Changes in hormone profiles, growth factors, and mRNA expression of the

related receptors in crop tissue, relative organ weight, and serum biochemical
parameters in the domestic pigeon (Columba livia) during incubation and
chick-rearing periods under artificial farming conditions

P. Xie,∗,†,‡,1 X. P. Wan,§ Z. Bu,# E. J. Diao,∗,†,‡ D. Q. Gong, and X. T. Zou§

∗
Jiangsu Collaborative Innovation Center of Regional Modern Agriculture & Environmental Protection, Huaiyin
Normal University, Huaian 223300, China; † Jiangsu Key Laboratory for Eco-Agricultural Biotechnology around
Hongze Lake, Huaiyin Normal University, Huaian 223300, China; ‡ Jiangsu Key Laboratory for Safety and
Nutrition Function Evaluation, Huaiyin Normal University, Huaian 223300, China; § Feed Science Institute,
Zhejiang University, Hangzhou 310029, China; # Poultry Institute, Chinese Academy of Agricultural Sciences,
Yangzhou 225125, China; and  College of Animal Science and Technology, Yangzhou University, Yangzhou
225009, China

ABSTRACT The present study was conducted to de-
termine the changes in concentrations of hormones and
growth factors and their related receptor gene expres-
sions in crop tissue, relative organ weight, and serum
biochemical parameters in male and female pigeons
during incubation and chick-rearing periods under ar-
tificial farming conditions. Seventy-eight pairs of 60-
week-old White King pigeons with 2 fertile eggs per
pair were randomly divided into 13 groups by differ-
ent breeding stages. Serum prolactin and insulin-like
growth factor-1 (IGF-1) concentrations in crop tissue
homogenates were the highest in both male and fe-
male pigeons at 1 d of chick-rearing (R1), while epi-
dermal growth factor (EGF) in female pigeons peaked
at d 17 of incubation (I17) (P < 0.05). mRNA ex-
pression of the prolactin and EGF receptors in the
crop tissue increased at the end of incubation and
the early chick-rearing stage in both sexes. However,
Key words: pigeon, crop tissue, hormone, growth factor, serum biochemical parameter
estrogen, progesterone, and growth hormone receptor
expression each decreased during the early chick-rearing
stage (P < 0.05). In male pigeons, IGF-1 receptor
gene expression reached its peak at R7, while in fe-
male pigeons, it increased at the end of incubation. The
relative weight of breast and abdominal fat in both
sexes and thighs in the males was lowest at R7, and
then gradually increased to the incubation period level.
Serum total protein, albumin, and globulin concentra-
tions increased to the highest levels at I17 (P < 0.05).
Total cholesterol, triglyceride, and low-density lipopro-
tein reached their highest values at I17 in male pi-
geons and R25 in female pigeons (P < 0.05). In
conclusion, hormones, growth factors, and their recep-
tors potentially underlie pigeon crop tissue develop-
ment. Changes in organs and serum biochemical profiles
suggested their different breeding-cycle patterns with
sexual effects.
2018 Poultry Science 97:2189–2202
http://dx.doi.org/10.3382/ps/pey061

INTRODUCTION hormone ligand in pigeon crop tissue has been exam-

The avian crop plays a major role in food storage
and moistening and provides a functional barrier for
pathogens (Kierończyk et al., 2016), but in brooding pi-
geons, under prolactin stimulation, epithelial cells in the
crop proliferate, accumulate nutrients via unclear mech-
anisms, and finally slough off to complete the “crop
milk” formation (Horseman and Buntin, 1995; Gillespie
et al., 2011). The prolactin receptor interacting with the

C 2018 Poultry Science Association Inc.
ined by gene cloning and binding assays (Shani et al.,
1981; Chen and Horseman, 1994). However, until now,
prolactin seems to be the only factor directly affect-
ing crop milk formation, feeding behaviors, and nest
defense in pigeons during breeding stages (Horseman
and Buntin, 1995; Mohamed et al., 2016). It remains
unclear whether other factors are involved. In mam-
mals, a complex network of endocrine and paracrine
signaling, including various hormones, gonadal steroids,
and cytokines, underlies mammary gland development
(Filgo and Faqi, 2017). Therefore, more detailed infor-

Received December 5, 2017.

mation may be revealed by investigating other hor-
Accepted January 23, 2018. mones or cytokines and their receptors in pigeon
1
Corresponding author: pengxiejqs@126.com crops.

