Singapore Junior Biology Olympiad 2018 4 Which of the following is an example of active transport?

Practice Test 1
A Movement of water molecules from the soil into the root hair cell
1 Which of the following correctly shows structures which are found in a B Movement of amino acids from the lumen into the epithelial cells of the
bacterial cell? small intestine
C Movement of carbon dioxide from atmosphere into leaves
Nuclear membrane Mitochondria Cell wall D Transport of dissolved mineral salts up the xylem vessel of a plant
A Absent Absent Absent
B Absent Absent Present 5 The diagram below shows the liver, a part of the small intestines and the
C Present Absent Present associated blood vessels in a mammal.
D Present Present Present

2 An amoeba had its nucleus removed. For several days it continued to move
and feed, but it did not reproduce. An intact amoeba reproduced twice in that
time. What conclusions do you draw from this experiment about the role of
the nucleus in the amoeba?

A The nucleus is necessary for cell division.

B The nucleus regulates the activity of the cell.
C The nucleus is the only part of the cell that contained DNA.
D The nucleus is necessary for the cell to grow. Which of the following shows the correct blood flow in this region?

3 Curve X shown in the diagram below represents the results of an enzyme A JKMQN
catalysed reaction under optimum conditions. Curve Y shows the action of the B JKPQN
same enzyme on the same substrate but with one alteration on the reaction C NQPKJ
conditions. What is the alteration? D NOPMK

6 To investigate the effect of deficiency in nitrogen on growth of plants, the

plants in the control set‐up should be grown in

Y A a complete culture solution

B distilled water
C a culture solution lacking nitrogen
D a culture solution lacking nitrogen and magnesium
A A higher pH
B A lower temperature
C A higher enzyme concentration
D A lower volume of reaction mixture
1
7 Anhydrous cobalt chloride paper placed against the lower surface and the Refer to the graph below that shows the effect of changing light intensity and
upper surface of the leaf has a faster change of colour on the lower surface. carbon dioxide concentration on the rate of photosynthesis for questions 9 and 10.
This information indicates that
X
A transpiration takes place through the stomata
B there are more stomata on the lower surface than on the upper Rate of
C the rate of transpiration from the lower surface of the leaf is higher than photosynthesis
that of the upper
D the cuticle on the lower surface of the leaf is thinner than that on the
upper

8 The graph below shows the changes in the mass of plant tissue in dilute salt
Light intensity
solution at 25C.
9 Insufficient carbon dioxide to be reduced by excess hydrogen ions generated
from the light‐dependent stage occurs

Mass of plant I at light intensity higher than A1 at 0.03% carbon dioxide

tissue / g II at light intensity lower than A2 at 0.08% carbon dioxide
III at light intensity between A1 and A3 at 0.13% carbon dioxide

Answer: …………………………………………..

Time / h 10 Which is the most likely limiting factor at X for a plant grown in a glasshouse?

Which of the following statements about the experiment is/are correct? A Temperature
B Water availability
I The cells are fully turgid from 1.5 h onwards. C Carbon dioxide concentration
II There is no movement of water from 1.5 h onwards. D Number of chloroplasts
III The water potential of the plant cells is less negative than that of the
dilute salt solution from 0 to 1.5 h. 11 Why do the phospholipid molecules in cell membranes form fluid bilayers?
IV The maximum mass of the plant tissue will be higher than 1.0 g if the
experiment is carried out at 35C. A The hydrocarbon tails are attracted to water.
B The hydrocarbon tails repel water.
Answer: ………………………………………….. C The polar heads repel each other.
D The polar heads are attracted to the hydrocarbon tails.

