Thermophilic

Methanol Utilization by
Sulfate Reducing Bacteria

Heleen Goorissen
Cover picture: solfatara, Vití crater, Krafla region, Iceland.
Original habitat of Desulfotomaculum strain V21T

The research described in this work was carried out at the Department of Microbiology of the
University of Groningen, The Netherlands, and was supported by the Technology Foundation
STW, applied science division of the Netherlands Organization for Scientific Research (NWO).
 RIJKSUNIVERSITEIT GRONINGEN

Thermophilic methanol utilization by

sulfate reducing bacteria

Proefschrift

ter verkrijging van het doctoraat in de

Wiskunde en Natuurwetenschappen
aan de Rijksuniversiteit Groningen
op gezag van de
Rector Magnificus, Dr. F. Zwarts,
in het openbaar te verdedigen op
maandag 11 november 2002
om 14.15 uur

door

Helene Petronel Goorissen

geboren op 29 januari 1963

te Veldhoven
Promotores: Prof. dr. L. Dijkhuizen
Prof. dr. ir. A. J. M. Stams

Co-promotor: Dr. ir. T. A. Hansen

Beoordelingscommissie: Prof. dr. A. J. M. Driessen

Prof. dr. D. B. Janssen
Prof. dr. B. Poolman
 Bij deze een welgemeend bedankt
aan ieder die een bijdrage heeft geleverd
aan mijn promotie-onderzoek en
het tot stand komen van dit proefschrift
Contents

Abbreviations

1 General Introduction 1

2 Methanol degradation in defined mixed cultures of 45

thermophilic anaerobes in the presence of sulfate

3 Methanol dissimilation in Desulfotomaculum kuznetsovii 55

4 Endospores of thermophilic sulfate reducing bacteria 63

survive extreme heat treatments

5 Isolation of thermophilic Desulfotomaculum strains with 71

methanol and sulphite, and characterization of
Desulfotomaculum solfataricum sp. nov.

6 Summary and concluding remarks 83

7 Summary in dutch 87
Samenvatting
Abbreviations

AB: homoacetogenic bacteria

Ac: acetate
ADH: alcohol dehydrogenase
Bio-FGD: biological flue-gas desulfurization
COD: chemical oxygen demand
EGSB: expanded granular sludge bed
Etoh: ethanol
ETDH: ethanol dehydrogenase
FGD: flue-gas desulfurization
HRT: hydraulic retention time (h-1)
LWS: limestone wet scrubbing
MA: methanogenic archaea
MDH: methanol dehydrogenase
Metoh: methanol
MTF: methyltransferase
NAD: nicotinamide adenine dinucleotide
NADP: nicotinamide adenine dinucleotide phosphate
PQQ: pyrroloquinoline quinone
SDA: spray dry absorption
SRB: sulfate reducing bacteria
UASB: upflow anaerobic sludge blanket
 1

General Introduction

Parts of this Chapter have been published previously (Weijma, 2000)

Chapter 1

General Introduction

Contents

1.1 Biological desulfurization 3

1.1.1 Sulfur dioxide emission 3
1.1.2 Biological desulfurization with methanol 4
1.1.3 Sulfate- and sulfite reduction 5
1.1.4 Selection of methanol as electron donor 6
1.1.5 Selection of thermophilic conditions 7
1.2 Microbiology of thermophilic anaerobic methanol conversion 7
1.2.1 Anaerobic degradation of methanol 7
1.2.2 Thermophilic sulfate reducing bacteria 9
1.2.2.1 The genus Desulfotomaculum 14
1.2.2.2 Spore-formation and heat resistance 18
1.2.3 Thermophilic methanogenic archaea 18
1.2.4 Thermophilic homoacetogens growing on C1-compounds 19
1.3 Biochemistry of anaerobic methanol degradation 23
1.3.1 Enzymes involved in degradation of primary alcohols 23
1.3.2 Methanol metabolism in homoacetogens and methanogenic archaea 24
1.3.3 Methanol metabolism in sulfate reducing bacteria 27
1.4 Methanol conversion by mixed communities 28
1.4.1 Substrate competition 28
1.4.2 Direct competition for methanol 29
1.4.3 Indirect competition 30
1.4.4 Syntrophic methanol conversion 31
1.5 Factors affecting the fate of methanol in biological desulfurization 31
1.5.1 Sulfur compounds 32
1.5.2 Methanol and acetate toxicity 33
1.5.3 Environmental conditions 34
1.6 Outline of this thesis 34
References 35

2
 Introduction

1.1 Biological desulfurization

In sub-section 1.1.1, sulfur dioxide emission and general aspects of the flue gas
desulfurization process are discussed. In sub-section 1.1.2 the biological desulfurization process is
described in more detail. Sulfate- and sulfite reduction (sub-section 1.1.3); the selection of
methanol as electron donor for reduction of sulfur oxyanions (sub-section 1.1.4), and the selection
of thermophilic conditions for the biological desulfurization process are discussed (sub-section
1.1.5).

1.1.1 Sulfur dioxide emission

Sulfur dioxide (SO2) represents the main fraction of anthropogenic sulfur emissions
worldwide. According to the U.S. Environmental Protection Agency (EPA), roughly 23 million
tonnes of SO2 are emitted annually in the United States. In the member states of the European
Union, about 16.5 million tonnes of SO2 were emitted in 1990. Anthropogenic sulfur dioxide
emission is mainly caused by combustion of sulfur-containing fossil fuels such as coal and oil.
Electricity generating plants account for nearly 70% of all SO2 emissions (The 1994 Protocol on
Further Reduction of Sulfur Emissions. United Nations Economic Commission for Europe). The
second major source of sulfur dioxide is industrial combustion processes, such as boilers, process
heaters, metallurgical operations, roasting and sintering, coke oven plants, processing of titanium
dioxide, pulp production, and the thermal treatment of municipal and industrial wastes. Also some
non-combustion processes contribute to sulfur dioxide emission, such as sulfuric acid production,
specific organic synthesis processes, treatment of metallic surfaces and oil refining processes.
Overall data (1990) for North America, Western, Central, and Eastern Europe, and Central Asia
show that 88% of total sulfur emissions originate from combustion processing, 5% from production
processing and 7% from oil refining. In terms of contribution by fuel type, coal-fired industrial and
electricity-generating plants account for more than 90% of all SO2 emitted by stationary fuel-
combustion sources.
Sulfur dioxide (along with NOx) has a number of unwanted environmental effects. First, acid
rain is formed when sulfur dioxide mixes with and dissolves in the water in clouds, eventually
forming dilute sulfuric acid. Acid rain causes lake and soil acidification, forest die-off, and corrosion
of stone and metalwork. Furthermore, SO2 contributes to the formation of acidic aerosols, which
can cause haze to form over large regions. It is believed that such haziness can substantially
reduce average temperatures in affected areas (Charlson et al., 1992). Through this mechanism,
SO2 could affect the earth's climate. SO2 and related pollutants have also been linked to a number
of human diseases (Amdur & Underhill, 1968). Therefore, the need for sulfur dioxide removal from
flue-gases is evident and acknowledged by many countries in treaties such as ‘The protocol to the
1979 convention on long-range transboundary air pollution on further reduction of sulfur emissions’
of the United Nations Economic Commission for Europe and the ‘1990 Clean Air Act Amendments’
of the United States government.
General options for reduction of sulfur emissions include energy management measures,
increasing the proportion of non-combustion renewable energy sources (i.e. hydro, wind, etc.) of
the total energy supply, fuel switching (e.g. from high- to low-sulfur coals and/or liquid fuels), or
from coal to gas, fuel desulfurization and advanced combustion technologies (e.g. coal gasification
combined with gas desulfurization). Another category of processes aims at removing already
formed sulfur oxides, referred to as Flue-Gas Desulfurization (FGD) processes. FGD was already
applied in the Battersea power plant in London in 1926, where it consisted of scrubbing the flue-
gas with alkaline water (Pfeiffer, 1975). The state-of-the-art technologies for flue-gas treatment
processes are all based on the removal of sulfur dioxide by wet, dry or semi-dry (also referred to as
wet and dry absorption processes) and catalytic chemical processes. In some cases, techniques
for reducing sulfur emissions may also result in the reduction of CO2 and NOx emissions and other
pollutants.
Flue-gas treatment processes currently applied include: lime/limestone wet scrubbing
(LWS); spray dry absorption (SDA); Wellman Lord process (flue-gas scrubbing using sulfite);
ammonia scrubbing; and combined NOx/SOx removal processes (activated carbon process and

3
Chapter 1

combined catalytic removal). In the power generation sector, LWS and SDA cover 85% and 10%
respectively of the installed flue-gas desulfurization capacity. In LWS, aqueous lime or limestone
slurries are brought inot contact with the flue-gas in a scrubber. The sulfur dioxide dissolves in the
aqueous phase and then reacts with hydroxide ions to form bisulfite (HSO3-), which subsequently
reacts with Ca2+ to form the poorly soluble CaSO3. CaSO4 (gypsum) is another product, as part of
the bisulfite is oxidized to sulfate, due to the presence of oxygen in flue-gas. The resulting CaSO3
and CaSO4 mixture is used in construction materials. However, impurities - such as fly-ash and
dust - originating from the flue-gas may limit this commercial application. Disposal as a waste then
becomes the only alternative, resulting in additional costs and environmental pollution. Over the
last decade, efforts have been made to develop a biotechnological alternative to conventional
physico-chemical processes for the removal of sulfur dioxide from flue-gases. This process is
called Biotechnological Flue-Gas Desulfurization (Bio-FGD). In Bio-FGD, bacteria are used to fix
SO2 as elemental sulfur.

1.1.2 Biological desulfurization with methanol

Figure 1.1. Flow sheet of the BIO –FGD process

Biotechnological Flue-Gas Desulfurization makes use of the following conversions of the

sulfur cycle:

SO2 +H2O ⇒ HSO3- + H+ 1

HSO3- + ½ O2 ⇒ SO42- + H+ 2
HSO3- + 6 {H} ⇒ HS- + 3 H2O 3a
SO42-+ 8 {H} -
⇒ HS + 3 H2O + OH -
3b
-
HS + ½ O2 ⇒ S + OH- 4

Figure 1.1 shows the flow sheet for Bio-FGD. In the first step of biological flue-gas
desulfurization, sulfur dioxide is scrubbed from the flue-gas using a bicarbonate solution (reaction
1). the presence of oxygen in the flue-gas results in oxidation of part of the sulfite into sulfate (2). In
the subsequent step, sulfite and sulfate are reduced under anaerobic conditions with an added
electron donor ({H}) to sulfide by sulfate-reducing bacteria (3a and b). In a micro-aerobic reactor,
the sulfide produced is partially oxidized to elemental sulfur by autotrophic sulfur bacteria like
Thiobacillus spp. (4) with concomitant production of hydroxide. Separation of the solid sulfur
particles from the medium enables the recovery of elemental sulfur as a valuable product. The

4
 Introduction

remaining alkaline solution, with a pH of about 9, can be reused for the scrubbing of sulfur dioxide.
Because - along with SO2 - heat is also transferred from the flue-gas to the scrubbing solution, it is
economically attractive to operate the desulfurization process at thermophilic conditions (50-65°C).
In biological desulfurization processes, methanogenesis should be avoided as this
decreases the selectivity of sulfate reduction with the added electron donor.

1.1.3 Sulfate- and sulfite reduction

Sulfite reduction is energetically more favorable than sulfate reduction. At a biochemical
level, this is manifested by the ATP demanding activation of sulfate to adenosine-5’-
phosphosulfate (APS) by ATP-sulfurylase, which is followed by APS reduction to form sulfite and
AMP. Sulfite is directly suitable as an electron acceptor for the SRB. A review of the biochemistry
of sulfate reduction can be found elsewhere (Widdel & Hansen, 1992). Sulfite addition to
sulfidogenic bioreactors may lead to the chemical formation of thiosulfate (Krämer & Cypionka,
1989):

4 HSO3- + 2 HS- ⇒ 3 S2O32- + 3 H2O (∆Go’= -167 kJ/mol )

Van Houten et al (1997) detected about 15 mg.L-1 (0.13 mM) thiosulfate in a thermophilic
bioreactor fed with H2/CO2, sulfite, and sulfate. The rather low thiosulfate concentration led to the
conclusion that the rate of sulfite reduction was higher than the chemical conversion rate of sulfite
plus sulfide to thiosulfate. An alternative explanation could be that the rates of thiosulfate formation
and reduction are about as high as each other.
The use of thiosulfate as terminal electron acceptor is energetically also more favorable
than the use of sulfate, as - like sulfite reduction - thiosulfate reduction requires, no ATP-dependent
activation (Krämer & Cypionka, 1989). This may explain the preferential use of thiosulfate over
sulfate as the electron acceptor in fresh water sediment (Jørgensen & Bak, 1991). Thiosulfate
reduction by SRB may lead to higher cell yields compared to sulfate reduction (Badziong & Thauer,
1978).

Disproportionation
Bak and Pfennig (1987) were the first to describe the disproportionation of sulfite and
thiosulfate to sulfide and sulfate by the sulfate-reducing bacterium Desulfovibrio sulfodismutans
according to the following stoichiometry:

S2O32- + H2O ⇒ SO42- + HS- + H+ ∆Go’= -21.9 kJ/mol S2O32-

4 SO32- + H+ ⇒ 3 SO42-+ HS- ∆Go’ = -58.9 kJ/mol SO32-

Later it was found that many SRB are able to disproportionate sulfite and thiosulfate
(Krämer & Cypionka, 1989). In batch experiments using fresh sludge from a thermophilic
methanol-fed, sulfidogenic bioreactor, sulfite disproportionation activity was observed, although
rates were 4 times lower than sulfate reduction rates with methanol (Weijma, 2000). Jørgensen
and Bak (1991) demonstrated that disproportionation and thiosulfate reduction may occur
simultaneously. Even disproportionation of elemental sulfur by SRB has recently been
demonstrated (Finster et al., 1998). For growth, most disproportionating SRB known thus far,
require acetate as a carbon source. Recently it was shown that Dm. thermobenzoicum can
disproportionate thiosulfate in the absence of any added carbon source (Jackson & McInerney,
2000). Thus far, only strain NTA 3 is known to grow autotrophically by thiosulfate
disproportionation (Bak & Cypionka, 1987). The finding that Dm. thermobenzoicum effectively
disproportionates thiosulfate shows that disproportionation metabolism is not exclusively restricted
to mesophilic gram-negative SRB.

5
Chapter 1

1.1.4 Selection of methanol as electron donor

An important factor determining the economic feasibility of biological desulfurization is the
cost of the electron donor needed for sulfate reduction in the anaerobic step. Formation of
undesirable side-products, such as methane and acetate, needs to be minimized. Possible
electron donors include organic waste materials, such as primary sewage sludge, spent yeast from
breweries, dairy whey, molasses, and bulk chemicals like H2, synthesis gas (a mixture of H2, CO2
and CO), ethanol, and methanol (Table 1.1). Organic waste has the advantage of low costs, but
because of its complex composition, adequate control of the process may be difficult. For instance,
intermediates formed during degradation of organic waste may promote undesirable growth of
methanogens. Also, incomplete degradation of organic compounds may decrease the performance
of the sulfide-oxidizing bioreactor of the desulfurization process (Janssen et al., 1997).
The applicability of pure chemicals such as lactate, ethanol, and acetate for sulfate
reduction has been demonstrated in mesophilic laboratory-scale reactors (Table 1.1), but use of
these chemicals on an industrial scale will probably be prohibitively expensive. Relatively cheap
bulk chemicals as synthesis gas or H2/CO2 are better options in this respect. Moreover, reasonable
to good sulfate elimination rates can be achieved using these substrates in mesophilic gas-lift
reactors (Table 1.1). However, under thermophilic conditions (preferable for Bio-FGD) elimination
rates with H2/CO2 are lower, while it has been found that about half of the added hydrogen is used
for methanogenesis, presumably due to the good kinetic growth properties of thermophilic
methanogens (Van Houten, et al., 1997).

Table 1.1. Sulfate and sulfite elimination rates found in biological desulfurization processes with
various electron donors.

Electron T Bioreactor SO42- removal SO32- removal COD to Reference

donor type -1 -1 -1 -1 H2S/CH4
(ºC) (g.L .day ) (g.L .day )
(%/%)
a
molasses 31 packed bed 6.5 na nrb Maree & Strydom, 1987
c
m.s.d. 30 packed bed na 46 100/0 Selvaraj et al., 1997
d
lactate RT plugflow 0.41 na nr Hammack et al., 1994
acetate 35 packed bed 65 na 100/0 Stucki et al., 1993
e
acetate 33 EGSB 9.4 na nr Dries et al., 1998
f
ethanol 35 UASB 6 na nr Kalyuzhnyi et al., 1997
syngas 30 gas-lift 10 na 100/0 Van Houten et al., 1995
H2/CO2 30 packed bed 1.2 na 100/0 duPreez & Maree, 1994
H2/CO2 30 gas-lift 30 na 100/0 Van Houten et al., 1994
H2/CO2 55 gas-lift 7.5 9.3 50/50 Kaufman et al., 1996
CO 30 packed bed 2.4 na 100/0 duPreez & Maree, 1994
a) na: no sulfate or sulfite added; b) nr : not reported; c) m.s.d.: municipal sewage digest; d) RT: room temperature; e)
EGSB : expanded granular sludge bed; f) UASB: upflow anaerobic sludge bed.

In the present study, the use of methanol as the electron donor for thermophilic sulfate
reduction was investigated. Methanol is a relatively cheap bulk chemical and therefore an attractive
substrate for use in biotechnological processes (Dijkhuizen et al., 1985). Methanol is successfully
used as an electron donor in denitrification (Germonpre et al., 1991), reductive dehalogenation
(Gerritse et al., 1999), and it has also been proposed as an electron donor in other sulfate-reducing
processes (Hard & Babel, 1995). Moreover, chemically synthesized methanol contains few organic
impurities, resulting only in a low extent of undesirable biological side-reactions resulting from
these impurities. A low level of impurities also makes additional treatment of biologically

6
 Introduction

desulfurized wastewater redundant. Hence, methanol was selected as the electron donor for
reduction of sulfur oxyanions in our investigation.

1.1.5 Selection of thermophilic conditions

Most of the biological desulfurization processes have been operated at mesophilic
temperatures (Table 1.1). The feasibility of the process will be determined partly by the energy
requirements of the operational system. A thermophilic process in the temperature range of the
flue-gas wastestream, can decrease the energy demand of the process. As well as producing SO2
heat is transferred from the flue-gas to the scrubbing solution, so it is attractive to operate the
desulfurization process at (moderate) thermophilic conditions, so that no cooling is required.
Moreover, thermophilic conditions might benefit the process in other ways. First, temperatures
above 65 ºC might rule out undesirable side reactions, for example methanogenesis with
methanol, since no methanogens growing with methanol above 65 ºC have yet been discovered.
Second, due to the relatively high temperature, turnover rates might be higher.
In the present work, sulfate reduction with methanol was studied at temperatures in the
range 60-65ºC. At the start of this research project, only a few thermophilic methanol-utilizing SRB
were known.

1.2 Microbiology of thermophilic anaerobic methanol degradation

In this section, the possible biological degradation routes of methanol are presented (sub-
section 1.2.1). An overview of sulfate reducers, methanogenic archaea and homoacetogens
possibly involved in thermophilic methanol degradation is given in sub-sections 1.2.2, 1.2.3, and
1.2.4, respectively.

1.2.1 Anaerobic degradation of methanol

Possible degradation pathways for methanol under anaerobic conditions are shown in
Figure 1.2. Reaction stoichiometries and Gibbs free energy changes are shown in Table 1.2. Three
groups of microorganisms are involved in anaerobic methanol degradation, namely sulfate-
reducing bacteria (SRB), methanogenic archaea (MA), and homoacetogenic bacteria (AB).
Methanol can be used directly as a carbon and energy source by SRB (conversion 1) (Nazina, et
al., 1987), MA (conversion 5a) (Touzel et al., 1985) and AB (conversion 9) (Savage & Drake,
1986). In addition, MA may reduce methanol to methane using H2 (conversion 5b). Therefore,
SRB, MA and AB will compete for the available methanol in mixed cultures. Thermophilic SRB e.g.
Desulfotomaculum thermoacetoxidans (Min & Zinder, 1990) and MA (Nozhevnikova & Chudina,
1984) may also compete for acetate (conversions 2 and 6), the product of methanol catabolism by
AB (conversion 9). It has also been demonstrated that acetate can be oxidized to H2/CO2
(conversion 11) under mesophilic conditions (Schnürer et al., 1996), as well as under thermophilic
conditions (Zinder & Koch, 1984). Therefore, degradation of methanol to methane by a triculture
consisting of a methylotrophic acetogen, acetate oxidizing species, and a hydrogenotrophic
methanogen is theoretically possible. Furthermore, anaerobic bacteria may partially oxidize
methanol to H2/CO2 (conversion 10), when the H2 concentration is kept low by hydrogenotrophic
sulfate reducers (conversion 3) or methanogens (conversion 7) (Davidova & Stams, 1996). In the
mesophilic temperature range, even methanogens have been shown to produce H2/CO2 from
methanol when grown in the presence of SRB (Phelps et al., 1985). Thus, competition for H2 may
also take place.
At a high hydrogen partial pressure, H2 may be consumed by homoacetogens (Wiegel et
al., 1981). As methanol oxidation to hydrogen is thermodynamically unfavorable at a high hydrogen
partial pressure, methanol oxidation followed by acetogenesis from H2/CO2 is unlikely to occur.
Therefore, this conversion is not included in Figure 1.2 and Table 1.2. Methanol conversion to
formate (conversion 12) is thermodynamically unfavorable under standard conditions. To our
knowledge, formate formation from methanol has not been reported in literature. However, besides
hydrogen, formate can be important in methanogenic environments (Boone et al., 1989; Dong &
Stams, 1995). SRB (conversion 4) (Nazina et al., 1987) and MA (conversion 8) (Zhilina & Ilarianov,

7
Chapter 1

1984) can subsequently use formate. Methanol degradation can be even more complex because
formate conversion to hydrogen and acetate (Guyot, 1986) and methanol degradation to butyrate
(Cato et al., 1986), or alanine (Balk et al., 2002) (not shown in Figure 1.2) may also occur. The
above illustrates that mixed cultures may mineralize the relatively simple C1-compound methanol in
a complex way. As a consequence, SRB and MA may not only compete for methanol, but also for
hydrogen, acetate, and formate.

2-
SO4
4 8
Sulfide Formate Methane
2-
SO4
1 5
Sulfide Methanol Methane
9 10
2-
SO4
2 7
Sulfide Acetate H2/CO2 Methane
2-
3 SO4

Methane Sulfide

Figure 1.2. Anaerobic methanol mineralization. Conversion numbers correspond to the numbers of
reaction equations in Table 1.2

Table 1.2. Stoichiometry and Gibbs free energy changes at standard conditions and pH 7 of reactions
possibly involved in anaerobic methanol degradation. Calculated from Thauer et al. (1977).
Reaction ∆G°' (kJ/reaction)
1) 4 CH3OH + 3 SO42- ⇒ 4 HCO3- + 3 HS- + 4 H2O + H+ -364
2) CH3COO- + SO42- ⇒ 2 HCO3- + HS- -48
3) 4 H2 + SO4 2- +H+ ⇒ HS- + 4 H2O -152
4) 4 HCOO- + SO42- + H+ ⇒ HS- + 4 HCO3- -172
5a) 4 CH3OH ⇒ 3 CH4 + HCO3- + H2O + H+ -316
5b) CH3OH + H2 ⇒ CH4 + H2O -113
6) CH3COO- + H2O ⇒ CH4 + HCO3- -31
7) 4 H2 + HCO3- + H+ ⇒ CH4 + 3 H2O -136
8) 4 CHOO- + H2O + H+ ⇒ CH4 +3 HCO3- -132
9) 4 CH3OH + 2 HCO3- ⇒ 3 CH3COO- + H+ + 4 H2O -220
10) CH3OH + 2 H2O ⇒ 3 H2 + HCO3- + H+ +23
11) CH3COO- + 4 H2O ⇒ 4H2 + 2 HCO3- + H+ +104
12) CH3OH + 2 HCO3- ⇒ 3 HCOO- + H2O + H+ +19

8
 Introduction

1.2.2 Thermophilic sulfate reducing bacteria

Sulfate reduction has been reported as occurring at maximum temperatures between 100-
110 ºC, although no organisms with such temperature optima have yet been isolated (Jørgensen
et al., 1992). Sulfate reduction with C1 or C2 compounds as substrate may occur at temperatures
up to 90 ºC, but is only known for hyperthermophilic archaea (Stetter, 1988; Burggraf et al., 1990;
Huber et al., 1997; Stetter et al., 1993). No eubacterial sulfate reducers with an upper temperature
limit above 85 ºC have yet been described (Nazina, et al., 1987; Rozanova & Khudyakova, 1974).
SRB constitute a diverse group of prokaryotes that contribute to a wide variety of essential
functions in many anaerobic environments. On the basis of phylogenetic and physiological
characteristics, SRB are classified into four distinct groups: Gram-negative mesophilic SRB; Gram-
positive spore-forming SRB; Gram-negative thermophilic SRB; and thermophilic archaeal SRB
(Castro et al., 2000). All of these groups are characterized by their use of sulfur oxyanions such as
sulfate, sulfite, or thiosulfate as the terminal electron acceptor for anaerobic respiration.
Thermophilic sulfate-reducers are spread among different genera, an overview of all described
thermophilic sulfate-reducers is given in Table 1.3. Phylogenetic classification of the thermophilic
sulfate-reducers within the bacterial domain combined with the archaeal sulfate-reducers, is given
in Fig. 1.3. The optimum pH for growth of the known thermophilic SRB lies in the range of 6.5-7.5
and the optimum temperature in the range of 54-70 ºC (Table 1.3., p.12). Most of the thermophilic
SRB are able to grow at moderately or high salt concentrations of up to 70 g.L-1.
The dominant genus in this overview of thermophilic SRB is the genus Desulfotomaculum,
which comprises at least 14 thermophilic species. Desulfotomaculum species play a central role in
the work described in this thesis and will be discussed in more detail in sub-section 1.2.2.1.
Genera consisting of thermophilic species only are Thermodesulfobacterium,
Thermodesulforhabdus, Thermodesulfovibrio, and Desulfacinum, although Desulfacinum
hydrothermale can grow at mesophilic temperatures. All species, except Thermodesulforhabdus
norvegicus, can use hydrogen as an electron donor. Some species - i.e. Dsm. alkaliphilum, all
Thermodesulfobacterium species, and all Thermodesulfovibrio species - need additional acetate as
a carbon source for growth on hydrogen. Dsm. thermoacetoxidans produces acetate and sulfide if
H2/CO2 is added in excess. Growth on formate with acetate as the carbon source is common, while
growth on acetate is rare (Table 1.3). Methanol utilization is even more rare and is restricted only
to a few Desulfotomaculum species, although utilization of methanol was not tested for some
species (Table 1.3). Use of sulfite and thiosulfate as an alternative electron acceptor is common
among SRB, although some species additionally use elemental sulfur (Desulfacinum subterraneum
and Dsm. thermoacetoxidans) or nitrate (Dsm. thermobenzoicum and Tvb. islandicus). Under
sulfate-limiting conditions, some thermophilic SRB ferment pyruvate (e.g. Desulfacinum species,
most Desulfotomaculum species, Tdv. yellowstonii, Tdb. commune, and Tdb. mobile) or lactate
(several Desulfotomaculum species). Furthermore, during sulfate limitation some thermophilic SRB
(Dsm. thermobenzoicum subsp. thermosyntrophicum, Dsm. thermocisternum) can produce
hydrogen growing in a syntrophic association with thermophilic hydrogen scavengers such as
Methan-othermobacter thermoautotrophicus, although reports on syntrophic growth of Dsm.
thermocisternum are contradictory (Nilsen et al., 1996; Imachi et al., 2000; Plugge et al., 2002).
Thermodesulforhabdus norvegicus, isolated from Norwegian oil platforms, was the first
thermophilic SRB, that showed good growth on acetate. This strain belongs to the delta subdivision
of the proteobacteria together with Desulfacinum infernum, a strain of similar origin.
Thermodesulforhabdus norvegicus and the genus Desulfacinum are classified in the group of
gram-negative mesophilic SRB and cluster phylogenetically in the family of Desulfobacteriaceae.
The majority of members of this family are mesophilic (Castro et al., 2000).
The genera Thermodesulfobacterium and Thermodesulfovibrio share similar physiological
and phenotypical characteristics but are phylogenetically only distantly related. They both belong to
the group of gram-negative thermophilic bacteria and they branch deeply in the Bacteria domain.
Their optimal temperatures are higher than those described for gram-positive spore-forming
thermophilic SRB and Desulfacinum species, but lower than those of the archaeal SRB.

9
Chapter 1

Figure 1.3. Phylogenetic relationships between all sulfate-reducers compared with some reference
genera. The genus Archaeoglobus was used as outgroup. Bootstrap values (50 replicants)
are expressed as percentages at the branch points. Classification of sulfate-reducers
according to Castro et al. (2000); A, thermophilic gram-negative SRB; B, mesophilic gram-
negative SRB; C, gram-positive SRB; D, thermophilic archaeal sulfate-reducers.

10
 Introduction

The genus Thermodesulfovibrio consists of two species - Tdv. yellowstonii and Tdv.
islandicus - both isolated from geothermal vents. In contrast with Tdv. yellowstonii, Tdv. islandicus
can reduce nitrate but not sulfite.
Four Thermodesulfobacterium species have been described to date: Tdb. commune and
Tdb. hveragerdense, both originating from terrestrial hot springs, Tdb. mobile, isolated from warm
oilfield water, and Tdb. hydrogeniphilum from marine hydrothermal chimneys and sediments. All
four species have a narrow substrate range: in Tdb. commune and Tdb. hveragerdense apart from
H2/CO2, only lactate and pyruvate can serve as an electron donor for sulfate reduction. In addition,
Tdb. mobile can also use formate as a substrate for sulfate reduction. Growth of Tdb.
hydrogeniphilum depends upon the presence of hydrogen, and some additional substrates like
acetate and fumarate stimulate growth, but could not be used as sole energy source. Except for
Tdb. hydrogeniphilum, all Thermodesulfobacterium species need additional acetate as a carbon
source for growth.
Four archaeal sulfate-reducers have been isolated yet, all from marine hydrothermal areas.
These species, with a lower temperature limit of 60 ºC and optimum growth temperatures above
80 ºC, are members of the genus Archaeaoglobus. Except for A. profundis, all Archaeoglobus
strains are facultative chemolithoautotrophs.

