http://informahealthcare.

com/drt
ISSN: 1061-186X (print), 1029-2330 (electronic)

J Drug Target, Early Online: 1–7

! 2015 Informa UK Ltd. DOI: 10.3109/1061186X.2015.1009073

ORIGINAL ARTICLE

A novel immunotoxin – rCCK8PE38 targeting of CCK-R overexpressed

colon cancers
Shiqi Gao1*, Jie Song1,2*, Fengge Chen1, Quan Wang3, Xilin Liu4, Honglin Ren1, Yansong Li1, Xingyu Meng1,
Yu Zhou1, Shiying Lu1, Pan Hu1, Weihua Tong3, and Zengshan Liu1
1
Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, Jilin University, Changchun, PR China, 2Shijiazhuang Center for
Journal of Drug Targeting Downloaded from informahealthcare.com by University of Toronto on 03/07/15

Disease Control and Prevention, Shijiazhuang, PR China, 3The First Hospital of Jilin University, Changchun, PR China, and 4China-Japan Union
Hospital of Jilin University, Changchun, PR China

Abstract Keywords
Background: Cholecystokinin (CCK) receptors are overexpressed in numerous human cancers, CCKR, colon cancer, rCCK8PE38, recombinant
such as pancreatic, colon and gastric cancers. Previous studies have shown that the specific immunotoxin, Pseudomonas exotoxin A
receptor-binding property of CCK for CCK receptors (CCKRs) can be exploited to produce
immunotoxins (ITs) that target cancer cells overexpressing CCK receptors. History
Purpose: Construct a new IT-targeting CCKR-overexpressing colon cancers.
Methods: To construct the CCKR-targeted IT, a reverse CCK8 peptide was fused with a modified Received 25 October 2014
38-kDa truncated form of the Pseudomonas exotoxin (PE38KDEL). An efficient immunoaffinity Revised 8 January 2015
purification procedure was used to produce a PE38-based IT. Several analyses, including CCK8 Accepted 14 January 2015
competition and indirect immunofluorescence assays, were performed to confirm the Published online 12 February 2015
For personal use only.

interaction between rCCK8 and CCKR. After cytotoxic assays on several cell lines, the anti-
tumor activity of the new IT was detected in nude mice.
Results: The rCCK8PE38 IT showed specific cytotoxicity for two colon cancer cell lines and
one gastric cancer cell line. After purification, 18–26 mg of pure rCCK8PE38 per 1 L of culture
was obtained. Purified rCCK8PE38 showed high cytotoxicity in colon cancer cell lines with IC50
values of 0.8–3.5 ng/mL. The results of the CCK8 competition and indirect immunofluorescence
assays showed that rCCK8 had a specific interaction with CCKR. Nude mice inoculated with
HCT-8 tumor xenografts were treated with rCCK8PE38, which efficiently decreased the tumor
size in those mice.
Conclusions and discussion: All of these data suggest that rCCK8PE38 has potential as a new
immunotherapy agent. Furthermore, the results of this study further support the high value of
the immunoaffinity method for IT purification procedures.