2
12 A 2% solution of starch (amylose) and a 2% solution of amylase were mixed 16 Haemophilia is a sex‐linked recessive condition. A haemophiliac man has one
together and incubated at 25C. After one hour, samples of the solution were son who has inherited haemophilia and two more sons who have not.
tested with three reagents. What result would be expected? The man’s wife is pregnant again. If this baby is a girl, what is the chance that
she will have haemophilia?
Biuret Benedict’s solution Iodine in potassium
reagents and heated iodide solution A 0% B 25% C 50% D 75%
A Blue Brick red precipitate Brown
B Blue Blue solution Blue‐black 17 In the light‐dependent stage of photosynthesis, which substance donates
C Purple Blue solution Blue‐black electrons directly to the electron transport chain?
D Purple Brick red precipitate Brown
A Chlorophyll a B Hydrogen ions C Reduced NADP D Water
13 What is an accurate description of the coding of protein structure by DNA?
18 Which two reactions are involved in the process of photophosphorylation?
A A degenerate, non‐overlapping code for the primary structure,
determining the location of the folding sites involved in tertiary structure A Hydrolysis of ATP and the reduction of GP (GPA)
B A code, with several triplets for each amino acid, determining the shape B Hydrolysis of ATP and the reduction of NADP
of the ‐helix for the secondary structure C Synthesis of ATP and the oxidation of reduced NADP
C 64 different complementary codons used in transcription to make the D Synthesis of ATP and the reduction of NADP
three‐dimensional shape of the tertiary structure
D Amino acids coded for by three consecutive bases, used with tRNA 19 Which sequence correctly represents the action of nitrifying bacteria?
anticodons in translation to determine the quarternary structure
A Ammonium  nitrite  nitrate
14 What is the form of the DNA in a sister chromatid? B Ammonium  nitrate  nitrite
C Nitrate  nitrite  ammonium
A One molecule of single‐stranded DNA D Nitrite  ammonium  nitrate
B Two molecules of single‐stranded DNA
C One molecule of double‐stranded DNA 20 Which group could be a single population?
D Two molecules of double‐stranded DNA
A All the bacteria in a colony of E. coli, estimated from counts made using a
15 An mRNA codon for the amino acid alanine is GCC. haemocytometer
How many alanine molecules are present in the polypeptide, containing 8 B All the butterflies in an isolated forest, estimated using a capture‐mark‐
amino acids, coded for by the following DNA template? recapture method
TCGGCCTACCGGGCCCATGCCAAT C All the fish caught in a single pond in a day, counted as they are returned
to the pond at the end of the day
Answer: ………………………………………….. D All the orchids on an island, estimated from counts made within 10 m x 10
m quadrats

3
21 Each polypeptide chain of haemoglobin contains a number of regions in the 24 What occurs as a result of base pairing during DNA replication?
form of an alpha helix. Which feature of the haemoglobin molecule is
responsible for this? A Both strands of the DNA have the same sequence of purines and
pyrimidines.
A Bonding between the four polypeptide chains B In each strand, the number of purine bases equals the number of
B Hydrophobic interactions at the centre of the molecule pyrimidine bases.
C The amino acid sequence of the globin chain C Purine bases in one strand become hydrogen‐bonded to purine bases in
D The presence of iron in the haem groups the other strand.
D The number of purine bases in one strand equals the number of
22 A certain cell membrane is made entirely of phospholipid and is 5 nm thick. A pyrimidine bases in the other strand.
volume of 1 mm3 of this phospholipid membrane was homogenized and
dropped onto the surface of water in a large tray. The phospholipid spread 25 If there were 34 amino acids and DNA only contained two types of
out to form a continuous thin film. What is the expected are of this film? nitrogenous bases, what would be the minimum number of bases per codon
that could code for proteins?
A 200 000 mm2 because the molecules form a single layer
B 200 000 mm2 because the molecules form a double layer A 3 B 4 C 6 D 8
C 400 000 mm2 because the molecules form a single layer
D 400 000 mm2 because the molecules form a double layer 26 If the frequency of two alleles in a gene pool is 90% A and 10% a, what is the
frequency of individuals in the population with the genotype Aa?
23 A sugar that is composed of three condensed monosaccharides is hydrolysed
by two different enzymes. The products are shown in the table. A 0.81 B 0.09 C 0.18 D 0.01