11
Table 1.3. Selected physiological characteristics of thermophilic bacterial and archaeal sulfate-reducers
o
Organism Origin Gram- Growth substrates Electron acceptors T-opt ( C) Specific Reference
o
stain T-range ( C) feature
Archaeoglobus
fulgidus Hydrothermal system - H2/CO2, for, lac, fum, Sox 83 Stetter, 1988
60-95
lithotrophicus Oil field reservoir - H2/CO2, for, ac, fum, etoh Stetter et al., 1993
profundis Hydrothermal system - H2 +ac, +lac, +pyr sulfate, thiosulfate 82 S0 inhibits Burggraf et al., 1990
65-90
veneficus Black smoker - H2/CO2, for, ac, fum, etoh sulfite, thiosulfate 80 S0 inhibits Huber et al., 1997
65-85
Desulfacinum
infernum Oil reservoir - H2/CO2, for, ac, metohnt Sox 60 Rees et al., 1995
hydrothermale Marine hydrothermal vent - H2/CO2, for, ac, metohnt Sox 60 halophilic Sievert & Kuever, 2000
37-64
subterraneum High temperature oil field - H2/CO2, for, ac, metohnt Sox, sulfur 60 ferments YE Rozanova et al., 2001
Vietnam 45-65
Desulfotomaculum
alkaliphilum Cow/pig manure + H2 + ac, for, lac, etoh, pyr Sox 50-55 alkaliphilic Pikuta et al., 2000
30-58
australicum Geothermal ground water + H2/CO2, ac, lac, etoh nt 68 Love et al., 1993
40-74
geothermicum Saline geothermal + H2/CO2, lac, etoh, fruc sulfate, sulfite, 54 halophilic Daumas et al., 1988
ground water thiosulfatent 30-57
kuznetsovii Hot spring + H2/CO2, for, ac, metoh, Sox 60 Nazina, et al., 1987
etoh 50-85
luciae Hot spring sediments + H2/CO2, for, lac, etoh, pyr sulfate, thiosulfate nr Liu et al., 1997
50-70
nigrificans Freshwater + H2/CO2, lac, etoh Sox 55 Klemps et al., 1985
30-70
putei Deep terrestrial rock + H2/CO2, for, lac, etoh Sox nr Liu et al., 1997
50-65
thermoacetoxidans Anaerobic digester + H2/CO2, for, ac, lac sulfate, thiosulfate, 55-60 Min & Zinder, 1990
Table continued

Organism Origin Gram- Growth substrates Electron acceptors T-opt (°C) Specific Reference
stain T-range (°C) feature
thermobenzoicum Deep submarine + H2/CO2, for, lac Sox, nitrate 62 Tasaki et al., 1991
groundwater 40-70
thermocisternum North sea oil reservoir + H2/CO2, lac, etoh Sox 62 halophilic Nilsen et al., 1996
41-75
thermosapovorans Rice compost + H2/CO2, for, lac Sox 50 Fardeau et al., 1995
35-60
thermobenzoicum subsp. Thermophilic granular + H2/CO2, lac, pyr, prop sulfate 55 syntrophic Plugge et al., 2002
thermosyntrophicum methanogenic sludge 45-62 growth
strain TPOSR Sulfidogenic + H2/CO2, for, ac, metoh, Sox 60 Stams, unpublished
thermophilic bioreactor etoh nr
strain WW1 Sulfidogenic + H2/CO2, metoh, etoh, for Sox 62-68 Weijma, 2000
thermophilic bioreactor 45-75
strain T93B Statfjord oil field + H2/CO2, metoh, etoh, for Sox 65 halophilic Rosnes et al., 1991
43-78
Thermodesulfobacterium
commune Volcanic hot water - H2+ac, lac, pyr, sulfate, thiosulfate 70 unusual Rozanova & Khudyakova,
45-85 morphology 1974;Rozanova & Pivovarova,
1988
hydrogeniphilum Marine hydrothermal - H2 sulfate 75 Jeanthon et al., 2002
chimney 50-80
hveragerdense Icelandic hot spring - H2+ac, lac, pyr, Sox 70-74 Sonne-Hansen & Ahring,
55-74 1999;Sonne-Hansen et al., 1999
mobile (formerly Oil field water - H2+ac, lac, pyr, for Sox 65 different cell Rozanova & Pivovarova, 1988,
Desulfovibrio sizes Rozanova & Khudyakova, 1974
thermophilus)

Thermodesulforhabdus Oil field reservoir - Ac, lac, etoh sulfate, sulfite 60 Beeder et al., 1995
norvegicus
Thermodesulfovibrio
yellowstonii Thermal vent water - H2+ac, lac, pyr, for+ac Sox 65 Henry et al., 1994
40-70
islandicus Icelandic hot Spring - Lac, pyr, H2, for Sulfate, thiosulfate, 65 Sonne-Hansen & Ahring, 1999
nitrate 45-70
metoh: methanol, etoh: ethanol, glu: glucose, ac: acetate, for: formate, fruc: fructose, lac: lactate, pyr: pyruvate, prop: propionate, YE: yeast extract, ; Sox: sulfate, sulfite, thiosulfate,
nt: not tested
Chapter 1

1.2.2.1 The genus Desulfotomaculum

Thermophilic methanol utilization by SRB has been described only for Desulfotomaculum
species. Several Desulfotomaculum strains were the subjects of the present study, but we
focussed mainly on the extremely heat-resistant spore producer Dsm. kuznetsovii. SRB that form
heat-resistant endospores share this trait with many Bacillus and Clostridium species and were
classified in one genus, namely Desulfotomaculum. Recently another spore-producing genus has
been proposed, namely the genus Desulfosporosinus, however, this genus comprises only
mesophilic species. Due to endospore formation, thermophilic Desulfotomaculum species are
widespread in nature and large numbers of spores may be found even in permanently cold
sediments at temperatures insufficient to support growth of these species (Isaksen et al., 1994;
Goorissen, unpublished results). The first isolate and type strain of this genus, is the moderate
thermophile, Dsm. nigrificans. This strain was isolated in the 1920s as Clostridium nigrificans and
finally named Dsm. nigrificans in 1965 by Campbell and Postgate (1965). Subsequently more
mesophilic and thermophilic species were isolated and this genus now comprises 20 validly
described species.
This genus exhibits a great versatility in the types of electron donors used for growth,
including H2/CO2, alcohols, fatty acids, other aliphatic monocarboxylic and dicarboxylic acids,
alanine, catechol, indole, nicotinate, phenol, acetone, and others. Depending on the species,
substrates are incompletely oxidized to acetate, or completely to CO2. Sulfite or thiosulfate can
replace sulfate as the electron acceptor and some species show the ability to use terminal electron
acceptors as Fe (III) (Dsm. reducens) or arsenate (Dsm. auripigmentum) for growth. These
properties are unusual, but also have not been tested for many species.
Although several Desulfotomaculum species show negative gram-stain, they are true gram-
positives as is evident from their cell wall architecture. Phylogenetically, they are separate from
other sulfate-reducing bacteria, and the genus is placed within the low G+C%-gram-positive
branch of the Clostridium-Bacillus subphylum (Fig. 1.4). However, recently published phylogenetic
trees questioned the coherence of the family and therefore changes have been proposed
(Stackebrandt et al., 1997; Kuever et al., 1999; Stubner & Meuser, 2000). In contrast to the
majority of the species, Dsm. orientis and Dsm. auripigmentum branch together with a
Desulfosporosinus cluster and Dsm. orientis has therefore been classified as Desulfosporosinus
orientis (Stackebrandt et al., 1997). Dsm. guttoideum is closely related to a Clostridium cluster, and
appears on a separate branch of the Desulfotomaculum main cluster, which justifies a
reclassification (Stackebrandt et al., 1997; Castro et al., 2000). Sporotomaculum
hydroxybenzoicum is closely affiliated to Dsm. thermosapovorans (>95%), although this species is
mesophilic and can grow on 3-hydroxybenzoate as the sole carbon- and energy source.
Furthermore, some phylogenetic analyses provide grounds for the separation of mesophilic and
thermophilic species in two distinct genera with the name “Thermodesulfotomaculum” proposed for
the thermophilic species (Nazina et al., 1999).
An overview of the 14 thermophilic species of the genus Desulfotomaculum is given in
Table 1.4. (p 16). On the basis of 16S rRNA sequence analyses, thermophilic Desulfotomaculum
species are scattered among five subclusters of the gram-positive spore-forming SRB phylogenetic
tree (Fig. 1.4). Species are separated by similarity values of 83 to 99%, which illustrates the
heterogeneity of the Desulfotomaculum thermophiles. Common phenotypic and physiological
characteristics are shared by all thermophilic Desulfotomaculum species, but some distinguishing
features can be mentioned. Desulfotomaculum species differ in the percentage G+C, ranging from
41 % for Dsm. alkaliphilum to 56% for Dsm. thermocisternum. NaCl tolerance differs significantly
between species, varying from 10 to 70 g/L. Dsm. alkaliphilum, Dsm. geothermicum, and Dsm.
thermocisternum can be regarded as halotolerant. All species can use hydrogen as an electron
donor, but some species require acetate as an additional carbon source. Growth with acetate as
the carbon- and energy source is only reported for Dsm. australicum, Dsm. kuznetsovii, Dsm.
thermoacetoxidans, Dsm. thermobenzoicum, and strain TPOSR. However, growth on acetate is
weak, except for Dsm thermoacetoxidans. Growth on methanol is observed for Dsm. kuznetsovii,
strain TPOSR, strain WW1, Dsm. putei, and Dsm. thermosapovorans, although in the latter two

14
 Introduction

organisms, growth is weak. Most of the thermophilic Desulfotomaculum species can use sulfite and
thiosulfate next to sulfate as electron donor. Exceptions are Dsm. thermobenzoicum subsp.
thermosyntrophicum, which can only use sulfate, and strains Dsm. luciae and Dsm. thermo-
acetoxidans, which both cannot use sulfite.

Figure 1.4. Phylogenetic tree of the genus Desulfotomaculum combined with some reference genera,
based on 16S rDNA sequence comparisons. Bacillus methanolicus was used as outgroup.
Cluster names in roman numerals are according to Stackebrandt et al. (1997). Thermophilic
species are represented in bold. * = subspecies thermosyntrophicum

15
Table 1.4. Selected properties of moderately thermophilic Desulfotomaculum species

Desulfotomaculum alkaliphilum australicum geothermicum kuznetsovii luciae nigrificans putei

Origin Cow/pig manure Geothermal Geothermal Hot spring Hot spring Freshwater Hot spring
groundwater groundwater sediments sediments
T optimum (ºC) 50-55 68 54 60-65 60-65 55 64
T range (ºC) 30-58 40-74 37-56 50-85 50-70 40-62 35-65
NaCl tolerance < 7% nr >5% 0-2% 0-1% 1-2% <2%
Spores + spherical, central + spherical, spherical, central subterminal paracentral,
central oval
Closest relative halophilum thermocisternum thermosapovorans luciae strain TPOSR putei nigrificans
(Desulfotomaculum)
16S rDNA % 92.7 99 92 96 98 94 94
Phyl. Cluster If Ic Ib Ic Ic Ia Ia
G+C mol% 40.9 48 50.4 49 51.4 44.5 47.1
Substrate utilization
Methanol - - - + - - +
H2/CO2 + ac + nr + + + ac +
Acetate - + - + - - -
Fermentation pyr pyr, lac nr nr pyr, lac pyr, fruc
Electron acceptors thiosulfate, sulfite nr nr thiosulfate, thiosulfate thiosulfate, thiosulfate,
next to sulfate sulfite sulfite sulfite
Reference Pikuta et al., 2000 Love et al., 1993 Daumas et al., 1988 Nazina, et al., Karnauchow et al., Klemps et al., Liu et al., 1997
1987 1992 1985
nr: not reported, ben: benzoate, fruc: fructose, fum: fumarate, gly: glycine, lac: lactate, pyr: pyruvate
Table continued

Desulfotomaculum thermoacetoxidans thermobenzoicum thermocisternum thermosapovorans thermobenzoicum strain strain WW1

subsp. thermosyn- TPOSR
trophicum
Origin Anaerobic digester Anaerobic digester Deep submarine Rice paddy soil Methanogenic Anaerobic Thermophilic
groundwater granular sludge digester bioreactor
T optimum (ºC) 55-60 62 62 50 55 60 62-68
T range (ºC) 45-65 40-70 41-75 35-60 45-62 nr 45-75
0
NaCl tolerance <1.5% nr 0.1 /00-4.7% 0-3.5 % nr nr nr
Spores spherical, central + spherical, central central oval, central Sperical, Sperical, central
central
Closest relative thermobenzoicum thermobenzoicum strain WW1 sapomandens thermoacetoxidans luciae thermocisternum
(Desulfotomaculum) subsp. thermosyn- subsp. thermosyn-
trophicum trophicum
16S rDNA % 98 96 99 97 98 98 99
Phyl. Cluster Id Id Ic Ib Id Ic Ic
G+C mol% 49.7 52.8 56 51.2 53.7 55 58.9
Substrate utilization + +
Methanol nr - - + - + +
H2/CO2 + + + + + nr nr
Acetate + + - - - - -
Fermentation lac-, pyr- pyr, lac pyr pyr, lac pyr, lac, fum, gly, nr nr
ben
Electron acceptors thiosulfate, sulfur thiosulfate, sulfite, thiosulfate, sulfite thiosulfate, sulfite - thiosulfate, thiosulfate,
next to sulfate nitrate sulfite sulfite
Reference Min & Zinder, 1990 Tasaki et al., 1991 Nilsen et al., 1996 Fardeau et al., 1995 Plugge et al., 2002 Stams, un- Weijma, 2000
published
nr = not reported, ben: benzoate, fruc: fructose, fum: fumarate, gly: glycine, lac: lactate, pyr: pyruvate
Chapter 1

1.2.2.2 Spore-formation and heat resistance

The production of endospores as an effective reproducing and survival strategy is a
phenomenon observed in prokaryotic as well as in eukaryotic species.
Especially in food industrial processess and in the manufactory of sterile medical devices, there is
great awareness of the control of sporulation by pathogenic and non-pathogenic bacteria. Dormant
spores are not hazardous, but spore germination, outgrowth and proliferation could result in food
spoilage and toxin production, in turn causing food poisoning.
The exceptional resistance properties of bacterial endospores are the subject of many studies.
Heat resistance of endospores has been studied extensively in
Bacilli (Gonzalez et al., 1999; Mazas et al., 1999; Casadei et al., 2001; Fernandez et al., 2001),
Clostridia (Adams, 1973; Nakamura et al., 1985; Payot et al., 1999) and Moorella (Van Rijssel et
al., 1992; Byrer et al., 2000) species.
Sporulation, spore dormancy, and spore germination are relatively well understood (see for
instance Serrano et al., 1999; Atrih & Foster, 1999; Boland et al., 2000; Henriques & Moran, 2000),
in contrast with the mechanism of heat resistance of bacterial spores which remains enigmatic.
Spore heat resistance is both complex and multifactorial, and it is unquestionable that the spore
cortex peptidoglycan, the dehydration, mineralization, and dipicolinic acid content of the spore core
are involved in spore heat resistance (Beaman & Gerhardt, 1986; Atrih & Foster, 2001). The
apparent heat resistance of spores can be influenced dramatically by changing the growth
conditions during sporulation (Leguerinel et al., 2000). Medium composition, for example, affects
the mineralization state of the spore cortex and the peptidoglycan structure and thereby the heat
resistance of the spores. Growth temperature is another parameter likely to affect spore heat
resistance: spores of the same strain produced at a high temperature are more heat resistant than
spores produced at a lower temperature (Warth, 1978; Setlow, 1994; Palop et al., 1999; Gonzalez
et al., 1999).
Within the heterogeneous group of sulfate-reducing prokaryotes, Desulfotomacula are
unique with respect to their spore producing properties. The production of spores by
Desulfotomaculum species undoubtedly has been reponsible for the widespread occurrence of
these organisms in nature.
The extreme heat resistance of spores of Desulfotomaculum strains was first recognized
several decades ago. Donelly and Busta (1980) reported a decimal reduction value of 5 min for
Dsm. nigrificans, a moderate thermophile. However, no other extreme heat resistant spores of
Desulfotomaculum strains have been described since then.

1.2.3 Thermophilic methanogenic archaea

In general, thermophilic methanogenic archaea display a narrow substrate range, varying
from strict autotrophic growth with H2/CO2 to the use of several C1-compounds. However, methanol
oxidation is restricted to moderate thermophiles, i.e. Methanosarcina species, Methanohalobium
evestigatum, and Methanosalsum zhilinae. The upper temperature limit for growth of these
organisms is equal to or below 60 ºC (Table 1.5). The Methanosarcina species have very similar
physiological properties and are probably all M. thermophila strains (Clarens & Moletta, 1990;
Zinder, 1990). M. thermophila TM-1 is the only strain which can grow on H2/CO2 and all
Methanosarcina strains can grow on acetate. Other acetate-utilizing methanogenic species are
found in the genus Methanothrix, for which the upper temperature for growth is 70ºC. Methanothrix
species have been isolated mainly from anaerobic digesters.
Thermophilic methanogens are dominated by the genus Methanothermobacter. This genus
was recently proposed to include several thermophilic Methanobacterium species (Wasserfallen et
al., 2000) based on three independent data sets: analysis of 16S rRNA sequences, antigenic
fingerprinting, and data pertaining to extrachromosomal elements, plasmids, and phages. As a
result of the proposal mentioned above, mesophilic and thermophilic Methanobacterium species
are separated into two different genera, although the thermophile Methanobacterium
thermoaggregans has not been renamed yet. All Methanothermobacter and Methanobacterium
species can grow autotrophically and some are also capable of utilizing formate for growth.

18
 Introduction

Methanothermobacter species are ubiquitous in a number of environments such as anaerobic

digesters, hot springs and digested sludge.
The genus Methanogenium comprises a great number of mesophilic species, one true
psychrophilic species, and a few subspecies of the species Mg. thermophilum (Jarrell & Kalmokoff,
1988; Franzmann et al., 1997). If H2/CO2 is used as the growth substrate, all Mg. thermophilum
strains need additional acetate as a carbon source. Methanothermococcus thermolithotrophicus
was originally classified as a member of the genus Methanococcus, which comprises some
methylotrophic mesophilic species as well (Blotevogel et al., 1986; Zhilina, 1986). However,
recently it was reclassified as a member of the new genus Methanothermococcus, which consists
of thermophilic, H2/CO2 en formate utilizing species.
Hydrogenotrophic methanogenesis may occur at temperatures as high as 97 ºC (Stetter et al.,
1990), although most thermophilic species grow at moderately high temperatures.

1.2.4 Thermophilic homoacetogens growing on C1-compounds

Homoacetogenic bacteria - often called ‘acetogenic’ bacteria - are probably the most
versatile anaerobes with respect to their substrate profile. Several homoacetogens grow with
methyl compounds such as methanol, methoxylated compounds or methylchloride. Well-studied
mesophilic methylotrophic utilizing homoacetogens are Sporomusa sp., Eubacterium limosum, and
Acetobacterium woodii. The best-characterized thermophilic methanol degrading homoacetogens
are the heat-resistant spore producing species Moorella thermoautotrophica and Moorella
thermoacetica (Table 1.6, p.22). They are physiologically and phylogenetically closely related to
Clostridium species, some of which can also convert methanol to acetate.
For homoacetogenic bacteria, the conversion of methanol to acetate is energetically more
favorable than its decomposition to CO2 and H2 (Table 1.1). However, in the presence of hydrogen
consuming SRB or MA, hydrogen might be produced. For methylotrophic mesophilic acetogens, at
low hydrogen partial pressure, syntrophic associations with hydrogenotrophic methanogens have
been observed (Cord-Ruwisch & Garcia, 1985; Heijthuijsen & Hansen, 1986). In a thermophilic
sulfidogenic enrichment culture, a syntrophic interaction between a methanol degrading
homoacetogen and a sulfate reducer was observed (Davidova & Stams, 1996). This culture was
partly characterized and the homoacetogen degraded methanol, but was unable to use hydrogen
and formate as growth substrate (Table, 1.6, strain AG).

19
Table 1.5. Selected physiological characteristics of moderately thermophilic MA

Organism Origin Growth T-opt (°C) pH opt. Specific Reference

Substrates T-range (°C) feature
Methanobacterium Mud from cattle H2/CO2 65 7.0-7.5 forms Blotevogel & Fischer, 1985
thermoaggregans pasture 40-75 aggregates

Methanogenium
thermophilum CR1 River sediment H2/CO2, formate marine strain Rivard & Smith, 1982
thermophilum LA Kelp digester H2/CO2, formate Zabel et al., 1984
Methanohalobium Saline Lagoon, metoh, 50 7.0-7.5 extreme Zhilina & Zavarzin, 1987
evestigatum Crim methylamines halophilic
Methanosalsum Bosa Lake metoh, 45 9.2 moderate Mathrani et al., 1988; Boone et
zhilinae (formerly methylamines halophilic al., 1993
Methanohalophilus zhilinae)

Methanosarcina
thermophila TM-1 Anaerobic digester metoh, ac, 50 6-7 Zinder & Mah, 1979; Zinder et
methylamines, al., 1985
H2/CO2
sp. CHTI55 Anaerobic digester metoh 55 6-8 Zinder et al., 1984a; Touzel et
al., 1985
MP Anaerobic digester metoh 55 6.5-7 Ollivier et al., 1984
30-60
MSTA-1 Anaerobic digester metoh, ac, 55 7 Clarens & Moletta, 1990
methylamines 30-60
CALS-1 Anaerobic digester metoh, ac 55-58 6.5 Zinder et al., 1984a
30-60
Methanothrix
thermoacetophila Anaerobic digester ac 65 nr Nozhevnikova & Chudina,
<70 1984
thermophila (formerly strain Anaerobic ac 60 6.5 Zinder et al., 1987; Kamagata
CALS-1, and Methanosaeta sp. bioreactor 37-70 & Mikami, 1991; Kamagata et
T
strain P ) al., 1992
Table continued

Organism Origin Growth T-opt (°C) pH opt. Specific Reference

Substrates T-range (°C) feature
Methanothermobacter
thermoautotrophicus (formerly Anaerobic sewage H2/CO2 65-70 7.2-7.6 Zeikus & Wolfe, 1972; Touzel
Methanobacterium thermoauto- sludge digester 40-75 et al., 1992; Zhilina & Ilarianov,
T
trophicum ∆H and Methano- 1984
bacterium thermoformicicum sp.)

defluvii (formerly Methanobacterium Anaerobic digester H2/CO2 60 7.0 halophilic Kotelnikova et al., 1993
defluvii)

marburgensis (formerly Mesophilic sewage H2/CO2 65 6.8-7.4 Schönheit et al., 1980;

Methanobacterium thermo- sludge 45-70 Wasserfallen et al., 2000
T
autotrophicum strain Marburg )

thermoflexus (formerly Digester sludge H2/CO2 55 7.9-8.2 halophilic Kotelnikova et al., 1993;
Methanobacterium thermoflexum) Wasserfallen et al., 2000

thermophilus (formerly Thermophilic H2/CO2 57 7.5 requires Laurinavichius et al., 1988;

Methanobacterium thermophilum) methane tank 45-75 6.5-8.5 coenzym M Wasserfallen et al., 2000

wolfeii (formerly Methanobacterium Sewage H2/CO2, formate 55-65 7.0-7.5 Winter et al., 1984;
wolfeii and Methanobacterium sludge/river 37-74 Wasserfallen et al., 2000;
thermoformicicum sp.) sediment Zhao et al., 1986

Methanothermococcus
okinawensis Deep sea H2/CO2, formate 60-65 6-7 Takai et al., 2002
hydrothermal vent + CO2 40-75 4.5-8.5
thermolithotrophicus Hot oil field H2/CO2, formate 60 5.1-5.9 Nilsen et al., 1996; Belyaev et
ST22 (formerly Methanococcus reservoir 17-62 al., 1991; Whitman, 2001
thermolitotrophicus)
Table 1.6. Selected physiological characteristics of thermophilic methanol- and H2/CO2- utilizing homoacetogens

Organism Origin Growth Substrates T-opt (°C) Specific feature Reference

T-range (°C)
Clostridium Horse manure, human metoh, formate 60-64 McBee, 1954
thermocellum feces, soil, marine mud nr
Moorella
thermoacetica metoh, H2/CO2, 55-60 Kerby & Zeikus, 1983;Wiegel &
formate, CO nr Garrison, 1985
thermoautotrophica Hot spring metoh, H2/CO2, 56-60 production of heat Ljungdahl, 1986;Wiegel et al.,
formate, CO 36-70 resistant spores 1981
Strain AG Granular sludge metoh 70 Davidova & Stams, 1996
55-75
Thermoacetogenium Anaerobic metoh, H2/CO2, 58 reduction of sulfate, Hattori et al., 2000
phaeum methanogenic reactor formate, ac thiosulfate with ac
syntrophic growth
on acetate
Thermoanaerobacter Freshwater lake H2/CO2, CO, 66 Leigh, et al., 1981;
kivui (formerly sediment formate 50-73 Collins et al., 1994
Acetogenium kivui)
nr. : not reported, metoh: methanol, ac: acetate
 Introduction

1.3 Biochemistry of methanol oxidation

In this section the possible enzymes involved in thermophilic anaerobic methanol
conversion are presented. An overview is given of the enzymes possibly involved in methanol
degradation in methylotrophic bacteria (sub-section 1.3.1). Enzymes found in methanogenic
archaea and homoacetogens (sub-section 1.3.2), and SRB (sub-section 1.3.3) are discussed.

1.3.1 Enzymes involved in primary alcohol degradation

Enzymes involved in primary alcohol degradation under anaerobic conditions can be
divided into three different groups depending on the cofactor or coenzyme used:

I NAD(P)-independent alcohol dehydrogenases

Gram-negative bacteria employ NAD(P)-independent alcohol dehydrogenases (ADHs)
(Anthony, 1982). These enzymes use pyrroloquinoline quinone (PQQ), haem and/or F420 instead of
NAD(P) as cofactor. PQQ is a typical cofactor for the periplasmic methanol dehydrogenase (MDH)
in methylotrophic gram-negative bacteria (Duine & Frank, 1980). In the methylotrophic
homoacetogen Moorella thermoautotrophica, for example, a PQQ containing methanol
dehydrogenase is present mediating the oxidation of methanol via formaldehyde to formate
(Winters & Ljungdahl, 1989).

II NAD(P)- dependent alcohol dehydrogenases

Three families of NADP dependent ADHs have been described (Table 1.7). Members of
Family I show no (or low) activities with methanol; Family II members involved in methanol
oxidation have not been described up to now, but several Familiy III enzymes from aerobic
methylotrophic gram-positive bactera are active with methanol (for a review see, for instance,
Hektor et al., 2000).
ADHs have been identified in a few gram-positive bacteria but, in contrast with their gram-
negative opposites, studies on this subject are limited. Most ADHs have been characterized from
some Clostridium species. C. acetobutylicum and C. beijerinckii both contain several NADPH-
dependent ADHs but none of these were active with methanol.
The only ADHs found in thermophilic species (i.e. in Thermoanerobacter brockii,
Thermoanaerobacter ethanolicus, and Clostridium thermocellum) are involved in the production of
ethanol from carbohydrates. However, these NADP-linked ADHs exhibit no activity with methanol
(Ben-Bassat & Zeikus, 1981).

Table 1.7. Classification of NAD(P)-dependent ADHs

Family Metal Subunit Quaternary Activity Specific features
dependence size structure with
methanol
I zinc 43 kDa di-or Not or very
Long-chain alcohol tetrameric low
dehydrogenases

II none nr nr nr Short primary structure;

Short-chain alcohol broad substrate specifity
dehydrogenases

III Iron, Various di-, tetra- or yes Ubiquitous in gram-, gram+,

Iron-dependent magnesium, 50-66 decameric anaerobic, aerobic bacteria,
alcohol zinc kDa yeasts, and amoeba
dehydrogenases
nr: not reported

III Methyltransferases
In the degradation of methanol, corrinoid proteins (corrinoids are cobalt-containing co-
factors) play a role in methyl transfer processes. Corrinoid-dependent methyltransferases are

23
Chapter 1

mainly found in homoacetogens and methanogenic archaea, and they catalyze the initial step in
methanol conversion.

1.3.2 Methanol metabolism in homoacetogens and methanogenic archaea

The metabolic pathways involved in the conversion of methanol to methane and acetate by
mesophilic methanogenic archaea and acetogens respectively have been partially resolved in the
recent years. In the elucidation of these pathways, several enzymes, coenzymes, and cofactors
(most of them containing transition metals) have been discovered. The initial step in methanol
conversion in mesophilic methanogens and homoacetogens is catalyzed by a corrinoid-dependent
methyltransferase (Van der Meijden et al., 1984a; Van der Meijden et al., 1984b; Stüpperich &
Konle, 1993; Daas et al., 1996).

Methanol reduction to methane

The results of investigations into the biochemistry of methanogenesis have been
extensively reviewed during recent decades (Thauer, 1990; Ferry, 1992; Blaut, 1994; Deppenmeier
et al., 1996). In methanogenesis, three basic metabolic pathways can be distinguished: the
pathway from H2/CO2, from methanol, and from acetate to methane. Among methanogenic
archaea, Methanosarcina barkeri is the best-studied organism regarding the biochemistry of
methylated compounds. The reactions involved in the degradation of methanol to methane in this
organism proceed via methyl-coenzym M. Besides, two methyltransferases are involved: MT1, of
which the corrinoid is methylated by methanol, and MT2, which transfers the methylgroup to
coenzym M. A detailed reaction mechanism is shown in Fig. 1.5.

Methanol oxidation to CO2

Part of the methanol is oxidized to CO2 to generate the reducing equivalents needed for the
reduction of the remainder of the methanol to methane. Part of the oxidation route of methanol
remains to be established and a number of possible alternatives have been postulated (see Fig.
1.5): (1) is the alternative oxidation of methanol by a methanol dehydrogenase and an unknown
one-carbon carrier (Blaut & Gottschalk, 1984). Other alternatives are the MT1-dependent activation
of methanol (3), or CH3-S-CoM synthesis (2), followed by the methylgroup transfer to
tetrahydrosarcinapterin (H4SPT), or a direct methylation of H4SPT by methanol catalyzed by a
novel methyltransferase (4) (Keltjens & Vogels, 1993).

Methanol conversion to acetate

In AB, several enzymes are involved in acetate synthesis, such as formate dehydrogenase,
a corrinoid protein, and carbon monoxide dehydrogenase. The formation of acetate from methanol
is only possible if other carbon containing compounds more oxidized than methanol - such as
formate, CO, or CO2 - are present (Zeikus et al., 1984). In Eubacterium limosum, the first step of
methanol conversion is catalyzed by a methyltransferase containing corrinoid (Van der Meijden et
al., 1984a). Tetrahydrofolate served as methylacceptor in this reaction, which is also the case for a
number of other AB (Jansen, 2000). The synthesis of acetate has been most thoroughly studied in
Clostridium thermoaceticum (Ragsdale, 1991). This organism is the only thermophilic methanol
utilizing acetogen for which methyltransferase activities were described (Kasmi et al., 1994). A
detailed reaction mechanism for the conversion of methanol to acetate is shown in Fig. 1.6 (p. 26).

24
 Introduction

Figure 1.5. Scheme of methanogenesis and alternative pathways for the methanol methylgroup
oxidation. Abbreviations: H4SPT, 5,6,7,8-tetrahydrosarcinapterin; F420, a 8-hydroxy-5-
deazaflavin derivative; X, unknown one carbon carrier suggested by Blaut and Gottschalk
(1984); MT1, methanol:5-hydroxybenzimidazolylcobamide methyltransferase; [Co(III)],
[Co(II)], and [Co(I)] represent the various oxidation states of the cobalt of the corrinoid
prosthetic groups of MT1; MT2, Co-methyl-5-hydroxybenzimidazolylcobamide:coenzyme M
methyltransferase; HS-CoM, coenzyme M; HS-HTP, 7-mercaptoheptanoylthreonine
phosphate. Numbers refer to reactions mentioned in the text (from Daas, 1996).

25
Chapter 1

Figure 1.6. Pathway of acetate synthesis from methanol in homoacetogens. Abbreviations: THF,
tetrahydrofolate; CoA, coenzyme A; CH3-E[Co], methyl corrinoid (bound). Numbers indicate
the following enzymes: 1, methyltransferase; 2, methylene-THF reductase; 3, methylene-
THF-dehydrogenase; 4, methenyl-THF-cyclohydrolase; 5, formyl-THF synthetase; 6, formate
dehydrogenase; 7a, carbon monoxide dehydrogenase; 7b, acetyl-CoA synthase (7a en 7b
are probably one enzyme); 8, phosphotransacetylase and acetate kinase (from Heijthuijsen
& Hansen, 1986)

26
 Introduction

1.3.3 Methanol metabolism in sulfate reducing bacteria

Methanol utilization by SRB is reported for a limited number of strains, i.e. Desulfovibrio
carbinolicus (Nanninga & Gottschal, 1987), Desulfovibrio alcoholovorans (Qatibi et al., 1991),
Desulfobacterium anilini (Schnell et al., 1989), Desulfobacterium catecholicum (Szewzyk &
Pfennig, 1987), Desulfosporosinus orientis (Klemps et al., 1985, Strain UFZ B378 (Hard & Babel,
1995), and several thermophilic Desulfotomaculum strains (Table 1.4). Although the mechanism of
methanol oxidation in acetogens and methanogenic archaea is well studied, this mechanism is
unresolved for SRB.
Ethanol is a common electron donor and carbon source for SRB and all methanol utilizing
thermophilic Desulfotomaculum strains can also use ethanol. Alcohol dehydrogenase activities
have been reported for some Desulfovibrio strains (Kremer et al., 1988) and the first NAD-linked
alcohol dehydrogenase was purified from Desulfovibrio gigas (Hensgens et al., 1993). This alcohol
dehydrogenase is an oxygen-labile, decameric enzyme with barely any activity towards methanol
(2%). The thermotolerant, gram-positive Bacillus methanolicus C1 contains a methanol
dehydrogenase with a similar decameric structure as the ADH from D. gigas. This enzyme
performs a a key role in the oxidation of methanol in B. methanolicus (Vonck et al., 1991).
For Desulfotomaculum strains, no reports have been published regarding the biochemistry
of alcohol metabolism. A possible route involving an ADH for the degradation of methanol coupled
to sulfate reduction is shown in Fig. 1.7. The involvement of methyltransferases in methanol
conversion by thermophilic SRB remains unclear.

Figure 1.7. Possible pathway for methanol metabolism coupled to sulfate reduction. Numbers indicate
the following enzymes: 1. methanoldehydrogenase; 2, formaldehydehydrogenase; 3,
formate-dehydrogenase. APS, adenosine-5’-phosphosulfate.

27
Chapter 1

1.4 Methanol conversion by mixed communities

This section deals with general aspects of competition between different trophic groups
involved in anaerobic methanol degradation. In sub-section 1.4.1 substrate competition is
described, followed by sub-sections on direct competition for methanol (sub-section 1.4.2) and
indirect competition for acetate, hydrogen, and formate (sub-section 1.4.3). Syntrophic interactions
between SRB, MA, and AB are the subject of sub-section 1.4.4.

1 4.1 Substrate competition

A simple method of predicting the outcome of competition between bacterial species for a
common substrate is to calculate the Gibbs free energy change of the conversion of the substrate.
Organisms performing the conversion with the highest Gibbs free energy change presumably
outcompete other bacteria. Based on this assumption, SRB should outcompete MA for substrates
such as methanol, acetate, hydrogen and formate Table 1.2. However, this does not always
correspond with findings from literature. For instance, Gupta (1994) found that methanol was solely
used by methanogens in mesophilic chemostats.

