Assignment 3

1. Forward Primer: 5’CATATG-ATGGGAAGGGCTCCTTGT…3’

Reverse Primer: 5’GGGCCCTCACTCTAATAAAGATTCT…3’
2. The size of the fragment that will be showed up on the gel will be 7900 bp and 28 bp.
However, this could create some errors when the interest gene is going to attach on the
plasmid because at the end of the gene interest there will be the same restriction enzymes
which are also available on the plasmid. This could cause another cut automatically then
it is hard for the interest genes to transcribe into this plasmid and it will never produce
any product since it will not attach one another.

m
er as
3. Forward Primer: 5’GGATCC-ATGGGAAGGGCTCC...3’

co
Reverse Primer: 5’CCTAGGTCACTCTAATAAAG…3’

eH w
4. In this case, BsrI and PflFI can not be contributed during this procced since it might cut

o.
rs e
on the inserted genes that want to be cloned, in addition, the restriction site of enzyme
ou urc
AgeI and SacII can not be found on the circular plasmid that it is using for the clone.
Thus, the between these 4 enzyme that can be proceed during this cloning will be BamHI
o

and AflII to avoid any cut in the interested gene that needs to be inserted.
aC s

On 1st Lane would be getting 2 bands which are 6,510 bp and 1,477 bp
vi y re

On 2nd Lane would be getting 2 bands which are 5,920 bp and 2,067 bp
On 3rd Lane would be getting 2 bands which are 6,215 bp and 1,772 bp
ed d

5. a). Plate C
ar stu

Reason: Transformed Bacteria with the interest plasmid is able to survive when
Ampicilin is existed due to the activity of the plasmid inside. Thus, it can be
is

growth although there is an Ampicilin antibiotic.

Th

b). Plate D
Reason: When Ampicilin is not exist, the transformed bacteria with the interest
plasmid is still remained, and also the plasmid inside is just inactivated because
sh

nothing’s triggered the plasmid to be activated. Thus, the growth colonies in the final
result are the live transformed bacterias.
c). Plate A

This study source was downloaded by 100000833857888 from CourseHero.com on 10-28-2021 15:21:32 GMT -05:00

https://www.coursehero.com/file/89870821/Assignment-3-BIOL-2071docx/
 Reason: When the transformed bacteria is being mixed with the water and no
antibiotic existence then the final result has a growth colony on the plate. By this can be
generelized that the result on the plate is just contaminated bacterias that are from the lab
d). Plate E
Reason: When the water was tested with the existence of antibiotic (Ampicilin), there
is no any growth colony which can be concluded that any random bacterias in the lab
environment whether it might be resistant to the antibiotic or not are died. Therefore,
there will be no contamination from bacterias who are antibiotic resistant in the lab
environment.
e). Cell Bacteria alone
Reason: When there is no Antibiotic inside the plate, this cell will still remain alive

m
er as
since there is nothing that could kill this bacteria. However, when on the plate there is an

co
eH w
Antibiotic that will be mixed by this cell, it will not be resistant since there will be no

o.
gene ineterest that could protect this bacteria from the antibiotic. Thereby, this bacteria
rs e
will die immediately which will result nothing on the plate.
ou urc
f). Based on the given data, in my point of view, the experiment on plate A was
contaminated with random bacterias from the lab environment but those bacteria are not
o

antibiotic resistant due to the fact of the result of plate E which is the tested water (only).
aC s
vi y re

Since on plate B which is water only who did not have any Ampicilin existence on the
plate, the final result got any colony which could be told that there was contamination
bacterias in that water. Therby, any bacterias who are trasnformed with this water will be
ed d
ar stu

contaminated with the random bacterias who are not resistant to Ampicilin.
g). In my opinion, it was a succesful experiment for getting the transformed bacteria with
the plasmid inside according to the result of plate C. The colonies on the plate showed hat
is

the transformed bacterias who contain plasmid in it are resistant where the Antibiotic was
Th

in it. Therefore, the transformed bacterias who contain plasmid and there is an Antibiotic
in it will always survive based on this given data.
sh

6. To construct pGADT7-AD plasmid with the interest gene from GmMYB103 gene for
obtaining a cloning product, the gene needs to be amplified in PCR and TF codes of the
gene will be taken off to proceed this cloning. By preparing 15-20 nucleotides of forward
primer and adding BamHI before start codon of the 5’sequence:

This study source was downloaded by 100000833857888 from CourseHero.com on 10-28-2021 15:21:32 GMT -05:00

https://www.coursehero.com/file/89870821/Assignment-3-BIOL-2071docx/
 5’GGATCCATGGGGAAGGGCTC3’as well as the reverse primer on the 5’ sequence:
5’CCTAGGTCACTCTAATAAAG3’. The restriction enzyme digested the primers
staggerly which could transform into the plasmid which also has the same restriction
eznyme on the interest gene to be attached. This proceed will occur in MCS site of the
plasmid. These primers of GmMYB103 gene that contains the codes will be attached on
the restriction enzymes on pGADT7-AD plasmid who has BamHI and AflII enzymes on
the fragment, and it will ligate by DNA ligase helped.

m
er as
co
eH w
o.
rs e
ou urc
o
aC s
vi y re
ed d
ar stu
is
Th
sh

This study source was downloaded by 100000833857888 from CourseHero.com on 10-28-2021 15:21:32 GMT -05:00

https://www.coursehero.com/file/89870821/Assignment-3-BIOL-2071docx/
Powered by TCPDF (www.tcpdf.org)