CLINICAL REPORT

Congenital Neutropenia With Retinopathy, a New

Phenotype Without Intellectual Deficiency or
Obesity Secondary to VPS13B Mutations
Lucie Gueneau,1 Laurence Duplomb,1 Pierre Sarda,2 Christian Hamel,3,4 Bernard Aral,1,5
Salima El Chehadeh,1,6 Nadège Gigot,1,5,6 Judith St-Onge,1,5 Patrick Callier,1,7 Julien Thevenon,1,6
Frédéric Huet,1 Virginie Carmignac,1 Nathalie Droin,8 Laurence Faivre,1,6
and Christel Thauvin-Robinet1,6*
1
EA 4271 GAD « Génétique et Anomalies du Développement », IFR 100 - Sante STIC, Université de Bourgogne, Dijon, France
2
Service de Génétique Médicale, Hôpital Arnaud de Villeneuve, CHU Montpellier, France
3
Centre de référence Affections Sensorielles Génétiques, Hôpital Gui de Chauliac, CHU Montpellier, France
4
Département de génétique et thérapie des cécités rétiniennes, INSERM U583 - Institut des Neurosciences de Montpellier, France
5
Laboratoire de Génétique Moléculaire, Plateau Technique de Biologie, CHU Dijon, France
6
Centre de Génétique et Centre de Reference « Anomalies du Développement et Syndromes Malformatifs » du Grand Est, Hôpital
d’Enfants, CHU Dijon, France
7
Laboratoire de Cytogénétique, Plateau Technique de Biologie, CHU Dijon, France
8
Inserm UMR 1009, Integrated Research Cancer Institute Villejuif (IRCIV), Institut Gustave Roussy, Villejuif, France

Manuscript Received: 7 May 2013; Manuscript Accepted: 20 September 2013

Over one hundred VPS13B mutations are reported in Cohen

syndrome (CS). Most cases exhibit a homogeneous phenotype
that includes intellectual deficiency (ID), microcephaly, facial
dysmorphism, slender extremities, truncal obesity, progressive
chorioretinal dystrophy, and neutropenia. We report on a pa-
tient carrying two VPS13B splicing mutations with an atypical
phenotype that included microcephaly, retinopathy, and con-
genital neutropenia, but neither obesity nor ID. RNA analysis of
the IVS34þ2T_þ3AinsT mutation did not reveal any abnormal
splice fragments but mRNA quantification showed a significant
decrease in VPS13B expression. RNA sequencing analysis up-
and downstream from the IVS57þ2T>C mutation showed ab-
normal splice isoforms. In contrast to patients with typical CS,
who express only abnormal VPS13B mRNA and truncated pro-
tein, a dose effect of residual normal VPS13B protein possibly
explains the incomplete phenotype in the patient. This observa-
tion emphasizes that VPS13B analysis should be performed in
cases of congenital neutropenia associated with retinopathy,
even in the absence of ID, therefore extending the VPS13B
phenotype spectrum. Ó 2013 Wiley Periodicals, Inc.
Key words: Cohen syndrome; dose effect; splice mutations;
VPS13B
INTRODUCTION
The VPS13B gene (OMIM 607817) encodes a Golgi matrix protein
required for Golgi integrity and function [Seifert et al., 2011].
How to Cite this Article:
Gueneau L, Duplomb L, Sarda P, Hamel C,
Aral B, Chehadeh SE, Gigot N, St-Onge J,
Callier P, Thevenon J, Huet F, Carmignac
V, Droin N, Faivre L, Thauvin-Robinet C.
2014. Congenital neutropenia with
retinopathy, a new phenotype without
intellectual deficiency or obesity secondary
to VPS13B mutations.
Am J Med Genet Part A 164A:522–527.
All the authors have no conflict of interest to declare.
Lucie Gueneau and Laurence Duplomb have contributed equally to the
work; Laurence Faivre and Christel Thauvin-Robinet have directed
equally the project.