2189
2190 XIE ET AL.
Life-history theory indicates that individuals trade
off current and future reproductive success (Stearns,
1992). Reproduction-induced changes in body weight
or energy reserves suggest a cost to the animal itself
(Gammonley, 1995; Neto and Gosler, 2010). Methods
for balancing breeding efforts between males and fe-
males, and the energy required for survival, sustenance,
and caring for offspring via the interactions between
body condition and nutritional and environmental fac-
tors have always been difficult (Farner and Wingfield,
1980; Scanes et al., 1984). Domestic pigeons are monog-
amous, non-seasonal breeders, and are known for their
biparental care of their eggs and young. Squabs have an
impressive growth performance, nearly reaching adult
body weight at 28 d (Gao et al., 2016). The body weight
loss of parental pigeons under different nutritional ma-
nipulation strategies suggests that their reproduction is
physiologically challenging (Xie et al., 2016).
Animals’ phenotypic flexibility in organ size occurs
in response to environmental factors or physiological
states (Hammond et al., 2001; Bauchinger and Biebach,
2006). Previous studies on migrating birds showed that
digestive organs hypertrophied while flight muscle at-
rophied to facilitate fueling (Piersma and Gill, 1998;
Landys-Ciannelli, 2003). Organ changes in breeding
birds are less studied than those in response to migra-
tion and molting, despite weight loss being common
during reproduction (Gaston and Perin, 1993; Chris-
tians and Williams, 1999; Vézina and Williams, 2003).
In addition, serum biochemical metabolites are impor-
tant indicators of animals’ physiological states. Avian
plasma chemistry studies have examined various as-
pects, including the influence of age (Gao et al., 2016),
sex (Ferrer and Dobado-Berrios, 1998), nutrition (Chen
et al., 2016), and circadian rhythms (Garcı́a-Rodriguez
et al., 1987); however, little information exists on the
dynamic changes in organs and serum biochemical pro-
files of adult pigeons during different breeding cycle
stages.
Therefore, the objective of the present study was to
determine the changes in concentrations of hormones,
growth factors, and gene expression of their related re-
ceptors, organs, and serum biochemical parameters in
male and female pigeons during incubation and chick
rearing under artificial farming conditions.
MATERIALS AND METHODS
All procedures used in this study were approved by
the Animal Care Committee of the Chinese Academy
of Agricultural Sciences.
Birds and Sample Collection
A total of 156 (60 wk of age) adult White King pi-
geons (78 pairs of 78 males and 78 females each) was
obtained from a commercial pigeon farm (Weitekai Pi-
geon Co., Ltd., Wuxi, China). All pairs were coupled
when sexually mature, and chosen from a large flock
(about 2,000 pairs). They all have a non-breeding phase
between egg-laying and chick-rearing stages. Each pair
of parent pigeons was housed in a manmade aviary
equipped with a nest and perch. To avoid egg break-
age, fertile eggs were hatched artificially, and plastic
eggs were provided to maintain broodiness as described
in the previous study (Xie et al., 2017). The time in-
terval between the first and second egg production was
about 44 hours. In order to keep in sync, 2 plastic eggs
were put into cages only after the second egg was laid,
and pigeon squabs hatched from the incubator were
reared by parents after 18 d of incubation. Parent pi-
geons were fed a compound diet of 55% corn, 24.5%
soybean meal (44.2% crude protein), 11% wheat, 1.2%
dicalcium phosphate, 2% limestone, 0.25% salt, 0.5%
vitamin and mineral premix, 2% soybean oil, 3.42%
zeolite powder, 0.07% lysine, and 0.06% methionine
(16.67% crude protein, 12.00 MJ/kg of metabolizable
energy, 1.13% calcium, 0.34% available P, 0.89% lysine,
and 0.31% methionine). The nutrient levels were rec-
ommended by pigeon producers in southern China and
Xie et al. (2017). During the study, caged birds were
housed in a room under a 16L:8D lighting cycle. The
mean daily temperature was 23±4◦ C. Pellet feed, sand,
and water were provided ad libitum.
The parent pigeons were assigned randomly into 13
groups by different breeding stages, which included d 2
(I2), 4 (I4), 6 (I6), 10 (I10), 14 (I14), and 17 (I17) of
the incubation period and d 1 (R1), 4 (R4), 7 (R7),
10 (R10), 15 (R15), 20 (R20), and 25 (R25) of the
chick-rearing period. Pigeons were weighed, and blood
was sampled by wing vein puncture before a 12-hour
fasting. Serum was prepared by centrifugation at 1,500
× g for 20 min at 4◦ C and stored at –20◦ C for subse-
quent analysis. After blood sampling, all pigeons were
euthanized by cervical dislocation. Crop tissues were
quickly frozen in liquid nitrogen and stored at –80◦ C.
Heart, liver, spleen, pancreas, proventriculus, gizzard,
breast, thigh, abdominal fat, and kidney were weighed
and the relative weights (RW) were calculated by ex-
pressing them as a percentage of the whole body weight.
Eggs and baby squabs were transferred to a commercial
pigeon farm to be cared for by other pigeons.
ELISA
Prolactin and gonadal steroid hormones in the serum
were measured using commercial ELISA kits: Human
Prolactin (PRL) ELISA Kit (Abcam Inc., Cambridge,
MA), Estradiol (E2) Parameter Assay Kit (R&D Sys-
tems Inc., Minneapolis, Minnesota), and Progesterone
(P) ELISA Kit (Sigma-Aldrich Corp., St. Louis, MO).
Assays were conducted in duplicate. The minimal de-
tectable dose and intra-assay coefficients of variation
(CV) were 0.05 ng/mL and 6.8% for prolactin, 12.1
pg/mlL and 4.7% for E2, and 0.22 ng/mL and 5.2% for
P, respectively. Absorbance at 450 nm was measured by
microplate reader (SpectraMax M5, Molecular Devices,
Sunnyvale, CA, USA).
 PHYSIOLOGICAL CHANGES IN BREEDING PIGEON
Table 1. Primers used in the present study.1
Target gene Nucleotide sequence (5 →3 )2
PRLR F: ATTATTGAGTGCTCTCGGTTGC
R: TGTCTTGGGTTTGAAGTGTTGA
ER F: CCAGCTTTCACCCTTCATCCA
R: GACAGGCTCCCTTTCTCGTT
PR F: GGCATTGAGCCTGAAGTTGTC
R: ATTCCGAAATCCTGGTAGCA
GHR F: TGCCAACACAGACACCCAAC
R: TTCACACCGTGCTCTCGCCA
INSR F: CTCGGATGAACGAAGAACCTACG
R: AGAGTTGGAAACGGAGATGGGA
EGF receptor F: TACGGCTGCCTCCTTGATTA
R: GCCTCCCTCGGCGTGATA
IGF-1 receptor F: TATGCTGTTTGAACTGATGCG
R: AGTGGGTTGGAGGGTAGAGG
18S F: AGCTCTTTCTCGATTCCGTG
R: GGGTAGGCACAAGCTGAGCC
1
PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR =
insulin receptor; EGF receptor = epidermal growth factor receptor; IGF-1 receptor = insulin-like growth factor (IGF)-1 receptor.
2
F = forward; R = reverse.
Concentrations of epidermal growth factor (EGF)
and insulin-like growth factor-1 (IGF-1) were exam-
ined in the crop tissue. According to the method de-
scribed by Bharathi et al. (1997), the crop was care-
fully excised as a whole and opened longitudinally, and
rinsed in ice-cold saline to remove the contents and
blotted dry. The middle part of the right lateral lobe
was homogenized in 10 volumes of lysis buffer (Key-
GEN, Nanjing, China) with an Ultra-Turrax (T8, IKA-
Labortechnik, Staufen, Germany). The process was
conducted on ice. The homogenate was centrifuged at
10,000 rpm for 10 min at 4◦ C, and the supernatant
was pooled. EGF and IGF-1 were measured using the
ELISA method (Boster Biological Technology, Wuhan,
China) under 450 nm. The detection limit and intra-
assay CV were 7.8 pg/mL and 5.9% for EGF, and 62.5
pg/mL and 7.2% for IGF-1.
RNA Isolation and Real-time Quantitative
PCR
Total RNA was isolated from the crop tissue using
the Trizol method. Briefly, the frozen middle part of
the left lateral lobe was finely shattered in liquid ni-
trogen, and 0.1 gram of tissue powder was immediately
transferred into 1.0 mL Trizol reagent. Then, 200 μL
of chloroform were added, and the mixture was cen-
trifuged at 12, 000 rpm for 10 min at 4◦ C. The aqueous
phase was transferred into another tube. RNA was pre-
cipitated with isopropanol, washed with 75% ethanol,
and finally resuspended in diethypyrocarbonate-treated
H2 O. Genomic DNA was eliminated using RNase-free
DNase (TaKaRa, Dalian, China). RNA quality was ex-
amined by both native RNA electrophoresis and the
UV absorbance ratio at 260 nm and 280 nm. cDNA was
synthesized by M-MLV reverse transcriptase at 42◦ C for
60 min with oligo dT-Adaptor primer.
The mRNA abundances of the prolactin receptor
(PRLR), estrogen receptor (ER), progesterone recep-
2191
Accession No. Size (bp)
NM 0,012,82822 263
NM 0,012,82825 180
XM 02,128,6334 147
NM 0,012,82815 235
XM 02,129,1610 106
XM 02,129,3035 240
Cloned by the author 226
AF173630 256
tor (PR), growth hormone receptor (GHR), insulin re-
ceptor (INSR), EGF receptor, and IGF-1 receptor were
detected by real-time quantitative PCR (qRT-PCR).
The qRT-PCR was performed using SYBR Premix Ex
Taq (TaKaRa, Dalian, China) on an ABI StepOne Plus
Real-Time PCR system (ABI7500, Carlsbad, CA). The
18S rRNA gene was used as the internal control. The
PCR program was 95◦ C for 30 s, followed by 42 cycles
of 95◦ C for 3 s, 60◦ C for 10 s, and 72◦ C for 30 sec-
onds. Each sample was analyzed in triplicate. Melting
curve analysis was used to verify amplification speci-
ficity. The relative expression quantity was calculated
using the 2−ΔΔCt method (Livak and Schmittgen, 2001).
The primers for the receptors and 18S are shown in
Table 1.
Biochemical Study
The concentrations of serum total protein (TP), al-
bumin (ALB), creatinine (CRE), urea nitrogen (UN),
uric acid (UA), glucose (GLU), total cholesterol (TC),
triglyceride (TG), high-density lipoprotein (HDL),
and low-density lipoprotein (LDL) were analyzed by
an automated system (7020 analyzer, Hitachi High-
Technologies Co., Tokyo, Japan) with standard com-
mercial kits following the protocols recommended by
the manufacturer (Nanjing Jiancheng Bioengineering
Institute, Nanjing, China). The serum globulin (GLB)
concentration was calculated by subtracting the ALB
concentration from the TP concentration.
Statistical Analysis
All data were presented as means ± SE. Data were
statistically evaluated using SPSS 17.0 (SPSS Inc.,
Chicago, IL), and analyzed using the GLM procedure.
The model included the main effects of sex, stage, and
their interactions. Differences among breeding stages
2192 XIE ET AL.