Growth kinetics
The rate at which bacteria grow can be described by the classical Monod equation:
S
µ = µmax* 
S + Ks
in which: µ : specific growth rate
S: substrate concentration
µmax: maximum specific growth rate
KS: affinity constant for substrate.

For sulfate-reducing bacteria, the Monod-equation can be extended to:

S SO42-
µ = µmax* * 
S + Ks SO42- + KSO42-
in which: SO42-: sulfate concentration
KSO42-: affinity constant for sulfate

According to Monod growth kinetics, growth only stops when all substrate is depleted.
However, many bacteria, including MA and SRB, stop growing below a certain substrate ‘threshold’
concentration (Lovley, 1985; Conrad & Wetter, 1990). In addition, sulfate reducers may encounter
a threshold concentration for sulfate as well (Sonne-Hansen et al., 1999). The Monod equation can
be adapted to account for threshold concentrations (Pavlostathis & Giraldo-Gomez, 1991):

S - St
µ = µmax* 
(S – St ) + Ks
in which: St = substrate threshold concentration.

28
 Introduction

For SRB, the equation becomes:

S- St SO42- - SO42-t
µ = µmax* -* 
(S - St + Ks) (SO42- - SO42-t)+ KSO42-
in which: SO42-t: sulfate threshold concentration

The kinetic parameters of the Monod equation are conditional constants: they depend on
environmental conditions such as pH and temperature. Growth kinetics may be used to explain the
outcome of competition between microbial species in high-rate anaerobic reactors. For instance,
Methanothrix species will dominate in thermophilic anaerobic sludge cultivated at low acetate
concentrations because of their higher acetate affinity as compared to that of Methanosarcina
(Zinder et al., 1984b). However, it should be kept in mind that most reported values for kinetic
growth properties were determined at optimal growth conditions in pure culture, and such optimal
and well-defined conditions obviously do not prevail in bioreactors.
The ratio µmax/KS is a useful parameter for comparing growth properties of bacteria on a
common substrate. At substrate concentrations around or below the KS, bacteria with a high
µmax/KS-ratio have better growth properties than bacteria with a low µmax/KS-ratio.
At low sulfate concentrations, growth of the sulfate reducing bacteria will be sulfate-limited.
Under such conditions, sulfate reducers have to compete with other sulfate reducers for the
available sulfate. The affinity for sulfate will play a role in this competition; however, no affinity
constants for sulfate for thermophilic sulfate reducers are known.
Competition between mesophilic MA and SRB has been studied quite extensively. Reviews
on this subject have been presented elsewhere (Hulshoff-Pol et al., 1998; Colleran et al., 1995;
Oude Elferink et al., 1994). Competition between methanogens and sulfate reducers in high-rate
anaerobic reactors is not merely determined by growth kinetics, but also by immobilization
properties of the various microorganisms, substrate diffusion limitations inside biofilms,
environmental conditions such as hydrogen sulfide concentration, and the composition of the
medium, temperature and pH. In addition, the bacterial composition of the seed sludge and the
applied hydraulic retention time (Alphenaar et al., 1993) may also be important.

1.4.2 Direct competition for methanol

Table 1.8. Selected growth properties of thermophilic SRB and AB on methanol

Methanol degrading culture µmax yield Reference

(h-1) (g dry wt/mol acetate)
Sulfate-reducing
Desulfotomaculum kuznetsovii 0.03 nra Chapter 2
Coculture acetogen AG and sulfate Davidova & Stams,
0.011 nr
reducer SR 1996
Homoacetogenic
Davidova & Stams,
Strain AG 0.07 nr
1996
Savage & Drake,
Moorella thermoautotrophica 0.077 6-9
1986
a) nr: not reported

Common substrates for which MA and SRB may compete in the anaerobic degradation of
methanol are methanol and methanol degradation products such as hydrogen, formate, and
acetate. AB may also compete with the MA and SRB for methanol. Growth kinetic data for
thermophilic methanol-degrading SRB and AB are summarized Table 1.8. No data are available for

29
Chapter 1

MA. The limited amount of data does not allow a conclusion to be drawn on the outcome of the
competition for methanol.

1.4.3 Indirect competition

The kinetics of acetate and hydrogen degradation by mesophilic MA and SRB has been
studied extensively (Colleran et al., 1995; Oude Elferink et al., 1994). Some relevant information
about the growth kinetics of hydrogen and acetate utilizing thermophilic MA is also available (
shown in Tables 1.9 and 1.10), but so far this is hardly the case for thermophilic SRB.
Unfortunately, to date not for a single thermophilic sulfate reducer both the Ks- and µmax- are
known. In general it can be stated that the Ks-values for hydrogen are about 40 times lower for
SRB than for MA, while the values for µmax of MA are maximally about 10 times higher compared to
those of SRB. Therefore, it looks reasonable to expect a higher µmax/KS-ratio for hydrogen for
thermophilic SRB than for MA. Consequently, SRB will outcompete MA at low hydrogen
concentrations. At a high hydrogen concentration, the situation is reversed due to the high
maximum specific growth rates of MA. For acetate, the situation is much less clear, as no KS
values of thermophilic SRB have been reported to date. Because no growth kinetic data are
available for growth on formate of thermophilic SRB and MA, a comparison of growth properties of
these groups of bacteria is not yet possible.

Table 1.9. Selected growth kinetic properties of thermophilic MA and SRB on acetate.
a
Acetate degrading culture µmax KS Treshold Yield µmax/KS Reference
-1 –1 -1
(h ) (mM) (mM) (h .mM )
Methanogenic
Methanosarcina thermophila TM-1 0.058 4.8 1 nrb 0.012 Zinder & Mah, 1979
Min & Zinder,
Methanosarcina CALS-1 0.058 nr 0.8-2.5 nr nr 1989;Zinder et al.,
1984b
Methanosarcina MP nr nr nr nr nr Ollivier et al., 1984
Clarens & Moletta,
Methanosarcina MSTA-1 0.052 11.4 4.1 3.1-4.6 0.0046
1990
Methanosarcina CHTI 55 0.085 10 nr 1.4 0.0085 Touzel et al., 1985
Nozhevnikova &
Methanothrix thermoacetophila nr nr nr nr nr
Chudina, 1984
Kamagata &
Methanosaeta sp. PT 0.020 nr nr nr nr
Mikami, 1991
0.012-
Methanothrix sp. CALS-1 0.028 <1.1 nr >0.025 Zinder et al., 1987
0.021
0.025- Ahring &
TAM 0.012 0.85 nr 0.014
0.075 Westermann, 1985

Sulfate-reducing
Desulfotomaculum
0.022 nr nr nr nr Min & Zinder, 1990
thermoacetoxidans
a) yield expressed in g dry cells/mol acetate; b) nr: not reported.

30
 Introduction

Table 1.10. Selected growth properties of thermophilic MA, SRB and AB on hydrogen.
a
Hydrogen degrading culture µmax KS threshold yield µmax/KS Reference
–1 –1 -1
(h ) (µM) (Pa) (h .mM )
Methanogenic
Schönheit et al.,
Methanothermobacter 0.6-1.6 1980; Taylor & Pirt,
0.14- 80- 0.0018-
5 1977; Zeikus & Wolfe,
thermoautotrophicus 0.69 120 3b 0.004
1972; Schmidt &
Ahring, 1993
c
Methanobacterium Strain THF nr nr 14 nr nr Lovley, 1985
Sulfate-reducing
Desulfotomaculum
0.077 nr nr nr nr Min & Zinder, 1990
thermoacetoxidans
Schmidt & Ahring,
Desulfotomaculum spp. nr 2 0.01 nr nr
1993
Davidova & Stams,
Strain SR 0.052 nr nr nr nr
1996
Thermodesulfobacterium d Sonne-Hansen et al.,
nr 2.4 1.2 nr nr
Strain JSP 1999
Thermodesulfovibrio d Sonne-Hansen et al.,
nr 1.9 0.5 nr nr
Strain R1Ha3 1999
Homoacetogenic
Savage & Drake,
Moorella thermoautotrophica 0.021 nr nr nr nr
1986
Leigh, et al., 1981;
Acetogenium kivui 0.35 nr 1000 nr nr Conrad & Wetter,
1990
a) yield expressed in g dry cells/mol end product; b) under hydrogen limitation; c) nr: not reported; d) Km.

1.4.4 Syntrophic methanol conversion

Interspecies hydrogen transfer in cocultures with methanol as a substrate has been
observed between methanol-utilizing homoacetogens and SRB or MA (Heijthuijsen & Hansen,
1986), and between methanol-utilizing methanogens and SRB (Phelps et al., 1985). These
observations of hydrogen transfer with methanol as a substrate were both done under mesophilic
conditions. Moderately thermophilic SRB, MA and AC might be involved in hydrogen transfer
reactions, but methanol was never used as a substrate. Examples of cocultures in which hydrogen
transfer is observed are: (1) a combined culture of Dsm. nigrificans and Methanothermobacter
thermoautotrophicus which grew and produced methane from lactate or ethanol (Klemps et al.,
1985); and (2) Dsm. thermobenzoicum subsp. thermosyntrophicum, which was able to grow in
coculture with Methanothermobacter thermoautotrophicus Z245 converting a variety of substrates,
including propionate, and lactate. However, neither methanol nor ethanol were used by this
coculture. The only thermophilic sulfate-reducing consortium growing at 65 oC in which hydrogen
transfer with methanol was observed is described by Davidova and Stams (1996). The nature of
the hydrogenotrophic sulfate reducer in this culture is still unclear.

1.5 Factors affecting the fate of methanol in biological desulfurization

In cultures growing at 65 oC with methanol, sulfite, and sulfate, inhibition may result from
high concentrations of substrates or possible intermediates and products such as acetate and
sulfide. A different susceptibility of SRB and MA towards these compounds may act as a selection
criterion in bioreactors. Also the pH, temperature NaCl concentration, and the presence of trace
elements may affect the competition. All these factors are discussed below.

31
Chapter 1

1.5.1 Sulfur compounds

Sulfide toxicity. Sulfate reduction results in the production of hydrogen sulfide (H2S) which, at
high concentrations, can become quite inhibitory for microbial growth. H2S is a very weak acid (pKa
of 7.0 at 30°C) and therefore at neutral values (the optimal pH range for most anaerobic
microorganisms) sulfide is mainly present as H2S (hydrogen sulfide or free sulfide) and HS-
(bisulfide). The sulfide ion (S2-) only occurs (>1% of total sulfide) as important sulfide species at
pH > 10, because the pKa of HS- is about 12 (Sillén & Martell, 1964). Hydrogen sulfide is
considered to be the most toxic form of sulfide (Reis et al., 1992b). The neutrality of the H2S-
molecule allows its easy diffusion through the lipid cell membrane into cytoplasm, where it reacts
with cell components. The reversibility of sulfide inhibition, as observed by Okabe et al. (1992) and
Reis et al. (1992a), seems contradictory as it may be expected that chemical reactions with cell
components are irreversible. As sulfide is a characteristic end product of SRB, it may be
speculated that SRB have developed a high tolerance towards sulfide in order to prevent self-
poisoning. However, this is not necessarily the case; hydrogen sulfide concentrations as low as 60
mgS.L-1 are already inhibitory for a thermophilic Desulfotomaculum species (Min & Zinder, 1990).
Moreover, bacteria not capable of dissimilatory sulfate reduction (such as methanogens) may have
a higher tolerance to H2S than SRB (McCartney & Oleszkiewicz, 1991; Uberoi & Bhattacharya,
1995).
The presence of sulfide may affect SRB in several ways. For the mesophilic Desulfovibrio
desulfuricans it was demonstrated that 250 mgS.L-1 of total sulfide lowers the growth rate and
growth yield by 50% (Okabe et al., 1995). By contrast, the substrate utilization rate increased at
higher sulfide concentration, showing that growth and activity were uncoupled. Uncoupling of
growth and activity at higher sulfide concentrations was also observed for anaerobic sulfate
reducing and methanogenic sludge granules (Visser, 1995). By increasing the total sulfide
concentration, the cell size may decrease, as was shown for Desulfovibrio desulfuricans (Okabe et
al., 1992). This may partly explain the decreased cell yield at increasing sulfide concentrations.
Literature regarding H2S inhibition levels at mesophilic conditions has been reviewed
elsewhere (Hao et al., 1996; Colleran et al., 1995; Oude Elferink et al., 1994). The free H2S levels
which are inhibitory for mesophilic methanogenesis vary from 50-400 mg.L-1. Complete inhibition of
growth of mesophilic SRB has been observed at a H2S concentration of 85 mg.L-1 (Widdel, 1988)
to 547 mg.L-1 (Reis et al., 1992a). No data are available on sulfide inhibition of methanogens under
thermophilic conditions. Complete inhibition of growth of thermophilic SRB may occur at total
sulfide levels as low as 60 mgS.L-1 (Min & Zinder, 1990) or as high as 400 mgS.L-1 (Nazina et al.,
1987). The variation in published data regarding H2S-toxicity reflects the influence of several
factors, such as the type of bacterial species studied, growth substrate (Maillacheruvu et al., 1993)
and time of exposure to sulfide. For undefined cultures, the discrepancies may also be a result of
interference with competitive and mutualistic microbial interactions between individual species.
Another cause of the discrepancies in literature may originate from neglecting pH and sulfide
concentration gradients in biofilms (Lens et al., 1993).
The lack of uniformity in methods for quantifying sulfide inhibition, the many factors that
affect sulfide inhibition and the possible interference with bacterial interactions and diffusion hardly
justify comparison of literature data. Published data cannot lead to a reliable prediction as to
whether SRB or MA will be more affected by sulfide in a specific situation.

Sulfate and sulfite toxicity. Sulfate is generally not toxic for anaerobic bacteria at concentrations
up to 10 g.L-1 (Minami et al., 1988; Karhadkar et al., 1987). For most wastewaters, as well as for
the scrubbing solution from a Bio-FGD plant, sulfate toxicity is not relevant, as the concentration
generally remains below this value. On the other hand, sulfite is very toxic for microorganisms and
for that reason it is used as anti-bacterial agent, for example in wine processing. The mechanism
of sulfite inhibition is not known precisely (Chang et al., 1997).
In pure cultures of SRB, complete inhibition of growth at concentrations as low as 40
mg.L-1) 0.5 mM sulfite was observed (Widdel & Bak, 1992). On the other hand, the sulfate reducer
Archaeaoglobus veneficus can tolerate sulfite concentrations of 1.5 g.L-1 (Huber et al., 1997).

32
 Introduction

Methane production by Methanobacterium ruminantium decreased by a factor of 2 at 100 mg.L-1

sulfite (Prins et al., 1972). Sulfite may have various effects on the activity of methanogenic sludge.
Puhakka et al. (1985) found that sulfite toxicity leads to a prolonged lag phase in methane
production by anaerobic sludge in batch reactors at concentrations exceeding 250 mg.L-1. In
addition, the rate of methane production decreased linearly to very low values in the range of 150
to 2500 mg.L-1 sulfite. However, after repeated sulfite addition to sludge, the toxicity effect may
decrease due to the growth of SRB or due to adaptation of the biomass.

1.5.2 Methanol and acetate toxicity.

Methanol. Alcohols are toxic for microorganisms at high concentrations, presumably due to the
fact that they damage the cell membrane and due to end product inhibition of glycolytic enzymes
(Dürre et al., 1988). Most bacteria are able to withstand ethanol concentrations of at least 10 g.L-1.
As alcohol toxicity towards bacteria decreases with decreasing chain length, it may be speculated
that methanol toxicity will not occur at concentrations below 10 g.L-1 (0.3 M). This was confirmed
for Moorella thermoautotrophica and Moorella thermoacetica as these species tolerate methanol
concentrations up to 16 g.L-1 (0.5 M) (Wiegel & Garrison, 1985; Wiegel, 1986). With 10 g.L-1
methanol, 22 g.L-1 sulfate can be reduced to sulfide. As sulfate concentrations normally will be less
than 6 g.L-1 in biodesulfurization of flue-gases, added methanol concentrations will normally not
exceed 3 g.L-1, which probably does not result in toxicity effects.

Acetate. Methanol degradation by AB may result in the accumulation of acetate, which is toxic for
microorganisms at higher concentrations. As with sulfide, unionized acetate (acetic acid) is
considered the most toxic form (Morvai et al., 1992. Lier et al., 1995) found 50% inhibition of
methane formation by thermophilic sludge occurred at an acetic acid concentration of about 1 mM,
while they observed a 10 times lower susceptibility of mesophilic methanogenic sludge towards
acetic acid. For thermophilic methylotrophic Methanosarcina spp., complete inhibition of growth
was found at 9 mM acetic acid (Yamaguchi et al., 1989). Inhibition by acetic acid may manifest in
weakly buffered bioreactors producing acetate. At pH 6 and a temperature of 55°C, a
concentration of 1 mM of undissociated acetate already is present at a total acetate concentration
of 17 mM. This can be calculated using a pKa for acetic acid of 4.8 at 55°C (Yamaguchi et al.,
1989).

1.5.3 Environmental conditions

pH. SRB and MA may have different pH-optima or pH ranges for growth on common substrates.
As the speciation of compounds such as acetate, H2S and NH4+ is affected by the pH, the effect of
a pH change on the growth of SRB and MA may partially also result from a change in the
concentration of these compounds (Visser et al., 1992) found for anaerobic sludge that
thermophilic (55°C) SRB outcompete methanogens for acetate at pH 8.3-8.6, while the rates of
methanogenesis and sulfate reduction at pH 7.6-7-9 were about equal. Minami et al. (1988)
suggested that pH may have a large effect on the occurrence of methanogenesis or sulfate reduction
from methanol. They found that sulfate reduction prevailed at pH 7.0-7.5 in a moderate thermophilic
(53°C) methanol-fed bioreactor. At pH values between 6.2 and 6.8, sulfate reduction was suppressed
and methanogenesis prevailed. However, inhibition of SRB in the lower pH range may also have
resulted from elevated H2S concentrations.

Salt requirement and salt tolerance. Sulfate reducers from marine environments often require salt
for growth and may be damaged in fresh water. Where marine species are moderate halophiles
requiring 1-3% NaCl for optimum growth (Cord-Ruwisch et al., 1985), fresh water species may be
inhibited at these concentrations. Most SRB are rather adaptable with respect to salt concentrations,
and grow without NaCl as well as with 5-6% NaCl (Rees et al., 1995). The highest tolerance and
optimum (10%) NaCl concentration among SRB is reported for the mesophilic Desulfohalobium
retbaense (Ollivier et al., 1991). SRB are known to outcompete MA in marine environments under
sulfate-limiting conditions; H2 and acetate are used mainly for sulfate reduction. However,

33
Chapter 1

methanogenesis is not totally absent in these environments and it is thought to occur from
noncompetitive substrates as methylamines (Oremland & Polcin, 1982). On the other hand, halophilic
hydrogenotrophic MA have been isolated and the highest tolerated salt concentration reported so far
for MA using H2 or formate is 8.3 % (Huber et al., 1982). From marine environments, halophilic
moderately thermophilic methylotrophic MA, i.e. Methanosalsum zhiliniae and Methanohalobium
evestigatum have been isolated (Table 1.5.). While methanogenic activity from H2 is low or not
expressed at salt concentrations above 15%, (Ollivier et al., 1994), Mhb. evestigatum grows optimally
at a salt concentration of 24%.
Mesophilic homoacetogenic halophiles seem to have a similar upper growth limit as
methylotrophic MA, e.g. 25% (Ollivier et al., 1994).

Temperature. Differences in optimal growth temperatures and growth temperature ranges may
cause shifts in the microbial composition of mixed cultures as a result of a temperature change. A
shift from a methanogenic to a sulfate-reducing population or vice versa also alters the anaerobic
mineralization profile, as exemplified by a study conducted by Visser et al. (1993). They found a rapid
shift from methanogenesis to sulfate reduction after elevating the temperature of an acetate and
sulfate fed UASB reactor from 30 to 55°C. A temperature increase from 37 to 55°C had the same
effect (Rintala & Lettinga, 1992). No acetoclastic methanogens have been isolated growing beyond
a temperature of 70°C (Zinder, 1990). Therefore, it may be speculated that acetoclastic
methanogenesis does not occur in reactors beyond this temperature. As acetotrophic sulfate
reduction is still possible up to at least 85°C (Table 1.3), the electron flow in acetate-rich
environments may therefore be diverted from methane to sulfide as a result of a temperature
increase from below 70°C to 70-85°C. The situation is similar for methanol: no methylotrophic
methanogens are known that grow at temperatures above 60°C (Table 1.4), while the methanol-
utilizing sulfate reducer Desulfotomaculum kuznetsovii was reported to grow up to 85°C (Nazina et
al., 1987). Temperature may also affect SRB and MA indirectly, as temperature decreases the
concentration of inhibitory H2S due to a lower pKa of H2S at increasing temperature.

Trace elements. As essential constituents of cell components - in particular proteins - trace

elements need to be available to microorganisms in order to facilitate growth. Bacteria compete for
trace elements when these are limiting, and it may be expected that species with a low (or no)
requirement or a high affinity for limiting trace elements will eventually dominate. Iron, cobalt,
nickel, zinc and copper were identified as trace elements that are necessary to maintain maximum
growth of MA (Speece, 1996). Growth of mesophilic methylotrophic MA and AB was found to be
optimal at an added cobalt concentration of 0.1 mg.L-1 (Florencio et al., 1994). In this case, the
cobalt requirement may be explained by the high content of corrinoids of methanol-grown MA and
AB (Krzycki & Zeikus, 1980; Stüpperich et al., 1988; Inoue et al., 1992). It is not known if corrinoids
are involved in methanol degradation by SRB. As opposed to MA, little is known about the trace
element requirements of SRB. Under sulfate-reducing conditions, it may be speculated that trace
metals (such as zinc and cobalt) are growth-limiting as the concentration of these metals may be
extremely low due to the precipitation of insoluble metal sulfides. However, Parkin et al. (1990)
found that the concentration of trace metals in microbial cultures was independent of the sulfide
concentration. This independence was explained by the microbial production of chelating agents.

1.6 Outline of this thesis

The aim of the research presented in this thesis was to study the microbiology of
thermophilic sulfate reduction with methanol as the electron donor in order to apply a thermophilic
desulfurization process of flue gas.
The thermophilic anaerobic degradation of methanol can proceed either via sulfidogenesis
in the presence of sulfate, or via acetogenesis. Moreover, a combination of both processes via
intermediates such as hydrogen is possible, and MA might be involved in the hydrogen transfer
process. The outcome of the competition for the substrate methanol and possible intermediates is
difficult to predict based on current literature and was therefore one of the main questions to be

34
 Introduction

answered in the present study. The first part of this thesis (Chapter 2) deals with the different
aspects of competition, inhibition and syntrophy that can occur in methanol fed thermophilic
sulfidogenic bioreactors. In continuous culture experiments defined mixtures of organisms were
studied with respect to methanol degradation. The biochemistry of methanol utilization in the
thermophilic sulfate-reducer Desulfotomaculum kuznetsovii is described in Chapter 3, while
Chapter 4 describes the extremely heat resistant spore formation by this strain. This extremely
heat resistance is unprecedented. Next to sulfate reduction, sulfite reduction will be an important
biological process in the desulfurization of off-gasses. To investigate whether we could isolate new
thermophilic sulfite-reducing strains, we collected samples from solfataric fields in Iceland. The
isolation and characterization of a new species from these inocula, Desulfotomaculum solfataricum
is described in Chapter 5. The results presented in this thesis are summarized and discussed in
Chapter 6.
Different aspects of the thermophilic sulfate- and sulfite reduction processes with methanol
in Expanded Sludge Bed Reactors have been studied by Jan Weijma in a counterpart thesis
project and have been published previously (Weijma, 2000).

References
Adams, D. M. (1973). Inactivation of Clostridium perfringens type A spores at ultrahigh temperatures. Appl
Microbiol Immunil 26,282-287.
Ahring, B. K. & Westermann, P. (1985). Methanogenesis from acetate: physiology of a thermophilic
acetate-utilizing methanogenic bacterium. FEMS Microbiol Lett 28,15-19.
Alphenaar, P. A., Visser, A. & Lettinga, G. (1993). The effect of liquid upward velocity and hydraulic
retention time on granulation in UASB reactors treating wastewater with a high sulphate content. Biores
Techno 43,249-258.
Amdur, M. O. & Underhill, D. (1968). J. Air poll.Contr.Assoc. 21,460.
Anthony, C. (1982). The biochemistry of methylotrophs. Academic Press, London.
Atrih, A. & Foster, S. J. (1999). The role of peptidglycan structure and structural dynamics during
endospore dormancy and germination. Ant Leeuwenhoek 75,1033-1041.
Atrih, A. & Foster, S. J. (2001). Analysis of the role of bacterial endospore cortex structure in resistance
properties and demonstration of its conservation amongst species. J. Appl Microbiol 91,364-372.
Badziong, W. & Thauer, R. K. (1978). Growth yields and growth rates of Desulfovibrio vulgaris (Marburg)
growing on hydrogen plus sulfate and hydrogen and thiosulfate as the sole energy sources. Arch
Microbiol 117,209-214.
Bak, F. & Cypionka, H. (1987). Novel type of energy metabolism involving fermentation of inorganic sulphur
compounds. Nature 326,891-892.
Bak, F. & Pfennig, N. (1987). Chemolithotrophic growth of Desulfovibrio sulfodismutans sp. nov. by
disproportionation of inorganic sulfur compounds. Arch Microbiol 147,184-189.
Balk, M., Weijma, J. & Stams, A. J. M. (2002). Thermotoga lettingae sp. nov., a novel thermophilic
methanol degrading bacterium isolated from a thermophilic anaerobic bioreactor. Int J Syst Evol Microbiol
52:1361-1368
Beaman, T. C. & Gerhardt, P. (1986). Heat resistance of bacterial spores correlated with protoplast
dehydration, mineralization, and thermal adaptation. Appl Environ Microbiol 52,1242-1246.
Beeder, J., Torsvik, T. & Lien, T. (1995). Thermodesulforhabdus norvegicus gen. nov., sp. nov., a novel
thermophilic sulfate-reducing bacterium from oil field water. Arch Microbiol 164,331-336.
Belyaev, S. S., Rozanova, E. P., Borzenkov, I. A., Charakhch'yan, I. A., Miller, Y. M., Sokolov, M. Y. &
Ivanov, M. V. (1991). Characteristics of microbiological processes in a water-flooded oil field in the
Middle Ob' region. Microbiology 59,754-759.
Ben-Bassat, A. & Zeikus, J. G. (1981). Thermobacteroides acetoethylicus gen. nov. and spec. nov., a new
chemoorganotrophic, anaerobic, thermophilic bacterium. Arch Microbiol 128,365-370.
Blaut, M. (1994). Metabolism of methanogens. Ant Leeuwenhoek 66,187-208.
Blaut, M. & Gottschalk, G. (1984). Coupling of ATP synthesis and methane formation from methanol and
molecular hydrogen in Methanosarcina barkeri. Eur J Biochem 141,217-222.
Blotevogel, K.-H. & Fischer, U. (1985). Isolation and characterization of a new thermophilic and autotrophic
methaneproducing bacterium Methanobacterium thermoaggregans sp. nov. Arch Microbiol 142,218-222.
Blotevogel, K.-H., Fischer, U. & Lupkes, K. H. (1986). Methanococcus frisius sp. nov., a new
methylotrophic marine methanogen. Can J Microbiol 32,127-131.

35
Chapter 1

Boland, F. M., Atrih, A., Chirakkal, H., Foster, S. J. & Moir, A. (2000). Complete spore-cortex hydrolysis
during germination of Bacillus subtilis 168 requires SleB and YpeB. Microbiology Reading 146,57-64.
Boone, D. R., Johnson, R. L. & Liu, Y. (1989). Diffusion of interspecies electron carriers H2 and formate in
methanogenic ecosystems and its implications in the measurement of Km for H2 or formate uptake. Appl
Environ Microbiol. 55,1735-1741.
Boone, D. R., Whitman, W. B. & Rouviere, P. 1993. Diversity and taxonomy of methanogens. In J. G. Ferry
(ed.), Methanogenesis. Chapman & Hall, London.
Burggraf, S., Jannasch, H. W., Nicolaus, B. & Stetter, K. O. (1990). Archaeoglobus profundus sp. nov.,
represents a new species within the sulfate reducing archaeobacteria. Syst Appl Microbiol 13,24-28.
Byrer, D. E., Rainey, F. A. & Wiegel, J. (2000). Novel strains of Moorella thermoacetica form unusually
heat-resistant spores. Arch Microbiol 174,334-339.
Campbell, L. L. & Postgate, J. R. (1965). Classification of the spore-forming sulfate-reducing bacteria.
Bacteriol Rev 29,359-363.
Casadei, M. A., Ingram, R., Hitchings, E., Archer, J. & Gaze, J. (2001). Heat resistance of Bacillus cereus,
Salmonella typhimurium, and Lactobacillus delbrueckii in relation to pH and ethanol. Int J Food Microbiol
63,125-134.
Castro, H. F., Williams, N. H. & Ogram, A. (2000). Phylogeny of sulfate-reducing bacteria. FEMS Microbiol
Ecol 31,1-9.
Cato, E. P., George, W. L. & Finegold, S. M. (1986). Genus Clostridium. Bergey's Manual of Systematic
Bacteriology 2,1141.
Chang, I. S., Kim, B. H. & Shin, P. K. (1997). Use of sulfite and hydrogen peroxide to control bacterial
contamination in ethanol fermentation. Appl Environ Microbiol. 63,1-6.
Charlson, R. J., Schwartz, S. E., Hales, J. M., Cess, R. D., Coakley, J., Hansen, J. E. & Hofmann, D. J.
(1992). Climate forcing by anthropogenic aerosols,. Science 255,423-430.
Clarens, M. & Moletta, R. (1990). Kinetic studies of acetate fermentation by Methanosarcina sp. MSTA-1.
Appl Microbiol Biotechnol 33,239-244.
Colleran, E., Finnegan, S. & Lens, P. (1995). Anaerobic treatment of sulphate-containing waste streams.
Ant Leeuwenhoek 67,29-46.
Collins, M. D., Lawson, P. A., A., W., Cordoba, J. J., Fernandez-Garayzabal, J., Garcia, P., Cai, J.,
Hippe, H. & Farrow, J. A. E. (1994). The phylogeny of the genus Clostridium: proposal of five new
genera and eleven new species combinations. Int J Syst Bacteriol 44,812-826.
Conrad, R. & Wetter, B. (1990). Influence of temperature on energetics of hydrogen metabolism in
homoacetogenic, methanogenic, and other bacteria. Arch Microbiol 155,94-98.
Cord-Ruwisch, R. & Garcia, J. L. (1985). Isolation and characterization of an anaerobic benzoate-
degrading spore-forming sulfate-reducing bacterium, Desulfotomaculum sapomandens, sp. nov. FEMS
Microbiol Lett 29,325-330.
Cord-Ruwisch, R., Kleinitz, W. & Widdel, F. (1985). Sulfate reducing bacteria and their economic activities.
Soc Petrol 13554,53-58.
Daas, P. J. H. (1996). Methanol-dependent methyl transfer reactions in Methanosarcina barkeri. PhD thesis.
University of Nijmegen, Nijmegen,The Netherlands.
Daas, P. J. H., Wassenaar, R. W., Willemsen, P., Theunissen, R. J., J.T., K., Van der Drift, C. & Vogels,
G. D. (1996). Purification and properties of an enzyme involved in the ATP-dependent activation of the
methanol:2-mercaptoethanesulfonic acid methyltransferase reaction in Methanosarcina barkeri. J Biol
Chem 271,22339-22345.
Daumas, S., Cord-Ruwisch, R. & Garcia, J. L. (1988). Desulfotomaculum geothermicum sp. nov., a
thermophilic, fatty acid-degrading, sulfate-reducing bacterium isolated with H2 from geothermal ground
water. Ant Leeuwenhoek 54,165-178.
Davidova, I. A. & Stams, A. J. M. (1996). Sulfate reduction with methanol by a thermophilic consortium
obtained from a methanogenic reactor. Appl Microbiol Biotechnol 46,297-302.
Deppenmeier, U., Mueller, V. & Gottschalk, G. (1996). Pathways of energy conservation in methanogenic
archaea. Arch Microbiol 165,149-163.
Dijkhuizen, L., Hansen, T. A. & Harder, W. (1985). Methanol, a potential feedstock for biotechnological
processes. Trends in Biotechnology 3,262-267.
Dong, W. & Stams, A. J. M. (1995). Evidence for H2 and formate formation during syntrophic butyrate and
propionate degradation. Anaerobe 1,35-39.
Donnelly, L. S. & Busta, F. F. (1980). Heat resistance of Desulfotomaculum nigrificans spores in soy protein
infant formula preparations. Appl Environ Microbiol 40,721-725.