The authors state that the research performed on the patient described in
this manuscript was reviewed and approved by the “Comité de
Protection des Personnes de Bourgogne, France.”
Grant sponsor: Regional Council of Burgundy.

Correspondence to:
Dr. Christel Thauvin-Robinet, MD, PhD, Centre de Génétique–Hôpital
d’Enfants, 10 Bd maréchal de Lattre de Tassigny, 21034 Dijon Cédex,
France.
E-mail: christel.thauvin@chu-dijon.fr
Article first published online in Wiley Online Library
(wileyonlinelibrary.com): 5 December 2013
DOI 10.1002/ajmg.a.36300

Ó 2013 Wiley Periodicals, Inc. 522

GUENEAU ET AL.
Domain structure and homologies with the yeast vacuolar protein
sorting-associated protein 13 (Vps13p) suggest that human
VPS13B is involved in vesicle-mediated sorting and intracellular
protein transport [Velayos-Baeza et al., 2004; Seifert et al., 2011].
To date, VPS13B mutations lead only to autosomal recessive
Cohen syndrome (CS; MIM216550) [Kolehmainen et al., 2003].
Most CS patients present with a homogeneous phenotype, that
includes non-progressive mild-to-severe intellectual deficiency
(ID), microcephaly, characteristic facial features, childhood hy-
potonia, truncal obesity with slender extremities, joint laxity,
early-onset and progressive myopia, retinal dystrophy, intermit-
tent isolated neutropenia, and a cheerful disposition [Cohen et al.,
1973; Kivitie-Kallio and Norio, 2001]. The characteristic facial
features include high-arched or wave-shaped eyelids, a short
philtrum, thick hair, and a low hairline. Clinical diagnostic criteria
for CS have been put forward [Chandler et al., 2003; Kolehmainen
et al., 2004]. Chandler et al. [2003] proposed that, together with
significant learning disabilities, two of the following criteria should
be present for the diagnosis of CS: facial gestalt, pigmentary
retinopathy, and neutropenia. Following identification of the
VPS13B gene, the Chandler criteria were modified by the same
team: CS was considered in patients who fulfilled at least six of the
following criteria: ID, microcephaly, typical facial gestalt, truncal
obesity with slender extremities, overly sociable behavior, joint
hypermobility, high myopia, and/or retinal dystrophy and neu-
tropenia [Kolehmainen et al., 2004]. Despite considerable muta-
tional heterogeneity, patients with VPS13B mutations fulfill the
diagnostic criteria with relative clinical homogeneity [El Chehadeh
et al., 2010].
Over one hundred different VPS13B mutations have been iden-
tified. These are mostly frameshift mutations, leading to truncated
protein and predicting functional null allele [Kolehmainen
et al., 2003; Hennies et al., 2004; Seifert et al., 2006, 2009]. Large
intragenic VPS13B rearrangements have also been reported recently
[Parri et al., 2010; Rivera-Brugues et al., 2011].
Here, we report on a patient with a new phenotype that included
congenital neutropenia, microcephaly, and retinopathy but no
intellectual disability. Hypotheses about VSP13B expression are
discussed to explain this new incomplete phenotype.
MATERIALS AND METHODS
Clinical Report
A 33-year-old female was referred for genetic investigations
because of the association of neutropenia and pigmentary retinop-
athy. She was the second child of healthy non-consanguineous
Caucasian parents. After an unremarkable pregnancy, she was
born at term with growth retardation (weight: 2.400 g; length:
44 cm, OFC: 35 cm). Her infancy and childhood were marked
by recurrent rhinopharyngeal infections and gingivitis from
18 months of age, leading to chronic hypertrophic gingivopathy,
and the diagnosis of chronic and intermittent neutropenia. Speech
and motor development was normal. At 5 years old, she presented
with pulmonary infection, recurrent bronchitis and otitis, and
recurrent severe buccal aphthosis. Bone marrow examination
revealed a normocellular marrow. Subcutaneous injections of G-
CSF were given from 5 to 7 years old and led to an increased
523
neutrophil count, but with no significant clinical improvement.