were estimated by Duncan post-hoc test. All of the

statements of significance were based on P < 0.05.

RESULTS
PRL, E2, and P
Different breeding stages significantly affected PRL
and E2 concentrations in pigeon serum. PRL concen-
tration ranged from 0.46 to 0.57 ng/mL and 0.29 to
0.47 ng/mL from I2 to I14 in male and female pi-
geons, respectively (Figure 1A). It rapidly reached the
peak value (male: 2.29 ng/mL, female: 1.54 ng/mL) in
both sexes at R1 (P < 0.05), and then gradually de-
creased to the base concentration after R15. In male
pigeons, serum E2 concentration was higher at R10
(39.06 pg/mL) and R15 (46.87 pg/mL) (P < 0.05)
(Figure 1B), but in female pigeons, it increased drasti-
cally after R15 (P < 0.05) (Figure 1B). In both male
and female pigeons, the P concentration showed no
changes during the incubation or chick-rearing period
(P > 0.05) (Figure 1C). An interaction of sex × breed-
ing stage for the concentrations of PRL (P = 0.014),
E2 (P < 0.001), and P (P = 0.027) was observed in the
study (Table 6).

Gene Expression of Hormone Receptors

All hormone receptor genes (PRLR, ER, PR, GHR,
and INSR) were expressed in the crop tissues of both
male and female pigeons. They all varied significantly
with stage and with the interaction of sex and stage
(Table 6). mRNA expression of PRLR showed a sim-
ilar pattern of change in both male and female pi-
geons, reaching peak values at I17 and I14, respectively
(P < 0.05) (Figure 2A). ER gene expression was lower
at R1 in both male and female pigeons (P < 0.05) (Fig-
ure 2B), and PR and GHR gene expression decreased
during the incubation period (P < 0.05) (Figure 2C-
D). PR mRNA reached the lowest level at R1 in both
males and females, and at R4 for GHR. In male pi-
geons, no changes were found in INSR gene expression
in male crop tissue during incubation or chick rearing Figure 1. Concentrations of serum prolactin (A), estradiol (B), and
(Figure 2E). In female pigeons, INSR gene expression progesterone (C) in male and female pigeons during incubation and
chick-rearing periods. The stages included incubation period: I2, I4,
reached a peak value at R4, and then decreased sharply I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15,
during the late chick-rearing period (P < 0.05) (Fig- R20, and R25. Values are means ± SEM (n = 6 males and females).
ure 2E). Data points with the different capital letters (A-F) or lowercase letters
(a-c) are significantly different (P < 0.05).

EGF and IGF-1

EGF and IGF-1 concentrations in crop tissue ho-
mogenates showed similar change patterns in both male
and female pigeons, and they changed significantly with
sex, with stage, and their interaction (Table 7). Rela-
tively higher levels of EGF were found in the late in-
cubation period (after I14) and at the beginning of the
chick-rearing period (before R7) (P < 0.05) (Figure 3).
Peak values for EGF (male: 378.70 pg/mL) and IGF-1
concentrations (male: 5424.20 pg/mL, female: 5064.06
pg/mL) were reached at R1, except for EGF in females
(349.84 pg/mL), which was at I17.
EGF and IGF-1 Receptors
mRNA abundance of the EGF receptor in crop tissue
reached its highest value at I17 in male pigeons and at
R1 in female pigeons (P < 0.05) (Figure 4A), and then
 PHYSIOLOGICAL CHANGES IN BREEDING PIGEON 2193

Figure 2. mRNA expression profiles of prolactin receptor (A), estrogen receptor (B), progesterone receptor (C), growth hormone receptor
(D), and insulin receptor (E) in crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included
incubation period: I2, I4, I6, I10, I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6
males and females). Bars with the different capital letters (A-F) or lowercase letters (a-e) are significantly different (P < 0.05).

decreased to the level at the start of incubation. In male
pigeons, IGF-1 receptor gene expression was highest at
R7, while in females, it increased significantly from I14
to I17 (P < 0.05) (Figure 4B). An interaction of sex
and stage for the gene expression of the EGF receptor
(P = 0.009) and IGF-1 receptor (P < 0.001) also was
observed in the study (Table 6).
Body Weight and Relative Organ Weight
As shown in Figure 5, body weight of both male pi-
geons and female pigeons was the greatest at I17, and
it decreased significantly at R15 in males and R7 in
females (P < 0.05). Different incubation and chick-
rearing stages did not affect the RW of the heart, liver,
2194 XIE ET AL.

Figure 3. Concentrations of epidermal growth factor (EGF) (A) and insulin-like growth factor-1 (IGF-1) (B) in crop tissue homogenates of
male and female pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10, I14, and I17; and
chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Data points with the different
capital letters (A-G) or lowercase letters (a-e) are significantly different (P < 0.05).

