FACULTY OF HEALTH AND APPLIED SCIENCES

DEPARTMENT OF HEALTH SCIENCE

QUALIFICATION: BACHELOR OF SCIENCES

QUALIFICATION CODE: 07BOSC LEVEL: 7

COURSE CODE: BIO702S COURSE NAME: BIOTECHNOLOGY

DATE: 16 SEPTEMBER 2021 TEST 1 MEMO

DURATION: 70 MINUTES MARKS: 70

EXAMINER DR NORMAN MUZHINJI

MODERATOR DR J. D. UZABAKIRIHO

INSTRUCTIONS
1. All examination RULES apply
2. Answer ALL the questions.
3. Write clearly and neatly.
4. Number the answers clearly.
5. All written work MUST be done in BLUE or BLACK ink.
Section A: Multiple choice questions (10 marks)

1. Which of the following choices best represents the phenotype of a cell containing a
mutation in the Lac I gene?

A Constitutive expression of the lac operon A

B No expression of the operon; RNA polymerase cannot bind properly
C Lactose can enter the cell, but cannot be broken down
D Lactose cannot enter the cell

2. Biotechnology is a recent science gaining much attention because of the COVID-19

pandemic. True or False? Justify your answer: (2)

Answer

False. Biotechnology is not a recent science that has gained functionality over the last
two decades. Biotechnology has been present in various iterations over the course of
history. Utilizing yeast to ferment and create alcohol is one form of biotechnology.
Utilizing in E coli vector to synthesize insulin was discovered in the 1960s.

3. Control of gene expression in eukaryotic cells occurs at which level(s)?

A. Only the transcriptional level D

B. Epigenetic and transcriptional levels
C. Epigenetic and transcriptional and translational levels
D. Epigenetic and transcriptional, translational, and post-translational level.

4. What would happen if the operator sequence of the lac operon contained a mutation
that prevented the repressor protein from binding the operator?

A. In the presence of lactose, the lac operon will be transcribed. A

B. In the absence of lactose, the lac operon will not be transcribed.
C. The cAMP-CAP complex will not increase RNA synthesis.
D. The RNA polymerase will not bind the promoter

5. What is the most logical sequence of steps for inserting foreign DNA into a plasmid
and inserting the plasmid into bacterium?

I) Transform bacteria with recombinant DNA molecule.

II) Extract plasmid DNA from bacterial cells and your gene of interest.
III) Hydrogen-bond the plasmid DNA to non-plasmid DNA fragments.
IV) Use ligase to seal plasmid DNA to non-plasmid DNA
V) Cut the plasmid DNA and DNA using restriction enzymes.
Answer
A. II, V, III, IV, I A
B. II, V. IV, III, I
C. I, V, IV, II, III
D. IV, I, II, V, III

6. Which of the following methods would you use to analyze gene expression changes?

A. Agarose gel electrophoresis

B. Southern blotting
C. Northern blotting C
D. Calcium chloride transformation

7. What is the role of the plasmid in molecular cloning?

A. They are used to create clones.
B. They are used as vectors to insert genes into bacteria. B
C. They are a functional part of binary fission.
D. They contain the circular chromosome of prokaryotic organisms.

8. Which of the following is required for repairing the phosphodiester backbone of DNA
during molecular cloning?

A. cDNA
B. Reverse transcriptase
C. Restriction enzymes
D. DNA ligase D

9. The enzyme that uses RNA as a template to produce a DNA copy is called:

A. A restriction enzyme
B. DNA ligase
C. Reverse transcriptase C
D. DNA polymerase
Section B: Answer all questions and use the spaces provided (60 Marks)

1. A) List any three applications of traditional biotechnology in Namibia, giving

relevant examples for each (3)

a.

b.

c.

Answers

• Brewing industry-Beer making; (National Breweries of Namibia)

• Dairy industry-Yoghurt making (Nam Dairies)
• Agriculture-Plant breeding, Tissue culture (Ministry of Agriculture, Seed houses)
• Bread making (Bakpro, Namib Mills)

Application + example = 1 mark; otherwise, half mark will be added.