Introduction has significantly greater binding affinity for CCK2R than

In this decade, cholecystokinin receptor (CCKR) ligands as
carriers for diagnostic and potent therapeutic purposes have
gained renewed interest [1–3]. CCKR is a G-protein coupled
receptor with a typical seven transmembrane domain structure
and is mainly overexpressed in cancers of the gastrointestinal
tract, such as colon and gastric cancers [4,5]. On the basis of
pharmacological and physiological studies, there are two
types of CCKRs, CCK-AR (CCK1R) and CCK-BR (CCK2R)
[6]. The naturally occurring ligands for these receptors are
cholecystokinin (CCK) and gastrin [7]. CCK is a high-affinity
ligand for both CCK1 and CCK2 receptors, whereas gastrin
*These authors contributed equally to this work.
Address for correspondence: Jie Song, Shijiazhuang Center for Disease
Control and Prevention, Shijiazhuang 050011, PR China. E-mail:
songjie231@126.com
Zengshan Liu, Key Laboratory of Zoonosis Research, Ministry of
Education, Institute of Zoonosis, Jilin University, Changchun 130062,
PR China. E-mail: zsliu1959@sohu.com
for CCK1R [8]. The evident therapeutic potential of lig-
and-binding affinity has made the CCKR an attractive target
of investigation for many pharmaceutical companies [7,9,10].
Immunotoxins (ITs) contain a cell-binding moiety that is
designed based on a ligand that has specificity for a tumor cell
antigen, and this moiety is attached to a portion of a bacterial
or plant toxin [11,12]. Truncated forms of Pseudomonas
exotoxin (PE) A containing the processing, translocation and
ADP-ribosylation domains of the exotoxin have been used as
the toxin moieties for recombinant ITs in several laboratories
[13–16]. The first recombinant IT described was anti-Tac(Fv)-
PE40, and it contained a single-chain Fv fragment of anti-Tac
and a monoclonal antibody directed against CD25, the alpha
subunit of the interleukin 2 receptor [17]. A derivative of this
molecule, called anti-Tac(Fv)-PE38 or LMB-2, was tested in
patients with leukemia [18]. Another IT, BL22, which targets
CD22, showed significant activity against hairy cell leukemia
[19,20]. However, an important limitation of the clinical
benefit of BL22 was its immunogenicity [21]. To avoid this
problem, our laboratory has focused for several years on the
 2 S. Gao et al.
development of novel ITs with CCK-like peptides fused to
PE38. First, rG17PE38, a reverse gastrin-17 peptide fused
with PE38 was developed. In vitro and in vivo data clearly
demonstrate a specific interaction between the rG17 moiety
and the CCK2R [22].
In this set of experiments, the novel IT rCCK8PE38 was
expressed and purified, and its in vitro cytotoxic activity and
subsequent in vivo tumor killing ability were assayed. In
this study, we report a novel CCKR-targeting IT that depends
on a reverse tetrapeptide (Trp-Met-Asp-Phe-NH2) construct to
bring it to the CCKR. Immunoaffinity chromatography with
polyol-responsive monoclonal antibodies is a powerful tool
for purifying PE-based ITs in solution. We also found
that rCCK8PE38 has specific cytotoxic activity against the
human colonic carcinoma cell line (HCT-8), the human
colorectal cancer cell line (SW116) and the human gastric
Journal of Drug Targeting Downloaded from informahealthcare.com by University of Toronto on 03/07/15
cancer cell line (MKN45), and it significantly inhibits the
growth of colon xenograft tumors in vivo. Collectively, these
data indicate that rCCK8PE38 has a new potential immuno-
therapy agent.
Materials and methods
Cell lines and animals
A total of 35 cell lines were used in this study. Briefly, five
colorectal cancer (HCT-8, SW480, HCT-116, HT-29 and
SW116), five gastric cancer (MKN-45, MKN-1, BGC-823,
For personal use only.
SGC-7901 and MGC-803), four breast cancer (ZR75-1, MCF-
7, MDA-MB-231 and SK-BR-3), three leukemia (U957,
Junkat and K562), three melanoma (A375, A875 and B16)
and two hepatocellular carcinoma (SMMC-7221 and HepG-2)
cells lines as well as a pancreatic carcinoma (PANC-1), non-