Enzyme used Products 27 In humans, Rh‐positive individuals have Rh antigen on their red blood cells,
Galactosidase Galactose and sucrose while Rh‐negative individuals do not. If the Rh‐positive phenotype is produced
Sucrase Melibiose and fructose by a dominant allele (A), and the Rh‐negative phenotype is due to its recessive
allele (a), what is the frequency of the Rh‐positive allele if 84% of a population
What information about the structure of melibiose can be deduced from is Rh‐positive?
these results?
A 0.16 B 0.48 C 0.60 D 0.84
A It is a hexose sugar.
B It is composed of fructose and galactose. 28 Dog salivating at the sound of a can opener is an example of
C It is composed of glucose and galactose.
D It is composed of sucrose and monosaccharide. A classical conditioning
B fixed‐action‐pattern
C habituation
D operant conditioning

4
29 A goose retrieves eggs that have rolled out of the nest with a stereotyped 34 Brightly coloured poison‐dart frogs is an example of
movement.
A Mullerian mimicry
A Classical conditioning B Batesian mimicry
B Fixed‐action‐pattern C Aposematic colouration
C Imprinting D Cryptic colouration
D Operant conditioning
35 Which of the following is not an example of symbiosis?
30 A rat in a box learns to associate pressing a lever with obtaining food.
A Lichens
A Classical conditioning B Mycorrhizae
B Fixed‐action‐pattern C Tapeworms and humans
C Imprinting D Monarch butterflies
D Operant conditioning
36 The entire range of factors an organism is able to exploit in its environment is
31 Gause's principle of competitive exclusion states that its

A the more abundant species will exclude the less abundant species A community
through competition B realized niche
B different species cannot share the same habitat C fundamental niche
C no two species can occupy the same niche when resources are limited D habitat
D larger organisms exclude smaller ones through competition
37 A species that interacts with many other organisms in its community in critical
32 Which of the following helps a prey species avoid being detected by a ways can be called a
predator?
A predator
A Mullerian mimicry B keystone species
B Batesian mimicry C primary succession species
C Aposematic colouration D secondary succession species
D Cryptic colouration

33 Which of the following helps a prey advertise to predators that it is

unpalatable?

A Mullerian mimicry
B Batesian mimicry
C Aposematic colouration
D Cryptic colouration

5
38 The graph shows the oxygen dissociation curves for the pigments myoglobin 40 Following an action potential, a number of changes occur in the membrane of
and haemoglobin. an axon to re‐establish a resting potential. Which is one of these changes?

A Diffusion of potassium ions into the axon

B Diffusion of potassium ions out of the axon
% saturation of C Diffusion of sodium ions into the axon
pigments with D Diffusion of sodium ions out of the axon
oxygen
41 When a stimulus arrives at a nerve ending, the membrane becomes
depolarised. The events during depolarisation are listed below.

Partial pressure of oxygen / Torr 1 K+ channels open, Na+ channels close.

Which statement is correct?
A Active muscles receive oxygen from myoglobin and not haemoglobin.
B Myoglobin has a lower affinity for oxygen than haemoglobin, so readily
releases its oxygen when muscles become active.
C Myoglobin will only release its oxygen when carbon dioxide levels are
high.
D Oxygen is stored in muscles and is only released when insufficient oxygen
is released from haemoglobin.
39 Intact mitochondria are mixed with a solution containing DCPIP, succinate and
sucrose. The enzyme succinate dehydrogenase in the mitochondria oxidises
the succinate and the DCPIP is a hydrogen acceptor. Why is sucrose added to
the reaction medium?
A To act as a hydrogen donor
B To act as a reducing agent
C To maintain the osmotic balance
D To provide energy for the reaction
2 Na+ channels open and Na+ diffuses in.
3 Membrane potential is +40 mV inside compared to the outside.
4 Membrane potential is ‐65 mV inside compared to the outside.
Which is the correct order of events (from the first to the last)?
Answer: …………………………………………..
42 Some organisms change the composition of their membranes to maintain
membrane fluidity when temperature changes. Which changes occur in the
composition of membranes following a change to low temperature?
A Increase phospholipids, decrease cholesterol
B Increase saturated fatty acids, increase cholesterol
C Increase saturated fatty acids, decrease cholesterol
D Increase unsaturated fatty acids, increase cholesterol
43 What effect of natural selection is likely to lead to speciation?
A Differences between populations are increased.
B Favourable genotypes are maintained in the population.
C Genetic diversity is reduced.
D Selection pressure on some alleles reduces reproductive success.