36
 Introduction

Dries, J., Smul, A. D., Goethals, L., Grootaerd, H. & Verstraete, W. (1998). High rate biological treatment
of sulfate-rich wastewater in an acetate fed EGSB-reactor. Biodegradation 9,103-111.
Duine, J. A. & Frank, J. (1980). The prosthetic group of methanol dehydrogenase. Purification and some of
its properties. Biochemistry J 187,221-226.
duPreez, L. A. & Maree, J. P. (1994). Pilot-scale biological sulfate and nitrate removal utilizing producer gas
as energy source. Wat Sci Technol 30,275-285.
Dürre, P., Bahl, H. & Gottschalk, G. (1988). Membrane processes and product formation in anaerobes, p.
187-241. In L. E. Erickson and D.-C. Fung (eds.), Handbook on anaerobic fermentations. Marcel Dekker
Inc., New York.
Fardeau, M. L., Ollivier, B., Patel, B.-K. C., Dwivedi, P., Ragot, M. & Garcia, J. L. (1995). Isolation and
characterization of a thermophilic sulfate-reducing bacterium, Desulfotomaculum thermosapovorans sp.
nov. Int J Syst Bacteriol 45,218-221.
Fernandez, A., Ocio, M. J., Fernandez, P. S. & Martinez, A. (2001). Effect of heat activation and
inactivation conditions on germination and thermal resistance parameters of Bacillus cereus spores. Int J
Food Microbiol 63,257-264.
Ferry, J. G. (1992). Biochemistry of methanogenesis. Crit Rev Biochem Mol Biol 27,473-503.
Finster, K., Liesack, W. & Thamdrup, B. (1998). Elemental sulfur and thiosulfate disproportionation by
Desulfocapsa sulfoexigens sp. nov., a new anaerobic bacterium isolated from marine surface sediment.
Appl Environ Microbiol 64,119-125.
Florencio, L., Field, J. A. & Lettinga, G. (1994). The importance of cobalt for individual trophic groups in an
anaerobic methanol degrading consortium. Appl Environ Microbiol. 60,227-234.
Franzmann, P. D., Y., L., D.L., B., Aldrich, H. C., Conway de Macario, E. & D.R., B. (1997).
Methanogenium frigidum sp. nov. a psychrophilic, H2-using methanogen from Ace Lake, Antarctica. Int J
Syst Bacteriol 47,1068-1072.
Germonpre, R., Liessens, J. & Verstraete, W. (1991). Fluidised bed denitrification of drinking water with
methanol -pilot plant experience, p. 49-52. In H. Verachtert and W. Verstraete (eds.), Proceedings of the
International Symposium on Environmental Biotechnology, The Royal Flemish Society of Engineers.,
Oostende, Belgium.
Gerritse, J., Drzyzga, O., Kloetstra, G., Keijmel, M., Wiersum, L. P., Hutson, R., Collins, M. D. &
Gottschal, J. C. (1999). Influence of different electron donors and acceptors on dehalorespiration of
tetrachloroethene by Desulfitobacterium frappieri TCE1. Appl Environ Microbiol 65,5212-5221.
Gonzalez, I., Lopez, M., Martinez, S., Bernardo, A. & Gonzalez, J. M. (1999). Thermal inactivation of
Bacillus cereus spores formed at different temperatures. Int J Food Microbiol 51,81-84.
Gupta, A., Flora, J. R. V., Sayles, G. D. & Suidan, M. T. (1994). Methanogenesis and sulfate reduction in
chemostats. I. Kinetic studies and experiments. Water Res 28,781-793.
Guyot, J. P. (1986). Role of formate in methanogenesis from xylan by Cellulomonas sp. associated with
methanogens and Desulfovibrio vulgaris: inhibition of the aceticlastic reaction. FEMS Microbiology Lett
34,149-153.
Hammack, R. W., Edenborn, H. M. & Dvorak, D. H. (1994). Treatment of water from an open pit copper
mine using biogenic sulfide and limestone: a feasibility study. Wat Res 28,2321-2329.
Hao, J. H., Chen, J. M., Huang, L. & Buglass, R. L. (1996). Sulfate-reducing bacteria. Crit Rev Environ Sci
Technol 26,155-187.
Hard, B. C. & Babel, W. (1995). Characterization of a methanol-utilizing sulfate-reducing bacterium isolated
from a waste-water pond. J Basic Microbiol 35,385-392.
Hattori, S., Kamagata, Y., Hanada, S. & Shoun, H. (2000). Thermoacetogenium phaeum gen. nov., sp.
nov., a strictly anaerobic thermophilic syntrophic acetate-oxidizing bacterium. Int J Syst Evol Microbiol
50,1601-1609.
Heijthuijsen, J. H. F. G. & Hansen, T. A. (1986). Interspecies hydrogen transfer in co-cultures of methanol-
utilizing acidogens and sulfate-reducing or methanogenic bacteria. FEMS Microbiol Lett 38,57-64.
Hektor, H. J., Kloosterman, H. & Dijkhuizen, L. (2000). Nicotinoprotein methanol dehydrogenase enzymes
in Gram-positive methylotrophic bacteria. J Mol Cat B:Enz 8,103-109.
Henriques, A. O. & Moran, C. P. J. (2000). Structure and assembly of the bacterial endospore coat.
Methods Enzymol 20,95-110.
Henry, E. A., Devereux, R., Maki, J. S., Gilmour, C. C., Woese, C. R., Mandelco, L., Schauder, R.,
Rensen, C. C. & Mitchell, R. (1994). Characterization of a new thermophilic sulphate reducing bacterium
Thermodesulfovibrio yellowstonii, gen. nov. and sp. nov.: its phylogenetic relationship to
Thermodesulfobacterium commune and their origins deep within the bacterial domain. Arch Microbiol
161,62-69.

37
Chapter 1

Hensgens, C. M. H., Vonck, J., Van Breemen, J. F. L., Van Bruggen, E. F. J. & Hansen, T. A. (1993).
Purification and characterization of an oxygen-labile, NAD-dependent alcohol dehydrogenase from
Desulfovibrio gigas. J Bacteriol 175,2895-2863.
Huber, H., Thomm, M., Konig, H., Thies, G. & Stetter, K. O. (1982). Methanococcus thermolithotrophicus,
a novel thermophilic lithotrophic methanogen. Arch Microbiol 132,47-50.
Huber, H., Jannasch, H., Rachel, R., Fuchs, T. & Stetter, K. O. (1997). Archaeoglobus veneficus sp. nov.,
a novel facultative chemolithoautotrophic hyperthermophilic sulfite reducer, isolated from abyssal black
smokers. Syst Appl Microbiol 20,374-380.
Hulshoff-Pol, L. W., Lens, P. N. L., Stams, A. J. M. & Lettinga, G. (1998). Anaerobic treatment of
sulphate-rich wastewaters. Biodegradation 9,213-224.
Imachi, H., Sekiguchi, Y., Kamagata, Y., Ohashi, A. & Harada, H. (2000). Cultivation and in situ detection
of a thermophilic bacterium capable of oxidizing propionate in syntrophic association with
hydrogenotrophic methanogens in a thermophilic methanogenic granular sludge. Appl Environ Microbiol
66,3608-3615.
Inoue, K., Kageyama, S., Miki, K., Morinaga, T., Kamagata, Y., Nakamura, K. & Mikami, E. (1992).
Vitamin B12 production by Acetobacterium sp. and its tetrachloromethane-resistant mutants. J Ferment
Bioeng 73,76-78.
Isaksen, M. F., Bak, F. & Jørgensen, B. B. (1994). Thermophilic sulfate reducing bacteria in cold marine
sediment. FEMS Microbiol Ecol 14,1-8.
Jackson, B. E. & McInerney, M. J. (2000). Thiosulfate disproportionation by Desulfotomaculum
thermobenzoicum. Appl Environ Microbiol 66,3650-3653.
Jansen, M. (2000). Microbial demethylation of dimethylsulfoniopropionate and methylthiopropionate. PhD
thesis. University of Groningen, Groningen, The Netherlands.
Janssen, A. J. H., Ma, S. C., Lens, P. & Lettinga, G. (1997). Performance of a sulphide oxidizing expanded
bed reactor supplied with dissolved oxygen. Biotechnol Bioeng 53,32-40.
Jarrell, K. F. & Kalmokoff, M. L. (1988). Nutritional requirements of the methanogenic archaebacteria. Can
J Microbiol 34,557-576.
Jeanthon, C., l'Haridon, S., Cueff, V., Banta, A., Reysenbach A.-L. & Prieur, D. (2002).
Thermodesulfobacterium hydrogeniphilum sp. nov., a thermophilic chemolithoautotrophic sulfate-reducing
bacterium isolated from a deep-sea hydrothermal vent at Gyamas Basin; emendation of the genus
Thermodesulfobacterium. Int J Syst Evol Microbiol 52,765-772.
Jørgensen, B. B. & Bak, F. (1991). Pathways and microbiology of thiosulfate transformations and sulfate
reduction in a marine sediment (Kattegat, Denmark). Appl Environ Microbiol 57,847-856.
Jørgensen, B. B., Isaksen, M. F. & Jannasch, H. (1992). Bacterial sulfate-reduction above 100 C in the
deep-sea hydrothermal vent sediments. Science,1756-1757.
Kalyuzhnyi, S. V., Leon-Fragoso, C. D. & Rodriguez-Martinez, J. (1997). Biological sulfate reduction in an
UASB reactor fed with ethanol as electron donor. Mikrobiologiya 66,674-680.
Kamagata, Y. & Mikami, E. (1991). Isolation and characterization of a novel thermophilic Methanosaeta
strain. Int J Syst Bacteriol 41,191-196.
Kamagata, Y., Kawasaki, H., Oyaizu, H., Nakamura, K., Mikami, E., Endo, G., Koga, Y. & Yamasato, K.
(1992). Characterization of three thermophilic strains of Methanothrix thermophila, new species (equals
Methanosaeta thermophila, equals Methanosaeta thermoacetophila) thermoacetophila. Int J Syst
Bacteriol 42,463-468.
Karhadkar, P. P., Audic, J.-M., Faup, G. M. & Khanna, P. (1987). Sulfide and sulfate inhibition of
methanogenesis. Wat Res 21,1061-1066.
Karnauchow, T. M., Koval, S. F. & Jarrell, K. F. (1992). Isolation and characterization of three thermophilic
anaerobes from a St. Lucia hot spring. Syst Appl Microbiol 15,296-310.
Kasmi, A. E., Rajasekharan, S. & Ragsdale, S. W. (1994). Anaerobic pathway for conversion of the methyl
group of aromatic methyl ethers to acetic acid by Clostridium thermoaceticum. Biochemistry 33,11217-
11224.
Kaufman, E. N., Little, M. H. & Selvaraj, P. T. (1996). A biological process for the reclamation of flue gas
desulfurization using mixed sulfate reducing bacteria with inexpensive carbon sources. Appl Biochem
Biotechnol 63-65,677-693.
Keltjens, J. T. & Vogels, G. D. (1993). Conversion of methanol and methylamines to methane and carbon
dioxide, p. 253-303. In J. G. Ferry (ed.), Methanogenesis. Chapman and Hall, New York.
Kerby, R. & Zeikus, J. G. (1983). Growth of Clostridium thermoaceticum on H2/CO2 or CO as the energy
source. Curr Microbiol 8,27-30.

38
 Introduction

Klemps, R., Cypionka, H., Widdel, F. & Pfennig, N. (1985). Growth with hydrogen, and further
physiological characteristics of Desulfotomaculum species. Arch Microbiol 143,203-208.
Kotelnikova, S. V., Obraztsova, A. Y., G.M., G. & Laurinavichius, K. S. (1993). Methanobacterium
thermoflexum sp. nov. and Methanobacterium defluvii sp. nov., thermophilic rod-shaped methanogens
isolated from anaerobic digester sludge. Syst Appl Microbiol 16,427-435.
Krämer, M. & Cypionka, H. (1989). Sulfate formation via ATP sulfurylase in thiosulfate- and sulfite-
disproportionating bacteria. Arch Microbiol 151,232-237.
Kremer, D. R., Nienhuis-Kuiper, H. E. & Hansen, T. A. (1988). Ethanol dissimilation in Desulfovibrio. Arch
Microbiol 150,552-557.
Krzycki, J. & Zeikus, J. G. (1980). Quantification of corrinoids in methanogenic bacteria. Curr Microbiol
3,243-245.
Kuever, J., Rainey, F. A. & Hippe, H. (1999). Description of Desulfotomaculum sp. Groll ass
Desulfotomaculum gibsoniae sp. nov. Int J Syst Bacteriol 49,1801-1808.
Laurinavichius, K. S., Kotelnikova, S. V. & Obraztsova, A. Y. (1988). New species of thermophilic
methane-producing bacteria, Methanobacterium thermophilum. Mikrobiologiya 57,1035-1041.
Leguerinel, I., Couvert, O. & Mafart, P. (2000). Relationship between the apparent heat resistance of
Bacillus cereus spores and the pH and NaCl concentration of the recovery medium. Int J Food Microbiol
55,223-227.
Leigh, J. A., Mayer, F. & Wolfe, R. S. (1981). Acetogenium kivui, a new thermophilic hydrogen-oxidizing
acetogenic bacterium. Arch Microbiol 129,275-280.
Lens, P. N. L., Beer, D. d., Cronenberg, C. C. H., Houwen, F. P. & Ottengraf, S. P. P. (1993).
Heterogeneous distribution of microbial activity in methanogenic aggregates: pH and glucose profiles.
Appl Environ Microbiol 59,3803-3815.
Lier, J. B. v., Groeneveld, N. & Lettinga, G. (1995). Development of sludge in compartmentalized upflow
reactors. Biotechnol Bioeng 50,115-124.
Liu, Y., Karnauchow, T. M., Jarrell, K. F., Balkwill, D. L., Drake, G. R., Ringelberg, D., Clarno, R. &
Boone, D. R. (1997). Description of two new thermophilic Desulfotomaculum spp., Desulfotomaculum
putei sp. nov., from a deep terrestrial subsurface, and Desulfotomaculum luciae sp. nov. from a hot
spring. Int J Syst Bacteriol 47,615-621.
Ljungdahl, L. G. (1986). The autotrophic pathway of acetate synthesis in acetogenic bacteria. Ann Rev
Microbiol 40,415-450.
Love, C. A., Patel, B. K. C., Nicholas, P. D. & Stackebrandt, E. (1993). Desulfotomaculum australicum, sp.
nov., a thermophilic sulfate-reducing bacterium isolated from the Great Artesian Basin of Australia. Syst
Appl Microbiol 16,244-251.
Lovley, D. R. (1985). Minimium threshold for hydrogen metabolism in methanogenic bacteria. Appl Environ
Microbiol 49,1530.
Maillacheruvu, K. M., Parkin, G. F., Peng, C. Y., Kuo, W.-C., Oonge, Z. I. & Lebduschka, V. (1993).
Sulfide toxicity in anaerobic systems fed sulfate and various organics. Water.Environ.Res. 65,100-109.
Maree, J. P. & Strydom, W. F. (1987). Biological sulphate removal from industrial effluent in an upflow
packed bed reactor. Wat Res 21,141-146.
Mathrani, I. M., Boone, D. R., Mah, R. A., Fox, G. E. & Lau, P. P. (1988). Methanohalophilus zhilinae
sp.nov., an alkaliphilic, halophilic methylotrophic methanogen. Int J Syst Bacteriol 38,139-142.
Mazas, M., Martinez, S., Lopez, M., Alvarez, A. B. & Martin, R. (1999). Thermal inactivation of Bacillus
cereus spores affected by the solutes used to control water activity of the heating medium. Int J Food
Microbiol 53,61-67.
McBee, R. H. (1954). The characteristics of Clostridium thermocellum. J Bacteriol 67,505-506.
McCartney, D. M. & Oleszkiewicz, J. A. (1991). Sulfide inhibition of anaerobic degradation of lactate and
acetate. Wat.Res. 25,203-209.
Min, H. & Zinder, S. H. (1989). Kinetics of acetate utilization by two thermophilic acetotrophic methanogens
Methanosarcina strain CALS-1 and Methanothrix sp. Strain CALS-1. Appl Environ Microbiol 52,617-622.
Min, H. & Zinder, S. H. (1990). Isolation and characterization of a thermophilic sulfate-reducing bacterium
Desulfotomaculum thermoacetoxidans sp. nov. Arch Microbiol 153,399-404.
Minami, K., Tanimoto, Y., Tasaki, M., Ogawa, S. & Okamura, K. (1988). Influence of pH on methane and
sulfide production from methanol. J FermTechnol 66,117-121.
Morvai, L., Mihaltz, P. & Hollo, J. (1992). Comparison of the kinetics of acetate biomethanation by raw and
granular sludges. Appl Microbiol Biotechnol 36,561-567.
Nakamura, S., Yamakawa, K., Izumi, J., Nakashio, S. & Nishida, S. (1985). Germinability and heat
resistance of spores of Clostridium difficile strains. Microbiol Immunil 29,113-118.

39
Chapter 1

Nanninga, H. J. & Gottschal, J. C. (1987). Properties of Desulfovibrio carbinolicus sp. nov. and other
sulfate-reducing bacteria isolated from an anaerobic purification plant. Appl Environ Microbiol 53,802-809.
Nazina, T. N., Ivanova, A. E., Kanchaveli, L. P. & Rozanova, E. P. (1987). A new sporeforming
thermophilic methylotrophic sulfate-reducing bacterium, Desulfotomaculum kuznetsovii sp. nov.
Mikrobiologiya 57,823-827.
Nazina, T. N., Turova, T. P., Poltaraus, A. B., Gryadunov, D. A., Ivanova, A. E., Osipov, G. A. &
Belyaev, S. S. (1999). Phylogenetic position and chemotaxonomic characteristics of the thermophilic
sulfate-reducing bacterium Desulfotomaculum kuznetsovii. Mikrobiologiya 68,92-99.
Nilsen, R. K., Torsvik, T. & Lien, T. (1996). Desulfotomaculum thermocisternum sp. nov., a sulfate reducer
isolated from a hot North Sea oil reservoir. Int J Syst Bacteriol 46,397-402.
Nilsen, R. K., Beeder, J., Thorstenson, T. & Torsvik, T. (1996). Distribution of thermophilic marine sulfate
reducers in north sea oil field waters reservoirs. Appl Environ Microbiol 62,1793-1798.
Nozhevnikova, A. N. & Chudina, V. I. (1984). Morphology of the thermophilic acetate bacterium
Methanothrix thermoacetophila sp. nov. Microbiology 53,618-624.
Okabe, S., Nielsen, P. H. & Characklis, W. G. (1992). Factors affecting microbial sulfate reduction by
Desulfovibrio desulfuricans in continuous culture: limiting nutrients and sulfide concentration. Biotechnol
Bioeng 40,725-734.
Okabe, S., Nielsen, P. H., Jones, W. L. & Characklis, W. G. (1995). Sulfide product inhibition of
Desulfovibrio desulfuricans in batch and continuous cultures. Wat Res 29,571-578.
Ollivier, B., Lombardo, A. & Garcia, J. L. (1984). Isolation and characterization of a new thermophilic
Methanosarcina strain (strain MP). Ann Microb 135B,187-198.
Ollivier, B., Caumette, P., Garcia, J. L. & Mah, R. A. (1994). Anaerobic bacteria from hypersaline
environments. Microbiol Rev 58,27-38.
Ollivier, B., Hatchikian, E. C., Prensier, G., Guezennenc, J. & Garcia, J. L. (1991). Desulfohalobium
retbaense gen. nov. sp. nov., a halophilic sulfate-reducing bacterium from sediments of a hypersaline
lake in Senegal. Int J Syst Bacteriol 41,74-81.
Oremland, R. S. & Polcin, S. (1982). Methanogenesis and sulfate-reduction: competetive and
noncompetetive substrates in estuarine environenments. Appl Environ Microbiol 44,1270-1276.
Oude Elferink, S. J. W. H., Visser, A., Hulshoff-Pol, L. W. & Stams, A. J. M. (1994). Sulfate reduction in
methanogenic bioreactors. FEMS Microbiol Rev 15,119-136.
Palop, A., Sala, F. J. & Condon, S. (1999). Heat resistance of native and demineralized spores of Baciluus
subtilis sporulated at different temperatures. Appl Environ Microbiol 65,1316-1319.
Parkin, G. F., Lynch, N. A., Kuo, W. C., Keuren, E. L. v. & Bhattacharya, S. K. (1990). Interactions
between sulfate reducers and methanogens fed acetate and propionate. J Water Pollut Control Fed
62,780.
Pavlostathis, S. G. & Giraldo-Gomez, E. (1991). Kinetics of anaerobic treatment: a critical review. Critical
Rev. Environ Control 21,411-490.
Payot, S., Guedon, E., Desvaux, M., Gelhaye, E. & Petitdemange, E. (1999). Effect of the dilution rate,
cellobiose, and ammonium availabilities on Clostridium cellulolyticum sporulation. Appl Microbiol
Biotechnol 52,670-674.
Pfeiffer, J. B. (1975). Sulfur removal and recovery from industrial processes. American Chemical Society,
Washington D.C.
Phelps, T. J., Conrad, R. & Zeikus, J. G. (1985). Sulfate-dependent interspecies hydrogen transfer
between Methanosarcina barkeri and Desulfovibrio vulgaris during co-culture metabolism of acetate or
methanol. Appl Environ Microbiol 50,589-594.
Pikuta, E., Lysenko, A., Suzina, N., Osipov, G., Kuznetsov, B., Tourova, T., Akimenko, V. &
Laurinavichius, B. (2000). Desulfotomaculum alkaliphilum sp. nov., a new alkaliphilic, moderately
thermophilic sulfate-reducing bacterium. Int J Syst Evol Microbiol 50,25-33.
Plugge, C. M., Balk, M. & Stams, A. J. M. (2002). Desulfotomaculum thermobenzoicum subsp.
thermosyntrophicum subsp. nov., a thermophilic, syntrophic, propionate-oxidizing, spore-forming
bacterium. Int J Syst Evol Microbiol 52,391-399.
Prins, R. A., Nevel, C. J. v. & Demeyer, D. I. (1972). Pure culture studies of inhibitors for methanogenic
bacteria. Ant Leeuwenhoek 38,281-287.
Puhakka, J. A., Rintala, J. A. & Vuoriranta, P. (1985). Influence of sulfur compounds on biogas production
from forest industry wastewater. Wat Sci Tech 17,281-285.
Qatibi, A. I., Nivière, V. & Garcia, J. L. (1991). Desulfovibrio alcoholovorans sp. nov., a sulfate-reducing
bacterium able to grow on glycerol, 1,2- and 1,3-propanediol. Arch Microbiol 155,143-148.

40
 Introduction

Ragsdale, S. W. (1991). Enzymology of the acetyl-CoA pathway of CO2 fixation. Crit Rev Biochem Mol Biol
26,261-300.
Rees, G. N., Grassiam, G. S., Sheehy, A. J., Dwivedi, P. P. & Patel, B. K. C. (1995). Desulfacinum
infernum gen. nov., sp. nov., a thermophilic sulfate-reducing bacterium from a petroleum reservoir.. Int J
Syst Bacteriol 45,85-89.
Reis, M. A. M., Almeida, J. S., Lemos, P. C. & Carrondo, M. J. T. (1992a). Effect of hydrogen sulfide on
growth of sulfate reducing bacteria. Biotechnol Bioeng 40,593-600.
Reis, M. A. M., Lemos, P. C., Almeida, J. S. & Carrondo, M. J. T. (1992b). Evidence for the intrinsic
toxicity of H2S to sulphate reducing bacteria. Appl Microbiol Biotechnol 36,145-147.
Rintala, J. & Lettinga, G. (1992). Effects of temperature elevation from 37 to 55°C on anaerobic treatment
of sulphate rich acidified wastewaters. Environ Technol 13,801-812.
Rivard, C. J. & Smith, P. H. (1982). Isolation and charcaterization of a thermophilic marine methanogenic
bacterium, Methanogenium thermophilim sp. nov. Int J Syst Bacteriol 32,430-436.
Rosnes, J. T., Torsvik, T. & Lien, T. (1991). Spore-forming thermophilic sulfate-reducing bacteria isolated
from North Sea oil field waters. Appl Environ Microbiol 57,2302-2307.
Rozanova, E. P. & Khudyakova, A. I. (1974). A new nonspore-forming thermophilic sulfate-reducing
organism Desulfovibrio thermophilus nov. sp. Mikrobiologiya 43,908-912.
Rozanova, E. P. & Pivovarova, T. A. (1988). Reclassification of Desulfovibrio thermophilus (Rozanova,
Khudyakova, 1974). Mikrobiologiya 57,102-106.
Rozanova, E. P., Tourova, T. P., Kolganova, T. V., Lysenko, A. M., Mityushina, L. L., Yusupov, S. K. &
Belyaev, S. S. (2001). Desulfacinum subterraneum sp nov., a new thermophilic sulfate-reducing
bacterium isolated from a high-temperature oil field. Microbiology 70,466-471.
Savage, M. D. & Drake, H. L. (1986). Adaptation of the acetogen Clostridium thermoautotrophicum to
minimal medium. J Bacteriol 165,315-318.
Schmidt, J. E. & Ahring, B. K. (1993). Effects of hydrogen and formate on the degradation of propionate
and butyrate in thermophilic granules from an upflow anaerobic sludge blanket reactor. Appl Environ
Microbiol 59,2546-2551.
Schnell, S., Bak, F. & Pfennig, N. (1989). Anaerobic degradation of aniline and dihydroxybenzens by newly
isolated sulfate-reducing bacteria and description of Desulfobacterium anilini. Arch Microbiol 152,556-
563.
Schnürer, A., Schink, B. & Svensson, B. H. (1996). Clostridium ultunense sp nov., a mesophilic bacterium
oxidizing acetate in syntrophic association with a hydrogenotrophic methanogenic bacterium. Int J Syst
Bacteriol 46,1145-1152.
Schönheit, P., Moll, J. & Thauer, R. K. (1980). Growth parameters (Ks, µmax, Ys) of Methanobacterium
thermoautotrophicum. Arch Microbiol 127,59-65.
Selvaraj, P. T., Little, M. H. & Kaufmann, E. N. (1997). Analysis of immobilized cell bioreactors for
desulfurization of flue gases and sulfite/sulfate-laden wastewater. Biodegradation 8,227-236.
Serrano, M., Zilhao, R., Ricca, E., Ozin, A. J., Moran, C. P. J. & Henriques, A. O. (1999). A Bacillus
subtilis secreted protein with a role in endospore coat assembly and function. J Bacteriol 181,3632-3643.
Setlow, P. (1994). Mechanism which contributes to the long-term survival of spores of Bacillus species. J
Appl Bacteriol 76,49S-60S.
Sievert, S. M. & Kuever, J. (2000). Desulfacinum hydrothermale sp. nov., a thermophilic sulfate-reducing
bacterium from geothermally heated sediments near Milos Island (Greece). Int J Syst Evol Microbiol
50,1239-1246.
Sillén, L. G. & Martell, A. E. 1964. Stability constants of metal-ion complexes. The Chemical Society,
Burlington House.
Sonne-Hansen, J. & Ahring, B. K. (1999). Thermodesulfobacterium hveragerdense sp. nov., and
Thermodesulfovibrio islandicus sp. nov., two thermophilic sulfate-reducing bacteria isolated from a
Icelandic hot spring. Syst Appl Microbiol 22,559-564.
Sonne-Hansen, J., Westermann, P. & Ahring, B. K. (1999). Kinetics of sulfate an hydrogen uptake by the
thermophilic sulfate-reducing bacteria Thermodesulfobacterium sp. Strain JSP and Thermodesulfovibrio
sp. strain R1Ha3. Appl Environ Microbiol 65,1304-1307.
Speece, R. E. (1996). Anaerobic biotechnology for industrial wastewaters. Archae Press, Nashville, USA.
Stackebrandt, E., Sproer, C., Rainey, F. A., Burghardt, J., Pauker, O. & Hippe, H. (1997). Phylogenetic
analysis of the genus Desulfotomaculum: Evidence for the misclassification of Desulfotomaculum
guttoidem and description of Desulfotomaculum orientis as Desulfosporosinus orientis gen. nov., comb.
nov. Int J Syst Bacteriol 47,1134-1139.

41
Chapter 1

Stetter, K. O. (1988). Archaeoglobus fulgidus gen. nov., sp. nov. a new taxon of extremely thermophilic
archaea. Syst Appl Microbiol 13,24-28.
Stetter, K. O., Fiala, G., Huber, G., Huber, R. & Segerer, A. (1990). Hyperthermophilic microorganisms.
FEMS Microbiol Rev 75,117-124.
Stetter, K. O., Huber, R., Bloechl, E., Kurr, M., Eden, R. D., Fiedler, M., Cash, H. & Vance, I. (1993).
Hyperthermophilic archaea are thriving in deep North Sea and Alaskan oil reservoirs. Nature 365,743-
745.
Stubner, S. & Meuser, K. (2000). Detection of Desulfotomaculum in an Italian rice paddy soil by 16S
fribosomal nucleic acid analyses. FEMS Microbiol Ecol 34,73-80.
Stucki, G., Hanselmann, K. W. & Hürzeler, R. A. (1993). Biological sulfuric acid transformation: reactor
design and process optimization. Biotechnol Bioeng 41,303-315.
Stüpperich, E. & Konle, R. (1993). Corrinoid-dependent methyl transfer reactions are involved in methanol
and 3,4-dimethoxybenzoate metabolism by Sporomusa ovata. Appl Environ Microbiol 59,3110-3116.
Stüpperich, E., Eisinger, H. & Kräutler, B. (1988). Diversity of corrinoids in acetogenic bacteria. J Biochem
172,459-464.
Szewzyk, R. & Pfennig, N. (1987). Complete oxidation of catechol by the strictly anaerobic sulfate-reducing
Desulfobacterium catecholicum. Arch Microbiol 147,163-168.
Takai, K., Inoue, A. & Horikoshi, K. (2002). Methanothermococcus okinawensis sp. nov., thermophilic,
methaneproducing archaeon isolated from a Western Pacific deep-sea hydrothermal vent system. Int J
Syst Evol Microbiol 52,1089-1095.
Tasaki, M., Kamagata, Y., Nakamura, K. & Mikami, E. (1991). Isolation and characterization of a
thermophilic benzoate degrading, sulfate-reducing bacterium, Desulfotomaculum thermobenzoicum sp.
nov. Arch Microbiol 155,348-352.
Taylor, G. T. & Pirt, S. J. (1977). Nutrition and factors limiting growth of a methanogenic bacterium
(Methanobacterium thermoautotrophicum). Arch Microbiol 113,17-22.
Thauer, R. K. (1990). Energy metabolism of methanogenic bacteria. Biochim Biophys Acta 1018,256-259.
Thauer, R. K., Jungermann, K. & Decker, K. (1977). Energy conservation in chemotrophic anaerobic
bacteria. Bacteriol Rev 41,100-180.
Touzel, J.-P., Petroff, D. & Albagnac, G. (1985). Isolation and characterization of a new thermophilic
Methanosarcina, the strain CHTI 55. Syst Appl Microbiol 6,66-71.
Touzel, J.-P., Conway de Macario, E., Nolling, J., De Vos, W. M., Zhilina, T. N. & Lysenko, A. M. (1992).
DNA relatedness among some thermophilic members of the genus Methanobacterium: emendation of the
species Methanobacterium thermoautotrophicum and rejection of the Methanobacterium
thermoformicicum as a synonym of Methanobacterium thermoautotrophicum. Int J Syst Bacteriol 42,408-
411.
Uberoi, V. & Bhattacharya, S. K. (1995). Interactions among sulfate reducers, acetogens, and
methanogens in anaerobic propionate systems. Wat Environment Res 67,330-339.
Van der Meijden, P. C., Van der Drift, C. & Vogels, G. D. (1984a). Methanol conversion in Eubacterium
limosum. Arch Microbiol 38,360-364.
Van der Meijden, P. C., Heythuysen, H. J., Sliepenbeek, H., Houwen, C., Van der Drift, C. & Vogels, G.
D. (1984b). Activation and inactivation of methanol: 2-mercaptoethanesulfonic acid methyltransferase
from Methanosarcina barkeri. J Bacteriol 153,6-11.
Van Houten, R. T., Hulshoff Pol, L. W. & Lettinga, G. (1994). Biological sulphate reduction using gas-lift
reactors fed with hydrogen and carbon dioxide as energy and carbon source. Biotechnol Bioeng 44,586-
594.
Van Houten, R. T., Yun, S. Y. & Lettinga, G. (1997). Thermophilic sulphate and sulphite reduction in lab-
scale gas-lift reactors using H2 and CO2 as energy and carbon source. Biotechnol Bioeng 55,807-814.
Van Houten, R. T., van der Spoel, H., Van Aelst, A., Hulshoff Pol, L. W. & Lettinga, G. (1995). Biological
sulphate reduction using synthesis gas as energy and carbon source. Biotechnol Bioeng 50,136-144.
Van Rijssel, M., Van der Veen, I. & Hansen, T. A. (1992). A lithotrophic Clostridium strain with extremely
thermoresistant spores isolated from a pectin-limited continuous culture of Clostridium
thermosaccharolyticum strain Haren. FEMS Microbiol Lett 91,171-176.
Visser, A. (1995). The anaerobic treatment of sulfate containing wastewaters. PhD thesis. Wageningen
Agricultural University, Wageningen, The Netherlands.
Visser, A., Gao, Y. & Lettinga, G. (1992). Anaerobic treatment of synthetic sulfate-containing wastewater
under thermophilic conditions. Wat. Sci. Techn. 25,193-202.
Visser, A., Gao, Y. & Lettinga, G. (1993). Effects of short-term temperature increases on the mesophilic
anaerobic breakdown of sulfate containing synthetic wastewater. Wat Res 27,541-550.