small cell lung cancer (A549), prostate cancer (DU145),
human epithelial cancer (HEp-2), nasopharyongeal epithelial
carcinoma (CNE-2Z), cervical cancer (HeLa), human
embryonic diploid, human embryonic kidney (293), mouse
macrophage (RAW264.7), murine hybridoma (Sp2/0),
African green monkey kidney fibroblast-like (COS-1),
Chinese hamster ovary and mouse mammary epithelial
(Eph4) cell line were included in this study. All of these
cell lines were obtained from the American Type Culture
Collection (Rockville, MD) and Chinese Academy of Medical
Sciences (Beijing, China). Cell lines were cultured in RPMI
Table 1. List of primers used to produce rCCK8PE38 construct.
Primers
F1 ATGTTCGACATGTGGGGCATGTATGACCATATGGCCGAAGAGGGCGGCAG
F2 TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGTTCGACATGTGGGGCATG
Reverse GAATTCTTATAATTCATCTTTTGGTGG
Figure 1. Construction of recombinant immu-
notoxin. Diagrams of pET-rCCK8PE38 and
pET-rG17PE38 expression vectors.
J Drug Target, Early Online: 1–7
or DMEM with 10% fetal bovine serum (FBS) and were
incubated at 37  C with 5% CO2. Six-week-old female nude
mice, which were injected with cells of the above-mentioned
cell lines to generate xenograft models, were purchased
from the Changchun Institute of Biological Products (Jilin
Province, China). Animal research protocols were approved
by the Jilin University Animal Care and Usage Committee.
Mice were housed in a pathogen-free facility throughout all
experiments.
Construction and purification of the IT
The use of the PE38KDEL gene fragment was previously
reported by our laboratory [22]. The rCCK8PE38 gene was
PCR-amplified using overlap extension primers and primers
that introduced Xba I and EcoR I restrictions sites into the
gene sequence (Table 1). After verification of successful PCR
by sequencing in the pMD-18T simple vector, the
rCCK8PE38 fragment was digested with Xba I and EcoR I
and cloned into a T7 expression vector (pET-28a) in which the
gene was expressed without any redundant amino acids
(Figure 1). Then, the recombinant plasmid was transformed
into the Escherichia coli strain Rosetta (DE3). Expression and
purification of the IT were performed as described previously
in the reference [22].
Western blotting
To detect rCCK8PE38 expression, cell extracts of E. coli
strains were separated by SDS-PAGE (4–12%) under reducing
conditions and transferred to a polyvinylidene difluoride
membrane (BioRad, Hercules, CA). The blocked membrane
was incubated with anti-PE38 monoclonal antibody for 1 h
and then subjected to a horseradish peroxidase-conjugated
goat anti-mouse antibody. Proteins were visualized using a
regular ECL kit (GE Healthcare, Buckinghamshire, England).
CCK competition assay
The competition binding assay protocol was previously
reported by our laboratory [22]. In brief, cells were plated
at a concentration of 1  104 cells/well in 96-well flat
bottom plates. The competition group was treated with
0.1 mM CCK-8 (CCK fragment 26-33 amide, Sigma,
Carlsbad, CA) for 20 min; then, 5 mg mL1 rCCK8PE38 was
Sequences (50 –30 )
 DOI: 10.3109/1061186X.2015.1009073 Basic research of a novel immunotoxin rCCK8PE38 targeting of colon cancer
added and the plates were incubated for 72 h. The control
plates were incubated with 5 mg mL1 of rCCK8PE38 for 72 h
without CCK-8. All experiments were performed in triplicate
on two or three separate occasions. Finally, 10 mL of MTT
(5 mg mL1) was added for 3 h. After incubation, colored
formazan crystals were dissolved with 150 mL of DMSO
solution. The plates were kept on an orbital shaker for 5 min,
and optical density was read on an ELISA reader at 490 nm.
Immunofluorescence
HCT-8 cells were seeded at 1  105 cells/well in 24-well
plates. When attached to the glass slide, the cells were fixed in
4% paraformaldehyde solution and then blocked for 1 h in
phosphate-buffered saline (PBS) containing 5% FBS. One
portion of the cells was incubated with rCCK8PE38 protein