6
44 Which term considers only evolutionary relationships? 49 Which type of enzyme enables a retrovirus to prepare its genetic information
for insertion into a host cell’s DNA?
A Classification
B Natural selection A DNA polymerase
C Phylogeny B Lytic enzyme
D Taxonomy C Restriction enzyme
D Reverse transcriptase
45 In the control of blood glucose level, in which organs are the receptor and
effector? 50 Which process in bacteria always allows chromosomal and non‐chromosomal
DNA to be transferred?
Receptor Effector
A Brain Pancreas A Binary fission
B Pancreas Liver B Conjugation
C Brain Liver C Transduction
D Liver Pancreas D Transformation

46 Which description defines a cDNA library? 51 Throughout which phase of the mitotic cycle would DNA be present in the
least amount in a nucleus?
A A collection of clones of overlapping DNA fragments representing the
entire genome A Interphase
B A collection of clones made by reverse transcriptase from mRNA B Prophase
C A collection of clones whose relationship to each other can be established C Anaphase
by chromosome mapping D Telophase
D A collection of DNA segments from known chromosomal locations
52 The figure below shows changes in the number of chromosomes of a cell
47 Which statement about the primary structure of a protein is not correct? during the cell cycle. The number of chromosomes in a normal body cell is x.
The time axis is not drawn to scale.
A It is unique to that protein.
B It is the sequence of amino acids in that protein. 2x
C It is hydrogen bonded.
D It determines the three‐dimensional shape of the final molecule. Number of Q R
chromosomes per
48 Which statement describes a feature of stem cells in adult humans? cell
x
A They can differentiate into some cell types. P
B They can give rise to a new organism. ½x
C They can differentiate into all cell types.
D They can undergo meiosis.
Time
7
 What are the most likely events that take place at P, Q and R? 55 Which of the following statements are true?

P Q R I Continuous variation is always influenced by the environment.

A Fertilisation DNA replication Telophase II Continuous variation is always caused by many genes.
B Fertilisation Anaphase Telophase, cytokinesis III Discontinuous variation is always caused by one gene.
C Gamete formation Interphase Anaphase IV Discontinuous variation is sometimes influenced by the environment.
D Anaphase Gamete formation Fertilisation
A I and IV B II and III C II and IV D III and IV
53 A triploid cell is one which contains three sets of chromosomes. Which of the
following processes will be affected in a triploid cell? 56 Two parents, both of blood group A, have a daughter with blood group O.
What is the probability that their next child will be a boy who has blood group
A Interphase and anaphase of mitosis O?
B Prophase I and metaphase I of meiosis
C Anaphase and metaphase of mitosis A 0.125 B 0.375 C 0.50 D 0.75
D Prophase II and metaphase II of meiosis
57 Both Mr and Mrs Brown have blood group A. Their first two children also have
54 Which of the following statements about the diagram are correct? blood group A. Their third child is found to be of a different blood group.
Which of the following statements are consistent with the observation above?

I The third child has blood group O.

II The third child has blood group AB.
III Mr and Mrs Brown are both heterozygous for blood group A.
IV Only Mr Brown is heterozygous for blood group A.
I Anaphase I of meiosis is shown.
II Anaphase II of meiosis is shown. Answer: …………………………………………..
III Homologous chromosomes are separating.
IV There will be 2 chromosomes per cell at the end of meiosis. 58 In mammals, glucose is present in blood plasma but not in urine. This is
because glucose molecules are
A I and III only
B I and IV only A actively transported from the proximal convoluted tubule
C II and IV only B oxidised to supply energy for ultrafiltration
D I, III and IV only C stored in the kidney
D too large to enter Bowman’s capsule

8
59 The following pressures in the kidney can be measured. 62 The diagram below shows the neural network in a man.

COP = colloid osmotic pressure of the blood

FP = filtration pressure at the glomerulus
HPb = hydrostatic pressure of blood in the glomeruli
HPf = hydrostatic pressure of the glomerular filtrate

Which of the following equations are correct?