2. Recombinant DNA technology tools and techniques have been copied from nature.
Discuss giving at least four examples (4)

Answer
• In nature, restriction enzymes (REs) prevent bacterial infection by slicing
foreign DNA especially from viruses. Scientists use REs to cut DNA e.g gene
of interest or plasmid in the laboratory
• Plasmids- Are circular extrachromosal self-replication DNA materials that
provide bacteria with genetic advantages, such as antibiotic resistance.
Antibiotic resistance has been exploited as a selectable marker in the laboratory
for selection of transformants.
• Agrobacterium tumefaciens, naturally infects plants causing crown galls. Its
used in the laboratory to transfer recombinant DNA into the host plants
• DNA ligase is used to seal DNA fragments during DNA replication the same
function it performs in the laboratory.
• PCR method used to amplify DNA is copied from DNA replication
3. Given a string of nucleotides, how do you determine if there are similar sequences in
the database? (3)

Answer

• BLAST in NCBI or any other nucleotide database

• Look for similar sequences from the results
• Similarity identity at from 99-100% recommended

4. Restriction enzymes are extensively used in molecular biology. Below are the
recognition sites of two enzymes, BamHI and BclI. BamHI, cleaves between G and A
and BclI cleaves after the first T and G.

5’ GAATCCTGATCA 3’ BamHI
3’ CTTAGGACTAGT 5’

5’ GAATCCTGATCA 3’ BcII
3’ CTTAGGACTAGT 5’

If the DNA sequence given below is cut with BamHI, how many DNA fragment
would you expect? Write out the sequence of these double-stranded DNA fragments.
(3)

5’ ATTGAGGTTCCGTAATGTGTCCTGATCACGCTCCACG 3’
3’ TAACTCCAAGGCATTACACAGGACTAGTGCGAGGTGC 5’

Answer
5’ ATTG 3’
3’ TAACTCCAAGGCATTACACA3’

5’GGTTCCGTAATGTGTCCTG 3’
3’GGACTAGTGCGA5’

5’ATCACGCTCCACG 3’
3’GGTGC 5’

5. Tomato variety STAR 9037 mostly grown in Namibia is susceptible to Tuta absoluta
a devastating insect that affect tomato fruits and leaves. Scientist discovered that a
tobacco variety resistant to Tuta absoluta resistant and the gene responsible for
resistance is tar. As a student of biotechnology, you have been assigned to clone the
gene tar into tomato variety STAR 9037.

a. What basic steps would you carry to produce a genetically engineered STAR
9037 carrying the tar gene? Illustrate your answer by well labelled diagram (10)
 b. How can the tomato variety STAR 9037 that carries the tar gene be identified in
the laboratory? (2)

Answer
a. Steps required to clone a foreign gene in a bacterial plasmid
– The genomic DNA and a bacterial plasmid are isolated away from their
sources and purified’. Plasmid can be isolated using ultracentrifugation or
alkaline lysis
– Both are cut with the same restriction enzyme e.g Hind III
– The fragments are mixed, and DNA ligase is added to bond the fragment
sticky ends
– Some recombinant plasmids now contain foreign DNA some plasmids don’t
– DNA mixture is added to bacteria (Agobacterium tumafaciens) that have been
genetically engineered to accept it
– The bacteria are plated on a type of agar that selects for the bacteria with
recombinant plasmids
– This results in the cloning of many foreign DNA fragments, including the
gene of interest (tar)
– Transform the tomato plants with Agrobacterium tumafaciens, use tissue
culture
b. Use PCR, with primers that target the tar gene

6. Explain the three disadvantages of cloning human genes into bacteria to treat human
diseases caused by specific protein deficiencies? (3)

Answer
• Inability of bacteria as a prokaryotic to carry out posttranslational modification
which is typical for eukaryotic;
• Inability of bacteria as a prokaryotic to carry out posttranscriptional modification
ie removal of introns which is typical for eukaryotic;
• Some proteins are made in insoluble form, a consequence of protein misfolding,
aggregation, and intracellular accumulation as inclusion bodies;
• Sometimes sufficient expression may not be observed due to protein degradation
or insufficient translation (mRNA may remain in secondary structure and
translation hampered);
• Codon sequence for a specific amino acid in eukaryotic is different from
prokaryotic bacteria. This phenomenon is known as “codon bias”

7. How do you make 250 ml of a 1.2% agarose gel? (2)

Answer

1.2 g in 100 mls

 Dissolve 3 g in 250 mls of TBE /TAE buffer

8. You are given a 34 bp cDNA sequence of COVID-19 virus isolated from a positive
case.

5’ TCCGGCGGAATTCCAAGGCCTCGTCGACTCCGGC 3’
3’ AGGCCGCCTTAAGGTTCCGGAGCAGCTGAGGCCG 5’

a. You are tasked with amplifying the cDNA sequence using the Polymerase
Chain Reaction (PCR). Design a set of 10-bp primer(s) both forward and
reverse you would use to amplify the entire cDNA sequence given above.
Explain your selection. (3)
b. In the PCR reaction, you need a three-step reaction cycle, which results in a
chain reaction that produces an exponentially growing population of
identical DNA molecules. Each step of a reaction cycle is performed at a
specific temperature i.e., 95oC for Step 1, 55oC for step 2 and 70oC for Step
3.