Journal of Drug Targeting Downloaded from informahealthcare.com by University of Toronto on 03/07/15
(5 mg/well) for 5 min at RT. All cells were incubated with the
anti-PE38 antibody 3B9 for 1 h. After washing, glasses were
then incubated for 30 min with FITC-conjugated secondary
antibody. Negative controls for the target antigen were
performed by replacing the primary antibody with an
irrelevant mouse antibody (4C3, mouse mAb, IgG, anti-DA)
[23]. Finally, slides were examined using a microscope
(Olympus, BX53, Tokyo, Japan) equipped with a cooled CCD
Color Digital Camera (Olympus, T2) and epifluorescence unit
with a FITC filter.
Cytotoxicity assay
For personal use only.
The cytotoxic activity of the IT on cultured cell lines was
assayed by a WST-8 assay using the Cell Counting Kit-8
(Dojindo Molecular Technologies, Gaithersburg, MD) as
previously described [22]. Cells were plated in 96-well plates
at 1.0  104 cells per 100 mL of complete medium per well 8 h
before the assay. rCCK8PE38 was serially diluted in PBS, and
10 mL of diluted IT was added to each well. Plates were
incubated for 72 h at 37  C and then 10 mL of the WST-8
reagent was added. The absorbance was measured at 450 nm.
The cytotoxicity of the IT was defined by its IC50, which was
the toxin concentration that suppressed cell viability by 50%
compared to the cells that were not treated with the toxin.
All experiments were performed in triplicate.
Antitumor activity
A total of 5  106 HCT-8 cells in 100 mL of PBS were injected
subcutaneously into the flanks of six-week-old nude female
mice. Animals were handled according to the health guidelines
approved by the Jilin University Animal Care and Use
Committee. Five days after inoculation, when tumors
had reached 60 mm3, animals (10 for each group) were treated
with rCCK8PE38 (0, 0.1 or 0.5 mg kg1) every other day for a
total of five treatments. The tumor dimensions were measured
with calipers every three days. Tumor volume (V) was
calculated using the following formula: V ¼ length (width)2
 0.4. Animals were sacrificed 30 d after the initiation of
treatment, and tumors were excised and weighed at that time.
Statistical analysis
The statistical analysis was performed using SPSS software,
version 19.0 (IBM, Chicago, IL). Comparisons of single data
3
points between the three groups were made by ANOVA and
the post-hoc test. p Values less than 0.01 were considered
statistically significant.
Results
Construction of rCCK8PE38 expression vector
Because CCKR is an attractive target for inhibiting several
cancers by many pharmaceutical companies [4,9,24], a
bacterial expression vector was constructed to contain the
cognitive ligand of CCKR and CCK8. As previously
described, a novel IT was produced with a reversed
octapeptide being expressed at its N-terminus [22]. We
suspect that the conformation of the target motif in the fusion
protein coincided with that of CCK8 or gastrin 17 (Figure 1).
The recombinant protein was expressed in E. coli with a yield
of up to 65% of the total cellular protein (Figure 2). The
expressed protein was confirmed by anti-PE38 monoclonal
antibody 3B9 (Figure 3). Subsequently, rCCK8PE38 was
shown to have an obvious cytotoxic activity in the human
colon cancer cell line HCT-8 and, thus, was tested for its
purity and its cytotoxicity toward several tumor cell lines.
Purification of rCCK8PE38
A purification protocol for PE-derived ITs was performed as
previously described [22]. Active protein was purified by AS
precipitation, hydrophobic interaction, immunoaffinity and
gel filtration chromatography successively. The AS precipi-
tation procedure removed all nucleic acids and lipids, which
increased sample density and jammed the column. To achieve
higher purification efficiency, an immunoaffinity column
with an immobilized polyol-responsive mAb on CNBr-
activated Sepharose was used. The eluted fraction was then
further enhanced using a Superdex 75 size-exclusion column
(GE Healthcare). The overall yield of recombinant protein