42
 Introduction

Vonck, J., Arfman, N., De Vries, G. E., Van Beeumen, J., Van Bruggen, E. F. J. & Dijkhuizen, L. (1991).
Electron microscopic analysis and biochemical characterization of a novel methanol dehydrogenase from
the thermotolerant Bacillus sp. C1. J Biol Chem 266,3949-3954.
Warth, A. D. (1978). Relationship between heat resistance of spores and the optimum and maximum growth
temperatures of Bacillus species. J Bacteriol 134,699-705.
Wasserfallen, A., Nölling, J., Pfister, P., Reeve, J. & Conway de Macario, E. (2000). Phylogenetic
analysis of 18 thermophilic Methanobacterium isolates supports the proposal to create a new genus,
Methanothermobacter gen. nov., and to reclassify several isolates in three species, Methanothermobacter
thermoautotrophicus comb. nov., Methanothermobacter wolfeii comb. nov., and Methanothermobacter
marburgensis sp. nov. Int J Syst Evol Microbiol 50,43-53.
Weijma, J. (2000). Methanol as electron donor for thermophilic biological sulfate and sulfite reduction. PhD
thesis. Wageningen University, Wageningen, The Netherlands.
Whitman, W.B. (2001). Genus II Methanothermococcus gen. nov. In Bergeys Manual of Systematic
Bacteriology, 2nd. edn, vol. 1 (The Archaea and the Deeply Branching and Phototrophic Bacteria), pp.
241-242. Edited by D.R. Boone, R.W. Castenholz & G.M. Garrity. New York. Springer
Widdel, F. (1988). Microbiology and ecology of sulphate- and sulphur-reducing bacteria, p. 469-586. In A. J.
B. Zehnder (ed.), Biology of Anaerobic Microorganisms. Wiley & Sons, New York.
Widdel, F. & Bak, F. (1992). Gram-negative mesophilic sulfate-reducing bacteria, p. 3352-3378. In A.
Balows, H. G. Trüper, M. Dworkin, W. Harder and K.-H. Schleifer (eds.), The Prokaryotes, 2nd. edn.
Springer-Verlag, New York.
Widdel, F. & Hansen, T. A. (1992). The dissimilatory sulfate- and sulfur-reducing bacteria, p. 583-624. In A.
Balows, H. G. Trüper, M. Dworkin, W. Harder and K.-H. Schleifer (eds.), The Prokaryotes, 2nd. edn.
Springer-Verlag, New York.
Wiegel, J. (1986). Methanol utilization by thermophilic homoacetogens, p. 18, Annu. Meet. SEB-ASM,
Birmingham, AL.
Wiegel, J. & Garrison, R. (1985). Utilization of methanol by Clostridium thermoaceticum. Annu Meet Am
Soc Microbiol, Abstract I115.
Wiegel, J., Braun, M. & Gottschalk, G. (1981). Clostridium thermoautotrophicum species novum, a
thermophile producing acetate from molecular hydrogen and carbon dioxide. Curr Microbiol 5,255-260.
Winter, J., Lerp, C., Zabel, H.-P., Wildenauer, F. X., König, H. & Schindler, F. (1984). Methanobacterium
wolfeii sp. nov., a new tungsten requiring, thermophilic, autotrophic methanogen. Syst Appl Microbiol
5,457-466.
Winters, D. K. & Ljungdahl, L. G. 1989. PQQ-dependent methanoldehydrogenase from Clostridium
thermoautotrophicum, p. 35-39. In J. A. Jongejan and J. A. Duine (eds.), PQQ and quinoproteins. KLuwer
Academic Publishers, Dordrecht.
Yamaguchi, M., Minami, K., Tanimoto, Y. & Okamura, K. (1989). Effects of volatile fatty acids on
methanogenesis of methanol and pregrowth with methanol on acetate utilization by methanogens. J Ferm
Bioeng 68,428-432.
Zabel, H.-P., Konig, H. & Winter, J. (1984). Isolation and characterization of a new coccoid methanogen,
Methanogenium tatii spec. nov. from a solfataric field on Mount Tato. Arch Microbiol 137,308-315.
Zeikus, J. G. & Wolfe, R. S. (1972). Methanobacterium thermoautotrophicum sp. nov., an anaerobic,
autotrophic extreme thermopile. J Bacteriol 109,707-713.
Zeikus, J. G., Kerby, R. & Krzycki, J. A. (1984). Single-carbon chemistry of acetogenic and methanogenic
bacteria. Science 227,1167-1173.
Zhao, Y., Yang, H., Boone, D. R. & Mah, R. A. (1986). Isolation and characterization of a fast growing,
thermophilic Methanobacterium species. Appl Environ Microbiol 52,1227-1229.
Zhilina, T. N. (1986). Methanogenic bacteria from hypersaline environments. Syst Appl Microbiol 7,216-222.
Zhilina, T. N. & Ilarianov, S. A. (1984). Characteristics of formate-assimilating methane bacteria and
description of Methanobacterium thermoformicicum sp. nov. Microbiology 53,785-790.
Zhilina, T. N. & Zavarzin, G. A. (1987). Methanohalobium evestigatum gen. nov. sp. nov., extremely
halophilic methane producing archaebacteria. Dokl Akad Nauk SSSR 311,464-46x.
Zinder, S. H. (1990). Conversion of acetic acid by to methane by thermophiles. FEMS Microbiol Rev 75,125-
138.
Zinder, S. H. & Mah, R. A. (1979). Isolation and characterization of a thermophilic strain of Methanosarcina
unable to use H2-CO2 for methanogenesis. Appl Environ Microbiol 38,996-1008.
Zinder, S. H. & Koch, M. (1984). Non-aceticlastic methanogenesis from acetate: acetate oxidation by a
thermophilic syntrophic co-culture. Arch Microbiol 54,263-272.

43
Chapter 1

Zinder, S. H., Anguish, T. & Cardwell, S. C. (1984a). Effects of temperature on methanogenesis in a

thermophilic (58 oC) anaerobic digestor. Appl Environ Microbiol 47,808-813.
Zinder, S. H., Cardwell, S. C., Anguish, T. & Lobo, A. L. (1984b). Methanogenesis in a thermophilic (58
°C) anaerobic digestor: Methanothrix sp. as an important acetoclastic methanogen. Appl Environ
Microbiol 47,796-807.
Zinder, S. H., Sowers, K. R. & Ferry, J. G. (1985). Methanosarcina thermophila sp. nov., a thermophilic
acetotrophic, methane-producing bacterium. Int J Syst Bacteriol 35,522-523.
Zinder, S. H., Anguish, T. & Lobo, A. L. (1987). Isolation and characterization of a thermophilic
acetotrophic strain of Methanothrix. Arch Microbiol 146,315-322.

44
 2
Methanol degradation in
defined mixed cultures of
thermophilic anaerobes
in the presence of sulfate

Heleen P. Goorissen, Alfons J. M. Stams, and Theo A. Hansen

In continuous culture experiments the possible conversions performed by a

microbial population of a sulfidogenic, thermophilic bioreactor fed with methanol
were studied. Mixed cultures of selected organisms were used, representing the
different pathways followed by various trophic groups of microorganisms.
Assuming Monod-type growth kinetics, the substrate coefficient, Ks, and the
specific growth rate, µmax, are of crucial importance in the prediction of which
bacterial population will become predominant. Moreover, substrate competition will
be highly affected by the sensitivity of the organisms to sulfide. Aggregation, which
is an important characteristic in bioreactor systems, was not taken into account in
our experiments. Our results show that direct competition for methanol between a
homoacetogen (Moorella thermoautotrophica) and a sulfate reducer is in favor of
the sulfate reducer (Desulfotomaculum kuznetsovii) due to its affinity for methanol.
Methanogenesis as a result of hydrogen transfer between D. kuznetsovii and a
hydrogen consuming methanogenic archaeon (Methanothermobacter thermo-
autotrophicus) occurred only below 5 mM total sulfide. A similar result was obtained
when M. thermoacetica was grown on methanol in the presence of Mb. thermo-
autotrophicus.
Interestingly, D. kuznetsovii could coexist with a non-methanol utilizing
sulfate reducer (Thermodesulfovibrio species). Our data show that it is possible to
maintain a dominant sulfate-reducing process with methanol as electron donor at
60 °C in mixed continuous cultures.

Submitted for publication

Chapter 2

Introduction
Methanol is a suitable substrate for the removal of inorganic sulfur compounds from off-
gases in anaerobic bioreactors operated at 60 °C or higher (Weijma, 2000). Under thermophilic
conditions, methanol can be used by several groups of microorganisms. The presence of sulfate in
the reactor leads to sulfide production with concomitant conversion of methanol to CO2 by sulfate-
reducing bacteria. Homoacetogens can use methanol in the presence of CO2 for the production of
acetate or butyrate. Direct methanogenesis from methanol has not been observed at this
temperature. However, methanogens can play a role as hydrogen scavengers in a syntrophic
association with methanol utilizers. Theoretically, in a sulfidogenic process methanol might be used
directly as electron donor by sulfate-reducing bacteria, or indirectly via the combined activities of
microorganisms. The conversion of methanol to sulfate is energetically a more favorable process
than the production of methane or acetate from methanol. Thus, in the absence of an external
electron acceptor, the formation of methane is more favourable than acetate formation. The
conversion of methanol to H2/CO2 is only energetically favorable at low hydrogen concentrations
and therefore depends upon syntrophic hydrogen utilization (for free Gibbs energy yields per
reaction, see Table 2.1). Very little is known about thermophilic syntrophic methanol degradation.
To our knowledge only two thermophilic sulfidogenic syntrophic associations with methanol have
been described and partially characterized. Davidova & Stams (1996) enriched a stable
thermophilic sulfate reducing culture from granular sludge of a methanogenic bench-scale reactor.
Methanol was degraded syntrophically to acetate, H2/CO2 and formate by a homoacetogen. The
isolated syntrophic sulfate-reducer was unable to use methanol, but could use hydrogen and
formate as growth substrates. This strain was not fully characterized, but will be referred to as
”Thermodesulfovibrio species” in this paper. Another syntrophic association with methanol was
obtained from a sulfidogenic EGSB reactor operated with methanol at 65 °C (Weijma, 2000). In this
reactor, methanol degrading Desulfotomaculum species were present, but part of the methanol
was uitlized by other species. Recently, a methanol degrader from this reactor was characterized
as a Thermotoga species, Thermotoga lettingae (Balk, et al., 2002) This strain degrades methanol
slowly, but degradation rates increased by the addition of thiosulfate or a methanogen. T. lettingae
was also able to grow on methanol in coculture with, Thermodesulfovibrio yellowstonii.
Here, we report for the first time on the kinetics of syntrophic interactions in defined
cocultures of a methanol utilizing thermophilic sulfate-reducer Desulfotomaculum kuznetsovii and a
hydrogenotrophic methanogenic archaeon or another sulfate reducer.

Table 2.1. Reactions and related reactions possibly involved in the anaerobic degradation of methanol.
Gibbs free energy changes are calculated from Thauer et al. (1977)

Reaction ∆G º’ (kJ/reaction)
4 CH3OH + 3 SO4 2- → 4 HCO3- + 3 HS- + H+ -364.4
CH3OH + HSO3 -→ HCO3- + HS- + H2O + H+ -108.8
4 CH3OH + 2 HCO3- → 3 CH3COO- + H+ + 4 H2O -221.6
CH3COO- + SO4 2- → 2 HCO3- + HS- -47.6
CH3OH + 2 H2O → HCO3- + 3 H2 + HS- +23.0
4 H2 + SO4 2- + H+ → HS- + H2O -151.9
4 CH3OH → 3 CH4 + HCO3- + H2O + H+ -314.6
CH3COO- + H2O → HCO3- + CH4 -31.0
4H2 + HCO3- + H+ → CH4 + 3 H2O -135.6

46
 Mixed cultures

Materials and methods

Strains. Desulfotomaculum kuznetsovii (DSM 6115) and Moorella thermoautotrophica (DSM 1974)
were obtained from the Deutsche Sammlung für Mikroorganismen (DSMZ, Braunschweig,
Germany). Methanothermobacter thermoautotrophicus (formerly Methanobacterium
thermoautotrophicum ∆H) (DSM 1053) was kindly provided by J.T. Keltjens (University of
Nijmegen, The Netherlands). The Thermodesulfovibrio species originated from an enrichment
culture from Davidova & Stams (1996).

Media and cultivation. A bicarbonate buffered basal medium was used containing (g/L): NaCl (7),
NaHCO3 (4), Na2SO4 (2.8), MgCl2⋅6H2O (1.2), KCl (0.5), NH4Cl (0.3), KH2PO4 (0.2), CaCl2 (0.15),
Na2S⋅7-9H2O (0.3). Additions were made from anoxic stock solutions and per liter of medium were
added: 0.5 ml vitamin solution according to Stams et al. (1983) 1 g yeast-extract, 1 ml trace-
element solution SL 6 according to Pfennig & Lippert (1966), and 2 mM acetate as carbon source
(if required). Filter sterilized methanol (20 mM, final concentration, or 30 mM in sulfate limiting
experiments) was added from anoxic stock solution. Prior to inoculation the gasphase in the
headspace was replaced by N2/CO2 (80%/20%). Bottles were closed with butylrubber stoppers and
aluminum caps. In all experiments anaerobic cultivation techniques were used.

Continuous culture experiment. Continuous culture experiments were carried out in a 2.5 L
Bioflow III fermentation vessel (New Brunswick Sc., Edison NJ) with a 1 L working volume. The
reactor, pH probes, and all associated tubing and drip tubes were autoclaved for 30 min at 121 °C
prior to use. All tubing connections were made with glass connectors (male-female), and all parts
that needed to be connected after autoclaving were wrapped in aluminum foil to maintain sterility.
Tubings in the vessel, the headplate and the vessel bottom were made of high-grade stainless
steel (RMS). All tubings outside the vessel were made of butylrubber or marprene. During the
fermentation the working volume was maintained with a tube at a fixed height, providing overflow
of the culture medium in a sterilized 20 L effluent vessel, thereby maintaining constant level. The
culture was stirred at 100 rpm during operation and a New Brunswick Sc. (Edison, NJ) motor and
speed controller were used to maintain the speed of the stainless steel impeller. Temperature was
maintained at 60 °C by constantly circulating water through the round-bottomed-water-jacketed
vessel. The pH was maintained at 7.5 by addition of 0.1 M sodium hydroxide to the fermentation by
a single speed peristaltic pump (Watson-Marlow Bredel, Falmouth, UK). Autoclavable pH probes
(Ingold, Mettler Toledo AG, Urdorf, Switzerland) suitable for applications with high sulfide
concentrations were connected through the headplate. Culture medium was pumped through a
drip tube connected to the headplate to prevent backgrowth of the culture medium. To control the
substrate flow rates, Watson-Marlow pumps (Watson Marlow Bredel, Falmouth, UK) were used.
The feed carboy was maintained under slight overpressure with N2/CO2 that had passed through a
sterilized filter. Samples for analyses were taken with nitrogen flushed syringes through a
bytulrubber septum in the headspace. Cultures were supposed to be in a steady state after five
volume changes. After every experiment with D. kuznetsovii all butylrubber tubings, filters and
Teflon parts were replaced by new ones.

Analytical procedures. Culture optical density was determined in a Starcoll colorimeter (R&D
Mechatronics) at a wavelength of 660 nm. All optical density measurements were made
immediately after sampling and samples were diluted in medium if necessary. Cells in culture
samples were counted using a Bürker-Türk counting chamber. Methanol, methane, and fatty acids
were analyzed by GC as described previously (Heijthuysen & Hansen, 1989). Sulfide was
determined colorimetrically using the methylene blue method (Trüper & Schlegel, 1064).

47
Chapter 2

Results

Direct competition for methanol

Desulfotomaculum kuznetsovii and Moorella thermoautotrophica.

D. kuznetsovii cells obtained from batch cultures grown on methanol/sulfate/yeast extract,
washed in medium and pre-incubated at 60 ºC did not convert methanol, despite the use of strict
anaerobic techniques throughout the manipulations. Therefore, methanol conversion kinetics of D.
kuznetsovii were determined in a methanol limited continuous culture. At steady state
(D = 0.022 h-1) the methanol concentration was below the detection limit (below 100 µM). The
medium flow was stopped when steady state was reached and methanol (20 mM) was added.
Product formation and substrate consumption were followed in time (Fig. 2.1). Methanol
consumption occurred at a rate of approximately 170 nmol min-1 mg protein-1. The apparent Km
value for D. kuznetsovii was approximately 1 mM as calculated from the substrate depletion curve.

20
18
16
Concentration (mM)

14
12
10
8
6
4
2
0
0 10 20 30 40 50 60
Time (h)

Figure 2.1. Methanol consumption in a steady state culture of D. kuznetsovii.

Symbols: !, methanol; ", sulfide

Due to contamination of our fermentors with extremely heat resistant D. kuznetsovii spores,
we were not able to grow M. thermoautotrophica as a pure culture in the chemostat. When D.
kuznetsovii and M. thermoautotrophica were grown together in a methanol limited continuous
culture, the competition for the substrate resulted in a dominancy of the sulfate-reducing process
(Fig. 2.2). A fermentor was inoculated with 4% of fresh cultures from both organisms, pregrown on
methanol. After a batch phase of 88 hours, medium supply was turned on. A few mmoles of
acetate were produced, but at steady state no acetate was detectable anymore. Steady state
cultures at a dilution rate of 0.02 h-1 with 20 mM methanol in the medium reservoir, contained 0.6
mM methanol. Microscopic examination of the steady state culture revealed that D. kuznetsovii

48
 Mixed cultures

was the dominant microorganism in the fermentor. In batch cultures, growth on acetate by D.
kuznetsovii is poor, yielding cultures with lower optical densities compared to the mixed culture
(results not shown). These observations strongly suggest that sulfate reduction occurred directly
from methanol and not indirectly via acetate. Sulfide toxicity experiments in batch culture revealed
that sulfide did not inhibit growth of both organisms at concentrations below 10 mM. Because the
sulfide concentration in the fermentor was kept below 10 mM, and because the culture was
methanol limited, the affinity for methanol was considered to be the crucial parameter in the
competition process.

25

20
Concentration (mM)

15

10

0
0 50 100 150 200
Time (h)

Figure 2.2. Competition for methanol between D. kuznetsovii and M. thermoautrophica.

Symbols: !, methanol; ", sulfide; #, acetate

Syntrophic growth

Desulfotomaculum kuznetsovii and Methanothermobacter thermoautotrophicus.

Syntrophic growth on methanol was observed when D. kuznetsovii was cultivated together
with Mb. thermoautotrophicus in a sulfate limited culture with sulfide concentrations below 5 mM,
as well as in a methanol limited culture. A sulfate limited culture of D. kuznetsovii was inoculated at
t = 7 with 10% of a culture of Mb. thermoautotrophicus pregrown on H2/CO2 (Fig. 2.3a). When the
sulfide concentration was reduced due to sparging with N2 (from t = 6), methane was produced as
soon as the sulfide concentration was lowered to 5 mM. In a methanol limited culture (Fig. 2.3b)
the methanogen still drives the sulfate reducer to hydrogen transfer, even if methanol
concentrations were below 0.5 mM. Mb. thermoautotrophicus is unable to use methanol and can
produce methane only with H2/CO2. However, when high sulfide concentrations (above 10 mM)
were applied, no methane was produced anymore. The toxicity of sulfide seems to be an important
parameter to suppress the methane production. To examine whether methane production could be
suppressed irreversibly, sulfide pulses were applied to a sulfate-limited steady state coculture of D.
kuznetsovii and Mb. thermoautotrophicus (fig. 2.3c). It was observed that after an extra supply of
sulfide to a concentration of 10 mM, methane production did not return. Whereas after a sulfide
pulse resulting in a sulfide concentration of 7 mM, methane production returned to the steady state
level within 5 hours.

49
Chapter 2

14

12
Concentration (mM)

10

0
0 2 4 6 8 10 12 14 16
Time (h)

Figure 2.3a. Sulfate limited culture of D. kuznetsovii and Mb. thermoautotrophicus at low sulfide
concentration. Arrow indicates inoculation with Mb. thermoautotrophicus.
Symbols: !, methanol; ", sulfide; #, methane

14

12
Concentration (mM)

10

0
0 4 8 12 16
Time (h)

Figure 2.3b. Methanol limited culture of D. kuznetsovii and Mb. thermoautotrophicus at low sulfide
concentration. Symbols: !, methanol; ", sulfide; #, methane

50
 Mixed cultures

14

12
Concentration (mM)

10

0
0 3 6 9 12 15 18
Time (h)

Figure 2.3c. Steady state culture of D. kuznetsovii and Mb. thermoautotrophicus under sulfate limiting
conditions. At t = 1 en t= 11 extra sulfide was added.
Symbols: !, methanol; ", sulfide; #, methane

Desulfotomaculum kuznetsovii and the Thermodesulfovibrio species.

Under methanol limitation a stable, mixed culture of two sulfate reducers was achieved with
sulfide concentrations up to 12 mM. Although D. kuznetsovii was the dominant organism in this
culture during a steady state, Thermodesulfovibrio-like cells remained at a constant low level
(results not shown).

Moorella thermoautotrophica and theThermodesulfovibrio species.

Because we were not able to grow M. thermoautotrophica without D. kuznetsovii in a
chemostat, we performed batch culture experiments to gain more insight into whether methanol
could be used for sulfidogenesis syntrophically. To an exponentially growing acetogenic culture (20
mM methanol) of M. thermoautotrophica, 20 mM sulfate was added. The pH of this culture was
adjusted to 7.0 with NaOH, followed by inoculation of the culture with 4%(v/v) of the
Thermodesulfovibrio species. After incubation, 7 mM sulfide was produced. In a control experiment
with M. thermoautotrophica growing on methanol and sulfate, sulfide was not produced and
acetogenesis continued till the substrate was converted completely. The sulfide production in the
coculture must be attributed to activity of the Thermodesulfovibrio species growing syntrophically
with M. thermoautotrophica.

Competition for hydrogen

Desulfotomaculum kuznetsovii, Methanothermobacter thermoautotrophicus, and the
Thermodesulfovibrio species.
A coculture of D. kuznetsovii and Mb. thermoautotrophicus was grown under sulfate
limitation and with a constant sulfide concentration of 5 mM. Mb. thermoautotrophicus produced 3
mM methane due to syntrophic growth. After a steady state was achieved, the coculture was
inoculated with the Thermodesulfovibrio species at t = 2. Methane production ceased and
Thermodesulfovibrio-like cells were detectable in the culture at constant low level after 12 hours of
growth (Fig. 2.4). Both at low and at high sulfide concentrations (12 mM), a stable sulfidogenic
culture of two sulfate reducers was obtained. These observations were confirmed in batch culture

51
Chapter 2

experiments. A methanogenic culture of Mb. thermoautotrophicus growing on H2/CO2 inoculated

with a Thermodesulfovibrio species culture pregrown on H2/CO2, produced 8 mM sulfide instead
and no more methane.

6 30

5 25

Number of cells (10 /ml)

Concentration (mM)

8
4 20

3 15

2 10

1 5

0 0
0 2 4 6 8 10 12 14 16
Time (h)

Figure 2.4. Sulfate limited culture of D. kuznetsovii, Mb. thermoautotrophicus, and the
Thermodesulfovibrio species at low sulfide concentration.
Symbols: !, methanol; ", sulfide; #, methane; $, D. kuznetsovii; +, Thermodesulfovibrio
species

Discussion
The direct competition for methanol during methanol limitation between D. kuznetsovii and
M. thermoautotrophica resulted in a dominance of the sulfate reducer. If we assume the ratio
µmax/Ks to be a useful parameter for comparing growth properties of microorganisms on a
common substrate, this ratio should be higher for D. kuznetsovii than for M. thermoautotrophica.
The µmax on methanol of M. thermoautotrophica is almost twice as high as the µmax of D.
kuznetsovii. Thus, the half-saturation constant for methanol of M. thermoautotrophica may be
assumed to be less than 0.5 mM. At high methanol concentrations, the outcome of the competition
may be reverse, due to the higher specific growth rate of M. thermoautotrophica.
Syntrophic growth of D. kuznetsovii and Mb. thermoautotrophicus suggests a central role
for hydrogen in the transfer of reducing equivalents, as the methanogen uses only hydrogen as
energy substrate. Hydrogen transfer to sulfate reducing bacteria was more pronounced than to
methanogens, probably due to differences in affinity, half-saturation constants (Ks) and sulfide
toxicity. This has also been observed in disintegrated granules from moderately thermophilic UASB
reactors. The addition of hydrogen utilizing sulfate reducing bacteria (Desulfotomaculum species)
resulted in a higher the degradation rate of volatile fatty acids in the granules than the addition of
comparable numbers of hydrogen utilizing methanogens (Methanothermobacter thermo-
autotrophicus) (Schmidt & Ahring, 1993). Our mixed culture experiment with D. kuznetsovii, Mb.
thermoautotrophicus, and the Thermodesulfovibrio species confirm these findings.
Hydrogen sulfide concentrations as low as 3.3 mM are already inhibitory for
Desulfotomaculum species (Min & Zinder, 1990). However, for sulfate reducing bacteria it is
observed that sulfide inhibition is reversible (Okabe et al., 1995): complete inhibition occured at an
H2S concentration as high as 16.1mM (Reis et al., 1992). In our experiments with D. kuznetsovii
concentrations up to 15 mM H2S had little effect on the specific growth rate (results not shown). A
decrease of 20 % of the specific growth rate was observed at an H2S concentration of 20 mM. On

52
 Mixed cultures

the contrary, our experiments showed that sulfide toxicity for methanogenic archaea is irreversible.
Uncoupling of growth and activity was not observed for Mb. thermoautotrophicus. Visser (1995)
showed that a 50% decrease of activity was observed for hydrogenotrophic methanogenesis in
methanogenic sludge granules at a concentration of 10 mM sulfide. The high sulfide
concentrations (> 30mM) applied in anaerobic bioreactors for the biological desulfurization process
(Weijma, 200) guarantee a complete inhibition of methanogenesis by Methanothermobacter
species.
The coexistence of two sulfate reducers in a stable methanol-limited sulfidogenic culture
can be explained by differences in substrate affinity. D. kuznetsovii and the Thermodesulfovibrio
species both can grow on H2/CO2 and/or formate. No yeast extract was present in the growth
medium, thus growth of the Thermodesulfovibrio species was due to a syntrophic interaction with
D. kuznetsovii. Competition for H2/CO2 and/or formate must be in favor of the Thermodesulfovibrio
species apparently due to a higher affinity of the Thermodesulfovibrio species for H2/CO2 and/or
formate compared to D. kuznetsovii.
Substrate competition during syntrophic growth of D. kuznetsovii with Mb. thermo-
autotrophicus and the Thermodesulfovibrio species is in favor of the hydrogenotrophic sulfate
reducer. Experiments were performed at sulfide concentrations not inhibiting the methanogen,
which means that affinity for hydrogen and not toxicity of sulfide is the dominant factor in the
competition for hydrogen. Threshold values for hydrogen in sediments are assumed to be lower for
sulfate reducers than for methanogens (Weijma, 200).
From our experiments it is clear that sulfate reduction with methanol at 60 ºC in defined
mixed cultures of different trophic organisms can be easily maintained. Moreover, competition for
substrates between different sulfate reducers and syntrophic growth of different sulfate reducers
may be more important in anaerobic environments than has been recognized hitherto.
Acknowledgements: We thank Lubbert Dijkhuizen for valuable discussions. This work was supported by
the Technology Foundation (STW) of the Netherlands Organization for Scientific Research (NWO).

References
Balk, M., Weijma, J. & Stams, A. J. M. (2002). Thermotoga lettingae sp. nov., a novel thermophilic
methanol degrading bacterium isolated from a thermophilic anaerobic bioreactor. Int J Syst Evol Microbiol
52,1361-1368.
Davidova, I. A. & Stams, A. J. M. (1996). Sulfate reduction with methanol by a thermophilic consortium
obtained from a methanogenic reactor. Appl Microbiol Biotechnol 46,297-302.
Heijthuijsen, J. H. F. G. & Hansen, T. A. (1989). Betaine fermentation and oxidation by marine
Desulforomonas strains. Appl Environ Microbiol 55,965-969.
Min, H. & Zinder, S. H. (1990). Isolation and characterization of a thermophilic sulfate-reducing bacterium
Desulfotomaculum thermoacetoxidans sp. nov. Arch Microbiol 153,399-404.
Okabe, S., Nielsen, P. H. & Characklis, W. G. (1995). Sulfide product inhibition of Desulfovibrio
desulfuricans in batch and continuous cultures. Wat Res 29,571-578.
Pfennig, N. & Lippert, K. D. (1966). Über das vitamin B12-bedürfnis phototropher Schwefelbakterien. Arch
Microbiol 55,245-256.
Reis, M. A. M., Almeida, J. S., Lemos, P. C. & Carrondo, M. J. T. (1992). Effect of hydrogen sulfide on
growth of sulfate reducing bacteria. Biotechnol Bioeng 40,593-600.
Schmidt, J. E. & Ahring, B. K. (1993). Effects of hydrogen and formate in the degradation of propionate and
butyrate in thermophilic granules from an upflow anaerobic sludge bed reactor. Appl Environ Microbiol
59,2546-2551.
Stams, A. J. M., Veenhuis, M., Weenk, G. H. & Hansen, T. A. (1983). Occurence of polyglucose as a
storage polymer in Desulfovibrio species and in Desulfobulbus propionicus. Arch Microbiol 136,54-59.
Thauer, R. K., Jungermann, K. & Decker, K. (1977). Energy conservation in chemotrophic anaerobic
bacteria. Bacteriol Rev 41,100-180.
Trüper, H. G. & Schlegel, H. G. (1964). Sulphur metabolism inThiorhodaceae I. Quantitative measurements
on growing cells of Chromatium okenii. J Microbiol Ser 30,225-238.
Weijma, J. 2000. Methanol as electron donor for thermophilic biological sulfate and sulfite reduction. PhD
thesis, Wageningen University, Wageningen, The Netherlands.

53
54
 3
Methanol dissimilation in
Desulfotomaculum kuznetsovii

Heleen P. Goorissen, Alfons J. M. Stams, and Theo A. Hansen

The enzymes involved in methanol degradation by Desulfotomaculum

kuznetsovii, a thermophilic, methanol utilizing sulfate reducer were studied. Low
NAD-dependent and dye-linked alcohol dehydrogenase activities were detected with
methanol in cell free extracts of D. kuznetsovii grown on methanol. However,
activities with ethanol as electron donor were 10 times higher. The alcohol
dehydrogenase from D. kuznetsovii was partially purified and characterized.
Methyltransferase activity with tetrahydrofolate as acceptor was not detected. Cells
grown on different alcohols showed different protein patterns on 2D-PAGE,
indicating that the enzymes were induced by methanol. However, we were not able
to isolate solitary spots for N-terminal amino acid sequence determination.
Our results indicate that an alcohol dehydrogenase is active with methanol in
D. kuznetsovii, although activities are low. We cannot conclude if this enzyme is
responsible for methanol oxidation in D. kuznetsovii. However, this is the first report
concerning methanol metabolism in a thermophilic Desulfotomaculum species.
Introduction

Several thermophilic sulfate reducers have been described which can use methanol as
electron donor (Fardeau et al., 1995; Klemps et al., 1985, Weijma, 2000). They all belong to the
genus Desulfotomaculum, and besides methanol, ethanol can be utilized as well. No data on the
pathway of methanol oxidation by thermophilic Desulfotomaculum species are available yet. In
contrast, for mesophilic sulfate reducers of the genus Desulfovibrio, the biochemistry of ethanol
metabolism has been subject of several studies (Hensgens et al., 1993; Kremer et al., 1988).
Certain possibilities exist for the conversion of methanol to CO2. The first step can involve
the oxidation of methanol to formaldehyde. In gram-positive bacteria this reaction is catalyzed by
NAD-dependent or NAD-independent alcohol dehydrogenases. In gram-negative bacteria mainly
NAD(P)-independent ADH’s are found which use PQQ as a typical cofactor. Methanol
dehydrogenases have been found in Bacillus methanolicus (Arfman et al., 1989), Amycolatopsis
methanolica (Duine et al., 1984), and Moorella thermoautotrophica (Winters & Ljungdahl, 1989).
Instead of oxidation of methanol to formaldehyde, the first step in the conversion of methanol may
be the transfer of the methylgroup to an unknown acceptor. A methyltransferase has been shown
to play a role in methyltransfer from methanol in homoacetogens and methanogenic archaea (Van
der Meijden et al., 1984a; Stüpperich & Konle, 1993; Daas et al., 1996). A methyltransferase
involved in the demethylation of dimethylsufoniopropionate has been purified from a sulfate
reducer (Jansen, 2000). However, this enzym was not active with methanol.
In the presence of sulfate, Desulfotomaculum kuznetsovii can use several alcohols,
including methanol as carbon and energy source. Methanol is completely oxidized to CO2 . Here
we describe our attempts to elucidate the nature of the enzymes possibly involved in methanol
oxidation in D. kuznetsovii.