Ophthalmologic examinations revealed reduced visual field and
retinal abnormalities, and retinal dystrophy was diagnosed at
25 years old. At the last examination at 33 years of age, she presented
with a persistent short stature and borderline microcephaly (153 cm
for length (2 SD), 43 kg for weight (1.5 SD), 52.5 cm for OFC
(2 SD). The clinical examination revealed a typical facial gestalt
and moderately slender extremities, but neither truncal obesity
(BMI ¼ 18.4) nor joint hypermobility (Fig. 1a–c). Facial dysmor-
phism included moderate downslanting palpebral fissures, a convex
high nasal bridge, malar hypoplasia, a short philtrum, and mild
ptosis. Her intellectual development was normal with high school
studies (IQ ¼ 100), social contacts and no behavioral disturbances.
Her neutrophil counts varied from 125 to 374/mm3 (normal
¼ 2,000–7,500/mm3), and she suffered from persistent buccal
aphthosis and cutaneous infections. Eye examination showed
decreased but stable visual acuity at 4/10 in both eyes. There was
no cataract. Fundus examination revealed moderate pigmentary
retinopathy with rare bone spicule-shaped pigment deposits in the
retinal periphery and macular edema. Electroretinography revealed
severely decreased responses in both scotopic and photopic con-
ditions indicating that both rod and cone photoreceptor responses
were impaired.
VPS13B DNA Sequencing
DNA was extracted from blood samples. PCR and sequencing
analyses of all 62 VPS13B exons and exon-intron boundaries
were performed (primer sequences available on request). PCR
products were sequenced using an ABI 3100 capillary sequencer
(Applied Biosystems, Carlsbad, CA). Reference sequence of geno-
mic VPS13B DNA was ENSG00000132549 (Ensembl Genome
Browser). Mutation nomenclature was based on the Ensembl
transcript ENST00000358544, with the position þ1 as the A of
the ATG initiation codon.
VPS13B mRNA analysis. Total RNA were extracted from
blood samples using the QIAamp RNA blood Mini Kit (Qiagen,
Valencia, CA) protocol. RNA concentrations and purity were
determined by the Nanodrop spectrophotometer. DNAseI-treated
RNA were reverse-transcribed to cDNA using the SuperScript III
first-strand synthesis system kit for RT-PCR (Invitrogen, Carlsbad,
CA). PCR, using cDNA as templates, were performed with the
VPS13B primers: COH1-E33F, COH1-E35R, COH1-E56F, and
COH1-59R (primer sequences and PCR conditions available on
request). The different fragments were extracted using QIAquick
Gel Extraction Kit (Qiagen) and sequenced.
Quantitative RT-PCR of VPS13B was performed using lympho-
blastoid cell lines from the patient and two controls. mRNA
expression levels for three fragments of the VPS13B gene were
measured by qPCR using the QuantiTect SYBR Green PCR Kit
(Qiagen) on the LightCycler 480 real-time PCR system (Roche,
Boulogne-Billancourt, France). The fragments were amplified with
the following primers: qCOH1-33F/34R, qCOH1-34F/35R, and
qCOH1-56F/57R (primer sequences and qPCR conditions avail-
able on request). The results were normalized to the expression
levels of GAPDH and RPLP0 RNA. Relative quantification was
performed with the LightCycler480 analysis software.
524
FIG. 1. Photographs of the proband at 33 years of age, showing (a,b) facial dysmorphism with moderate downslanting palpebral fissures, mild
ptosis, a high convex nasal bridge, malar hypoplasia, and a short philtrum, as well as (c) slender extremities. Family pedigree and
chromatograms of the VPS13B mutations showing the VPS13B mutations inherited from the mother and the father (d).