after those four steps was 18–26 mg per 1 L of culture, and a
purity of 91.8% or higher was obtained (Figure 4).
rCCK8PE38 has specific cytotoxicity against HCT-8
cancer cell lines
To determine whether the cytotoxic activity of rCCK8PE38 is
specific against colon cancer cell lines, WST-8 assays were
performed. Thirty-five cell lines were exposed to the
rCCK8PE38 IT for 72 h. The results showed that HCT-8
(Figure 5), SW116 and MKN45 cells were susceptible to
rCCK8PE38, with IC50 values of 0.8, 1.4 and 3.5 ng mL1,
respectively. In contrast, the human embryo lung diploid cell
line and the other 31 tumor cell lines were not sensitive
to rCCK8PE38 (IC504100 ng mL1; Table 2). One reason-
able explanation for this finding is differences in the
receptor numbers and affinity diversities of these cell lines.
Compared with chemotherapy drugs, such as 5-FU
(IC50 & 100 mg mL1), cisplatin (IC50 & 25 mg mL1),
1
oxaliplatin (IC50 & 200 mg mL ), paclitaxel (IC50 &
100 mg mL1) and irinotecan (IC50 & 500 mg mL1) [22],
rCCK8PE38 showed much higher cytotoxic activity against
cancer cells. The result of the in vitro experiments indicated
that rCCK8PE38 has a specific cytotoxic activity against
HCT-8, SW116 and MKN45 cancer cell lines.
 4 S. Gao et al.
Journal of Drug Targeting Downloaded from informahealthcare.com by University of Toronto on 03/07/15
Figure 2. Expression of recombinant immunotoxin. (A) SDS-PAGE analysis of protein expression in Rosetta (DE3). Lane 1–4, total proteins obtained
from IPTG-induced E. coli Rosetta (DE3) (pET-rCCK8PE38). Lane M, protein marker. Lane 5, control. (B) Gel-pro analysis shows that the
recombinant protein is 65% of total cellular protein.
For personal use only.
Figure 3. Western blots of anti-PE38 monoclonal antibody reacting with
rCCK8PE38. Lane 1, extracts from induced E. coli Rosetta (DE3) (pET-
28a-rCCK8PE38). Lane 2, control (native pET-28a vector).
The cytotoxic pathway of rCCK8PE38 acts specifically
through CCKR
To evaluate the target of rCCK8PE38 on HCT-8 cancer cells,
a CCK8 octapeptide competition assay was performed. In
these experiments, CCK-8 was added in excess to compete
with rCCK8G17PE38 for binding to CCKR and thus decrease
the cytotoxic effect of rCCK8G17PE38 on HCT-8, SW116
and MKN45 cancer cell lines. As shown in Figure 6, the
cytotoxic activity of 5 mg mL1 rCCK8PE38 against HCT-8,
SW116 and MKN45 cells, as indicated by optical density, was
0.057 ± 0.03, 0.131 ± 0.03 and 0.214 ± 0.03, respectively, and
was reduced to 0.58 ± 0.02, 0.58 ± 0.02 and 0.54 ± 0.02,
respectively, with the addition of 0.1 mM of CCK-8.
Significant differences between CCK-8 + rCCK8PE38 treat-
ment and rCCK8PE38 treatment alone on these cell lines
were assessed using single data point t-tests (p50.01).
J Drug Target, Early Online: 1–7
Figure 4. SDS-PAGE of purified rCCK8PE38. Lane M, protein marker.
Lane 1, purified rCCK8PE38 through AS precipitation, hydrophobic
interaction, immunoaffinity and gel filtration chromatography. Lane 2,
total proteins of Rosetta (DE3) (pET-28a-rCCK8PE38).
To confirm the results of the CCK-8 competition analysis,
we tested the interaction of proteins using an immunofluor-
escence assay. In the presence of rCCK8PE38, fluorescence
was efficiently maintained on the HCT-8 cellular membrane
(Figure 7). There was no fluorescence detected when
rCCK8PE38 or 3B9 antibody was substituted with PBS or
4C3 antibody. Taken together, these data indicate that
rCCK8PE38 acts specifically through CCKR.
Intravenous administration inhibits tumor hyperplasia
The antitumor activities of rCCK8PE38 were evaluated
using a HCT-8 mouse xenograft tumor model. On the fifth
day, the subcutaneous tumor was visible. The recombinant IT
rCCK8PE38 was injected intravenously on days 6, 8, 10, 12
and 14 post-implantation. Tumor size was measured regularly
 DOI: 10.3109/1061186X.2015.1009073 Basic research of a novel immunotoxin rCCK8PE38 targeting of colon cancer 5
Journal of Drug Targeting Downloaded from informahealthcare.com by University of Toronto on 03/07/15