Figure 4. mRNA expression profiles of epidermal growth factor (EGF) receptor (A) and insulin-like growth factor-1 (IGF-1) receptor (B) in
crop tissues of male and female parent pigeons during incubation and chick-rearing periods. The stages included incubation period: I2, I4, I6, I10,
I14, and I17; and chick-rearing period: R1, R4, R7, R10, R15, R20, and R25. Values are means ± SEM (n = 6 males and females). Bars with the
different capital letters (A-E) or lowercase letters (a-f) are significantly different (P < 0.05).

spleen, pancreas, or kidney (P > 0.05) (Figures 6A-D;

Figure 5. Changes in body weight of male and female pigeons
during incubation and chick-rearing periods. The stages included in-
cubation period: I4, I10, and I17; and chick-rearing period: R1, R7,
R15, and R25. Values are means ± SEM (n = 6 males and females).
Bars with the different capital letters (A-C) or lowercase letters (a-c)
are significantly different (P < 0.05).
8B). In female pigeons, proventriculus RW was higher
at R7 (P < 0.05) (Figure 7A), while gizzard RW de-
creased to the lowest at R1 (P < 0.05) (Figure 7B).
Breast RW in both males and females and thigh RW
in males were the lowest at R7, and then gradually in-
creased to the incubation period level (P < 0.05) (Fig-
ure 7C-D). Thigh RW in females was lowest at I4 (P
< 0.05) (Figure 7D), and it also was affected by the
interaction of sex and stage (P = 0.016) (Table 8). Ab-
dominal fat RW increased at I17, but sharply decreased
at R7 and R1 in male and female pigeons, respectively
(P < 0.05) (Figure 8A).
Serum Biochemical Parameters
Serum TP, ALB, and GLB concentrations reached
the highest value at I17 (P < 0.05), and then decreased
to the lowest at R4 in both male and female pigeons
(P < 0.05) (Table 2). CRE and UA concentrations were
the highest at R7 in both sexes during the incubation
 PHYSIOLOGICAL CHANGES IN BREEDING PIGEON 2195

Figure 6. Changes in relative weight of organs [heart (A), liver (B), spleen (C), and pancreas (D)] of male and female pigeons during incubation
and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are
means ± SEM (n = 6 males and females).

and chick-rearing stages (P < 0.05) (Table 3). UN con-
centration in male pigeons increased after R15 (P <
0.05), whereas it was higher at R25 than at other stages
in female pigeons (P < 0.05) (Table 3). In male pigeons,
TC, TG, and LDL concentrations reached their high-
est values at I17 (P < 0.05), while they were highest
at R25 in female pigeons (P < 0.05). HLD concentra-
tion peaked at R15 (P < 0.05) for males, and at I17 in
females (P < 0.05) (Table 5). Concentrations of HDL
and LDL also varied significantly with the interaction
of sex and stage (Table 9). Different incubation and
chick-rearing stages did not affect pigeon serum GLU
concentration (P > 0.05) (Table 4).
DISCUSSION
Prolactin produced by the pituitary gland in pigeons
has been shown to induce a marked epithelial hyper-
plasia of the crop tissue (Dumont, 1965; Horseman and
Buntin, 1995), leading to “milk” formation, which in-
cludes lipid (Horseman and Will, 1984; Gillespie et al.,
2013) and protein synthesis (Hu et al., 2016) during
the brooding period. To support crop milk feeding, a
complex array of behavioral adaptations (parental hy-
perphagia and feeding activity) is triggered by high lev-
els of prolactin secretion (Foreman et al., 1990; Hnasko
and Buntin, 1993). In the present study, prolactin in-
creased at the end of the incubation period, and peaked
at the beginning of the chick-rearing period, which
was consistent with the previous study (Horseman and
Buntin, 1995). Crop sac development was directly fol-
lowed by increased prolactin levels (Goldsmith et al.,
1981; Horseman, 1987), and its weight and thickness re-
mained higher during the first wk of lactation (Hu et al.,
2016). Vandeputte-Poma (1980) reported that pure pi-
geon milk constituted only 50% of crop content at 12
d after squab hatching and is replaced by full grains at
the end of chick rearing. In the present study, the serum
prolactin level gradually decreased to the base concen-
tration after R15. This fluctuation was well conformed
to the regular changes in physiological structure of crop
tissue and pigeon milk formation.
In an early study, gonadectomy appeared to have no
adverse effects on crop milk production, indicating that
gonadal steroids may be not involved in crop develop-
ment and stimulation (Schooley et al., 1941). In mam-
mals, estradiol and progesterone also play important
roles in mammary gland development, including gland
lobuloalveolar growth, ductal enlongation and differen-
tiation, and cell proliferation (Stingl, 2011). However,
2196 XIE ET AL.

Figure 7. Changes in relative weight of organs [proventriculus (A), gizzard (B), breast (C), and thigh (D)] of male and female pigeons during
incubation and chick-rearing periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25.
Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-b) are significantly
different (P < 0.05).

Figure 8. Changes in relative weight of organs [abdominal (A) and kidney (B)] of male and female pigeons during incubation and chick-rearing
periods. The stages included incubation period: I4, I10, and I17; and chick-rearing period: R1, R7, R15, and R25. Values are means ± SEM (n
= 6 males and females). Bars with the different capital letters (A-C) or lowercase letters (a-c) are significantly different (P < 0.05).

relatively lower estradiol levels in pigeons during incu-
bation and at the beginning of chick rearing were found
in the present study. It may be caused by higher pro-
lactin levels, which induced ovarian regression (Daw-
son, 2006). In addition, adopting chicks also leads to
decreased gonadal steroid secretion (Leboucher et al.,
1990). Estradiol synthesized by stroma and the theca
layer of white non-hierarchical and yellow hierarchical
follicles is essential for nutrient accumulation during
egg formation (Bahr et al., 1983; Williams et al., 2004;
 PHYSIOLOGICAL CHANGES IN BREEDING PIGEON 2197
Table 2. Concentrations of serum total protein (TP), albumin (ALB), and globulin (GLB) of male and female pigeons during different
stages of incubation and chick-rearing periods.1

Incubation (d) Chick-rearing (d)

2
Item 4 10 17 1 7 15 25

TP (mg/mL)
Male 35.0 ± 1.2B,C 36.3 ± 1.6A,B 40.1 ± 1.2A 30.4 ± 1.5C,D 28.7 ± 0.9D 32.3 ± 2.6B,C,D 34.0 ± 1.7B,C
Female 36.6 ± 1.7a,b 32.6 ± 1.2b,c 39.5 ± 1.8a 30.7 ± 1.3b,c 27.9 ± 1.6c 33.6 ± 3.1a,b,c 36.4 ± 2.5a,b
ALB (mg/mL)
Male 14.2 ± 0.4A,B 14.1 ± 0.7A,B 15.2 ± 0.7A 12.3 ± 0.6B,C 11.7 ± 0.6C 12.4 ± 0.6B,C 13.6 ± 0.7A,B,C
Female 14.5 ± 0.4a,b 13.1 ± 0.6b,c 15.9 ± 0.7a 12.1 ± 0.4c,d 10.5 ± 0.7d 12.0 ± 0.9c,d 13.2 ± 0.6b,c
GLB (mg/mL)
Male 20.8 ± 1.0B,C 22.2 ± 1.0A,B 24.9 ± 0.6A 18.2 ± 1.2C,D 17.0 ± 0.5D 19.9 ± 2.2B,C,D 20.4 ± 1.1B,C,D
Female 22.2 ± 1.3a,b 19.4 ± 0.7a,b,c 23.6 ± 1.1a 18.5 ± 1.1b,c 17.4 ± 0.9c 21.6 ± 2.3a,b,c 23.2 ± 2.0a
1
Data are shown as means ± SEM; n = 6.
2
TP = total protein; ALB = albumin; GLB = globulin.
A–D, a–d
Mean values within the same row not sharing a common superscript letter are significantly different (P < 0.05).