Briefly explain the three steps and why they are performed under different
temperatures. (6)

c. Estimate the number of copies of each original DNA molecule that would
be present after 25 cycles of PCR ? (2)

Answer
a. Forward primer 5’TCCGGCGGAAT3’
Reverse primer 5’GCCGGAGTCG3’
The primers are complimentary to the forward and reverse stands so they will be
able to anneal by base complementarity rule

b. Denaturation: The reaction temperature is increased to 95 °C, which melts

(disrupts the hydrogen bonds between complementary bases) all dsDNA into
single-stranded DNA (ssDNA).

Annealing: The temperature is lowered to approximately 5 °C below the melting

temperature (Tm) of the primers (often 45–60 °C) to promote primer binding to the
template.
 Extension: The temperature is increased to 72 °C, which is optimum for DNA
polymerase activity to allow the hybridized primers to be extended.

c. 225 =33554432

9. Suppose you are working in a molecular biology laboratory and are having difficulty
performing the PCR successfully. You decide to double-check the PCR protocol
programmed into the thermal cycler and discover that instead of adding Taq polymerase
you added normal DNA polymerase. What effects would this mistake have on your
PCR reaction? (3)

Answer
Taq polymerase is thermostable
DNA polymerase is denatured by excessive temperature
PCR won’t occur because primer elongation won’t take place

10. A Scientists manufactured large quantities of human insulin using genetic engineering.
They started by isolating mRNA from pancreatic cells. From this they produced DNA
which code for insulin.

a. Suggest the major reason why it was better to start with mRNA from
pancreatic cells rather than with the DNA from these cells. (2)

b. Mention the enzyme required to catalyse the reaction (1)

c. What will be the advantages of producing insulin in tobacco plants rather

than in E. coli cells (2)

Answer
a) mRNA does not have introns, while DNA has
b) Reverse transcriptase
c) Tobacco is a eukaryotic organism can perform post transcriptional and
posttranslational modifications. Rapid scalability, that is, up- scaling of plants to as
much area as needed using inexpensive resources

10. Ms Maria Tulelah, a recent graduate in biotechnology gets so excited about genetic
engineering concepts she learnt in BIO702S and wants to clone DNA extracted from
potato leaves in pBluescript 11SK shown below plasmid.
Firstly, she grinds up some potato tissues, extracts the DNA from it and digests the
DNA with two different restriction enzymes (separately, not together): EcoRI and
BamHI. She then obtains a cloning vector pBluescript 11SK and digests it with the
same two enzymes. She then runs a gel, which is shown below.

a. What are the key characteristics that plasmid pBluescript 11SK have that it can
be used for successful cloning (3)
b. Which enzyme would she use for cloning the potato DNA: EcoRI, or BamHI?
Explain why you made your choice. (2)

c. Notice that the cloning vector made nice, tight bands on the gel, but the potato
DNA just looks like a smear with no distinct bands. However, this is just what
 the Ms Maria Tulelah was expecting, so she’s not worried about it at all.
Explain why this is the expected result. (2)
d. Ms Maria Tulelah now mixes the potato DNA (digested with the enzyme you
specified in part A) with cloning vector DNA (digested with the same enzyme).
He then adds the mixture to E. coli cells that have been treated with CaCl2, heats
briefly to 42°C, adds growth medium and incubate if for an hour. What would
be his next step? Be as specific as possible. (2)
e. Unfortunately, after doing the next step as you specified, Ms Maria Tulelah
doesn’t get a single bacterial colony. Not even one! When she reviews his
procedure, she realizes he left out a critical ste. What did he forget, and why
would this be necessary? (2)

Answer
a. Origin of replication
Selectable marker e.g ampicillin resistance
Multiple cloning sites (MCs)
b. BamHI, because it only cuts the plasmid once—if you cut the plasmid twice,
then both pieces must go back together along with your insert in order to get a
functional recombinant plasmid.
c. Plasmids are small and might have only one or two cut sites for a particular
enzyme. The potato genome is huge and will have hundreds or thousands of
sites for that enzyme. So we expect many, many more fragments, leading to
the smeary appearance. That’s OK, though, because after cloning all the
fragments (to make a library), we’ll have a way to identify the one correct
clone.
d. Now the cells would be put on an antibiotic-containing plate. This will kill any
cell that didn’t get a plasmid and allow those that did to grow into colonies
e. She forgot to add the ligase! Ligase enzyme is needed to join the potato DNA
with the cloning vector to make a single, circular recombinant DNA molecule.