Web Resources
Primer blast designing tool (http://www.ncbi.nlm.nih.gov/tools/
primer-blast/); translating prediction tool (http://web.expasy.org/
translate/); splice analyses of the intronic variations using
HSF: Human Splicing Finder v.2.4.1 software (http://www.umd.
be/HSF/); OMIM (http://omim.org/).
RESULTS
DNA sequencing of the VPS13B gene identified two heterozygous
splicing mutations in the patient: IVS34þ2T_þ3AinsT and
IVS57þ2T>C in introns 34 and 57, respectively (Fig. 1d). Both
parents were heterozygous for one of these mutations. Both muta-
tions were absent in 100 controls. In order to study the splicing
consequences of both mutations, VPS13B cDNA sequencing anal-
ysis and quantification were performed.
RT-PCR sequencing analysis up- and downstream from the
IVS34þ2T_þ3AinsT mutation failed to reveal any abnormal
spliced fragments, thus excluding exon 34 skipping or the activation
of a cryptic splice site in this exon. Only the normal spliced fragment
was amplified. In silico analyses by hSF predicted that the insertion
of 1 bp between the second and the third position of the donor
consensus splice site would lead to a rupture of this splice site.
Indeed, the wild-type sequence of the intron 34 donor splice site has
a consensus value of 96% whereas a mutated sequence brings down
the value of the consensus sequence to 78%. This suggested the
retention of intron 34 and the creation of a PTC (Premature
Termination Codon) at the beginning of this intron 34. If not
degraded, the resulting protein would contain only 1,995 amino
acids (Fig. 2a).
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
Quantitative RT-PCR of VPS13B transcripts, between exons 33–
34 and 34–35 revealed a significant 50% decrease in VPS13B mRNA
expression on both fragments in the patient compared with control
mRNAs (Fig 2b) suggesting a nonsense-mediated mRNA decay
process (NMD). Finally, the abnormal RNA was probably partially
degraded by the NMD machinery, which is enhanced when a PTC is
detected on an abnormal RNA.
In silico analysis by hSF of the intron 57 donor splice site gave a
consensus value of 76% for the wild-type sequence while analysis of
the mutated sequence (IVS57þ2T>C) abolished the donor splice
site of this intron. RT-PCR sequencing analysis up- and down-
stream IVS57þ2T>C mutation showed four fragments: three
abnormal spliced isoforms with intron retention and/or exon
skipping, leading to a PTC or in frame deletion, as well as the
normal spliced one (Fig. 2c). Quantitative RT-PCR of VPS13B
transcripts, between exons 56 and 57, also revealed a significant 50%
decrease in VPS13B mRNA expression in the patient compared with
control mRNAs (data not shown).
DISCUSSION
We report on a new VPS13B-related phenotype, that includes
moderate facial dysmorphism, microcephaly, retinopathy, and
neutropenia, but without ID or truncal obesity. This is the first
report of a patient with two different VPS13B splicing mutations.
These mutations lead to abnormal RNA fragments (Fig 2c) and
NMD, which is responsible for the incomplete phenotype. In order
to explain this atypical phenotype, we speculate that both splice site
mutations lead to a residual production of normal VPS13B RNA
and protein. A dose effect of residual production of normal protein
GUENEAU ET AL. 525

FIG. 2. a: Schematic representation of putative consequences of the IVS34þ2T_þ3AinsT VPS13B mutation in intron 34 on mRNA and protein
levels; giving rise to a suspected premature termination codon (PTC) after Gly1995 and a theoretical protein of 1995 amino acids. b: VPS13B
mRNA quantification between exons 33–34 and 34–35 showing a significant 50% decrease in VPS13B expression on both fragments in the
patient compared with control mRNAs. c: Schematic representation of the putative consequences of the IVS57þ2T>C VPS13B mutation in
intron 57 at mRNA level. RT-PCR results showed three abnormal spliced RNA fragments, as well as the wild-type fragment: (1) the longest one
included 263 bp of the beginning of intron 56 (GTAAGAACACAAGCTGAGGGTCTGTGATGAGCTAGAGCCCGGGTAGAAATGACACGCTTGGGGGTAGCACCTCATTT-
CAAGACCTAAAGAAGCAATTGGCAAGAGGTGACACACCTGAGCTCTACAGTTACACAGAACTGGATCTAAATCTAGAGCCTGCCACTGTTAGCTGTAAGACTTTGGGCAAGTTATTGAAC
CTTCCTGAGTCTCCATTTCCTCATCGATAAAATGGCTTTGAAGATTTCTGAGAGGATCAGATGAAA) between normal exons 56 and 57, (2) the second one with the
same part of intron 56 as the first band, but lacking exon 57. For these two RNA species, a cryptic splice site was used in intron 56 and a
PTC was created after the incorporation of five new amino acids consequently to the retention of intron 56. (3) The third one corresponded to
a transcript with a normal size and sequence, and (4) the fourth one showed an in-frame skipping of exon 57.