A FP = COP + HPf + HPb

B FP = COP – (HPf + HPb)
C FP = HPb – (HPf + COP)
D FP = HPf – (HPb + COP)

60 The graph below shows changes in a person’s skin temperature over a period Which of the following pathways of nervous impulse may bring about a
of time. Which of the periods A, B, C or D would the arterioles supplying skin voluntary action of the arm?
capillaries first dilate?
A B C D A 124
37.6
B 534
37.2
C 1235
Skin D 532124
temperature /
oC 36.8
63 Which of the following results from increased secretion of adrenaline?
36.4
I Increased blood supply to the intestines
II Increased supply of glucose in the blood
36.0
III Vasodilation of the aorta
Time / min
Answer: …………………………………………..
61 Which changes take place in the iris of the eye when a person moves quickly
from darkness into bright light?
64 Which function(s) is/are carried out by the hormone insulin?
I Pupil dilates.
I It breaks down glucose.
II Circular muscles of iris relax.
II It catalyses the condensation of glucose to form glycogen.
III Pupil constricts.
III It increases the entry of glucose into cells.
IV Radial muscles of iris relax.
Answer: …………………………………………..
Answer: …………………………………………..

9
65 In mice, the allele for black hair colour (B) is dominant and brown hair colour Which statement correctly describes the relationship between the two genes?
(b) is recessive.
The agouti allele (A) causes banding on hairs so that the colour of the coat A Gene D/d is epistatic and gene Q/q hypostatic.
appears paler, black hair appears grey and brown hair appears beige. The B Genes D/d and Q/q are linked.
recessive, non‐agouti allele (a) gives a continuous pigment in the hairs so that C Petal colour is the result of dominant epistasis.
the coat appears darker. D Petal colour is the result of recessive epistasis.
What would be the expected ratio of grey : beige : black : brown offspring if
the parents had the genotypes Aabb and aaBb? 68 The table shows the differences in the average length in kilobases (kb) of a
gene and of messenger RNA (mRNA) in a bacterium and a mammal.
A 1:1:1:1 B 3:3:1:1 C 6:3:3:1 D 9:3:3:1
Organism Average length of gene / kb Average length of mRNA / kb
66 Skin colour in a variety of pumpkins is controlled by two pairs of alleles Pp and Bacterium 2.0 2.0
Rr which segregate independently. Mammal 16.6 2.2
The allele P is dominant and must be present for the development of
pigmentation in the skin. Pumpkins without pigment are white. Allele R is Which feature of the mammalian genome does not account for these
dominant and produces a red pigment in the skin. The recessive allele r gives differences?
a yellow colour.
In a testcross with a parent of unknown genotype, a phenotypic ratio of 1 red: A 94% of mammalian genes are interrupted by introns.
1 white was obtained. B Initial transcripts of pre‐mRNA are shortened by intron splicing in a
What was the genotype of the unknown parent? mammal.
C Mammalian genes have an average of seven introns.
A PPRR B PpRR C PPRr D Pprr D The mammalian genome is 1000 times longer than the bacterial genome.

67 In Dahlia flower petals, the dominant allele, D, of one gene results in the 69 In most organisms, all possible triplets of bases in DNA code for an amino acid
production of yellow pigment. No pigment is produced by the recessive allele except for the coding strand ‘stop’ triplets ATT, ATC and ACT. The coding
d. strand is complementary to mRNA.
The dominant allele, Q, of another gene codes for an inhibitor to the In the prokaryote, Methanosarcina barkeri, the coding strand triplet ATC
production of yellow pigment. codes for an unusual amino acid, pyrrolysine.
A Dahlia with white petals with the genotype DdQq was test crossed. The The non‐coding strand of a section of DNA in M. barkeri has the following
genotypes and phenotypes expected in the offspring are shown in the table. sequence of bases: TTTTTATTGTATTACTAGTGTTAATGA
How many amino acids can be made into a peptide by M. barkeri from the
gametes DQ Dq dQ Dq coding strand of this region of DNA?
dq DdQq Ddqq ddQq ddqq
white petals yellow petals white petals white petals A 5 B 6 C 7 D 8

10
70 How is translation controlled in eukaryotes? Which of the following occur at W?