Figure 5. Cytotoxicity on HCT-8 cell lines. (A) HCT-8 cells incubated with 2 mM supernatant of lysate of Rosetta (DE3) (pET-28a) for 20 h.
(B) HCT-8 cells incubated with 2 mM supernatant of lysate of Rosetta (DE3) (pET-rCCK8PE38) for 20 h.

Table 2. Cytotoxic activity of rCCK8PE38 on malignant cell lines.

Discussion
IC50 of
rCCK8PE38
The aim of this study was to construct an IT targeting CCKR,
Original Cell line (ng/mL) which is overexpressed in colon cancers. Based on the
receptor-binding property of the CCK ligands and the toxicity
Colorectal cancer HCT-8 0.8
SW480 68 mechanism of PE, we constructed the recombinant IT
HCT-116 231 rCCK8PE38. The rCCK8PE38 recombinant IT was prepared
For personal use only.

HT-29 358 based on the integration of the reverse CCK octapeptide and
SW116 1.4
toxin moiety through recombinant technology, expression
Gastric cancer MKN-45 3.5
MKN-1 89 and purification. The specificity and antitumor activities of
BGC-823 530 the IT were evaluated in vitro and in vivo.
SGC-7901 630 The major issue for designing CCKR-targeted ITs is the
MGC-803 862
Breast cancer ZR75-1 41000
nonavailablity of CCK’s C-terminal pentapeptide sequence
MCF-7 41000 (Gly-Trp-Met-Asp-PheNH2) when CCK is fused with the PE
MDA-MB-231 41000 moiety [1]. Structure–activity relationship studies with syn-
SK-BR-3 41000 thetic CCK analog studies have indicated that the CCK1R
Leukemia cell lines U957 41000
Junkat 41000 binds sulfated CCK with a 500 - to 1000-fold higher affinity
K562 41000 than non-sulfated CCK. However, the CCK2R does not
Melanoma cells A375 41000 discriminate between the sulfated and non-sulfated CCK
A875 41000 analogs [6]. Therefore, a ligand-based IT was constructed
B16 41000
Hepatocellular carcinoma cells SMMC-7221 41000 by connecting a reversed CCK octapeptide to PE38KDEL.
HepG-2 41000 It is very important to investigate the sulfation level of
Pancreatic carcinoma PANC-1 53 rCCK8PE38. Although we did not test whether the rCCK8
Non-small cell A549 41000 moiety was sulfated or not, the complicated sulfation
Prostate cancer DU145 41000
Human epithelial HEp-2 41000 mechanism (tyrosine residues are sulfated by protein
Nasopharyongeal carcinoma epithelial cell CNE-2Z, 41000 sulfotransferase in the trans-Golgi network [25]) indicate
Cervical cancer HeLa 41000 that it should be non-sulfated. Earlier cytotoxic activity and
Human embryo diploid cell HEK293 41000 GST pull-down studies have been reported on a reverse G17
Mouse macrophage cell line RAW264.7 1.9
Murine hybridoma cell line Sp2/0 41000 moiety used as a CCK2R ligand, and a PE38-based recom-
African green monkey kidney COS-1 41000 binant protein with forward G17 has been shown to have no
fibroblast-Like cell line CCK2R-targeting function [22]. In this study, rCCK8PE38
Chinese hamster ovary cells and mouse Eph4 41000
mammary epithelial cells
has specific cytotoxic activity for three colon cancer and
gastric cancer cell lines, and the competition assay also
verified that the CCK8 peptide could abrogate the cytotoxic
for up to 30 d (Figure 8). Mice treated with 0.1 mg kg1 activity of rCCK8PE38, most likely by competitively binding
rCCK8PE38 showed tumor regression to an average min- to the CCKR. Furthermore, the indirect immunofluorescence
imum size of 100 mm3 on day 18. On day 20, 8 of 10 mice assay demonstrated a specific interaction between rCCK8 and
treated with 0.5 mg kg1 rCCK8PE38 had undetectable the CCKR. These data clearly suggest that rCCK8PE38 can
tumors, while the tumor size of the negative control group target the CCKR and produce cytotoxic activity against
grew rapidly and was greater than 1000 mm3. HCT-8, SW116 and MKN45 cells.
 6 S. Gao et al. J Drug Target, Early Online: 1–7

Figure 6. CCK-8 inhibits rCCK8PE38 cyto-

toxicity against three cancer cell lines.
0.1 mM CCK-8 peptide almost completely
inhibited rCCK8PE38 cytotoxicity against
HCT-8, SW116 and MKN45 cells. The
significance of differences between CCK-
8 + rCCK8PE38 treatment and rCCK8PE38
treatment of the three cell lines were assessed
using post-hoc tests (HH, p50.01). The
difference between CK (control check) cells
and CCK-8+ rCCK8PE38-treated cells was
non-significant.
Journal of Drug Targeting Downloaded from informahealthcare.com by University of Toronto on 03/07/15

Figure 7. Fluorescence images of

rCCK8PE38 localization. (A) HCT-8 cells
directly incubated with anti-PE38 monoclo-
nal antibody and appropriate fluorescently
labeled secondary antibody. (B) HCT-8 cells
directly incubated with other monoclonal
antibodies and appropriate fluorescently
labeled secondary antibody. (C) HCT-8 cells
were treated with rCCK8PE38 protein and
For personal use only.

then probed using anti-PE38 monoclonal

antibody and appropriate fluorescently
labeled secondary antibody. (D) HCT-8 cells
were treated with CCK8 peptide and then
incubated with rCCK8PE38, anti-PE38
monoclonal antibody and appropriate fluor-
escently labeled secondary antibody.