Table 3. Concentrations of serum creatinine (CRE), urea nitrogen (UN), and uric acid (UA) of male and female pigeons during
different stages of incubation and chick-rearing periods.1

Incubation (d) Chick-rearing (d)

Item2 4 10 17 1 7 15 25

CRE (μ mol/mL)
Male 11.7 ± 1.3B 10.2 ± 1.3B 10.6 ± 1.4B 15.8 ± 3.6A,B 22.2 ± 5.6A 12.3 ± 3.3B 10.3 ± 1.3B
Female 12.2 ± 0.7b 10.5 ± 0.9b 11.7 ± 1.1b 13.7 ± 2.9b 29.5 ± 4.8a 15.8 ± 3.2b 10.2 ± 2.8b
UN (μ mol/mL)
Male 1.93 ± 0.07B 1.98 ± 0.07A,B 2.00 ± 0.16A,B 1.98 ± 0.05A,B 2.22 ± 0.10A,B 2.35 ± 0.17A 2.32 ± 0.20A
Female 2.00 ± 0.10b 1.98 ± 0.07b 2.02 ± 0.11b 1.87 ± 0.06b 1.90 ± 0.07b 2.00 ± 0.04b 2.34 ± 0.14a
UA (μ mol/mL)
Male 358 ± 39B,C 419 ± 49A,B,C 311 ± 8C 426 ± 96A,B,C 618 ± 78A 549 ± 70A,B 435 ± 58A,B,C
Female 451 ± 40a,b 355 ± 22b 453 ± 37a,b 565 ± 69a 541 ± 65a 467 ± 61a,b 422 ± 34a,b
1
Data are shown as means ± SEM; n = 6.
2
CRE = creatinine; UN = urea nitrogen; UA = uric acid.
A–C, a–b
Mean values within the same row not sharing a common superscript letter are significantly different (P < 0.05).

Table 4. Concentration of serum glucose (GLU) of male and female pigeons during different stages of incu-
bation and chick-rearing periods.1

Incubation (d) Chick-rearing (d)

2
Item 4 10 17 1 7 15 25

GLU (μ mol/mL)
Male 19.3 ± 0.9 20.1 ± 0.5 19.4 ± 0.5 19.3 ± 0.7 19.1 ± 0.4 18.8 ± 0.5 19.6 ± 0.6
Female 18.8 ± 0.6 19.5 ± 0.8 18.8 ± 0.6 18.3 ± 0.5 18.4 ± 1.0 17.7 ± 0.8 18.5 ± 1.2
1
Data are shown as means ± SEM; n = 6.
2
GLU = glucose.

Table 5. Concentrations of serum total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL), and low-density lipopro-
tein (LDL) of male and female pigeons during different stages of incubation and chick-rearing periods.1

Incubation (d) Chick-rearing (d)

Item2 4 10 17 1 7 15 25

TC (μ mol/mL)
Male 7.69 ± 0.46A,B 7.92 ± 0.29A,B 8.41 ± 0.57A 6.37 ± 0.73B 7.15 ± 0.51A,B 7.44 ± 0.48A,B 7.83 ± 0.42A,B
Female 8.12 ± 0.38a,b 7.23 ± 0.27b 7.76 ± 0.49b 6.74 ± 0.33b 6.81 ± 0.27b 7.73 ± 0.70b 9.67 ± 1.24a
TG (μ mol/mL)
Male 2.16 ± 0.27A 2.28 ± 0.23A 2.38 ± 0.09A 1.29 ± 0.24B 2.05 ± 0.27A,B 1.27 ± 0.15B 2.06 ± 0.31A,B
Female 1.98 ± 0.22a,b 1.93 ± 0.23a,b 1.96 ± 0.17a,b 1.51 ± 0.15b 2.35 ± 0.40a,b 2.39 ± 0.65a,b 2.62 ± 0.58a
HDL (μ mol/mL)
Male 4.22 ± 0.16A,B,C 4.28 ± 0.21A,B,C 4.23 ± 0.21A,B,C 3.84 ± 0.23C 3.91 ± 0.25B,C 4.64 ± 0.22A 4.54 ± 0.20A,B
Female 4.58 ± 0.14a 4.03 ± 0.11a,b 4.39 ± 0.18a 4.09 ± 0.16a,b 3.57 ± 0.27b,c 3.17 ± 0.32c 4.15 ± 0.17a,b
LDL (μ mol/mL)
Male 1.59 ± 0.12A,B 1.73 ± 0.10A 1.94 ± 0.21A 1.28 ± 0.15B 1.64 ± 0.17A,B 1.61 ± 0.07A,B 1.61 ± 0.13A,B
Female 1.59 ± 0.11b,c 1.55 ± 0.10b,c 1.56 ± 0.14b,c 1.26 ± 0.09c 1.89 ± 0.14a,b,c 2.37 ± 0.42a,b 2.56 ± 0.50a
1
Data are shown as means ± SEM; n = 6.
2
TC = total cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein.
A–C, a–c
Mean values within the same row not sharing a common superscript letter are significantly different (P < 0.05).
2198 XIE ET AL.
Table 6. P-values for the effects of sex, stage, and their interactions in concentrations of serum hormones and gene expression of the
related receptors in crop tissues in male and female pigeons during incubation and chick-rearing periods.

Hormone1 Gene2
Item PRL E2 P PRLR ER PR GHR INSR

P-value
Sex < 0.001 < 0.001 0.010 0.466 0.803 0.216 0.001 < 0.001
Stage < 0.001 < 0.001 0.233 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001
Sex × Stage 0.014 < 0.001 0.027 0.001 0.007 < 0.001 < 0.001 < 0.001
1
PRL = prolactin; E2 = estradiol; P = progesterone.
2
PRLR = prolactin receptor; ER = estrogen receptor; PR = progesterone receptor; GHR = growth hormone receptor; INSR = insulin receptor.

Table 7. P-values for the effects of sex, stage, and their interactions
in concentrations of growth factors and gene expression of their re-
ceptors in crop tissues in male and female pigeons during incubation
and chick-rearing periods.

Growth factor1 Gene2

Item EGF IGF-1 EGF receptor IGF-1 receptor

P-value
Sex 0.001 0.004 0.001 0.058
Stage < 0.001 < 0.001 < 0.001 < 0.001
Sex × Stage < 0.001 < 0.001 0.009 < 0.001
1
EGF = epidermal growth factor; IGF-1 = insulin-like growth factor-1.
2
EGF receptor = epidermal growth factor receptor; IGF-1 = insulin-like
growth factor-1 receptor.