Materials and methods

Analytical procedures. Culture optical density was determined in a Starcoll colorimeter (R&D
Mechatronics) at a wavelength of 660 nm. All optical density measurements were made
immediately after sampling and samples were diluted in medium if necessary. Methanol, ethanol,
methane, and fatty acids were analyzed by GC as described previously (Heijthuijsen & Hansen,
1989). Sulfide was determined colorimetrically using the methylene blue method (Trüper &
Schlegel, 1964). Protein was determined according to Bradford (1976) using the BioRAd reagent
with bovine albumine serum as standard.

Enzyme assays. Enzyme activities were measured spectrofotometrically according to general

procedures of Kremer & Hansen (1987). Assay systems in cuvettes were made anaerobic by
flushing with N2 for at least three minutes and the assay mixture was equilibrated at least five
minutes at 60 ºC.
The dehydrogenation assay mixture contained 50 mM Tris-HCl (pH 9.0), 100 mM methanol
or 10 mM ethanol, and 5 mM NAD. The assay mixture for the reverse reaction contained 50 mM
Tris-HCl (pH 7.5), 2 mM formaldehyde or 2 mM acetaldehyde, and 0.2 mM NADH. The reactions
were started with cell free extract and the formation or disappearence of NADH was recorded at
340 nm. One unit of activity is the amount of enzyme that reduces or oxidizes 1 µmol of NAD or
NADH per min, respectively.
Dye-linked alcohol dehydrogenase actitvities were assayed with 0.07 mM 2,6-
dichlorophenolindophenol (DCPIP; ε600 = 19 mM-1·cm-1) or 1.2 mM 3-(4’,5’-dimethylthiazol-2-yl)-2,4-
diphenyltetrazolium bromide (MTT; ε578 = 13 mM-1·cm-1) in 50 mM Tris-HCl (pH 10) or 50 mM
potassium phosphate (pH 7.5), respectively.

56
 Methanol dissimilation

Methyltransferase assays with 50 mM methanol as a substrate and with tetrahydrofolate as

acceptor were performed according to Jansen & Hansen (1998) with a minor modification: the
incubation temperature of the assay mixture was 60 ºC. Tetrahydrofolate and methyltetra-
hydrofolate were separated by HPLC according to Stüpperich and Konle (1993).

Biochemical methods. Denaturing polyacrylamide gel electrophoresis (12.5% acrylamide) was

done according to Laemmli (1970) with 0.1% sodium dodecyl sulfate. Molecular mass markers
(BioRAD) were myosin, (200.0 kDa), β-galactosidase (116.25 kDa), phosphorylase b (97.4 kDa),
serum albumin (66.2 kDa), ovalbumin (45 kDa), trypsin inhibitor (21.5 Da), lysozyme (14.4 kDa),
aprotinin (6.5 kDa). Proteins were stained with Coomassie Brilliant Blue R-250. Western blotting
was carried out according to Kyhse-Andersen (1984) using a semi-dry electroblotter.
Proteins were separated by two dimensional gel electrophoresis (2D-PAGE) as described by
O’Farrell (1975), with slight modifications. Total protein was visualized by a silver staining
according to Morrisey (1981)

Alcohol dehydrogenase purification. For the enzyme purification, cell free extract was used
immediately after preparation from freshly harvested cells.. All purification steps were performed in
an anaerobic glove box equipped with a palladium catalyst (RO20; BASF. Ludwigshafen,
Germany) and containing an atmosphere of N2/H2 (approximately 95%/5% v/v), to prevent rapid
loss of activity due to aerobiosis. Active fractions were cooled on ice and assayed immediately.
Cell extract (50 ml, 9 mg·ml-1 protein) was loaded onto a Q sepharose fast Flow
(Pharmacia) column (16 by 2.6 cm; cooled to 4 ºC) and equilibrated with 10 mM potassium
phosphate buffer (pH 7.2) at a flow rate of 3.0 ml·min-1. The column was eluted (3.0 ml·min-1) with
a linear gradient of 0 – 0.5 M KCl (200 ml). Activity eluted between 225-300 mM KCl and active
fractions were pooled (41 ml). The Q Sepharose pool was subjected to 40% ammonium sulfate
precipitation by slowly adding ammonium sulfate crystals while gentle stirring at 4 ºC. After 45 min
the suspension was centrifuged (48.000g; 30 min at 4 ºC) and the supernatant was applied to a
butyl sepharose (Pharmacia) column (20 by 1.6 cm) equilibrated with 1 M ammoniumsulfate. The
column was eluted with a linear gradient of 1 to 0.4 M ammoniumsulfate (100 ml) at a flow rate of
2.5 ml·min-1. Active fractions were collected and used for further analysis.

Results and discussion

Extracts of methanol-grown cells did not exhibit any methyltransferase activity with
tetrahydrofolate when methanol was used as a substrate. Addition of ATP did not stimulate the
activity, nor did the addition of NAD(P) or cobalamin. These results indicate that D. kuznetsovii
does not employ a methanol degradation pathway involving methyltransferases. However, it
cannot be excluded that another compound may serve as the methyl acceptor in D. kuznetsovii or
that a different assay system is required.

Table 3.1. Alcohol dehydrogenase activities with methanol or ethanol in cell free extracts
of D. kuznetsovii. Cells were grown on methanol

Cofaktor Specific activity with methanol Specific activity with ethanol

(µmol/min/mg protein) (µmol/min/mg protein)
NAD 0.04 0.4
NADP 0.0a) 0.0
MTT 0.04 0.04
DCPIP 0.05 nm
NMDA 0.0 nm
a) below detection limit; nm, not measured

Alcohol dehydrogenase activities in cell free extracts of D. kuznetsovii cells grown on

methanol were detected with different acceptors (Table 3.1). Dithiothreitol, present in the general

57
assay buffer highly influenced activities and was therefore omitted from the assay buffer. Low
specific activities with methanol and NAD, or MTT, or DCPIP as acceptor could be detected (40
nmol·min-1·mg-1 protein). A lineair correlation between protein concentration and enzyme activities
was observed. However, a five-fold higher activity is necessary to explain the growth rate on
methanol.
Highest activity was found with ethanol as electron donor and NAD as acceptor (400
nmol·min-1·mg-1 protein). In extracts of cells grown on ethanol, the activity with ethanol was
comparable with the activities of methanol grown cells. On the contrary, the activity with methanol
was ten times lower compared to those in methanol grown cells. This highly suggests the
presence of more than one alcohol dehydrogenase involved in alcohol metabolism in D.
kuznetsovii.

From cells grown on ethanol or methanol different SDS Page patterns were observed. (Fig.
3.1). From these patterns we concluded that a 42 kDa protein was induced by growth on methanol.
We tried to isolate this protein by 2-D gelectrophoresis. Several proteins in the 40-100 kDa region
not present in the ethanol or lactate grown cultures were present in the methanol grown cultures.
This was a strong indication for the induction of specific enzymes correlated with methanol
metabolism. However, in the 40 kDa region more than four different proteins could be visualized
which were unique for the methanol grown cultures. Based on these results it was not possible to
identify the protein which was responsible for initial methanol biotransformation.

M EtoH MetoH

Figure 3.1. SDS page pattern of D. kuznetsovii cells grown on different substrates.
M; marker; EtOH, cells grown on ethanol; MetOH, cells grown on methanol.
An arrow indicates the methanol induced 42 kDa protein

58
 Methanol dissimilation

The partial purification of the alcohol dehydrogenase resulted in a 80% purification of the
ETDH and 50% purification of the MDH activity. Some purification steps yielded more than 100
U/mg protein, suggesting that the enzyme makes up at least 1% of the total protein in the cell
extract (Table 3.2). The enzyme was relatively stable when stored under nitrogen at –20 ºC: only
50% of the activity was lost after one week storage. The enzyme was oxygen sensitive for both
activities.

Table 3.2. Purification of an alcohol dehydrogenase from D. kuznetsovii

Step Total Total activity Specific Yield (%) Purification

protein (mg) (U) activity (fold)
(U/mg)
C1a) C2 C1 C2 C1 C2 C1 C2
Crude extract 420 10.9 54.6 0.02 0.13 100 100 1 1
Q-sepharose 73.8 59.0 295 0.8 4.0 540 540 31 31
Butyl- 19.7 25.6 197 1.3 10.8 234 360 50 83
sepharose
a) C1, electron donor methanol; C2, electron donor ethanol

Cell Free extract

Butyp Seph

Q Seph
Marker

Figure 3.2. SDS page pattern of the partly purified alcohol dehydrogenase from
D. kuznetsovii

The molecular weight of the ADH subunit was estimated to be 42 kDa by SDS-PAGE (Fig.
3.2), which resembles the subunit size of the ADH of Desulfovibrio gigas (Hensgens et al., 1993)
and Desulfovibrio HDv (Hensgens et al., 1995). Cell extracts of D. kuznetsovii were subjected to

59
SDS-PAGE. However, western blots showed that the antibodies raised against purified Dv. gigas
ADH did not cross react with cell free extract of D. kuznetsovii.
Highest activities in the dehydrogenation reaction were found with ethanol; lower activities
were found for 1-propanol, 1-butanol, and methanol. The purified ADH was inactive towards 2-
propanol. NAD, DCPIP, and MTT were used as electron acceptor and hardly any activity with
NADP was observed. For the reverse reaction aldehydes were used at 2 mM. Highest activity was
found with acetaldehyde; the activity with formaldehyde was very low. The enzyme was most
active at 60 ºC and at a pH between 8 and 9. The apparent Km values were: for ethanol, 1 mM and
for methanol 13 mM. This Km value for ethanol is 2-fold and 7-fold higher than the Km value of the
purified ADH form Dv. gigas (Hensgens et al., 1993) and Desulfovibrio HDv (Hensgens et al.,
1995) respectively. However, the Km value, was determined at higher pH than the normal
cytoplasmic value.

Acknowledgements: We thank Lubbert Dijkhuizen for valuable suggestions and Manny Nienhuis-Kuiper for
technical assistance. This work was supported by the Applied Science Division (STW) of the Netherlands
Organization for Scientific Research (NWO).

References
Arfman, N., Watling, E. M., Clement, W., oosterwijk, R. J., De Vries, G. E., Harder, W., Attwood, M. M. &
Dijkhuizen, L. (1989). Methanol metabolism in thermotolerant methylotrophic Bacillus strains involving a
novel catabolic NAD-dependent methanol dehydrogenase as a key enzyme. Arch Microbiol 152,280-288.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein binding-dye binding. Anal Biochem 72,248-254.
Daas, P. J. H., Wassenaar, R. W., Willemsen, P., Theunissen, R. J., J.T., K., Van der Drift, C. & Vogels,
G. D. (1996). Purification and properties of an enzyme involved in the ATP-dependent activation of the
methanol:2-mercaptoethanesulfonic acid methyltransferase reaction in Methanosarcina barkeri. J Biol
Chem 271,22339-22345.
Duine, J. A., Frank, J. & Berkhout, P. J. (1984). NAD-dependent, PQQ-containing methanol
dehydrogenase: a bacterial dehydrogenase in a multienzym complex. FEBS Letters 168,217-221.
Fardeau, M. L., Ollivier, B., Patel, B.-K. C., Dwivedi, P., Ragot, M. & Garcia, J. L. (1995). Isolation and
characterization of a thermophilic sulfate-reducing bacterium, Desulfotomaculum thermosapovorans sp.
nov. Int J Syst Bacteriol 45,218-221.
Heijthuijsen, J. H. F. G. & Hansen, T. A. (1989). Betaine fermentation and oxidation by marine
Desulforomonas strains. Appl Environ Microbiol 55,965-969.
Hensgens, C. M. H., Vonck, J., Van Breemen, J. F. L., Van Bruggen, E. F. J. & Hansen, T. A. (1993).
Purification and characterization of an oxygen-labile, NAD-dependent alcohol dehydrogenase from
Desulfovibrio gigas. J Bacteriol 175,2859-2863.
Hensgens, C. M. H., Jansen, M., Nienhuis-Kuiper, M. E., Boekema, E. J., Van Breemen, J. F. L. &
Hansen, T. A. (1995). Purification and characterization of an alcohol dehydrogenase from 1,2-
propanediol-grown Desulfovibrio strain HDv. Arch Microbiol 164, 265-270
Jansen, M. (2000). Microbial demethylation of dimethylsulfoniopropionate and methylthiopropionate. PhD
thesis. University of Groningen, Groningen, The Netherlands.
Jansen, M. & Hansen, T. A. (1998). Tetrahydrofolate serves as methyl acceptor in the demethylation of
dimethylsulfoniopropionate in cell extracts of sulfate-reducing bacteria. Arch Microbiol 169,84-87.
Klemps, R., Cypionka, H., Widdel, F. & Pfennig, N. (1985). Growth with hydrogen, and further
physiological characteristics of Desulfotomaculum species. Arch Microbiol 143,203-208.
Kremer, D. R. & Hansen, T. A. (1987). Glycerol and dihydroxyacetone dissimilation in Desulfovibrio strains.
Arch Microbiol 147,249-256.
Kremer, D. R., Nienhuis-Kuiper, H. E. & Hansen, T. A. (1988). Ethanol dissimilation in Desulfovibrio. Arch
Microbiol 150,552-557.
Kyshe-Andersen, J. (1984). Electroblotting of multiple gels: a simple apparatus without buffer tank for rapid
transfer of proteins from polyacrylamide to nitrocellulose. J Biochem Biophys Meth 10,203-209
Laemmli, U. K. & Favre, K. (1970). Maturation of the head of a bacteriophage T4I. DNA packaging events.
J Mol Biol 80,575-599

60
 Methanol dissimilation

Morrisey, J. H. (1981). Silver stain for proteins in polyacrylamide gels: A modified procedure with enhanced
uniform sensitivity. Anal Biochem 117,307-310.
O'Farrell, P. H. (1975). High resolution tow-dimensional electrophoresis of proteins. J Biol Chem 250,4007-
4021.
Pfennig, N. & Lippert, K. D. (1966). Über das vitamin B12-bedürfnis phototropher Schwefelbakterien. Arch
Microbiol 55,245-256.
Stams, A. J. M., Veenhuis, M., Weenk, G. H. & Hansen, T. A. (1983). Occurence of polyglucose as a
storage polymer in Desulfovibrio species and in Desulfobulbus propionicus. Arch Microbiol 136,54-59.
Stüpperich, E. & Konle, R. (1993). Corrinoid-dependent methyl transfer reactions are involved in methanol
and 3,4-dimethoxybenzoate metabolism by Sporomusa ovata. Appl Environ Microbiol 59,3110-3116.
Trüper, H. G. & Schlegel, H. G. (1964). Sulphur metabolism inThiorhodaceae I. Quantitative measurements
on growing cells of Chromatium okenii. J Microbiol Ser 30,225-238.
Van der Meijden, P. C., Van der Drift, C. & Vogels, G. D. (1984). Methanol conversion in Eubacterium
limosum. Arch Microbiol 38,360-364.
Weijma, J. 2000. Methanol as electron donor for thermophilic biological sulfate and sulfite reduction. PhD
thesis. Wageningen University, Wageningen, The Netherlands.
Winters, D. K. & Ljungdahl, L. G. 1989. PQQ-dependent methanoldehydrogenase from Clostridium
thermoautotrophicum, p. 35-39. In J. A. Jongejan and J. A. Duine (eds.), PQQ and quinoproteins. Kluwer
Academic Publishers, Dordrecht.

61
62
 4
Endospores of thermophilic
sulfate reducing bacteria
survive extreme heat treatments

Heleen P. Goorissen, Manny H. M. Nienhuis-Kuiper,

Alfons J. M. Stams, and Theo A. Hansen

The ability of microorganisms to survive extreme environmental conditions is

partly determined by their capacity to protect DNA from destructive chemical and
physical conditions. Some bacteria form endospores that can resist extreme
conditions — including pressure, extreme heat or cold, drought, starvation, most
poisons, and UV-radiation. Spores may remain dormant for centuries and may even
survive over geological time and through interstellar travel.
Here we report on the extreme heat resistance of spores of the thermophilic
sulfate-reducing bacterium Desulfotomaculum kuznetsovii. About 10% of the spores
of this organism survived a heat treatment at 140 ºC for 15 min., which is
unprecedented. This unusual characteristic is represented by a z-value (thermal
inactivation coefficient) of 16.7 ºC. The decimal reduction value at 120 ºC is 4 hours,
which is highest ever.

Submitted for publication

Chapter 4

Introduction

Heat resistant spores are found among several species, mainly those belonging to the
genera Bacillus and Clostridium (Hyung et al., 1983; Fernandez et al., 2001). Most of the research
into heat resistance of spores has been done using mesophilic species in food industrial
processes. Less attention has been paid to the heat resistance of spores formed by thermophilic
bacteria. Spores from thermophilic bacteria are more heat resistant than spores from mesophilic
species (Warth, 1978). Heat resistant spores from thermophilic anaerobes can be troublesome in
research laboratories and routine autoclaving protocols of culture media and materials might be
insufficient to inactivate bacterial spores. On the contrary, normal autoclaving procedures (20 min.,
121 ºC) may even activate and increase the apparent heat resistance of spores (Hyung et al.,
1983; Byrer et al., 2000).
The first high decimal reduction value DT (the incubation time at temperature T necessary
for a 90% decrease in the viability of the spores) for thermophilic species was reported in 1965 for
Clostridium thermoaceticum, an acetogen with a D124 of more than 72 minutes (Xezones et al.,
1965). More recently, extremely heat resistant spores have been detected in other thermophilic
Clostridium and Moorella species, i.e. Cl. thermohydrosulfuricum (D120 = 11 min.) (Hyung et al.,
1983), Cl. thermoautotrophicum (D120 = 70 min.) (van Rijssel et al., 1992), and Moorella
thermoacetica JW/DB2 and JW/DB4 (D120 = 84 min., 111 min., respectively) (Byrer et al., 2000).
What determines the spore heat resistance is not known with certainty. Multiple factors are
involved, such as the composition of the proteinaceous spore-coat (Henriques & Moran, 2000), the
dipicolinic acid concentration of the spore-cortex (Beaman & Gerhardt, 1986), its thickness, and its
Ca2+ content, the dehydration and mineralization state of the spore (Popham et al., 1999), and
specialized DNA-binding proteins termed α/β type small acid soluble spore proteins (SASP)
(Setlow & Setlow, 1998).
Virtually no studies have been made of the heat resistance of spores of the thermophilic
sulfate-reducing bacteria of the genus Desulfotomaculum, which are widespread in nature. Only
for D. nigrificans, a moderate thermophile that was responsible for sulfur stinker spoilage in canned
food products, a D120 = 5.4 min. was reported (Donnelly & Busta, 1980). We studied the
metabolism of Desulfotomaculum kuznetsovii, a thermophilic, rod-shaped, spore-forming, sulfate-
reducing bacterium isolated from a geothermal hot spring (Nazina et al., 1987). In continuous
cultures, it appeared that sterilization procedures of even longer than two hours at 120 °C were
insufficient to kill the spores of D. kuznetsovii in our fermentors. This observation led to the
question whether this extremely heat resistant spore production is a typical phenomenon for all
thermophilic Desulfotomaculum strains or is specific to D. kuznetsovii. All strains present in the IC
and ID subclusters of the phylogenetic tree of the Desulfotomaculum main cluster were examined
for the production of heat resistant spores.

64
 Heat resistant spores

Methods

Strains. The following strains were purchased from the Deutsche Sammlung von Mikroorganismen
und Zellkulturen (Braunschweig, Germany): Desulfotomaculum kuznetsovii (DSM 6115),
Desulfotomaculum thermoacetoxidans (DSM 5813), Desulfotomaculum thermobenzoicum (DSM
6193), and Desulfotomaculum thermocisternum (DSM 10259). Desulfotomaculum australicum
(AB33) and Desulfotomaculum luciae (SMCC W644) were kindly provided by Bharat Patel (Griffith
University, Nathan, Queensland) and David Boone (Oregon Graduate Institute of Science and
Technology, Portland Oregon) respectively. Strain TPOSR, strain WW1, and strain V21 were
isolated in our laboratories.

Phylogenetic analysis. Sequences were downloaded from the Genbank Database and aligned
using Clustal W. The 16S rDNA phylogenetic tree was constructed from a distance matrix based
on the neighbor-joining method (Saitou & Nei, 1987) as implemented in the TREECON program
(van de Peer & de Wachter, 1995). A manual correction method was applied and tree topology
was re-examined by using bootstrap analysis (100 replicants, all bootstrap values ≥ 68).

Cultivation techniques. Anaerobic culture techniques were used throughout this study, with all
media prepared as described in the catalog of strains of the Deutsche Sammlung von
Mikroorganismen und Zellkulturen (http://www.gbf.de/dsmz/media/media.htm). For the production
and germination of the spores, substrates methanol (20 mM, filter sterilized) or lactate (20 mM,
heat sterilized) were added from anoxic stock solutions. Incubations were carried out at 60 °C in 1
liter bottles filled with 100 ml medium for the spore-production experiments or in 16 ml tubes filled
with 10 ml medium for the spore-germination experiments and most probable number counts.

Determination of D-values. From a 1 liter culture, cells and spores were harvested and
concentrated 25-fold by centrifugation. Samples (2 ml) of this suspension were transferred to new
anaerobic sterile tubes. Tubes were heated in an oil-bath for different times (1 to 40 hours) and
different temperatures. After heat treatment, the spore suspensions were diluted in fresh anaerobic
medium and incubated at 60 °C for most probable number counts. Decimal reduction values (D)
were calculated from the best linear fit from y = ax + b, in which x is the incubation time (hours) and
y is log N. N is the number of viable spores after heat treatment. Experiments were carried out in
duplo.

Results

Determination of the heat resistance of D. kuznetsovii spores

Heat resistance of the spores of D. kuznetsovii was determined in duplicate culture
suspensions (3·109 viable cells per ml) at incubation temperatures of 120, 130, and 140 °C. The
survival of viable spores after heat treatment was counted using the most probable number
method. Survival curves of D. kuznetsovii spores are depicted in Fig. 4.1.
The decimal reduction value for D. kuznetsovii spores at 140º C is 15 min., an
unprecedented value. At lower temperatures, the D-values are extremely high (D130 = 79.2 min.,
D120 = 240 min.) and this slow decrease of viability of the spores at higher temperatures is also
illustrated by a high z-value i.e. 16.7 ºC (Fig. 4.2).

65
Chapter 4

Log decimal reduction values 12

10

0
0 5 10 15 20 25 30 35 40
Incubation time (h)

Figure 4.1. Survival curve of D. kuznetsovii spores at different temperatures.

Symbols: !, T = 120 ºC; ", T = 130 ºC; #, T = 140 ºC.

y = -0.0655x + 10.392
Log decimal reduction value

2.5
R2 = 0.988
2

1.5

0.5

0
115 120 125 130 135 140 145
Incubation temperature (ºC)

Figure 4.2. Thermal inactivation curve. Best fit through log decimal reduction values
of D. kuznetsovii spores

Assuming first order kinetics for the inactivation of spores by heat, extrapolation of the
thermal inactivation curve results in a D100 of approximately 70 hours and a D90 of more than 11
days. Altering the growth conditions could influence the apparent heat resistance of the spores.
Omission of calcium from the sporulation medium reduced the D120 to 87 min. This confirms the
observation that bacterial spores accumulate calcium, which contribute to spore heat resistance,
depending on the concentration in the growth medium (Popham et al., 1999). The assumed
relation between spore cortex/cytoplasm ratio and degree of heat resistance as postulated by
Hyung et al (1983) could not be confirmed in our study. In D. kuznetsovii spores, this ratio is
relatively low (1.7) in view of their extreme heat resistance.

66
 Heat resistant spores

Phylogenetic analysis of thermophilic Desulfotomaculum species

The complete 16S rDNA sequences of all Desulfotomaculum strains in subclusters IC and ID and
some other strains that form heat resistant spores were compared. In the resulting phylogenetic
tree (Fig. 4.3), species within the Desulfotomaculum subcluster IC are closely related, showing
similarity values of 95-98%. The sequence similarity of the subclusters IC and ID is more than
90%.

ans
ID

toxid
Desu

um
oace
lfoto

oic
enz
therm
mac

ob
u lu m

rm
Th

um
ulum
er

the
m

lic
oa

ra
n i gr

mac
na
lum

st
er

au
ob um
ifica

ac u
rn
l fo to

um
ac t e
te ci s
tom

ul
rs
ns

mo
ac
Desu

id e r
er m
lfo

Mo o th
to
ph lum
su

ore
lfo

ilu cu
l IC
De

la a
su

the s m
Moo to
De

rella rm fo
therm oa s ul
oaut c
otro etic De WW1
phic a Strain ulum luciae
a Desulfotomac
Strain
TPOSR
St
ra
in De
V2 sul
1 fot
om
acu
lum
kuz
n ets
o vii
s
licu
no
tha
me
us
cill
Ba

Figure 4.3. Phylogenetic tree based on 16S rRNA gene sequence comparisons. The neighbor-joining
tree was reconstructed from distance matrices; bootstrap values are not shown. Cluster
designation according to Stackebrandt et al. (1997) The GenBank accession numbers for
the organisms used in this analysis are Desulfotomaculum kuznetsovii AF009646; Desul-
fotomaculum luciae AF069293; Desulfotomaculum nigrificans X62176; Desulfotomaculum
thermoacetoxidans Y11573; Desulfotomaculum thermobenzoicum L15628; Desulfoto-
maculum thermocisternum U33455; Moorella thermoacetica M59121; Moorella thermoauto-
trophica L09168; Thermoanaerobacter siderophilus AF120479; Strain TPOSR AF442686;
Strain WW1 AF442687. Bacillus methanolicus X64465 S42879 served as outgroup

67
Chapter 4

Determination of the heat resistance of spores of thermophilic Desulfotomaculum species

Among all the studied strains, only strain TPOSR and strain WW1 produced extremely heat
resistant spores, although their spores were considerably less heat resistant than D. kuznetsovii
spores. The D120 value for WW1 is 60 min. and for TPOSR D120 is 114 min (Table 4.1). For both
strains, tubes were positive after a heat treatment of 16 hours and negative after 20 hours. We
were unable to obtain sporulating cultures of D. australicum and D. luciae. For D. luciae, it has
been reported that cells were still viable after a 30 min. boiling procedure (Karnauchow et al.,
1992). All other strains from subcluster IC and ID produced spores with D120-values equal to or
below 3 min. (Table 4.1).

Table 4.1. Highest reported D120-values (values < 3 min. are not taken into account), combined with
D120-values of Desulfotomaculum strains from the 1C and 1D phylogenetic cluster

Strain D120 (min) Sporecortex to Reference

cytoplasm ration
Bacillus stearothermophilus 3 2.8 Aiba & Humphrey, 1978
Clostridium difficile 88 32.5 nr Nakamura et al., 1985
Cl. thermoautotrophicum 70 1.4 van Rijssel et al., 1992
Cl. thermohydrosulfuricum 39E 11 6.6 Hyung et al., 1983
Cl. thermosaccharolyticum 72.5 nr Xezones et al., 1965
Desulfotomaculum nigrificans 5.6 nr Donnelly & Busta, 1980
a
D. kuznetsovii 240 1.7 This report
D. thermoacetoxidans <3 nd This report
D. thermobenzoicum <3 nd This report
D. thermocisternum <3 nd This report
Strain V21 <3 nd This report
Strain TPOSR 114 nd This report
Strain WW1 60 nd This report
Moorella thermoacetica JW/DB-4 111 5.97 Byrer, et al., 2000
Moorella thermoacetica JW/DB-2 83 3.13 Byrer, et al., 2000
nr, not reported; nd, not determined; a) determined as described previously (van Rijssel et al., 1992)

Discussion

The production of extremely heat resistant spores with a D140 of 15 min. is an exclusive
feature of D. kuznetsovii and makes this strain unique, not only within the genus
Desulfotomaculum, but among all spore-forming bacteria. To our knowledge, D140-values higher
than 7.9 sec. have not been demonstrated previously (Huemer et al., 1998). Highest DT values
reported are D120 values, found for thermophilic low G+C % gram-positive Clostridium and Moorella
species (Table 4.1). On the basis of 16S rDNA sequence comparisons a relative high degree of
relatedness between these species and the thermophilic Desulfotomaculum species exists (80-
87%). Desulfotomaculum species have been isolated from anaerobic bioreactors and from
environmental samples. In both classes, heat-sensitive spore producers are also present. This

68
 Heat resistant spores

indicates that the occurrence of Desulfotomaculum species with extremely heat resistant spores is
not confined to a particular habitat.
The comparison of data published on the heat resistance of spores is complicated because
no standard quantification and incubation protocols are available. Besides, environmental factors
greatly affect microbial heat resistance. Composition of the growth medium (Payot et al., 1999;
Casadei et al., 2001) sporulation temperature (Beaman & Gerhardt, 1986), the heating conditions
and recovery medium (Coroller et al., 2001; Palop et al., 2000), and increased heating time (Byrer
et al., 2000) influence the apparent heat resistance. Often a survival of boiling treatments is
reported to indicate heat resistance, e.g. D. thermoacetoxidans survived 10 min. boiling, but did not
survive 15 min. boiling (Min & Zinder, 1990); Thermoanaerobacter siderophilus survived a 90 min.
boiling treatment (Slobodkin et al., 1999), and methanol utilizing Desulfotomaculum species
survived a heat treatment at 131 ºC for 20 min. (Rosnes et al., 1991). Although these data might
give a prediction of heat resistance, such observations are not comparable with D-values. In all our
experiments, the same conditions have been applied. Therefore it is clear that the differences in
heat resistance among the spores of different Desulfotomaculum species is an intrinsic property of
the thermophilic Desulfotomaculum species

References
Aiba, S. & Humphrey, A. E. 1978. Biochemical Engineering, p. 240-244. Tokyo University Press, Tokyo.
Beaman, T. C. & Gerhardt, P. (1986). Heat resistance of bacterial spores correlated with protoplast
dehydration, mineralization, and thermal adaptation. Appl Environ Microbiol 52,1242-1246.
Byrer, D. E., Rainey, F. A. & Wiegel, J. (2000). Novel strains of Moorella thermoacetica form unusually
heat-resistant spores. Arch Microbiol 174,334-339.
Casadei, M. A., Ingram, R., Hitchings, E., Archer, J. & Gaze, J. (2001). Heat resistance of Bacillus cereus,
Salmonella typhimurium, and Lactobacillus delbrueckii in relation to pH and ethanol. Int J Food Microbiol
63,125-134.
Coroller, L., Leguerinel, I. & Mafart, P. (2001). Effect of water activities of heating and recovery media on
apparent heat resistance of Bacillus cereus spores. Appl Environ Microbiol 67,317-322.
Donnelly, L. S. & Busta, F. F. (1980). Heat resistance of Desulfotomaculum nigrificans spores in soy protein
infant formula preparations. Appl Environ Microbiol 40,721-725.
Fernandez, A., Ocio, M. J., Fernandez, P. S. & Martinez, A. (2001). Effect of heat activation and
inactivation conditions on germination and thermal resistance parameters of Bacillus cereus spores. Int J
Food Microbiol 63,257-264.
Henriques, A. O. & Moran, C. P. J. (2000). Structure and assembly of the bacterial endospore coat.
Methods Enzymol 20,95-110.
Hyung, H. H., Zeikus, J. G., Longin, R., Millet, J. & Ryter, A. (1983). Ultrastructure and extreme heat
resistance of spores from thermophilic Clostridium species. J Bacteriol 156,1332-1337.
Karnauchow, T. M., Koval, S. F. & Jarrell, K. F. (1992). Isolation and characterization of three thermophilic
anaerobes from a St. Lucia hot spring. System Appl. Microbiol. 15,296-310.
Min, H. & Zinder, S. H. (1990). Isolation and characterization of a thermophilic sulfate-reducing bacterium
Desulfotomaculum thermoacetoxidans sp. nov. Arch Microbiol 153,399-404.
Nakamura, S., Yamakawa, K., Izumi, J., Nakashio, S. & Nishida, S. (1985). Germinability and heat
resistance of spores of Clostridium difficile strains. Microbiol Immunil 29,113-118.
Nazina, T. N., Ivanova, A. E., Kanchaveli, L. P. & Rozanova, E. P. (1987). A new sporeforming
thermophilic methylotrophic sulfate-reducing bacterium, Desulfotomaculum kuznetsovii sp. nov.
Mikrobiologiya 57,823-827.
Palop, A., Alvarez, I., Raso, J. & Condon, S. (2000). Heat resistance of Alicyclobacillus acidocaldarius in
water, various buffers, and orange juice. J Food Prot 63,1377-1380.
Payot, S., Guedon, E., Desvaux, M., Gelhaye, E. & Petitdemange, E. (1999). Effect of the dilution rate,
cellobiose, and ammonium availabilities on Clostridium cellulolyticum sporulation. Appl Microbiol Biotechnol
52,670-674.
Popham, D. L., Gilmore, M. E. & Setlow, P. (1999). Roles of low-molecular weight penicillin binding
proteins in Bacillus subtilis spore peptidoglycan synthesis and spore properties. J Bacteriol 181,126-132.
Rosnes, J. T., Torsvik, T. & Lien, T. (1991). Spore-forming thermophilic sulfate-reducing bacteria isolated
from North Sea oil field waters. Appl Environ Microbiol 57,2302-2307.

