combined with chemometric methods.
J Pharm Biomed Anal. 2018;154:236e244.
19. Zhang K, Yan M, Han S, et al. Identification of chemical markers for the
discrimination of radix Angelica sinensis grown in geoherb and non-geoherb
regions using UHPLC-QTOF-MS/MS based metabolomics. Molecules.
2019;24(19).
20. von Weymarn LB, Murphy SE. Coumarin metabolism by rat esophageal mi-
crosomes and cytochrome P450 2A3. Chem Res Toxicol. 2001;14(10):
1386e1392.
21. Yang HH, Oh KE, Jo YH, et al. Characterization of tyrosinase inhibitory con-
stituents from the aerial parts of Humulus japonicus using LC-MS/MS coupled
online assay. Bioorg Med Chem. 2018;26(2):509e515.
22. Yang L, Liu RH, He JW. Rapid analysis of the chemical compositions in semi-
liquidambar cathayensis roots by ultra high-performance liquid chromatog-
raphy and quadrupole time-of-flight tandem mass spectrometry. Molecules.
2019;24(22).
23. Fu C, Yu P, Wang M, Qiu F. Phytochemical analysis and geographic assessment
of flavonoids, coumarins and sesquiterpenes in Artemisia annua L. based on
HPLC-DAD quantification and LC-ESI-QTOF-MS/MS confirmation. Food Chem.
2020;312, 126070.
24. Zhou W, Guo Z, Yu L, et al. On-line comprehensive two-dimensional liquid
chromatography tandem mass spectrometry for the analysis of Curcuma
kwangsiensis. Talanta. 2018;186:73e79.
25. Cao JL, Wang SS, Hu H, et al. Online comprehensive two-dimensional hydro-
philic interaction chromatographyxreversed-phase liquid chromatography
coupled with hybrid linear ion trap Orbitrap mass spectrometry for the anal-
ysis of phenolic acids in Salvia miltiorrhiza. J Chromatogr A. 2018;1536:
216e227.
26. Li Z, Wen R, Du Y, et al. Simultaneous quantification of fifteen compounds in rat
plasma by LC-MS/MS and its application to a pharmacokinetic study of Chaihu-
Guizhi decoction. J Chromatogr, B: Anal Technol Biomed Life Sci. 2019;1105:
15e25.
27. Steimer SS, Kourtchev I, Kalberer M. Mass spectrometry characterization of
peroxycarboxylic acids as proxies for reactive oxygen species and highly
oxygenated molecules in atmospheric aerosols. Anal Chem. 2017;89(5):
2873e2879.
28. Witkowski B, Ganeczko M, Hryszko H, Stachurska M, Gierczak T, Biesaga M.
Identification of orcein and selected natural dyes in 14th and 15th century
liturgical paraments with high-performance liquid chromatography coupled to
the electrospray ionization tandem mass spectrometry (HPLC-ESI/MS/MS).
Microchem J. 2017;133:370e379.
29. Yin L, Han H, Zheng X, Wang G, Li Y, Wang W. Flavonoids analysis and anti-
oxidant, antimicrobial, and anti-inflammatory activities of crude and purified
extracts from Veronicastrum latifolium. Ind Crop Prod. 2019;137:652e661.
30. Zhou YN, Zhao L, Zheng L, Lv L. [Rapid identification of chemical constituents in
Salvia chinensis by HPLC-TOF-MS]. Zhongguo Zhongyao Zazhi. 2013;38(23):
4109e4112.
31. Zeng JK, Li YY, Wang TM, et al. Simultaneous quantification of multiple com-
ponents in rat plasma by UPLC-MS/MS and pharmacokinetic study after oral
administration of Huangqi decoction. Biomed Chromatogr : BMC (Biomed
Chromatogr). 2018;32(5):e4178.
32. Zeng X, Yao H, Zheng Y, et al. Tissue distribution of naringin and derived
metabolites in rats after a single oral administration. J Chromatogr, B: Anal
Technol Biomed Life Sci. 2020;1136, 121846.
33. Liu EH, Qi LW, Peng YB, et al. Rapid separation and identification of 54 major
constituents in Buyang Huanwu decoction by ultra-fast HPLC system coupled
with DAD-TOF/MS. Biomed Chromatogr : BMC (Biomed Chromatogr).
2009;23(8):828e842.