Table 8. P-values for the effects of sex, stage, and their interactions in body weight and relative weight of organs in male and female
pigeons during incubation and chick-rearing period.

Relative weight of organ

Item Body weight Heart Liver Spleen Pancreas Proventriculus Gizzard Breast Thigh Abdominal fat Kidney

P-value
Sex 0.212 0.484 0.965 0.020 0.261 0.645 0.944 0.777 0.016 0.021 0.186
Stage 0.001 0.097 0.838 0.374 0.456 0.225 0.239 0.001 0.001 0.042 0.091
Sex × Stage 0.410 0.476 0.652 0.130 0.595 0.552 0.715 0.789 0.016 0.091 0.489

Table 9. P-values for the effects of sex, stage, and their interaction in serum biochemical parameters in male and female pigeons
during incubation and chick-rearing period.

Serum biochemical parameter1

Item TP ALB GLB CRE UN UA GLU TC TG HDL LDL

P-value
Sex 0.954 0.347 0.609 0.133 0.088 0.503 0.043 0.553 0.379 0.035 0.117
Stage < 0.001 < 0.001 < 0.001 < 0.001 0.003 0.003 0.509 0.006 0.033 0.013 0.008
Sex × Stage 0.701 0.758 0.444 0.014 0.241 0.124 0.999 0.301 0.071 0.001 0.028
1
TP = total protein; ALB = albumin; GLB = globulin; CRE = creatinine; UN = urea nitrogen; UA = uric acid; GLU = glucose; TC = total
cholesterol; TG = triglyceride; HDL = high-density lipoprotein; LDL = low-density lipoprotein.