526
could be related to the severity of the phenotype: no VPS13B wild-
type protein synthesis leads to typical CS, whereas its synthesis in a
small residual quantity induces a less severe and incomplete phe-
notype. The synthesis of residual normal RNA has previously been
shown to be involved in moderate or partial phenotype in patients
with splicing mutations in other rare diseases such as spinal
muscular atrophy [Vezain et al., 2011], McArdle disease [Vissing
et al., 2009] or different deafness syndromes due to MYO7A
mutations [Ben Rebeh et al., 2010]. For example, in a mild form
of recessive MYO7A-related retinopathy and deafness, the
c.1935G>A mutation occurs at the last position of exon 16 and
is responsible for partial skipping of exon 16. The authors attributed
the mild phenotype to the presence of a residual functional myosin
VIIa protein [Ben Rebeh et al., 2010].
The hypothesis of the residual production of normal VPS13B
RNA and protein in the incomplete phenotype of the proband is
supported by the mutation spectrum of VPS13B. Indeed, the vast
majority of VPS13B mutations underlying CS lead to truncated
proteins with loss of function. Whether homozygous or compound
heterozygous mutations, they resulted in shorter or abnormal
proteins, and patients do not express normal residual VPS13B
protein. VPS13B splicing mutations have occasionally been
reported in the literature in typical CS patients and usually with
an in trans truncating mutation [Hennies et al., 2004; Kolehmainen
et al., 2004; Seifert et al., 2006; Katzaki et al., 2007; Taban et al., 2007;
Megarbane et al., 2009; Seifert et al., 2009; Parri et al., 2010]. No
compound heterozygous CS patients for two splicing mutations
have been reported so far, but exceptional patients with homozy-
gous splicing mutations have been reported [Hennies et al., 2004;
Kolehmainen et al., 2004; Megarbane et al., 2009]. These rare
patients present a typical CS phenotype. The homozygous
c.9406-1G>T [Hennies et al., 2004] and c.9406-1G>C [Megarbane
et al., 2009] mutations affect the same nucleotide and have been
shown to activate a cryptic splice site, creating frameshift and PTC,
that finally predicted a shorter protein [Hennies et al., 2004]. No
RNA study was performed in the family with the homozygous
c.8697-2A>G mutation [Kolehmainen et al., 2004]. Therefore,
none of the splicing mutations described up to now in VPS13B
has been associated with the presence of residual production of
normal RNA or protein.
To date, CS is the only diagnosis that comprises the association of
congenital neutropenia and retinopathy [Kolehmainen et al., 2003].
Our proband also presented additional features described in CS,
including compatible facial gestalt, microcephaly, and slender ex-
tremities, but she did not meet other CS diagnosis criteria such as ID
and truncal obesity [Chandler et al., 2003; Kolehmainen et al., 2004].