A By activation of the protein by folding or cleavage after it is formed I Blood is ejected from ventricles to arteries.
B By differential removal of introns enabling a gene to code for more than II Ventricular diastole is occurring.
one protein III Stretching of the arterial wall occurs.
C By protein factors that bind to specific sequences in the mRNA IV There is elastic recoil of the arterial wall.
D By the production of RNA from the non‐coding strand of the DNA
Answer: …………………………………………..
71 The figure shows the pressure in the left side of the heart during one
heartbeat. 73 The diagram below shows a sun leaf. The sun leaf is adapted to live in areas
with high light intensity such as the tropical rainforest canopy.

At which period of time in the heart cycle are the semilunar valves open? With reference to the diagram, which of the following are important
structural features of the sun leaf that adapt it to its environment?
72 The figure below shows the blood pressure in blood vessels.
I Thick layer of palisade mesophyll to contain more chloroplasts
II Large intercellular air spaces to facilitate gaseous exchange
III Thick upper cuticle to reduce transpiration
Blood IV Well‐developed xylem vessels to deliver water for photosynthesis
pressure /
mm Hg Answer: …………………………………………..

Distance from the heart / arbitrary unit

11
74 The apparatus below was set 76 A green bean pod (fruit) has several seeds, but a mango fruit has only one
X
up to demonstrate two seed. Which of the following best explains this difference?
processes that occur in
plants. A The green bean flower has several ovaries, but the mango flower has only
one ovary.
B The ovary in the green bean flower has a few ovules, but the ovary in the
mango flower has only one ovule.
C A few pollen grains that landed on the stigma of the mango flower failed
Y to germinate to form pollen tubes.
D The ovule of the green bean flower has several egg cells, while that of the
mango flower has only one egg cell.
Which of the following correctly shows the processes shown by X and Y?
77 The graph below shows the changes in the concentration of oestrogen in a
X Y woman’s blood during part of the menstrual cycle and the changes in her
A Evaporation of water Absorption of water from soil body temperature.
B Respiration Transpiration stream
C Evaporation of water Transpiration pull
D Transpiration Root pressure 37.0
36.9
75 A student decides to study the impact of removing certain parts of bisexual
36.8
flowers on fruit formation in species P. He chooses three separate plants that
36.7
are growing in the same plot under similar conditions. The data is shown in
the table below. 36.6
36.5
Plant Part removed from all Impact on fruit formation on the plant 36.4
flowers on the plant 36.3
1 Anther 30% less fruit formed than an average plant 36.2
in the plot 36.1
2 Stigma No fruit formed 36.0
3 Petal No significant impact

Which of the following conclusions are consistent with the data?

I The flowers of species P is likely to be wind‐pollinated.

II Pollen grains must reach the stigma in order for fruits to be formed.
III Species P relies completely on cross‐pollination.

Answer: …………………………………………..
12
 What is the relationship between the woman’s basal body temperature and 79 Which of the following is not a characteristic of the causative agent of the
the concentration of oestrogen in her blood? Acquired Immune Deficiency Syndrome (AIDS)?

A A sharp increase in oestrogen concentration causes a rise in body A It has a capsid.

temperature. B It does not have cytoplasm.
B A sharp increase in body temperature causes a rise in oestrogen C It does not have a cell wall.
concentration. D It has a cell membrane.
C There is a link between a fall in oestrogen concentration and a rise in
body temperature. 80 A particular species of plant has 26 chromosomes in its egg cell. How many
D When oestrogen concentration decreases, body temperature decreases. chromosomes are present in a cell making up the anther wall, the generative
nucleus and a mature phloem sieve tube cell?
78 The structure of the human placenta is shown in the diagram below.
Anther wall Generative nucleus Mature phloem sieve tube cell
X A 52 26 52
Y B 26 52 52
C 52 26 0
D 26 26 0

81 The diagrams below show a human foetus and a germinating seed.

4
1 6

2
Which of the following correctly describes the concentration of substances in 5 7
vessel X in relation to vessel Y? human 3
foetus germinating seed
Urea Amino acid Oxygen
A Higher than Y Lower than Y Lower than Y
Structure 2 is comparable with structure(s) ……… of the germinating seed.
B Lower than Y Higher than Y Higher than Y
C Higher than Y Higher than Y Higher than Y
A 4
D Lower than Y Lower than Y Lower than Y
B 4 and 5
C 4, 5 and 6
D 4, 5 and 7

13
82 The reaction rate of salivary amylase on starch decreases as the concentration 85 The diagram represents part of the life cycle of the beef tapeworm.
of chloride ions is reduced. Which of the following describes the role of the
chloride ions?