Another important aspect of this study is that a PE38
immunoaffinity column was introduced into the purification
process. The recombinant protein was expressed in Rosetta
(DE3) and composed 50% of the total bacterial protein. SDS-
PAGE and western blot showed that most of the fusion protein
was solubly expressed. Most of PE-derived ITs, previously
described in the literature, were expressed in inclusion bodies
and purified by denaturation and refolding [15,26]. In a
previous work, a polyol-responsive monoclonal antibody was
developed and coupled to a CNBr-activated Sepharose 4B
column [22]. Using this immunoaffinity column, the
rCCK8PE38 protein could be purified in its native form.
Purified by hydrophobic chromatography, immunoaffinity
chromatography and gel filtration chromatography, the
rCCK8PE38 protein was obtained with more than
91% purity in 15 h. The short time needed for purification
will be advantageous with respect to the activity and yield
of this IT.
The specific toxicity test showed that rCCK8PE38 had a
significant killing effect on HCT-8, SW116 and MKN45 cells.
The IC50 values of rCCK8PE38 for these cell lines were very
low. The IT had no killing effect on normal cells or 30 other
cell lines tested. Our immunofluorescence assay and compe-
tition study showed that HCT-8, SW116 and MKN45 cells
highly express the CCKR. We believe that the lack of any
significant cytotoxic activity of rCCK8PE38 on other cancer
cells may be due to the small amount of CCKR expression or
low ligand affinity of those cell lines.
The ultimate goal of ITs is to eradicate tumor cells.
A mouse model with HCT-8 colon cancer cell tumors
was established. A five-treatment regimen showed that
rCCK8PE38 is effective against colon cancer cells in vivo.
 DOI: 10.3109/1061186X.2015.1009073 Basic research of a novel immunotoxin rCCK8PE38 targeting of colon cancer
Figure 8. Antitumor activity of rCCK8PE38 in mice. Groups of 10 nude
mice bearing HCT-8 colon tumors were treated QOD  5 (arrows), with
Journal of Drug Targeting Downloaded from informahealthcare.com by University of Toronto on 03/07/15
PBS (m), rCCk8PE38 at 0.1 mg kg1 (˙) or 0.5 mg kg1 (g). Data are
expressed as the means ± SD.
1
At a dose of 0.5 mg kg , rCCK8PE38 completely eradicated
the tumors in these mice. According to Pastan Ira, many
PE-based ITs have similar anti-tumor activities [21]. The ITs
rG17PE38 and rCCK8PE38 have the same cytotoxic moiety
(PE38), and both of them target CCK receptors. Thus, these
two ITs acted very similarly in nude mice. The minor
difference in the activities of these two ITs might be the cell
specificity and tumor-to-kidney ratios [27]. This is worth
additional careful study in the future.
For personal use only.
In conclusion, the evaluation of rCCK8PE38 indicated that
the recombinant IT has selective cytotoxic activity against
CCKR-overexpressing colon cancer cells in vitro and in vivo.
These results indicate that rCCK8PE38 is a potential candi-
date for further development as an anticancer drug for CCKR-
overexpressing tumors.
Declaration of interest
This work was supported by the National Natural Science
Foundation of China (Grant no. 81401953), the Jilin Province
Science & Technology Support (20120966) and the Research
Fund for Doctoral Program of Higher Education
(2012006111078).
References
1. Gupta AK, Varshney K, Saxena AK. Toward the identification of a
reliable 3D QSAR pharmacophore model for the CCK2 receptor
antagonism. J Chem Inf Model 2012;52:1376–90.
2. Foucaud M, Archer-Lahlou E, Marco E, et al. Insights into the
binding and activation sites of the receptors for cholecystokinin and
gastrin. Regul Pept 2008;145:17–23.
3. Katsouni E, Zarros A, Skandali N, et al. The role of cholecystokinin
in the induction of aggressive behavior: a focus on the available
experimental data (review). Acta Physiol Hung 2013;100:361–77.