34. Song W, Qiao X, Chen K, et al. Biosynthesis-based quantitative analysis of 151
secondary metabolites of licorice to differentiate medicinal Glycyrrhiza species
and their hybrids. Anal Chem. 2017;89(5):3146e3153.
35. Xu Y, Cai H, Cao G, et al. Profiling and analysis of multiple constituents in
Baizhu Shaoyao San before and after processing by stir-frying using UHPLC/Q-
TOF-MS/MS coupled with multivariate statistical analysis. J Chromatogr, B: Anal
Technol Biomed Life Sci. 2018;1083:110e123.
36. Kuhn F, Oehme M, Romero F, Abou-Mansour E, Tabacchi R. Differentiation of
isomeric flavone/isoflavone aglycones by MS2 ion trap mass spectrometry and
a double neutral loss of CO. Rapid Commun Mass Spectrom : RCM (Rapid Com-
mun Mass Spectrom). 2003;17(17):1941e1949.
37. Zheng YY, Zeng X, Peng W, Wu Z, Su WW. Characterisation and classification of
Citri Reticulatae Pericarpium varieties based on UHPLC-Q-TOF-MS/MS com-
bined with multivariate statistical analyses. Phytochem Anal : PCA (Phytochem
Anal). 2019;30(3):278e291.
38. Gajbhiye NA, Makasana J, Saha A, Patel I, Jat RS. LC-ESI-MS/MS method for
simultaneous determination of triterpenoid glycosides and aglycones in Cen-
tella asiatica L. Chromatographia. 2016;79(11-12):727e739.
39. Zuo T, Qian Y, Zhang C, et al. Data-dependent acquisition and database-driven
efficient peak annotation for the comprehensive profiling and characterization
of the multicomponents from compound xueshuantong capsule by UHPLC/IM-
262
Journal of Traditional and Complementary Medicine 13 (2023) 245e262
QTOF-MS. Molecules. 2019;24(19).
40. Dong Y, Ji G, Cao A, et al. [Effects of sinensetin on proliferation and apoptosis of
human gastric cancer AGS cells]. Zhongguo Zhongyao Zazhi. 2011;36(6):
790e794.
41. Han H, Du B, Pan X, et al. CADPE inhibits PMA-stimulated gastric carcinoma cell
invasion and matrix metalloproteinase-9 expression by FAK/MEK/ERK-
mediated AP-1 activation. Mol Cancer Res. 2010;8(11):1477e1488.
42. Ouyang Y, Li L, Ling P. Nobiletin inhibits helicobacterium pylori infection-
induced gastric carcinogenic signaling by blocking inflammation, apoptosis,
and mitogen-activated protein kinase events in gastric epithelial-1 cells.
J Environ Pathol Toxicol Oncol : Off Organ Int Soc Environ Toxicol Cancer.
2020;39(1):77e88.
43. Wang ZF, Ma DG, Wang L, et al. Paeoniflorin inhibits migration- and invasion-
promoting capacities of gastric cancer associated fibroblasts. Chin J Integr Med.
2019;25(11):837e844.
44. Liao ZH, Zhu HQ, Chen YY, et al. The epigallocatechin gallate derivative Y(6)
inhibits human hepatocellular carcinoma by inhibiting angiogenesis in MAPK/
ERK1/2 and PI3K/AKT/HIF-1a/VEGF dependent pathways. J Ethnopharmacol.
2020;259, 112852.
45. Tang L, Wang F, Xiao L, et al. Yi-Qi-Jian-Pi formula modulates the PI3K/AKT
signaling pathway to attenuate acute-on-chronic liver failure by suppressing
hypoxic injury and apoptosis in vivo and in vitro. J Ethnopharmacol. 2021;280,
114411.
46. H T. The Influence of Differentiation about Drug-Containing Serum of Jianpi
Yangwei Decoction on CD44(þ) Gastric Cancer Stem Cells. 2016.
47. Stylos E, Chatziathanasiadou MV, Syriopoulou A, Tzakos AG. Liquid chroma-
tography coupled with tandem mass spectrometry (LC-MS/MS) based
bioavailability determination of the major classes of phytochemicals.
J Chromatogr, B: Anal Technol Biomed Life Sci. 2017;1047:15e38.
48. Tian S, Wang J, Li Y, Li D, Xu L, Hou T. The application of in silico drug-likeness
predictions in pharmaceutical research. Adv Drug Deliv Rev. 2015;86:2e10.