A Allosteric inhibitor
B Coenzyme
C Cofactor
D Non‐competitive inhibitor

83 Six tubes containing preparations from animal tissue were set up as shown in
the table.

Tube Contents
1 Glucose + homogenised cells
2 Glucose + mitochondria Which of the following possible control measures would be the most effective
3 Glucose + cytoplasm lacking organelles in helping to eliminate the parasite from the human population?
4 Pyruvic acid + homogenised cells
5 Pyruvic acid + mitochondria A Banning the use of human faeces as a fertiliser
6 Pyruvic acid + cytoplasm lacking organelles B Banning the use of river water for irrigation
C Building new sewage treatment works for treatment of all sewage
After incubation, in which three tubes will carbon dioxide be produced? D Thorough cooking of all meat to kill bladderworms

Answer: ………………………………………….. For questions 86 to 90, state whether each statement is true or false.

84 What happens to most of the reduced NAD molecules in cell metabolism?
A They act as oxidising agents in glycolysis.
B They are oxidised in mitochondrial ATP formation.
C They are oxidised in the Calvin cycle.
D They combine with succinic acid as part of the Krebs cycle.
86 The light compensation point occurs earlier for the shade plant than the sun
plant.
87 Transpiration rate is higher in the day so that more water can be delivered to
the plant cells for photosynthesis.
88 The chemical energy in the form of ATP that is needed in the light‐
independent stage of photosynthesis is obtained from respiration.

89 Wilting takes place in order to cause the leaves to fold up to reduce water loss.

90 Water moves in the apoplast pathway by osmosis.

14
91 The diagram shows a section through a villus. What are expected to be 95 How many polypeptide chains and iron‐containing groups are present in a
present in high amounts in structures X and Y after an intake of full cream molecule of haemoglobin?
milk?
Number of polypeptide chains Number of iron‐containing groups
A 2 1
B 2 4
X C 4 1
D 4 4
Y
96 Which set of bonds is found in triglycerides?

Structure X Structure Y
A Amino acids Glucose and fructose
B Fats Glucose, galactose and amino acids
C Fatty acids and glycerol Glucose, galactose and amino acids
D Fats Lactose and amino acids

92 Gastric enzymes are secreted by the ………………… cells.

A chief B parietal C goblet D oxyntic

97 An enzyme is a globular protein held together by several different types of
93 Which of the following triggers the formation of the others? chemical bond, giving the enzyme primary, secondary and tertiary levels of
structure. What correctly summarises the types of bond involved in each level
A Trypsin of structure?
B Enterokinase
C Carboxypeptidase Disulphide Hydrogen Ionic bonds Peptide
D Chymotrypsin bonds bonds bonds
A Tertiary Secondary, Tertiary Primary
94 Secretin from the duodenum causes the pancreas to produce secretions rich tertiary
in …………………. B Primary, Primary Secondary, Secondary
tertiary tertiary
A proteases B amylase C lipase D bicarbonate C Secondary Secondary Tertiary Primary
D Primary Tertiary Secondary Tertiary

15
98 Which biological process relies upon the adhesive and cohesive properties of
water?

A Entry of water into root hair cells

B Survival of fish in ice covered lakes
C Transport of ions in a mammal
D Water movement in a transpiration stream

99 Which carbohydrate has glycosidic bond between carbon atom 1 and carbon
atom 6 of its component glucose molecule?

A Amylose B Cellulose C Glycogen D Maltose

100 Which statement refers to the quaternary structure of collagen?

A Each polypeptide is in the form of a stretched‐out helix.

B Every third amino acid in the polypeptide is glycine.
C Many triple helices, with covalent cross links, lie parallel with each other,
forming fibrils.
D Three helical polypeptides wind around each other to form a rope‐like
structure.

16