4. Staljanssens D, Azari EK, Christiaens O, et al. The CCK(-like)
receptor in the animal kingdom: functions, evolution and structures.
Peptides 2011;32:607–19.
5. Brabez N, Nguyen KL, Saunders K, et al. Synthesis and evaluation
of cholecystokinin trimers: a multivalent approach to pancreatic
7
cancer detection and treatment. Bioorg Med Chem Lett 2013;23:
2422–5.
6. Dufresne M, Seva C, Fourmy D. Cholecystokinin and gastrin
receptors. Physiol Rev 2006;86:805–47.
7. Morton M, Prendergast C, Barrett TD. Targeting gastrin for the
treatment of gastric acid related disorders and pancreatic cancer.
Trends Pharmacol Sci 2011;32:201–5.
8. Rai R, Chandra V, Tewari M, et al. Cholecystokinin and gastrin
receptors targeting in gastrointestinal cancer. Surg Oncol 2012;21:
281–92.
9. Tornesello AL, Aurilio M, Accardo A, et al. Gastrin and
cholecystokinin peptide-based radiopharmaceuticals: an in vivo
and in vitro comparison. J Pept Sci 2011;17:405–12.
10. Roosenburg S, Laverman P, van Delft FL, et al. Radiolabeled CCK/
gastrin peptides for imaging and therapy of CCK2 receptor-
expressing tumors. Amino Acids 2011;41:1049–58.
11. Kreitman RJ, Arons E, Stetler-Stevenson M, et al. Recombinant
immunotoxins and other therapies for relapsed/refractory hairy cell
leukemia. Leuk Lymphoma 2011;52:82–6.
12. Weldon JE, Pastan I. A guide to taming a toxin – recombinant
immunotoxins constructed from Pseudomonas exotoxin A for the
treatment of cancer. FEBS J 2011;278:4683–700.
13. Haso W, Lee DW, Shah NN, et al. Anti-CD22-chimeric antigen
receptors targeting B-cell precursor acute lymphoblastic leukemia.
Blood 2013;121:1165–74.
14. Baskar S, Wiestner A, Wilson WH, et al. Targeting malignant B
cells with an immunotoxin against ROR1. mAbs 2012;4:349–61.
15. Chandramohan V, Bao X, Keir ST, et al. Construction of an
immunotoxin, D2C7-(scdsFv)-PE38KDEL, targeting EGFRwt and
EGFRvIII for brain tumor therapy. Clin Cancer Res 2013;19:
4717–27.
16. Chandramohan V, Sampson JH, Pastan I, et al. Toxin-based
targeted therapy for malignant brain tumors. Clin Dev Immunol
2012;2012:480429.
17. Singh R, Zhang Y, Pastan I, et al. Synergistic antitumor activity of
anti-CD25 recombinant immunotoxin LMB-2 with chemotherapy.
Clin Cancer Res 2012;18:152–60.
18. Wayne AS, Fitzgerald DJ, Kreitman RJ, et al. Immunotoxins for
leukemia. Blood 2014;123:2470–7.
19. Wayne AS, Kreitman RJ, Findley HW, et al. Anti-CD22
immunotoxin RFB4(dsFv)-PE38 (BL22) for CD22-positive hema-
tologic malignancies of childhood: preclinical studies and phase I
clinical trial. Clin Cancer Res 2010;16:1894–903.
20. Kreitman RJ, Pastan I. Antibody fusion proteins: anti-CD22
recombinant immunotoxin moxetumomab pasudotox. Clin Cancer
Res 2011;17:6398–405.
21. Liu W, Onda M, Lee B, et al. Recombinant immunotoxin
engineered for low immunogenicity and antigenicity by identifying
and silencing human B-cell epitopes. Proc Natl Acad Sci USA
2012;109:11782–7.
22. Song J, Ren H, Li Y, et al. rG17PE38, a novel immunotoxin target
to gastric cancer with overexpressed CCK-2R. J Drug Target 2013;
21:375–82.
23. Zhou Y, Zhang YY, Shen QF, et al. Development of a novel
antibody probe useful for domoic acid detection. Biosens
Bioelectron 2009;24:3159–63.
24. Wayua C, Low PS. Evaluation of a cholecystokinin 2 receptor-
targeted near-infrared dye for fluorescence-guided surgery of
cancer. Mol Pharm 2013;11:468–76.
25. Beinfeld MC. Biosynthesis and processing of pro CCK: recent
progress and future challenges. Life Sci 2003;72:747–57.
26. Mazor R, Eberle JA, Hu X, et al. Recombinant immunotoxin for
cancer treatment with low immunogenicity by identification and
silencing of human T-cell epitopes. Proc Natl Acad Sci USA 2014;
111:8571–6.
27. Susan R, Peter L, Floris LD, et al. Radiolabeled CCK/gastrin
peptides for imaging and therapy of CCK2 receptor-expressing
tumors. Amino Acids 2011;41:1049–58.