69
Chapter 4

Saitou, N. & Nei, M. (1987). The neighbour-joining method: a new method for the reconstructing of
phylogenetic trees. Mol Biol Evol 4, 406-425.
Setlow, B. & Setlow, P. (1998). Heat killing of Bacillus subtilis spores in water is not due to oxidative
damage. Appl Environ Microbiol 64,4109-4112.
Slobodkin, A. I., Tourova, T. P., Kuznetsov, B., Kostrikina, N. A., Chernyh, N. A. & Bonch-
Osmolovskaya, E. A. (1999). Thermoanaerobacter siderophilus sp. nov., a novel disimilatory Fe (III)-
reducing, anaerobic, thermophilic bacterium. Int J Syst Bacteriol 49,1471-1478.
Van de Peer, Y. & De Wachter, R. (1995). TREECON for Windows: a software package for the construction
and drawing of evolutionary trees for the Microsoft Windows Environment. Comput Appl Biosci 10,569-
570.
Van Rijssel, M., Van der Veen, I. & Hansen, T. A. (1992). A lithotrophic Clostridium strain with extremely
thermoresistant spores isolated from a pectin-limited continuous culture of Clostridium
thermosaccharolyticum strain Haren. FEMS Microbiol Lett 91,171-176.
Warth, A. D. (1978). Relationship between heat resistance of spores and the optimum and maximum growth
temperatures of Bacillus species. J Bacteriol 134,699-705.
Xezones, H., Segmiller, J. L. & Hutchings, I. J. (1965). Processing requirements for a heat-tolerant
anaerobe. Food Technol 19,1001-1002.

70
 5
Isolation of thermophilic Desulfotomaculum
strains with methanol and sulphite
from solfataric mud pools
and characterization of
Desulfotomaculum solfataricum sp. nov.

Heleen P. Goorissen, Henricus T. S. Boschker,

Alfons J. M. Stams, and Theo A. Hansen

Four strains of thermophilic, endospore-forming, sulphate-reducing bacteria

were enriched and isolated from hot solfataric fields in the Krafla area of north-east
Iceland using methanol and sulphite as substrates. Morphologically, these strains
resembled thermophilic Desulfotomaculum species. The strains grew with alcohols
including methanol, and with glucose and fructose as electron donors, and
sulphate, sulphite, or thiosulphate as electron acceptors. For all four strains,
optimum temperature, pH and NaCl concentration for growth were 60 ºC, pH 7.3, and
0 g l-1 NaCl. Phylogenetic analysis on the basis of partial 16S rRNA-sequence
comparisons showed high similarities (>98%) with D. kuznetsovii and D. luciae.
However, DNA-DNA hybridization studies with D. kuznetsovii revealed that the novel
strains belong to a single new species. A representative of this group of isolates,
strain V21, is proposed as the type strain of a new species of the spore-forming
sulphate-reducing genus Desulfotomaculum, D. solfataricum.

Submitted for publication

Chapter 5

Introduction

Thermophilic, sulphate-reducing bacteria are found in a wide range of environments

including hot springs, geothermal groundwater (Zeikus et al., 1983; Daumas et al., 1988; Nazina
et al., 1987; Love et al., 1993; Henry et al., 1994; Liu et al., 1997) fresh water (Elsgaard et al.,
1994; Kuever et al., 1999), cold marine sediments (Isaksen et al., 1994), oilfields (Rosnes et al.,
1991; Rees et al., 1995; Beeder et al., 1995; Tardy-Jacquenod et al., 1996; Nilsen et al., 1996),
compost and manure (Fardeau et al., 1995; Pikuta et al., 2000), and anaerobic bioreactors (Min &
Zinder, 1990; Tasaki et al., 1991; Weijma, 2000, Plugge et al., 2002). Most of these thermophiles
belong to a phylogenetically coherent cluster of Gram-positive, spore-forming Desulfotomaculum
species (Stackebrandt et al., 1997). Gram-negative, thermophilic sulphate-reducing bacteria are
members of the genera Thermodesulfobacterium, Thermodesulfovibrio, Thermodesulforhabdus, or
Desulfacinum (Henry et al., 1994; Rees et al., 1995; Rozanova et al., 2001; Sievert & Kuever,
2000; Sonne-Hansen & Ahring, 1999; Zeikus et al., 1983; Beeder et al., 1995). These Gram-
negative sulphate reducers are all characterized by a narrow substrate range compared to the
thermophilic Desulfotomaculum species. Most of the thermophilic sulphate-reducers also use
sulphite and thiosulphate as electron acceptors. Sulphate reduction is energetically less favorable
than sulphite reduction. Sulphate has to be activated first at the expense of ATP to adenosine-5’-
phosphosulphate (APS) by ATP-sulphurylase, followed by APS reduction to form sulphite and AMP
(Widdel & Hansen, 1992). Thiosulphate - as electron acceptor - is energetically also more
favorable than sulphate and in freshwater sediments thiosulphate is preferentially used (Jørgensen
& Bak, 1991). The aim of our work is to identify and characterize bacterial strains that may find
application in a biological process for the thermophilic desulfurization of off-gasses. For this
process, thermophilic, methanol-utilizing, sulphite reducing strains were considered essential. In
nature, mesophilic sulphite-reducing bacteria, i.e. Desulfitobacterium species, are found which
cannot reduce sulphate (Utkin et al., 1994; Christiansen & Ahring, 1996; Gerritse et al., 1996;
Bouchard et al., 1996; Sanford et al., 1996; Gerritse et al., 1999). A good sampling site for isolation
of thermophilic sulphite-reducers is the Krafla region in north-east Iceland - a relatively young,
geothermically active area, which has experienced recent volcanic outbursts. On the slopes of
these young craters and in the lower regions, solfataric mud pools with large differences in
temperature (40-110 °C) and acidity (pH 2.5 –8.0) were found. Enrichments from sediments of
these pools led to the isolation of new methanol-utilizing, sulphate- and sulphite-reducing bacteria.
In this paper, we describe the isolation and characterization of strain V21T.

Methods

Sources of cultures. Desulfotomaculum kuznetsovii (DSM 6115T) was purchased from the
Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany).
Desulfotomaculum luciae was kindly provided by David Boone (Oregon Graduate Institute of
Science and Technology, Portland, Oregon). Strain TPOSR was isolated at the Laboratory of
Microbiology in Wageningen from anaerobic methanogenic granular sludge with propionate and
sulphate as substrates (unpublished). Strain WW1 was enriched and isolated from a thermophilic
methanol-fed sulphate-reducing lab-scale reactor and kindly provided by Jan Weijma (2000).

Source of inocula. Sediment samples were taken from hot (T = 45-110 ºC) solfataric fields in the
Krafla region of north-east Iceland. Around 10 samples of both the Naumaskjárd and Vití solfatara
were collected from the blackened layers of the solfataric mud pools. Samples were kept under an
anaerobic atmosphere (N2/CO2, 80%/20%), transported at room temperature, and used for
enrichments within seven days of sampling.

Media and cultivation. A bicarbonate-buffered medium was used for growth, enrichment, and
isolation experiments. The basal medium contained (gl-1): NaHCO3 (4, separately sterilized),
Na2SO4 (2.8), MgCl2⋅6H2O (1.2), KCl (0.5), NH4Cl (0.3), KH2PO4 (0.2), CaCl2 (0.15), Na2S⋅7-9H2O

72
 Isolation

(0.3, separately sterilized). The following additions were made from anoxic stock solutions: per liter
of medium 0.5 ml vitamin solution according to Stams et al. (1983), 0.1 µM Na2SeO3, 0.1 µM
Na2WO4, and 1 ml trace-element solution SL 6 according to Pfennig & Lippert (1966). In standard
growth experiments, 1g yeast extract (Difco, Detroit, MI.), and 7 gl-1 NaCl were added to the culture
medium.

Enrichment and isolation. Enrichments were carried out in both batch and continuous cultures.
Incubations in batch experiments were done at 60 °C at neutral pH in 120-ml bottles filled with 50
ml basal medium without sulphate, and supplemented with 10 mM methanol as the electron donor,
10 mM sulphite as electron acceptor, and 5 mM hydrogen sulfide to select for sulphide-tolerant
organisms. Yeast extract was omitted. The headspace consisted of N2/CO2 (80%/20%). Under
anaerobic conditions, approximately 5 ml of sediment was added to the culture bottles. After
growth was observed (4 to 5 weeks), sulphide production was analyzed and positive cultures were
transferred to a fresh medium. Slow growing organisms were enriched in a continuous culture
vessel with glass and teflon parts present. The influent contained a standard medium with 10 mM
methanol as the growth-limiting substrate, 10 mM sulphite instead of sulphate, and 5 mM sulphide.
The dilution rate was 0.005 h-1, the temperature was 60 °C, the pH was maintained at 7.3 by
titration with HCl and the stirring speed was 100 rpm. At a constant culture density the culture was
used for isolation. Strains were obtained in pure culture by using agar shake dilution tubes. Black
colonies from the highest dilutions showing growth were used for three successive transfers in
agar tubes and checked for purity.

pH, temperature and NaCl concentration optima. The effect of pH on growth was determined at
60 ºC. The pH of the basal medium was adjusted to defined values (pH range 6-8.5) with sterile
stock solutions of NaOH or HCl. The temperature range (37-75 ºC) for growth was determined in
basal medium at pH 7.5. The requirement for NaCl was determined in a basal medium containing
0, 0.5, 1, 2, 3, and 5 % (w/v) NaCl.

Electron donor and electron acceptor utilization. The ability of the strains to utilize substrates
was tested in basal medium supplemented with autoclaved or filter-sterilized substrates.
Concentrations ranged from 5 to 20 mM and cultures were incubated for two weeks. The utilization
of various electron acceptors was studied in basal medium containing lactate (20 mM) as the
electron donor. Electron acceptors were added from sterile stock solutions up to a concentration of
10 mM.

Analytical procedures. Optical density was measured at a wavelength of 660 nm in a Starcoll

colorimeter (R&D Mechatronics). Methanol, methane and fatty acids were analyzed by GC as
described by Heijthuijsen & Hansen (1989). Sulphide was determined colorimetrically using the
methylene blue method of Trüper & Schlegel (1964). Bacterial growth was determined by
measuring the increase in OD660, the methanol consumption and the sulphide production.

Phospholipid fatty acid analysis. Bacterial cultures grown on methanol and sulphate were
harvested by centrifugation (20,000 g, 20 min., 4 oC) and pellets were directly extracted using a
modified Bligh and Dyer extraction. The total lipid extract was fractionated on silic acid, and mild
alkaline transmethylation was used to yield fatty acid methyl esters from the phospholipid fraction.
Concentrations of individual PLFA as fatty acid methyl esters (FAME) were determined by capillary
GC-FID. Identification of PLFA was based on comparison betweeb retention time data and known
standards (see Boschker et al. (1999) for further details).

Phylogenetic analysis
Partial 16S rRNA-sequence analysis of the four isolates. For the genotypic characterization of
isolates V20, V21, V28, V29, and strain TPOSR, chromosomal DNA was isolated from a liquid
culture as described previously (Van der Maarel et al., 1996). The 16S-rRNA gene was selectively

73
Chapter 5

amplified by PCR, using oligonucleotide primers complementary to conserved regions of the

eubacterial 16S rRNA. The following primer pair was used: 5’ ACCTAATACGACTAC-
TATAGGGAGAGTTTGATCCTGGCTCAG 3’ (positions 8-27, E. coli numbering) and 5’
ATTGTAAAACGACGGCCAGT-GGTTACCTTGTTACGACTT 3’ (positions 1492-1510, E. coli
numbering). The PCR amplification products were sequenced with an Applied Biosystems 373A
DNA sequencer by using the Taq DyeDeoxy terminator cycle sequencing method and custom
primers based on conserved regions.
Full 16S rRNA sequence analysis of strain V21. Extraction of genomic DNA and PCR mediated
amplification of the 16S rRNA was carried out as described previously
(Rainey et al., 1996). Purified PCR products were cloned using the pCR-ScriptTMSK(+) Cloning Kit
from Stratagene. Genomic DNA was extracted from positive clones . PCR mediated amplification
of the 16S rDNA and purification of the PCR product was carried out as described by Rainey et al.
(1996). Purified PCR products were sequenced using the ABI PRISMTM DYE Terminator Cycle
Sequencing Ready Reaction Kit (Applied Biosystems, Germany) as directed in the manufacturer’s
protocol. Sequence reactions were electrophoresed using the Applied Biosystems 373A DNA
sequencer. Approximately 95% of the 16S rRNA gene sequence of strain V21 was determined.
Sequence alignment and construction of a phylogenetic tree. The assembled DNA sequences
were aligned with 16S rRNA sequences of closely related strains found in the GenBank database
using CLUSTAL W. The following sequences were extracted from GenBank: Bacillus
methanolicus, Clostridium celerecrescens, Clostridium aerotolerans, Clostridium sphenoides, Clos-
tridium xylanoliticum, Desulfitobacterium dehalogenans, Desulfitobacterium chlororespirans, Desul-
fitobacterium hafniense, Desulfotomaculum acetoxidans, Desulfotomaculum aeronauticum, Desul-
fotomaculum alkaliphilum, Desulfotomaculum australicum, Desulfotomaculum auripigmentum,
Desulfotomaculum geothermicum, Desulfotomaculum gibsoniae, Desulfotomaculum guttoideum,
Desulfotomaculum halophilum, Desulfotomaculum kuznetsovii, Desulfotomaculum luciae, Desul-
fotomaculum nigrificans, Desulfotomaculum orientis, Desulfotomaculum putei, Desulfotomaculum
ruminis, Desulfotomaculum sapomandens, Desulfotomaculum thermoacetoxidans, Desul-
fotomaculum thermobenzoicum, Desulfotomaculum thermobenzoicum, subsp. thermo-
syntrophicum, Desulfotomaculum thermocisternum, Desulfotomaculum thermosapovorans, and
Sporotomaculum hydroxybenzoicum. A 16S rRNA phylogenetic tree was constructed from a
distance matrix based on the neighbor-joining method (Saitou & Nei, 1987) as implemented in the
TREECON program (Van de Peer & De Wachter, 1995). A manual correction method was applied
and tree topology was re-examined by using bootstrap analysis (100 replicants).

DNA-DNA-hybridizations. DNA was isolated and purified according to Marmur (1961). The DNA
nucleotide composition was determined by the thermal denaturation method (Owen et al., 1961)
and DNA homology was determined by De Ley’s optical reassociation method (De Ley et al.,
1970).

Results

Isolation of pure cultures

Two sites in the Krafla region were sampled: Naumaskjárd and Vití. Naumaskjárd is a
relatively old solfataric field, although no cyanobacterial colonization was visible around the site.
Samples were taken from 9 solfatara ranging in temperature from 40-100 ºC. The Vití site was on
the slope of a young volcano and elemental sulphur was abundant around this site. Samples were
taken from sediments of 11 solfatara with temperatures ranging from 50-90 ºC and pH ranging
from 2.5-5.5. These sediments were used as inoculum and incubated at 60 ºC with methanol and
sulphite as electron donor and electron acceptor respectively. After incubation for 4 weeks sulphide
was produced in three out of twenty enrichment cultures and these positive cultures originated
from the sediments taken from the Vití location. No methane or acetate was produced in any of the
cultures. In none of the enrichments from the Naumaskjárd field was sulphide formation or
bacterial growth observed. A continuous culture inoculated with a Vití sample did produce sulphide

74
 Isolation

at steady state. Sulphide concentrations of 10 to 15 mM were detected, and the methanol was
completely used.
During the isolation procedure the highest dilutions in which colonies were formed ranged
from 10-5 to 10-7. After three successive transfers of isolated colonies to an agar medium, cultures
were expected to be pure. Four strains were obtained in pure culture and designated as strains
V20, V21, and V28 (isolated from batch culture enrichments) and strain V29 (isolated from a
continuous culture experiment).

Morphological and physiological characteristics

Cells of all four isolates were non-motile straight rods (3.5 –5 x 1.5 µm), and were often
observed in pairs or longer chains (Fig.5.1). All four strains were sporulating; spores were central
or terminal, spherical and sporulation caused swelling of the cells to a lemon-shape appearance.
Spores were not extremely resistant to heat sterilization, as was found for some thermophilic
Desulfotomaculum strains (Goorissen, unpublished). Their decimal reduction value at 120 ºC was
below 3 min. The Gram stain result was negative, as often observed for Desulfotomaculum strains
(Sleytr et al., 1969; Rosnes et al., 1991; Liu et al., 1997), but electron microscopic analysis
revealed a typical Gram-positive cell wall architecture (results not shown).

Figure 5.1. Phase-contrast photomicrograph of strain V21T. Bar, 10 µm

All four strains grew at temperatures between 48 and 65 ºC with an optimum growth
temperature of 60 ºC. No growth was observed outside this temperature range. Growth occurred at
initial pH values between 6.4 and 7.9. The optimal pH was 7.3. Optimal growth was observed when
NaCl was omitted from the medium. Yeast extract stimulated growth and a vitamin supplement
was required for growth.
The range of electron donors and acceptors used was similar for the four strains. The
electron acceptors used were sulphate, sulphite, and thiosulphate. Nitrate was tested but not
utilized. The compounds used as electron donors were (mM): lactate (20), fumarate (10), acetate
(10), formate (5) propionate (10), butyrate (10), succinate (10), H2/CO2, glucose (20), fructose (20),
ethanol (20), methanol (20), propanol (10), butanol (5), isobutanol (5). Compounds not used were
isobutyrate (5), 3-chlorobenzoate (2), isopropanol (5), and benzoate (5). Distinguishing features
between the isolates were their µmax on methanol (0.012-0.034 h-1), and their tolerance for NaCl
(0.7-2%). Characteristics of the representative strain V21 compared to its closest relatives are
listed in Table 5.1.

75
Chapter 5

Table 5.1. Characteristics of strain V21T compared to its closest relatives D. kuznetsovii,
D. luciae, and strain TPOSR

Characteristic D. kuznetsovii D. luciae Strain Strain V21T

TPOSR
T optimum (°C) 60-65 nr 55-65 60
T range (°C) 50-85 (50-70) nr (48-65)
Spore-formation + +* + +
Extremely heat resistant spores + nt + -
NaCl requirement - + -
G+C% 49 51.4 55 48.3
sulfide inhibition 15 nr 15 15
(initial concentration, mM)
Gram-stain - - - -
Growth factors required - - nr vitamins
Electron donors
Glucose - - - +
Fructose - nr - +
Formate + + + +
Acetate + - + +
Propionate + - + +
Butyrate + - + +
Lactate + + + +
Fumarate + nr + +
Succinate + - + +
Methanol + - + +
Butanol nr nr nr +
Isobutanol nr nr nr +
H2/CO2 + + + +
µmax on methanol (h-1) 0.033 - 0.03 0.017
Electron acceptors
Sulphate + + + +
Sulphite + - + +
Thiosulphate + + + +
Nitrate - nr - -
Reference Nazina et al., 1987 Liu et al., this report this report
1997
*not confirmed in this study; (+), (weak) growth; (-), no growth; nr, not reported; nt, not tested

76
 Isolation

Phospholipid fatty acid composition of bacterial cultures

Strain V21 contained almost exclusively only i15:0 and i17:0 as PLFA when cultured on methanol
with sulphate (Table 5.2). This simple composition resembles that of D. australicum (Love et al., 1993), a
related strain (Table 5.2). PLFA compositions of D. kuznetsovii and D. thermobenzoicum subsp.
thermosyntrophicum were somewhat more complex, but i15:0 and i17:0 were also major compounds,
together with 15:0 and 16:0 (Table 5.2). The fatty acid composition of D. kuznetsovii reported here was
rather different from data presented by Nazina et al. (1999). Possible explanations for this difference are
that Nazina et al. (1999) studied total extractable fatty acids or - more likely - that they used cultures
grown on propionate and sulphate. The substrate used may influence fatty acid compositions in bacteria
especially when using methanol, a C1 compound.

Table 5.2. PLFA composition of strain V21T compared to some reference strains

PLFA Mol %
Strain V21T Desulfotomaculum D. kuznetsovii D. australicum
thermobenzoicum subsp.
thermosyntrophicum

14:0 2.1 2.7 0.6

i15:0 68.3 55.3 49.0 48.6
a15:0 0.2 0.2 2.9
15:0 1.0 6.6 9.6 0.8
i16:1 1.8
i16:0 1.2 2.3 2.0
16:1ω7c 1.6
16:1ω7t 0.3
16:1ω5 0.1
16:0 2.5 15.7 15.5 7.4
i17:1 0.9 0.5
i17:0 28.1 6.2 13.3 37.4
a17:0 0.7 2.3
cy17:0 0.4
17:0 1.1 1.8
18:1ω9c 2.3
18:1ω7c 1.5
18:0 1.5 2.0
cy19:0 0.6
ref. this report this report this report Love et al., 1993

77
Chapter 5

Figure 5.2. Phylogenetic tree based on 16S rRNA gene sequence comparisons of all validly described
species of the genus Desulfotomaculum and some additional strains. The neighbor-joining
tree was reconstructed from distance matrices and bootstrap values above 50 are
expressed at the branching points. Cluster designation according to Stackebrandt et al.
(1997) and Kuever et al. (1999). Bacillus methanolicus served as outgroup. * = subspecies
thermosyntrophicum

Phylogenetic analysis and taxonomic affiliation

For a phylogenetic screening of the strains, their partial 16S rRNA sequence (790 bp) was
compared and DNA-DNA homology was determined. 16S rRNA sequence similarity between the
isolates was 93% and DNA-DNA homology ranged from 85-92%. The G + C content of the DNA
ranged from 48.3-48.7 mol%. High physiological and phylogenetic similarities between the isolates
justified the choice of one strain, i.e. strain V21, as a representative of this group of isolates. For
further study and taxonomic description, strain V21 was used as a type strain (V21T). A full 16S
rRNA sequence of strain V21T was obtained and compared to sequences of all other described
Desulfotomaculum species (Fig.5.2). The topology of the resulting phylogenetic tree was in
accordance with data published by others (Nilsen et al., 1996; Liu et al., 1997; Stackebrandt et al.,
1997; Pikuta et al., 2000). In the phylogenetic tree, strain V21T consistently branches together with
members of the genus Desufotomaculum of subcluster IC. Its closest relatives are D. kuznetsovii
(93% similarity), D. luciae (92% similarity), and strain TPOSR (92% similarity). Levels of sequence
similarity of ≤95% suggest that the phylogenetic distance is large enough for designation of the

78
 Isolation

strain as a separate species (Stackebrandt & Goebel, 1994). This was confirmed by DNA-DNA
hybridization studies on strain V21T and D. kuznetsovii , showing a homology value of 49%.

Discussion

Strain V21T is able to utilize methanol (Table 5.1), a characteristic it shares only with D.
kuznetsovii, D. thermosapovorans, strain TPOSR, and strain WW1. Methanol utilization by
thermophilic sulphate-reducing organisms is a rare characteristic restricted to species of the genus
Desulfotomaculum. Strain V21T can utilize fructose like the moderate thermophiles D. nigrificans
and D. geothermicum. Glucose utilization has not been described for thermophilic or mesophilic
Desulfotomaculum strains and seems to be a unique property of strain V21T, although growth is
weak. The organism with the closest sequence similarity to strain V21T is D. kuznetsovii. However,
this organism produces extremely heat-resistant spores (Goorissen, unpublished). The second
nearest relative, D. luciae, has a limited substrate range and is not able to grow on methanol and
does not use sulphite. Strain TPOSR, like D. kuznetsovii, produces extremely heat resistant spores
and does not grow on sugars. Moreover, the G+C content of its DNA is far higher than that of our
organism. Strain TPOSR has been isolated from an anaerobic bioreactor on propionate, whereas
strain V21T was obtained from solfataric sediment.
Sulphite may be inhibitory for microorganisms, and a sulphite concentration as low as 40
mg l-1 is inhibitory to sulphate reducing organisms (Widdel & Bak, 1992). However, our batch
culture experiments using V21T, showed that sulphite concentrations up to 1.6 g l-1 did not inhibit
sulphidogenesis with methanol (results not shown). The relatively high initial sulphide
concentration used in our enrichment experiments also may have increased the selection pressure
in favour of sulphate-reducing bacteria. Moreover, the initial sulphide concentration of 5 mM did not
inhibit growth or sulphide production by our isolates. However, initial sulphide concentrations
above 15 mM totally inhibited growth.
Based on the physiological differences of strain V21T with all known related organisms,
combined with the results of DNA-DNA hybridization studies, we propose that strain V12T
represents a new species of the genus Desulfotomaculum.

Description of Desulfotomaculum solfataricum sp. nov.

Desulfotomaculum solfataricum (sol.fa.ta’ri.cum M.L. neutr. adj. solfataricum from solfatara,
referring to the original habitat of the organism). Straight rods that occur singly and in pairs, and
are 1.5-2.5 µm in diameter and 3.5-5 µm long. Spores are spherical and central and distend the
cells. The Gram stain is negative, but the cell wall structure is typical Gram-positive. No gas
vacuoles are observed. The following substrates are utilized as carbon and energy sources in the
presence of sulphate: methanol, ethanol, propanol, butanol, isobutanol, H2/CO2, acetate, formate,
propionate, butyrate, lactate, fumarate, succinate, glucose, and fructose. Electron acceptors used
are sulfate, sulphite and thiosulphate. Nitrate is not utilized. Initial sulfide concentrations up to 15
mM are tolerated. The organism grows fermentatively on lactate. Vitamins are required for growth.
The temperature range for growth is 48-65 ºC: the optimum growth temperature is 60 ºC. The pH
range for growth is 6.4-7.9; the optimum pH is 7.3. The NaCl concentration range for growth is 0-
1.5 gl-1; the best growth is achieved without NaCl. The G + C content of the DNA is 48.3 mol%.
Phylogenetically a member of the subcluster IC of the genus Desulfotomaculum. Isolated from hot
solfataric fields in northeast Iceland. The type strain of Desulfotomaculum solfataricum, strain
V21T, is deposited at the DSMZ with the accession number: DSMZ 14956.

Acknowledgments
The authors thank Lubbert Dijkhuizen for his valuable suggestions, Johan Ørlygsson (Akureyri, Iceland) for
assistance with sample collection, Manny Nienhuis-Kuiper for DNA isolation and PCR amplification, René
Haanstra for 16S rRNA sequencing, and Anatoliy Lysenko at the Moscow State University for G + C analysis
and DNA-DNA hybridization studies. This work was supported by the Technology Foundation STW, of the
Netherlands Organization for Scientific Research (NWO).

79
Chapter 5

References

Beeder, J., Torsvik, T. & Lien, T. (1995). Thermodesulforhabdus norvegicus gen. nov., sp. nov., a novel
thermophilic sulfate-reducing bacterium from oil field water. Arch Microbiol 164,331-336.
Boschker, H. T. S., de Brouwer, J. F. C. & Cappenberg, T. E. (1999). The contribution of macrophyte
derived organic matter to microbial biomass in salt marsh sediments: stable carbon-isotope analysis of
microbial biomarkers. Limnol Oceanogr 44,309-319.
Bouchard, B., Beaudet, R., Villemur, R., McSween, G., Lepine, F. & Bisaillon, J. G. (1996). Isolation and
characterization of Desulfitobacterium frappieri sp. nov., an anaerobic bacterium which reductively
dechlorinates pentachlorophenol to 3-chlorophenol. Int J Syst Bacteriol 64,1010-1015.
Christiansen, N. & Ahring, B. K. (1996). Desulfitobacterium hafniense sp. nov., an anaerobic, reductively
dechlorinating bacterium. Int J Syst Bacteriol 46,442-448.
Daumas, S., Cord-Ruwisch, R. & Garcia, J. L. (1988). Desulfotomaculum geothermicum sp. nov., a
thermophilic, fatty acid-degrading, sulfate-reducing bacterium isolated with H2 from geothermal ground
water. Ant Leeuwenhoek 54,165-178.
De Ley, Cattoir, H. & Reynaerts, A. (1970). The quantitative measurement of DNA hybridization from
renaturation rates. Eur J Biochem 12,133-142.
Elsgaard, L., D., P., Mukwaya, G. M. & Jørgensen, B. B. (1994). Thermophilic sulfate reduction in
hydrothermal sediment of Lake Tanganyika, east Africa. Appl Environ Microbiol 60,1473-1480.
Fardeau, M. L., Ollivier, B., Patel, B.-K. C., Dwivedi, P., Ragot, M. & Garcia, J. L. (1995). Isolation and
characterization of a thermophilic sulfate-reducing bacterium, Desulfotomaculum thermosapovorans sp.
nov. Int J Syst Bacteriol 45,218-221.
Gerritse, J., Renard, V., Pedro Gomes, T. M., Lawson, P. A., Collins, M. D. & Gottschal, J. C. (1996).
Desulfitobacterium sp. strain PCE1, an anaerobic bacterium that can grow by reductive dechlorination of
tetrachloroethene or ortho-chlorinated phenols. Arch Microbiol 165.
Gerritse, J., Drzyzga, O., Kloetstra, G., Keijmel, M., Wiersum, L. P., Hutson, R., Collins, M. D. &
Gottschal, J. C. (1999). Influence of different electron donors and acceptors on dehalorespiration of
tetrachloroethene by Desulfitobacterium frappieri TCE1. Appl Environ Microbiol 65,5212-5221.
Heijthuijsen, J. H. F. G. & Hansen, T. A. (1989). Betaine fermentation and oxidation by marine
Desulforomonas strains. Appl Environ Microbiol 55,965-969.
Henry, E. A., Devereux, R., Maki, J. S., Gilmour, C. C., Woese, C. R., Mandelco, L., Schauder, R.,
Rensen, C. C. & Mitchell, R. (1994). Characterization of a new thermophilic sulphate reducing bacterium
Thermodesulfovibrio yellowstonii, gen. nov. and sp. nov.: its phylogenetic relationship to
Thermodesulfobacterium commune and their origins deep within the bacterial domain. Arch Microbiol
161,62-69.
Isaksen, M. F., Bak, F. & Jørgensen, B. B. (1994). Thermophilic sulfate reducing bacteria in cold marine
sediment. FEMS Microbiol Ecol 14,1-8.
Jørgensen, B. B. & Bak, F. (1991). Pathways and microbiology of thiosulfate transformations and sulfate
reduction in a marine sediment (Kattegat, Danmark). Appl Environ Microbiol 57,847-856.
Kuever, J., Rainey, F. A. & Hippe, H. (1999). Description of Desulfotomaculum sp. Groll as
Desulfotomaculum gibsoniae sp. nov. Int J Syst Bacteriol 49,1801-1808.
Liu, Y., Karnauchow, T. M., Jarrell, K. F., Balkwill, D. L., Drake, G. R., Ringelberg, D., Clarno, R. &
Boone, D. R. (1997). Description of two new thermophilic Desulfotomaculum spp., Desulfotomaculum
putei sp. nov., from a deep terrestrial subsurface, and Desulfotomaculum luciae sp. nov. from a hot spring.
Int J Syst Bacteriol 47,615-621.
Love, C. A., Patel, B. K. C., Nicholas, P. D. & Stackebrandt, E. (1993). Desulfotomaculum australicum, sp.
nov., a thermophilic sulfate-reducing bacterium isolated from the Great Artesian Basin of Australia. System
Appl Microbiol 16,244-251.
Marmur, J. (1961). A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J Mol Biol
3,208-218.
Min, H. & Zinder, S. H. (1990). Isolation and characterization of a thermophilic sulfate-reducing bacterium
Desulfotomaculum thermoacetoxidans sp. nov. Arch Microbiol 153,399-404.
Nazina, T. N., Ivanova, A. E., Kanchaveli, L. P. & Rozanova, E. P. (1987). A new sporeforming
thermophilic methylotrophic sulfate-reducing bacterium, Desulfotomaculum kuznetsovii sp. nov.
Mikrobiologiya 57,823-827.
Nazina, T. N., Turova, T. P., Poltaraus, A. B., Gryadunov, D. A., Ivanova, A. E., Osipov, G. A. &
Belyaev, S. S. (1999). Phylogenetic position and chemotaxonomic characteristics of the thermophilic
sulfate-reducing bacterium Desulfotomaculum kuznetsovii. Mikrobiologiya 68,92-99.