Indeed all CS patients with identified VPS13B mutations reported in
the literature to date presented ID. Therefore this is the first report of
an adult patient with causal VPS13B mutations not fulfilling the
diagnosis criteria, despite considerable mutational heterogeneity
[Kolehmainen et al., 2004]. We thus showed that the association of
neutropenia and retinopathy should indicate VPS13B sequencing,
and special attention should be paid to neutrophil count in patients
with a retinopathy, even in the absence of ID or obesity.
In conclusion, we report here on a new phenotype and thus
enlarge the VPS13B mutational spectrum. We also suggest that the
absence of ID should not preclude the analysis of VPS13B, especially
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
in cases where congenital neutropenia is associated with retinopa-
thy and/or microcephaly.
ACKNOWLEDGMENTS
The authors thank the family for their contribution. They also thank
the Regional Council of Burgundy for providing financial support
for the project.
REFERENCES
Ben Rebeh I, Moriniere M, Ayadi L, Benzina Z, Charfedine I, Feki J, Ayadi
H, Ghorbel A, Baklouti F, Masmoudi S. 2010. Reinforcement of a minor
alternative splicing event in MYO7A due to a missense mutation results in
a mild form of retinopathy and deafness. Mol Vis 16:1898–1906.
Chandler KE, Kidd A, Al-Gazali L, Kolehmainen J, Lehesjoki AE, Black GC,
Clayton-Smith J. 2003. Diagnostic criteria, clinical characteristics, and
natural history of Cohen syndrome. J Med Genet 40:233–241.
Cohen MM, Jr Hall BD, Smith DW, Graham CB, Lampert KJ. 1973. A new
syndrome with hypotonia, obesity, mental deficiency, and facial, oral,
ocular, and limb anomalies. J Pediatr 83:280–284.
El Chehadeh S, Aral B, Gigot N, Thauvin-Robinet C, Donzel A, Delrue MA,
Lacombe D, David A, Burglen L, Philip N, Moncla A, Cormier-Daire V,
Rio M, Edery P, Verloes A, Bonneau D, Afenjar A, Jacquette A, Heron D,
Sarda P, Pinson L, Doray B, Vigneron J, Leheup B, Frances-Guidet AM,
Dienne G, Holder M, Masurel-Paulet A, Huet F, Teyssier JR, Faivre L.
2010. Search for the best indicators for the presence of a VPS13B gene
mutation and confirmation of diagnostic criteria in a series of 34 patients
genotyped for suspected Cohen syndrome. J Med Genet 47:549–553.
Hennies HC, Rauch A, Seifert W, Schumi C, Moser E, Al-Taji E, Tariverdian
G, Chrzanowska KH, Krajewska-Walasek M, Rajab A, Giugliani R,
Neumann TE, Eckl KM, Karbasiyan M, Reis A, Horn D. 2004. Allelic
heterogeneity in the COH1 gene explains clinical variability in Cohen
syndrome. Am J Hum Genet 75:138–145.
Katzaki E, Pescucci C, Uliana V, Papa FT, Ariani F, Meloni I, Priolo M,
Selicorni A, Milani D, Fischetto R, Celle ME, Grasso R, Dallapiccola B,
Brancati F, Bordignon M, Tenconi R, Federico A, Mari F, Renieri A,
Longo I. 2007. Clinical and molecular characterization of Italian patients
affected by Cohen syndrome. J Hum Genet 52:1011–1017.
Kivitie-Kallio S, Norio R. 2001. Cohen syndrome: Essential features,
natural history, and heterogeneity. Am J Med Genet 102:125–135.
Kolehmainen J, Black GC, Saarinen A, Chandler K, Clayton-Smith J,
Traskelin AL, Perveen R, Kivitie-Kallio S, Norio R, Warburg M, Fryns
JP, de la Chapelle A, Lehesjoki AE. 2003. Cohen syndrome is caused by
mutations in a novel gene, COH1, encoding a transmembrane protein
with a presumed role in vesicle-mediated sorting and intracellular
protein transport. Am J Hum Genet 72:1359–1369.