49. Xu W, Yang Z, Xie C, et al. PTEN lipid phosphatase inactivation links the hippo
and PI3K/Akt pathways to induce gastric tumorigenesis. J Exp Clin Cancer Res :
CR (Clim Res). 2018;37(1):198.
50. Zhang J, Guo S, Wu Y, Zheng ZC, Wang Y, Zhao Y. P4HB, a novel hypoxia target
gene related to gastric cancer invasion and metastasis, 2019 BioMed Res Int.
2019, 9749751.
51. Sheppard K, Kinross KM, Solomon B, Pearson RB, Phillips WA. Targeting PI3
kinase/AKT/mTOR signaling in cancer. Crit Rev Oncog. 2012;17(1):69e95.
52. Park JH, Lee JY, Shin DH, Jang KS, Kim HJ, Kong G. Loss of Mel-18 induces tumor
angiogenesis through enhancing the activity and expression of HIF-1a medi-
ated by the PTEN/PI3K/Akt pathway. Oncogene. 2011;30(45):4578e4589.
53. Sukocheva OA, Furuya H, Ng ML, et al. Sphingosine kinase and sphingosine-1-
phosphate receptor signaling pathway in inflammatory gastrointestinal dis-
ease and cancers: a novel therapeutic target. Pharmacol Therapeut. 2020;207,
107464.
54. Yang Y, Zhang J, Yan Y, et al. Low expression of Rap1GAP is associated with
epithelial-mesenchymal transition (EMT) and poor prognosis in gastric cancer.
Oncotarget. 2017;8(5):8057e8068.
55. Wei M, Shen D, Mulmi Shrestha S, Liu J, Zhang J, Yin Y. The progress of T cell
immunity related to prognosis in gastric cancer, 2018 BioMed Res Int. 2018,
3201940.
56. Espindola KMM, Ferreira RG, Narvaez LEM, et al. Chemical and pharmacological
aspects of caffeic acid and its activity in hepatocarcinoma. Front Oncol. 2019;9:
541.
57. Buldak RJ, Hejmo T, Osowski M, et al. The impact of coffee and its selected
bioactive compounds on the development and progression of colorectal cancer
in vivo and in vitro. Molecules. 2018;23(12).
58. Tyszka-Czochara M, Bukowska-Strakova K, Kocemba-Pilarczyk KA, Majka M.
Caffeic acid targets AMPK signaling and regulates tricarboxylic acid cycle
anaplerosis while metformin downregulates HIF-1a-Induced glycolytic en-
zymes in human cervical squamous cell carcinoma lines. Nutrients. 2018;10(7).
59. Xiang Y, Zhang Q, Wei S, Huang C, Li Z, Gao Y. Paeoniflorin: a monoterpene
glycoside from plants of Paeoniaceae family with diverse anticancer activities.
J Pharm Pharmacol. 2020;72(4):483e495.
60. Zheng YB, Xiao GC, Tong SL, et al. Paeoniflorin inhibits human gastric carci-
noma cell proliferation through up-regulation of microRNA-124 and suppres-
sion of PI3K/Akt and STAT3 signaling. World J Gastroenterol. 2015;21(23):
7197e7207.
61. Han Jie L, Jantan I, Yusoff SD, Jalil J, Sinensetin Husain K. An insight on its
pharmacological activities, mechanisms of action and toxicity. Front Pharmacol.
2020;11, 553404.
62. Ashrafizadeh M, Zarrabi A, Saberifar S, et al. Nobiletin in cancer therapy: how
this plant derived-natural compound targets various oncogene and onco-
suppressor pathways. Biomedicines. 2020;8(5).
63. Kang NJ, Lee KW, Shin BJ, et al. Caffeic acid, a phenolic phytochemical in coffee,
directly inhibits Fyn kinase activity and UVB-induced COX-2 expression.
Carcinogenesis. 2009;30(2):321e330.
64. Sp N, Kang DY, Kim DH, et al. Nobiletin inhibits CD36-dependent tumor
angiogenesis, migration, invasion, and sphere formation through the Cd36/
stat3/Nf-Κb signaling Axis. Nutrients. 2018;10(6).
65. Sp N, Kang DY, Lee JM, Jang KJ. Mechanistic insights of anti-immune evasion by
nobiletin through regulating miR-197/STAT3/PD-L1 signaling in non-small cell
lung cancer (NSCLC) cells. Int J Mol Sci. 2021;22(18).