Wistedt et al., 2014). Serum estrogen levels in female pi-
geons increase during the egg-laying period (Dong et al.,
2013). Higher concentration of serum estradiol in female
pigeons after R15 in the present study may be explained
by the relatively longer breeding cycle needing a slower
follicle development due to a continued hormone effect.
However, estradiol’s function in male pigeons during
chick rearing remains unclear.
Our data showed that the changing pattern of PRLR
gene expression coincided with prolactin fluctuation in
both male and female pigeons. The prolactin receptor
belongs to the class I cytokine receptor superfamily and
is considered as a candidate gene for broodiness (Dunn
et al., 1998). We found it at higher concentrations in
late incubation and at the beginning of chick rearing.
PRLR modulates prolactin-inducible signal transmit-
ting (Vleck et al., 2000), and prolactin can increase the
receptor content in the pigeon crop sac (Shani et al.,
1981), possibly because it increases activity of PRLR
promoter via the STAT5 pathway found in mammals
(Welte et al., 1994).
Although both ER and PR can be directly regulated
by the corresponding hormone ligands via distinctive
membrane signaling (Dominguez and Micevych, 2011;
 PHYSIOLOGICAL CHANGES IN BREEDING PIGEON
Sivik and Jansson, 2012), changing gene expression pat-
terns in pigeon crop tissue were incompatible with the
circulating hormone fluctuation during the breeding
period, indicating that other factors may be involved
in this regulation. The PR gene contains an Sp1 site
and could confer estrogen responsiveness to a heterolo-
gous promoter in an estrogen receptor-dependent man-
ner (Schultz et al., 2003). The correlation between ER
and RP gene expression probably also exists in the pi-
geon crop. Compared to ER and PR, the similar chang-
ing pattern of GHR gene expression in crop tissue also
made it likely unnecessary in crop-stimulating growth.
This study raised the new question of whether pro-
lactin negatively affects gene expressions of ER, PR,
and GHR in pigeon crops. In addition, the irregular
change in INSR gene expression only in female pigeon
crops showed its potential involvement in crop milk for-
mation or other physiological processes.
Both EGF and IGF-1 concentrations in crop milk
decreased during chick rearing in a previous study (Xie
et al., 2013), which was similar to the results for the
crop tissue in the current study. It suggested that EGF
and IGF-1 in crop milk and crop tissue probably have
the same origination. Milk secreted by mammals con-
tains higher EGF and IGF-1 concentrations, and both
subsequently decreased in the later period of lactation
(Donovan et al., 1994; Xu, 1996). The changing pat-
tern of 2 growth factors was found to coincide with
crop weight and thickness changes, as reported by Hu
et al (2016). This result indirectly verified the early hy-
pothesis that crop cell proliferation might be brought
about by the synergistic action of prolactin and growth
factors (Anderson et al., 1987), which can accumulate
in the tissue during brooding (Bharathi et al., 1993).
Generally, a final cellular outcome can be governed by
input from several factors, because the combined effect
of cellular inputs may be more than their individual
effects due to synergistic action (Crouch et al., 2000).
Growth factors such as IGF-1 and EGF play im-
portant roles in multiple cellular responses, including
DNA synthesis, nutrient accumulation, and mitogenesis
(Thomas et al., 1982; Adams and Haddad, 1996; Deleu
et al., 1999; Berfield et al., 2002; Mau et al., 2008). The
authors speculated they were also potentially involved
in crop tissue hyperplasia and milk formation via their
receptors. In addition, IGF-1 stimulates insulin-like ac-
tion, and the overlap in action is due to the high ho-
mology between the INSR and the IGF-1 receptor, ini-
tiating the intracellular signaling pathway via similar
cascades (Taniguchi et al., 2006). A nearly 4-fold in-
crease in insulin levels was found in lactating pigeons,
although it did not distinguish the parental sex (Hu
et al., 2016), and insulin also enhanced the gene ex-
pression of the IGF-1 receptor and effectively induced
EGF receptor accumulation on the actin arc of cells
(Crouch et al., 2000; Hunter and Hers, 2009).
Seasonal variations, reproductive cycle, and sex-
related differences in body weight and organ dynamics
are well-documented in water fowls, passerines, or some
2199
species of wild migratory birds in the wild (Ankney
and MacInnes, 1978; Gammonley, 1995; Woodburn and
Perrins, 1997; Badzinski et al., 2011; Jacobs et al.,
2011), but similar studies in pigeons are few, espe-
cially under artificial caged farming conditions. We hy-
pothesized that pigeons allocate energy resources for
the most demanding period of the reproductive cy-
cle through phenotypic flexibility in body weight and
organ size. In female blue tits, body reserves increased
after clutch completion, and were mobilized during the
first 5 d of the nestling period, which showed a decrease
in whole body weight (Woodburn and Perrins, 1997).
Lower body weights in male and female pigeons during
the chick-rearing period observed in the present study
were probably due to both parents giving the contribu-
tions of caring for offspring. Lean dry weight and fat
content of the digestive system in female blue tits also
was found to be decreased during the beginning of the
nestling period (Woodburn and Perrins, 1997), but no
significant changes in gizzard or intestine weight dur-
ing the reproductive cycle were reported in ruddy ducks
(Tome, 1984). In the present study, the proventriculus
RW increased at R7 and gizzard RW decreased at R1 in
female pigeons, but no changes in these 2 organs were
found in males, indicating that sex and potential species
differences existed.
Breast muscle is a key factor for flight performance,
and it also functions as a nutrient reserve that can be
used during the reproductive cycle (Kullberg et al.,
2002). However, no evidence of incubation negatively
affecting bird’s body condition was found, and energy
reserves increased during this period, such as in Savi’s
Warblers, although the female did most of the incubat-
ing (Neto and Gosler, 2010). Similar results for thigh
RW in female pigeons were found in our experiment. As
in other studies, breast muscle in bird species decreased
in weight during chick rearing (Woodburn and Perrins,
1997; Neto and Gosler, 2010), which was almost en-
tirely due to protein (Jones, 1991) and lipid loss (Jacobs
et al., 2011). This phenomenon also was observed in the
present study, and in passerines, the decline in muscle
during the breeding season was even greater in females
than in males (Gosler, 1991). The author speculated
that both male and female parent pigeons probably in-
curred physiological stress when caring for offspring,
but the relative contributions of the 2 sexes, as well as
the mechanism involved, remain unclear.
Our study found dramatic changes in abdominal fat
RW, especially in female pigeons within only a few d
(from I17 to R1). It was reported that body fat content
can change rapidly in birds, for instance, during the d
and as an adaptation to predation risk (Gosler, 1996).
The decline in organ RW in parent pigeons mostly
occurred before R15 in the present study. These re-
sults verified the hypothesis that the first half of the
nestling period may be more demanding because the
parents have to brood and feed the nestlings simultane-
ously, having little time to feed themselves (Sanz and
Moreno, 1995; Moe et al., 2002). During the second
2200
half of the nestling period, parent pigeons do not need
to remain in the nest as long, and the food received
by the squabs changes from crop milk to whole grains
(Vanderputte-poma, 1980; Horseman and Buntin,
1995). This suggested that the physiological stress of
the parent pigeons was alleviated after R15.
Blood metabolites, such as glucose, protein, albumin,
and TG, are indicative of nutritional status in gen-
eral (Junghanns and Coles, 2008). In the present study,
continuous increases in serum TP, ALB, and GLB in
both male and female pigeons during incubation are
attributed to strengthening of the metabolism by pro-
tein synthesis. ALB is a carrier protein for many hor-
mones and metal ions (Refetoff et al., 1970; Cookson
et al., 1988). Prolactin induces serum albumin transla-
tion (Baruch et al., 1998), and the maximum ALB value
parallels with the peak prolactin level during the termi-
nal incubation phase in pigeons reported by Gayathri
and Hegde (2006). In addition, squab pigeons obtain the
immunoglobulins, mainly IgA and IgG, through crop
milk from parental transfer (Jacquin et al., 2012). How-
ever, with crop tissue regression during the second half
of the chick-rearing period, squabs were gradually fed
by full grains, and this may be why the trend of recov-
ered serum protein indices occurred.
Creatinine, a byproduct of phosphocreatine break-
down in skeletal muscle, is another important indica-
tor of protein metabolism (Piotrowska et al., 2011). We
speculated that the increased serum creatinine value
probably correlated with breast and thigh muscle de-
composition, which showed a lower RW at R7 in the
present study.
UA and UN come mainly from digestion, the break-
down products of the digestive tract, and the metabo-
lites released from tissue cells (Wang et al., 2009). Their
changes can reflect the efficiency of amino acid use