Kolehmainen J, Wilkinson R, Lehesjoki AE, Chandler K, Kivitie-Kallio S,
Clayton-Smith J, Traskelin AL, Waris L, Saarinen A, Khan J, Gross-Tsur
V, Traboulsi EI, Warburg M, Fryns JP, Norio R, Black GC, Manson FD.
2004. Delineation of Cohen syndrome following a large-scale genotype-
phenotype screen. Am J Hum Genet 75:122–127.
Megarbane A, Slim R, Nurnberg G, Ebermann I, Nurnberg P, Bolz HJ. 2009.
A novel VPS13B mutation in two brothers with Cohen syndrome, cutis
verticis gyrata and sensorineural deafness. Eur J Hum Genet 17:1076–
1079.
Parri V, Katzaki E, Uliana V, Scionti F, Tita R, Artuso R, Longo I, Boschloo
R, Vijzelaar R, Selicorni A, Brancati F, Dallapiccola B, Zelante L, Hamel
CP, Sarda P, Lalani SR, Grasso R, Buoni S, Hayek J, Servais L, de Vries BB,
Georgoudi N, Nakou S, Petersen MB, Mari F, Renieri A, Ariani F. 2010.
GUENEAU ET AL.
High frequency of COH1 intragenic deletions and duplications detected
by MLPA in patients with Cohen syndrome. Eur J Hum Genet 18:
1133–1140.
Rivera-Brugues N, Albrecht B, Wieczorek D, Schmidt H, Keller T, Gohring
I, Ekici AB, Tzschach A, Garshasbi M, Franke K, Klopp N, Wichmann HE,
Meitinger T, Strom TM, Hempel M. 2011. Cohen syndrome diagnosis
using whole genome arrays. J Med Genet 48:136–140.
Seifert W, Holder-Espinasse M, Kuhnisch J, Kahrizi K, Tzschach A,
Garshasbi M, Najmabadi H, Walter Kuss A, Kress W, Laureys G, Loeys
B, Brilstra E, Mancini GM, Dollfus H, Dahan K, Apse K, Hennies HC,
Horn D. 2009. Expanded mutational spectrum in Cohen syndrome,
tissue expression, and transcript variants of COH1. Hum Mutat 30:
E404–E420.
Seifert W, Holder-Espinasse M, Spranger S, Hoeltzenbein M, Rossier
E, Dollfus H, Lacombe D, Verloes A, Chrzanowska KH, Maegawa
GH, Chitayat D, Kotzot D, Huhle D, Meinecke P, Albrecht B, Mathijssen
I, Leheup B, Raile K, Hennies HC, Horn D. 2006. Mutational spectrum
of COH1 and clinical heterogeneity in Cohen syndrome. J Med Genet
43:e22.
527
Seifert W, Kuhnisch J, Maritzen T, Horn D, Haucke V, Hennies HC. 2011.
Cohen syndrome-associated protein, COH1, is a novel, giant Golgi
matrix protein required for Golgi integrity. J Biol Chem 286:37665–
37675.
Taban M, Memoracion-Peralta DS, Wang H, Al-Gazali LI, Traboulsi
EI. 2007. Cohen syndrome: Report of nine cases and review of
the literature, with emphasis on ophthalmic features. J AAPOS 11:
431–437.
Velayos-Baeza A, Vettori A, Copley RR, Dobson-Stone C, Monaco
AP. 2004. Analysis of the human VPS13 gene family. Genomics 84:
536–549.
Vezain M, Gerard B, Drunat S, Funalot B, Fehrenbach S, N’Guyen-Viet V,
Vallat JM, Frebourg T, Tosi M, Martins A, Saugier-Veber P. 2011. A
leaky splicing mutation affecting SMN1 exon 7 inclusion explains an
unexpected mild case of spinal muscular atrophy. Hum Mutat 32:
989–994.
Vissing J, Duno M, Schwartz M, Haller RG. 2009. Splice mutations preserve
myophosphorylase activity that ameliorates the phenotype in McArdle
disease. Brain 132:1545–1552.