80
 Isolation

Nilsen, R. K., Torsvik, T. & Lien, T. (1996). Desulfotomaculum thermocisternum sp. nov., a sulfate reducer
isolated from a hot North Sea oil reservoir. Int J Syst Bacteriol 46,397-402.
Owen, R. J., Hill, L. R. & Lapage, S. P. (1961). Determination of DNA-base composition from melting
profiles in dilute buffers. Biopolymers 7,503-516.
Pfennig, N. & Lippert, K. D. (1966). Über das vitamin B12-bedürfnis phototropher Schwefelbakterien. Arch
Microbiol 55,245-256.
Pikuta, E., Lysenko, A., Suzina, N., Osipov, G., Kuznetsov, B., Tourova, T., Akimenko, V. &
Laurinavichius, B. (2000). Desulfotomaculum alkaliphilum sp. nov., a new alkaliphilic, moderately
thermophilic sulfate-reducing bacterium. Int J Syst Evol Microbiol 50,25-33.
Plugge, C. M., Balk, M. & Stams, A. J. M. (2002). Desulfotomaculum thermobenzoicum subsp.
thermosyntrophicum subsp. nov., a thermophilic, syntrophic, propionate-oxidizing, spore-forming
bacterium. Int J Syst Evol Microbiol 52,391-399
Rainey, F. A., Ward-Rainey, N., Kroppenstedt, R. M. & Stackebrandt, E. (1996). The genus Nocardiopsis
represents a phylogenetically coherent taxon and a distinct actinomycete lineage; proposal of
Nocardiopsaceae fam. nov. Int J Syst Bacteriol 46,1088-1092.
Rees, G. N., Grassiam, G. S., Sheehy, A. J., Dwivedi, P. P. & Patel, B. K. C. (1995). Desulfacinum
infernum gen. nov., sp. nov., a thermophilic sulfate-reducing bacterium from a petroleum reservoir. Int J
Syst Bacteriol 45,85-89.
Rosnes, J. T., Torsvik, T. & Lien, T. (1991). Spore-forming thermophilic sulfate-reducing bacteria isolated
from North Sea oil field waters. Appl Environ Microbiol 57,2302-2307.
Rozanova, E. P., Tourova, T. P., Kolganova, T. V., Lysenko, A. M., Mityushina, L. L., Yusupov, S. K. &
Belyaev, S. S. (2001). Desulfacinum subterraneum sp nov., a new thermophilic sulfate-reducing bacterium
isolated from a high-temperature oil field. Microbiology 70,466-471.
Saitou, N. & Nei, M. (1987). The neighbour-joining method: a new method for the reconstructing of
phylogenetic trees. Mol Biol Evol 4, 406-425.
Sanford, R. A., Cole, J. R., Loffler, F. E. & Tiedje, J. M. (1996). Characterization of Desulfitobacterium
chlororespirans sp. nov., which grows by coupling the oxidation of lactate to the reductive dechlorination of
3-chloro-4-hydroxybenzoate. Appl Environ Microbiol 64,3800-3808.
Sievert, S. M. & Kuever, J. (2000). Desulfacinum hydrothermale sp. nov., a thermophilic sulfate-reducing
bacterium from geothermally heated sediments near Milos Island (Greece). Int J Syst Evol Microbiol
50,1239-1246.
Sleytr, U., Adam, H. & Klaushofer, H. (1969). The fine structure of the cell wall and cytoplasmic membrane
of Clostridium nigrificans demonstrated by means of freeze etching and chemical fixation techniques. Arch
Microbiol 66,40-58.
Sonne-Hansen, J. & Ahring, B. K. (1999). Thermodesulfobacterium hveragerdense sp. nov., and
Thermodesulfovibrio islandicus sp. nov., two thermophilic sulfate-reducing bacteria isolated from a
Icelandic hot spring. System Appl Microbiol 22,559-564.
Stackebrandt, E. & Goebel, B. M. (1994). Taxonomic note: a place for DNA-DNA reassociation and 16S
rRNA sequence analysis in the present species definition bacteriology. Int J Syst Bacteriol 44, 846-849.
Stackebrandt, E., Sproer, C., Rainey, F. A., Burghardt, J., Pauker, O. & Hippe, H. (1997). Phylogenetic
analysis of the genus Desulfotomaculum: Evidence for the misclassification of Desulfotomaculum
guttoidem and description of Desulfotomaculum orientis as Desulfosporosinus orientis gen. nov., comb.
nov. Int J Syst Bacteriol 47,1134-1139.
Stams, A. J. M., Veenhuis, M., Weenk, G. H. & Hansen, T. A. (1983). Occurence of polyglucose as a
storage polymer in Desulfovibrio species and in Desulfobulbus propionicus. Arch Microbiol 136,54-59.
Tardy-Jacquenod, C., Caumette, P., Matheron, R., Lanau, C., Arnauld, O. & Magot, M. (1996).
Characterization of sulfate-reducing bacteria isolated from oil-field waters. Can J Microbiol 42,259-266.
Tasaki, M., Kamagata, Y., Nakamura, K. & Mikami, E. (1991). Isolation and characterization of a
thermophilic benzoate degrading, sulfate-reducing bacterium, Desulfotomaculum thermobenzoicum sp.
nov. Arch Microbiol 155,348-352.
Trüper, H. G. & Schlegel, H. G. (1964). Sulphur metabolism in Thiorhodaceae I. Quantitative
measurements on growing cells of Chromatium okenii. J Microbiol Ser 30,225-238.
Utkin, I., Woese, C. & Wiegel, J. (1994). Isolation and characterization of Desulfitobacterium dehalogenans
gen. nov., sp. nov., an anaerobic bacterium which reductively dechlorinates chlorophenolic compounds. Int
J Syst Bacteriol 44,612-619.
Van de Peer, Y. & De Wachter, R. (1995). TREECON for Windows: a software package for the construction
and drawing of evolutionary trees for the Microsoft Windows Environment. Comput Appl Biosci 10,569-
570.

81
Chapter 5

Van der Maarel, M. J. E. C., Jansen, M., Haanstra, R., Meijer, W. G. & Hansen, T. A. (1996).
Demethylation of dimethylsulfoniopropionate to 3-S-methylmercaptopropionate by marine sulfate-reducing
bacteria. Appl Environ Microbiol 62,3978-3984.
Weijma, J. 2000. Methanol as electron donor for thermophilic biological sulfate and sulfite reduction. PhD
thesis. Wageningen University, Wageningen, The Netherlands.
Widdel, F. & Bak, F. (1992). Gram-negative mesophilic sulfate-reducing bacteria, p. 3352-3378. In A.
Balows, H. G. Truper, M. Dworkin, W. Harder and K.-H. Schleifer (eds.), The Prokaryotes, 2 nd. ed.
Springer-Verlag, New York.
Widdel, F. & Hansen, T. A. (1992). The dissimilatory sulfate- and sulfur-reducing bacteria, p. 583-624. In A.
Balows, H. G. Trüper, M. Dworkin, W. Harder and K.-H. Schleifer (eds.), The Prokaryotes, 2 nd. ed, vol. 1.
Springer-Verlag, New York.
Zeikus, J. G., Dawson, M. A., Thompson, T. E., Ingvorsen, K. & Hatchikian, E. C. (1983). Microbial
ecology of volcanic sulphidogenesis: isolation and characterization of Thermodesulfobacterium commune
gen. nov. and sp. nov. J Gen Microbiol 129,1159-1169.

82
 6
Summary and
concluding remarks
Chapter 6

The deposition of sulfuroxyanions like sulfate, sulfite and thiosulfate by man causes severe
environmental problems like anaerobiosis of surface water and acid rain. The classical way of
treatment of sulfuroxyanions containing waste streams like flue- gases is a chemical process in
which the sulfur compounds are fixed as the relatively insoluble gypsum (CaSO4).
A biological desulfurization process of flue-gases has several advantages over the classical
chemical desulfurization process. In a biological process, the sulfuroxyanions are converted to the
relatively high valued elemental sulfur. In this two step process an anaerobic stage converts the
sulfur compounds to hydrogensulfide, which is oxidized to sulfur in a second, micro-aerobic
process by Thiobacillus spp. (Janssen et al., 1997). Because most waste streams contain low
levels of electron donors, a relatively cheap electron donor has to be added to the anaerobic stage
of the biological process. As suggested by Dijkuizen et al (1985) the relatively cheap bulk-chemical
methanol is an attractive electron donor in biotechnological processes.
The work described in this thesis focussed on the first, anaerobic stage of the biological
desulfurization process of flue-gas with methanol, i.e. the reduction of sulfuroxyanions. At the start
of this project not much was known about the utilization of methanol as electron donor for such a
thermophilic desulfurization process. Recently, it was shown that in lab scale reactors operated at
high temperatures and fed with methanol and sulfate or sulfite, a desulfurization process could be
easily obtained (Weijma, 2000). The sulfate reducers in these high-rate bioreactors ultimately
outcompeted methanogenic consortia. On the other hand, acetate formation was always present in
a substantial amount, with a maximum of 13% of the degraded methanol. The population in these
bioreactors was partly characterized and consisted of several types of sulfate reducing bacteria.
Methanol was both directly and indirectly used for sulfate reduction.
This thesis deals with the microbiological aspects of thermophilic sulfate reduction using
methanol in order to apply and understand a thermophilic, biological desulfurization process of
flue-gases with the electron donor methanol. Different aspects of sulfate- and sulfite reduction with
methanol were studied:

• Competition and coexistence of different thermophilic species representing the different trophic
groups able to grow in an anaerobic, thermophilic environment with sulfate, methanol, and
sulfide present.
• The nature of the enzymes catalyzing methanol oxidation in the thermophilic sulfate reducers
responsible for the sulfidogenic process with methanol.
• The isolation of new sulfite and/or sulfate-reducing thermophilic sulfate reducers that might be
more appropriate for the applied process.

The General Introduction (Chapter 1) gives an overview of the different fundamental and
applied aspects of thermophilic sulfate-reduction with methanol. The biological flue-gas
desulfurization process is described, and process parameters are determined. In addition, the role
of several different trophic groups, i.e. homoacetogens, methanogenic archaea, and sulfate
reducers that may be involved in an anaerobic sulfidogenic process using methanol as the electron
donor, are discussed. An overview is given of all validly described thermophilic organisms in these
different trophic groups and of the possible degradation pathways of methanol. Furthermore,
because of our choice for the thermophilic sulfate reducer, Desulfotomaculum kuznetsovii as
model organism for our experiments, the genus Desulfotomaculum is described in more detail.
Desulfotomaculum species are spore-producing sulfate reducers, therefore also some attention is
given to the phenomenon of sporulation. The biochemistry of methanol oxidation by sulfate-
reducers is not well studied. The enzymes that might catalyze this reaction in thermophilic sulfate
reducers are described and compared to the enzymes catalyzing this conversion in
homoacetogens and methanogenic archaea. The outcome of competition for the substrate
methanol is unknown and the possible cocultures and syntrophic interactions are described.
Finally, the different factors that affect the fate of methanol in biological desulfurization are
summarized.

84
 Summary

The possible routes followed to obtain a sulfidogenic process with methanol were studied in
Chapter 2. Different kinds of organisms can use methanol, resulting in different end products. If
methanol is used by homoacetogens, acetate is the main end product. However, sulfate reducers
may oxidize the acetate. Moreover, methanogens can use the methanol or the acetate produced
by the activity of homoacetogens, to produce methane. This is an undesirable side-reaction,
because no sulfate reduction can take place. Sulfate reducers can use the methanol directly or
indirectly via acetate, H2/CO2, or formate to produce sulfide. The outcome of the substrate
competition experiments, performed in continuous cultures revealed that at high sulfate
concentrations, sulfate reduction became the dominant process. D. kuznetsovii easily outcompeted
the homoacetogen Moorella thermoautotrophica for the substrate methanol. Both strains were
relatively insensitive for sulfide inhibition. No methanol-utilizing methanogenic archaea growing
under thermophilic conditions have been described to date.
At a sulfide concentration below 5 mM, the methanogenic archaeon Methanothermobacter
thermoautotrophicus could use 14 % of the methanol indirectly via hydrogen transfer for the
production of methane. However, methanogenesis could be irreversibly repressed by applying high
sulfide concentrations of 12 mM or higher. The addition, at low sulfide concentration, of another
sulfate reducer, not able to grow on methanol did cease the methane production, meaning that Mb.
thermoautotrophicus was outcompeted by the Thermodesulfovibrio species for the substrate
hydrogen. A stable coculture of two sulfate reducers was obtained when D. kuznetsovii was grown
with the Thermodesulfovibrio species, but D. kuznetsovii remained the dominant organism in the
coculture.
From these mixed culture experiments it was concluded that at high sulfide concentrations
sulfate-reduction was the dominant process, although it can result from both indirect and direct
utilization of methanol. At low sulfide concentration, methanogenesis may occur, although this can
be suppressed by the addition of another, hydrogen utilizing sulfate reducer which outcompeted
the methanogenic archaeon.
In future studies more emphasis should be placed on the coexistence of different sulfate
reducers in the same environment, because this highly influences the spectrum of end products
formed in anaerobic bioreactors. A suitable sulfate reducer might use the minor side-product
acetate, found in the bioreactors described by Weijma (2000).

The biochemistry of methanol oxidation in sulfate reducers is largely unknown. In Chapter 3

we measured activities of enzymes possibly involved in methanol conversion in D. kuznetsovii.
Methyltransferase activities with tetrahydrofolate as acceptor could not be detected in D.
kuznetsovii. However, low NAD-dependent and dye-linked methanol dehydrogenase activities
were detected and an ethanol dehydrogenase could be purified partly. This enzyme, with a subunit
of 42 kDa is oxygen sensitive and shows low activity with methanol and 10-fold higher activity with
ethanol. The Km value for ethanol and methanol were 1 mM and 13 mM respectively. From 2D-
gelelectrophoresis experiments it was concluded that enzymes were induced by growth on
methanol. However, we could not identify solitary enzyme spots for N-terminal amino acid
sequence determination. From these experiments it is not clear whether the purified alcohol
dehydrogenase is the main enzyme responsible for the methanol oxidation in D. kuznetsovii and
further studies are needed.

In Chapter 4 we describe an unusual characteristic of D. kuznetsovii, namely its production of

extreme heat resistant spores. All Desulfotomaculum strains produce spores, but we discovered
that D. kuznetsovii spores exhibit an unusual heat resistance. Heat resistant spores are found in
species of related genera such as Clostridium and Moorella, but only one Desulfotomaculum strain
is currently known for its heat resistant spores. This strain, D. nigrificans has a decimal reduction
value at 120 ºC of 5 min. All thermophilic Desulfotomaculum strains were compared regarding their
heat resistant spores and their decimal reduction values at temperature of 120 ºC were
determined. We discovered that D. kuznetsovii produced spores with a D120-value of 4 hours and a
D140-value of 15 min, which both are unprecedented. Comparison with the other thermophilic

85
Chapter 6

Desulfotomaculum strains made clear that heat-resistant spore production is not an intrinsic
property of the thermophilic Desulfotomaculum species. Only strain WW1 and strain TPOSR had
D120-values comparable to D. kuznetsovii. This exceptional property of D. kuznetsovii makes it very
difficult to work with this organism in complex apparatus, such as a continuous system. In future
studies the nature of the D. kuznetsovii spores should be studied in more detail, in order to explain
their unusual heat-resistance.

In Chapter 5 the isolation of a new, thermophilic Desulfotomaculum strain i.e.

Desulfotomaculum solfataricum is described. D. solfataricum was isolated from slurry of hot
solfataric fields in Iceland and enriched on sulfite and methanol. D. solfataricum can use methanol,
ethanol, propanol, H2/CO2, acetate, fructose, and glucose as an electron donor. Sulfate, sulfite,
thiosulfate and not nitrate were used as electron acceptor. D. solfataricum is closely related to
other thermophilic Desulfotomaculum species and it grows on methanol with a specific growth
rate 2-fold lower compared to D. kuznetsovii, its closest relative. D. solfataricum produces spores,
however, they are not heat-resistant.

References

Dijkhuizen, L., Hansen, T. A. & Harder, W. (1985). Methanol, a potential feedstock for biotechnological
processes. Trends in Biotechnology 3,262-267.
Janssen, A. J. H., Ma, S. C., P.Lens & Lettinga, G. (1997). Performance of a sulphide oxidizing expanded
bed reactor supplied with dissolved oxygen. Biotechnol Bioeng 53,32-40.
Weijma, J. 2000. Methanol as electron donor for thermophilic biological sulfate and sulfite reduction. PhD
thesis, Wageningen University, Wageningen, The Netherlands.

86
 7
Summary in dutch
Samenvatting
Chapter 7

De uitstoot van rookgassen waarin hoge concentraties geoxideerde zwavelverbindingen,

zoals sulfaat, sulfiet en zwaveldioxide, aanwezig zijn, zorgt voor een zware belasting van het
milieu. Zure regen, als gevolg van de vorming van zwavelzuur en het ontstaan van zuurstofarm
oppervlaktewater zijn o.m. gevolgen van deze uitstoot. Om de lozing van zwavelverbindingen in
het milieu te voorkomen, worden deze selectief verwijderd uit rookgassen via een ontzwavelings
proces. Conventionele ontzwaveling vindt plaats via een chemisch reactie proces, waarbij gips
(calciumsulfaat) het eindproduct is. Nadeel van deze methode is een hoog energie- en
chemicaliëngebruik. Bovendien bevat dit gips verontreinigingen zoals bijvoorbeeld vliegas en heeft
het een beperkte toepasbaarheid.
Een minder belastende manier van ontzwaveling van rookgassen is de biologische
ontzwaveling, waarbij gebruik wordt gemaakt van verschillende soorten micro-organismen
(Dijkman, 1995). Dit proces wordt in twee stappen uitgevoerd: een anaëroob proces, waarin
sulfaatreducerende bacteriën (SRB) met behulp van een geschikte elektronendonor (‘substraat’)
de geoxideerde zwavelverbindingen (elektronenacceptoren) omzetten in hoofdzakelijk
waterstofsulfide (H2S). En een aëroob proces, waarin zwavel-oxiderende bacteriën (bijv.
Thiobacillus soorten) dit waterstofsulfide omzetten in elementair zwavel (Janssen et al., 1995). Het
grote verschil in redoxpotentiaal tussen beide processen verlangt dat ze zich afspelen in ruimtelijk
van elkaar gescheiden compartimenten, bijvoorbeeld bioreactoren. Dit proefschrift handelt over de
biologische sulfaatreductie in de anaërobe processtap.
Het influent van zo’n anaërobe bioreactor bestaat uit een warme (55-65 oC), sulfaat-en
sulfiethoudende oplossing, afkomstig van het wassen van de zwaveldioxide uit de rookgasstroom
met een bicarbonaat oplossing. Aan dit influent moeten extra voedingsstoffen toegediend worden
waaronder een externe elektronendonor, ten behoeve van de SRB. Het relatief goedkope
methanol is in dit onderzoek gebruikt als elektronendonor. Het influent en de bioreactor zijn niet
steriel en in de reactor kunnen hoge concentraties van het giftige waterstofsulfide optreden. Deze
condities bepaalden de eigenschappen waarop de SRB voor dit onderzoek geselecteerd zijn, te
weten:

• methanol fungeert als elektronendonor

• bij 60-65 oC verloopt groei optimaal
• zowel sulfaat als sulfiet kunnen als elektronenacceptor dienen
• tolerantie tegen waterstofsulfide is hoog
• kinetische eigenschappen beïnvloeden de concurrentie om het substraat methanol met
andere organismen in gunstige zin

Het onderzoek beschreven in dit proefschrift is gericht op het verkrijgen van meer inzicht in
de microbiologie en biochemie van thermofiele sulfaatreductie met methanol.

In de algemene inleiding (Hoofdstuk 1) wordt een uitgebreid overzicht gegeven van alle
mogelijke thermofiele bacteriën die betrokken kunnen zijn bij de anaërobe omzetting van methanol.
In samenhang hiermee worden de mogelijke anaërobe afbraakroutes van methanol beschreven.
De SRB worden geïnventariseerd en vergeleken wat betreft hun geschiktheid voor het beoogde
proces. Voor zover bekend zijn er slechts enkele thermofiele SRB beschreven die met methanol
kunnen groeien en dit zijn allen soorten uit het geslacht Desulfotomaculum. Een karakteristiek van
alle soorten uit dit geslacht is dat ze, onder bepaalde omstandigheden in staat zijn specifieke
structuren te vormen, de zogenaamde (endo)sporen. Deze sporen zijn zeer persistent en bevatten
alle genetische informatie van de ‘moedercel’. Sporen zijn bestand tegen extreme omstandigheden
als uitdroging, hitte, koude, uv-straling, ozon etc. en ze kunnen lange tijd in een sluimertoestand
verkeren en, als de condities gunstig zijn, ontkiemen en weer delende cellen vormen.
Sporenvormende bacteriën zijn vaak zeer wijdverspreid en sporen van thermofiele
Desulfotomaculum soorten worden zelfs aangetroffen worden in noordeuropese zeebodem
sedimenten waar de temperaturen veel te laag zijn om te kunnen groeien (Isaksen et al., 1994).
Het proces van sporulering (sporenvorming) wordt in het kort aangestipt.

88
 Samenvatting

Behalve SRB worden ook homoacetogene bacteriën (AB) geïnventariseerd die methanol
kunnen omzetten naar acetaat. Homoacetogenen komen deels voor in dezelfde omgeving als SRB
en zouden kunnen concurreren met de SRB om de elektronendonor methanol. Bovendien kunnen
methanogene archaea (MA) de eventuele bijproducten van de afbraak van methanol, zoals
waterstof of formiaat omzetten in methaan. Deze methanogene archaea worden tevens in dit
hoofdstuk beschreven De mogelijke combinaties van organismen die de afbraak van methanol
zouden kunnen uitvoeren zijn bovendien beschreven. Een schematische weergave van de
mogelijke omzetting van methanol in een anaërobe, thermofiele reactor is weergegeven in Figuur
7.1. Welke route in werkelijkheid zal plaatsvinden, zal voornamelijk afhangen van de groei-
omstandigheden en de kinetische eigenschappen van de organismen.

Figuur 7.1. Mogelijke omzettingsroutes van methanol met bijbehorende trofische groepen in anaërobe
bioreactoren. Symbolen: 1, SRB; 2, AB; 3, MA; - - - -, indirecte omzetting van methanol via
waterstofoverdracht; X, reactie is niet beschreven

De biochemie van de oxidatie van methanol in SRB is nog niet eerder bestudeerd. In dit
hoofdstuk wordt een overzicht van de bekende metabole routes met de bijbehorende katalytische
enzymen gegeven, zoals gevonden in andere methylotrofe organismen.
Besloten wordt met een korte opsomming van andere chemisch/fysische factoren die het beoogde
proces kunnen beïnvloeden.

In Hoofdstuk 2 zijn de mogelijke routes die gevolgd kunnen worden in een thermofiel
sulfaatreducerend proces met methanol in gedefinieerde mengcultures beschreven. Geschikte
vertegenwoordigers van de drie belangrijke trofische groepen van anaërobe organismen
beschreven in hoofdstuk 1 zijn voor deze experimenten gebruikt. Deze organismen zijn in
verschillende combinaties en onder verschillende condities gekweekt in fermentoren (continu
cultures).

89
Chapter 7

Bij gebruik van hoge waterstofsulfideconcentraties in mengcultuur experimenten, bleek

sulfaatreductie het dominante proces te zijn. Methanol werd volledig door Desulfotomaculum
kuznetsovii (het modelorganisme) gebruikt voor sulfaatreductie en D. kuznetsovii domineerde de
homoacetogeen Moorella thermoautotrophica. Acetaat speelde geen rol als tussenproduct in deze
concurrentie om methanol. Beide organismen waren relatief ongevoelig voor hoge
waterstofsulfideconcentraties, één van de factoren die de uitkomst van de concurrentie om het
substraat kunnen beïnvloeden. Er zijn geen methanol gebruikende thermofiele MA beschreven,
maar MA kunnen wel een rol spelen in de concurrentie met SRB en/of AB om bijproducten, zoals
waterstof. Bij lage waterstofsulfideconcentraties (5 mM) was de methanogeen
Methanothermobacter thermoautotrophicus in staat 14 % van de methanol indirect, via
waterstofoverdracht van zowel D. kuznetsovii, als van M. thermoautotrophica, om te zetten naar
methaan, echter, bij hoge waterstofsulfideconcentraties (> 11 mM) werd methaanvorming
duurzaam onderdrukt en speelde geen rol van betekenis meer. Het toevoegen van een
sulfaatreduceerder die geen methanol kan gebruiken maar wel waterstof (Thermodesulfovibrio
soort), aan een mengcultuur van D. kuznetsovii en Methanothermobacter thermoautotrophicus (bij
lage sulfideconcentraties), deed de methaanproductie stoppen. Dit betekent dat de
waterstofgebruikende Thermodesulfovibrio soort, Methanothermobacter thermoautotrophicus
volledig domineerde en de concurrentie om waterstof won. Een stabiel verkregen cocultuur van
twee sulfaatreduceerders, namelijk D. kuznetsovii en de Thermodesulfovbrio soort, kon verklaard
worden uit waterstofoverdracht van D. kuznetsovii naar de Thermodesulfovibrio soort.
Belangrijkste conclusie uit al deze mengcultuur experimenten is, dat bij hoge
waterstofsulfideconcentraties, sulfaatreductie met methanol het dominante proces wordt (zie
Figuur 7.2). Deze sulfaatreductie kan resultaat zijn van direct en indirect (via waterstofoverdracht)
gebruik van methanol. Bij lage waterstofsulfideconcentraties zou methaanvorming een rol kunnen
spelen, maar deze kan effectief onderdrukt worden door toevoeging van een waterstofgebruikende
SRB.

Sulfide
(H2S)

1 1

Methanol
(CH3OH)

Methaan
(CH4)

Figuur 7.2. Dominante omzettingsroutes van methanol zoals bepaald in gedefinieerde mengcultures.
Symbolen: 1, SRB; 3, MA; - - - -, indirecte omzetting van methanol via waterstofoverdracht

90
 Samenvatting

In studies naar substraatgebruik voor sulfaatreductie zou meer aandacht besteed kunnen
worden aan de coëxistentie van SRB met verschillende eigenschappen. De uitkomst van de
concurrentie om substraten en de resulterende eindproducten in bijvoorbeeld bioreactoren, worden
in hoge mate bepaald door de samenstelling van de sulfaatreducerende populatie. Een geschikte
SRB zou bijvoorbeeld in de bioreactoren van Weijma (2000) het residuele acetaat kunnen
gebruiken voor sulfaatreductie.

In Hoofdstuk 3 is getracht de enzymen die de methanol oxidatie in D. kuznetsovii

katalyseren te karakteriseren. Methyltransferasen, die de methylgroep van methanol overdragen
naar een acceptor, bijvoorbeeld tetrahydrofolaat, zijn niet aangetroffen in D. kuznetsovii. Er werd
echter wel een alcoholdehydrogenase activiteit gevonden in D. kuznetsovii en dit
alcoholdehydrogenase enzym werd gedeeltelijk gezuiverd en gekarakteriseerd. Dit enzym is
gevoelig voor zuurstof en vertoont een activiteit met ethanol die 10 keer zo hoog is als de activiteit
met methanol. Uit eiwitpatroonanalyses werd geconcludeerd dat bij groei op methanol, specifieke
enzymen worden geïnduceerd. Deze enzymen konden echter niet worden geïsoleerd zodat
karakterisering niet mogelijk was.
Uit bovengenoemde experimenten kon niet met zekerheid geconcludeerd worden of het
geïsoleerde alcoholdehydrogenase het belangrijkste enzym in D. kuznetsovii is dat
verantwoordelijk gesteld kan worden voor de methanol oxidatie. Uitbreiding van het onderzoek
naar de inductie van specifieke enzymen door methanol en de analyse van die enzymen zou meer
duidelijkheid hieromtrent kunnen opleveren.

In Hoofdstuk 4 wordt een bijzondere eigenschap van D. kuznetsovii beschreven, namelijk

de productie van extreem hitteresistente sporen. In Fig. 7.3 is het verschil zichtbaar tussen een
gewone staafvormige cel van D. kuznetsovii en een citroenvorm-achtige, sporenvormende cel.

a b

Figuur 7.3. Elektronenmicroscopische opname van niet-sporulerende (a) en sporulerende (b) cellen van
D. kuznetsovii.

Alle Desulfotomaculum stammen produceren sporen, maar tijdens de experimenten met D.

kuznetsovii in fermentoren werden we geconfronteerd met de ongewoon extreme hitteresistentie
van D. kuznetsovii sporen. Fermentoren waarin D. kuznetsovii was gekweekt konden niet meer
met de gangbare sterilisatie methoden (20 min, 121 ºC) gesteriliseerd worden. Na sterilisatie
ontstond er spontaan groei in de fermentoren als gevolg van het kiemen van de sporen. Extreme
procedures zouden nodig zijn om de gebruikte fermentoren sporenvrij en steriel te maken. Het
bleek wel dat de condities waaronder de sporen gevormd werden, zoals de samenstelling van het
betreffende kweekmedium, de hitteresistentie van de sporen enigszins konden beïnvloeden.
Hitteresistente sporen worden gevonden in soorten uit geslachten die verwant zijn aan het
geslacht Desulfotomaculum, zoals Clostridium, Moorella, en Bacillus. Echter, slechts één extreem
hitteresistente sporenvormende Desulfotomaculum stam was bekend en dat is D. nigrificans, een

91
Chapter 7

gematigd thermofiel organisme. De decimale reductietijd bij 120 ºC (dat is de incubatietijd bij een
temperatuur van 120 ºC , nodig om 90% van de sporen te doden) van de sporen van D. nigrificans
is 5 minuten (Donnelly & Busta, 1980). Uit onderhavig onderzoek bleek echter, dat D. kuznetsovii
sporen produceert met een D120 van 4 uur en een D140 van 15 min, wat uitermate uitzonderlijk
genoemd mag worden.
Alle bekende thermofiele Desulfotomaculum stammen zijn in dit onderzoek vergeleken wat
betreft hun decimale reductietijd tijd bij 120 ºC (D120). Uit deze vergelijking bleek dat extreem
hitteresistente sporenvorming niet inherent is aan deze groep van organismen. Alleen
Desulfotomaculum stam WW1 en Desulfotomaculum stam TPOSR vormden ook extreem
hitteresistente sporen, doch met een beduidend lagere D120 dan D. kuznetsovii. De structuur van
de spore van D. kuznetsovii vertoont bij een elektronenmicroscopische opname (Fig. 7.3) geen
opvallende verschillen - die de extreme hitteresistentie zou kunnen verklaren - met die van niet
hitteresistente sporenvormende Desulfotomaculum soorten.
Deze uitzonderlijke eigenschap van D. kuznetsovii maakt het bijzonder lastig om met dit
organisme te werken in complexe kweeksystemen zoals fermentors. In vervolgonderzoek zou
zowel meer aandacht aan de oorzaak van deze extreem hitteresistente sporenproductie, als aan
hoe dergelijke organismen te gebruiken in laboratoria, besteed kunnen worden. Bovendien zou in
de voedselverwerkende industrie meer rekening gehouden moeten worden met de mogelijke
aanwezigheid van andere dan de klassieke voedselbedervende sporenvormers als Clostridium en
Bacillus soorten in voedselproducten.

Hoofdstuk 5 beschrijft de isolatie van een onbekende, thermofiele Desulfotomaculum

stam, namelijk Desulfotomaculum solfataricum. D. solfataricum is geïsoleerd uit moddermonsters
afkomstig van solfatara (hete zwavelpoelen van vulkanische oorsprong) in IJsland en verrijkt op
methanol en sulfiet. D. solfataricum kan een breed spectrum aan substraten gebruiken, waaronder
alcoholen en vetzuren. Opmerkelijk is het gebruik van de suikers fructose en glucose, dat niet
voorkomt bij andere thermofiele Desulfotomaculum soorten. Als elektronenacceptoren kunnen
behalve sulfiet, ook sulfaat en thiosulfaat, maar niet nitraat gebruikt worden. Fylogenetisch gezien
is D. solfataricum nauw verwant aan D. kuznetsovii, stam TPOSR en D. luciae. D. solfataricum
groeit op methanol met een specifieke groeisnelheid die 2 keer zo laag is als die van D.
kuznetsovii. Ook D. solfataricum vormt sporen, deze zijn echter niet extreem hitteresistent.

Bibliografie

Dijkman, H. (1995). Biological gas desulfurization. 9th Forum for Applied Biotechnology, Ghent, Belgium,
27-29 September, 1995. Meded Fac Landbouwwet Rijksuniv Gent; 60,2677-2684.
Donnelly, L. S. & Busta, F. F. (1980). Heat resistance of Desulfotomaculum nigrificans spores in soy protein
infant formula preparations. Appl Environ Microbiol 40,721-725.
Isaksen, M. F., Bak, F. & Jørgensen, B. B. (1994). Thermophilic sulfate reducing bacteria in cold marine
sediment. FEMS Microbiol Ecol 14,1-8.
Janssen, A. J. H., Sleyster, R., Kaa, C. v. d., Jochemsen, A., Bontsema, J. & Lettinga, G. (1995).
Biological sulphide oxidation in a fed-batch reactor. Biotechnol Bioeng 47,327-333.
Weijma, J. 2000. Methanol as electron donor for thermophilic biological sulfate and sulfite reduction. PhD
thesis. Wageningen University, Wageningen, The Netherlands.

92