throughout the body (Donsbough et al., 2010). Casado
et al. (2002) found that nestling brooding eagles had
higher plasma UA and UN concentrations than non-
brooding ones, which was consistent with our results.
We speculated that physiological stresses brought on
by feeding squabs may incur the 2 increased parame-
ters with muscle tissue decomposition.
Serum levels of TG, TC, LDL, and HDL are used
to measure serum lipid levels (Chou et al., 2012). Our
data showed that serum concentrations of TC, TG, and
LDL were lower in both male and female pigeons at the
beginning of chick rearing, which may be due to lipid
formation in crop milk with the decrease of abdomi-
nal fat RW simultaneously. However, the time needed
to reach the higher values of these parameters differed
between males and females, indicating that potential
differences in lipid metabolism existed between the two
sexes, as sexual dimorphism in the plasma lipid pro-
file established in mammals (Wang et al., 2011). The
higher values of serum TC, TG, and LDL detected in fe-
male pigeons during the terminal phase of chick rearing
was probably due to the continuously increasing estra-
diol level. This phenomenon has already been shown in
XIE ET AL.
female mammals (Ferreri and Naito, 1978; Cinci et al.,
2000; Mady, 2000).
CONCLUSIONS
Prolactin, EGF, and IGF-1 concentrations, as well
as gene expression of their receptors in pigeon crop tis-
sues changed dynamically during the breeding cycle,
and these factors potentially underlie crop tissue de-
velopment with a combined effect. The RW of breast
muscle, thigh muscle, and abdominal fat declined sig-
nificantly during chick rearing, which may function as
a nutrient reserve for later use. Serum biochemical pro-
files detected in the present study showed that protein
and lipid metabolism-related parameters in adult pi-
geons varied significantly during incubation and chick
rearing with sexual effects.
ACKNOWLEDGMENTS
The authors thank all the members in the School
and Institute for their generous technical advice. This
research was supported by National Natural Funds of
China (No. 31501974) and National Natural Science
Foundation of Jiangsu Province (BK20150462).
REFERENCES
Adams, G. R., and F. Haddad. 1996. The relationships among IGF-
1, DNA content, and protein accumulation during skeletal muscle
hypertrophy. J. Appl. Physiol. 81:2509–2516.
Anderson, T. R., G. L Mayer, N. Hebert, and C. S. Nicoll. 1987. In-
teractions among prolactin, epidermal growth factor, and proin-
sulin on the growth and morphology of the pigeon crop-sac mu-
cosal epithelium in vivo. Endocrinology. 120:1258–1264.
Ankney, C. D., and C. D. Macinnes. 1978. Nutrient reserves and re-
productive performance of female lesser snow geese. Auk. 95:459–
471.
Badzinski, S. S., L. Kennedy, S. A. Petrie, and M. L. Schummer.
2011. Variation in body composition and digestive organs of tun-
dra swans during migration at long point, Lake Erie, Ontario,
Waterbirds 34:468–475.
Bahr, J. M., S. C. Wang, M. Y. Huang, and F. O. Calvo. 1983.
Steroid concentrations in isolated theca and granulosa layers of
preovulatory follicles during the ovulatory cycle of the domestic
hen. Biol. Reprod. 29:326–334.
Baruch, A., M. Shani, and I. Barash. 1997. Insulin and prolactin
synergize to induce translation of human serum albumin in the
mammary gland of transgenic mice. Transgenic Res. 7:15–27.
Bauchinger, U., and H. Biebach. 2006. Transition between moult and
migration in a long-distance migratory passerine: organ flexibility
in the African wintering area. J Ornithol. 147:266–273.
Berfield, A. K., D. L. Andress, and C. K. Abrass. 2002. IGF-1-
induced lipid accumulation impairs mesangial cell migration and
contractile function. Kidney Int. 62:1229–1237.
Bharathi, L., K. B. Shenoy, M. Mojamdar, and S. N. Hegde.
1993. Studies on the growth-stimulatory activity of pigeon milk-
comparison and synergistic effects with serum. J. Comp. Physiol.
B. 163:332–336.
Bharathi, L., K. B. Shenoy, and S. N. Hegde. 1997. Biochemical dif-
ferences between crop tissue and crop milk of pigeons (Columba
livia). Comparative Biochemistry and Physiology Part A: Physi-
ology. 116:51–55.
Casado, E., J. Balbontin, and M. Ferrer. 2002. Plasma chemistry
in booted eagle (Hieraaetus pennatus) during breeding season.
 PHYSIOLOGICAL CHANGES IN BREEDING PIGEON
Comparative Biochemistry and Physiology Part A: Molecular &
Integrative Physiology. 131:233–241.
Chen, X., and N. D. Horseman. 1994. Cloning, expression, and mu-
tational analysis of the pigeon prolactin receptor. Endocrinology
135:269–276.
Chen, X., K. Naehrer, and T. J. Applegate. 2016. Interactive effects
of dietary protein concentration and aflatoxin B1 on performance,
nutrient digestibility, and gut health in broiler chicks. Poult. Sci.
95:1312–1325.
Christians, J. K., and T. D. Williams. 1999. Organ mass dynam-
ics in relation to yolk precursor production and egg formation
in european starlings sturnus vulgaris. Physiol. Biochem. Zool.
72:455–461.
Chou, C. H., Y. Y. Chang, B. S. Tzang, C. L. Hsu, Y. L. Lin, H. W.
Lin, and Y. C. Chen. 2012. Effects of taurine on hepatic lipid
metabolism and anti-inflammation in chronic alcohol-fed rats.
Food Chem. 135:24–30.
Cinci, G., R. Guerranti, R. Pagani, F. Carlucci, L. Terzuoli, F. Rosi,
and E. Marinello. 2000. Fatty acid composition of phospholipids,
triglycerides and cholesterol in serum of castrated and estradiol
treated rats. Life Sci. 66:1647–1654.
Cookson, E. J., M. R. Hall, and J. Glover. 1988. The transport of
plasma thyroxine in White storks (Ciconia ciconia) and the asso-
ciation of high levels of plasma transthyretin (thyroxine-binding
prealbumin) with moult. J. Endocrinol. 117:75–84.
Crouch, M. F., D. A. Davy, F. S. Willard, and L. A. Berven. 2000.
Insulin induces epidermal growth factor (EGF) receptor cluster-
ing and potentiates EGF-stimulated DNA synthesis in Swiss 3T3
cells: A mechanism for costimulation in mitogenic synergy. Im-
munol Cell Biol. 78:408–414.
Dawson, A. 2006. Control of molt in birds: Association with prolactin
and gonadal regression in starlings. Gen. Comp. Endocrinol.
147:314–322.
Deleu, S., I. Pirson, K. Coulonval, A. Drouin, M. Taton, F. Clermont,
P. P. Roger, T. Nakamura, J. E. Dumont, and C. Maenhaut. 1999.
IGF-1 or insulin, and the TSH cyclic AMP cascade separately
control dog and human thyroid cell growth and DNA synthesis,
and complement each other in inducing mitogenesis. Mol. Cell.
Endocrinol. 149:41–51.
Dominguez, R., and P. Micevych. 2010. Estradiol rapidly regulates
membrane ERα levels in hypothalamic neurons. J. Neurosci.
30:12589–12596.
Dong, X. Y., M. Zhang, Y. X. Jia, and X. T. Zou. 2013. Physiological
and hormonal aspects in female domestic pigeons (Columba livia)
associated with breeding stage and experience. J. Anim. Physiol.
An. N. 97:861–867.
Donovan, S. M., L. K. McNeil, R. Jiménez-Flores, and J. Odle. 1994.
Insulin-like growth factors and insulin-like growth factor binding
proteins in porcine serum and milk throughout lactation. Pediatr
Res 36:159–168.
Donsbough, A. L., S. Powell, A. Waguespack, T. D. Bidner, and L.
L. Southern. 2010. Uric acid, urea, and ammonia concentrations
in serum and uric acid concentration in excreta as indicators of
amino acid utilization in diets for broilers. Poult. Sci. 89:287–294.
Dumont, J. N. 1965. Prolactin-induced cytologic changes in the mu-
cosa of the pigeon crop during crop-“milk” formation. Z. Zell-
forsch. Mikrosk. 68:755–782.
Dunn, I. C., G. Mcewan, T. Okhubo, P. J. Sharp, I. R. Paton, and D.
W. Burt. 1998. Genetic mapping of the chicken prolactin receptor
gene: a candidate gene for the control of broodiness. Br. Poult.
Sci. 39:23–24.
Farner, D. S., and J. C. Wingfield. 1980. Reproductive endocrinology
of birds. Annu. Rev. Physiol. 42:457–472
Ferreri, L. F., and H. K. Naito. 1978. Effect of estrogens on rat
serum cholesterol concentrations: Consideration of dose, type of
estrogen, and treatment duration. Endocrinology. 102:1621–1627.
Ferrer, M., and P. Dobado-Berrios. 1998. Factors affecting plasma
chemistry values of the Spanish Imperial Eagle, Aquila adalberti.
Comparative Biochemistry and Physiology Part A: Molecular &
Integrative Physiology. 120:209–217.
Filgo, A. J., and A. S. Faqi. 2017. Effects of chemicals on mam-
mary gland development. Pages 205–234 in Developmental and
Reproductive Toxicology. Springer, New York.
2201
Foreman, K. T., R. W. Lea, and J. P. Buntin. 1990. Changes in
feeding activity, plasma luteinizing hormone, and testes weight
in ring doves following hypothalamic injections of prolactin. J.
Neuroendocrinol. 2:667–673.
Gammonley, J. H. 1995. Nutrient reserve and organ dynamics of
breeding Cinnamon Teal. The Condor. 97:985–992.
Gao, C. Q., J. X. Yang, M. X. Chen, H. C. Yan, and X. Q. Wang.
2016. Growth curves and age-related changes in carcass character-
istics, organs, serum parameters, and intestinal transporter gene
expression in domestic pigeon (Columba livia). Poult. Sci. 95:867–
877.
Garcı́a-Rodriguez, T., M. Ferrer, J. C. Recio, and J. Castroviejo.
1987. Circadian rhythms of determined blood chemistry values in
buzzards and eagle owls. Comparative Biochemistry and Physi-
ology Part A: Physiology. 88:663–669.
Gaston, A. J., and S. Perin. 1993. Loss of mass in breeding Brun-
nich’s Guillemots Uria lomvia is triggered by hatching. Ibis.
135:472–475.
Gayathri, K. L., and S. N. Hegde. 2006. Alteration in haema-
tocrit values and plasma protein fractions during the breed-
ing cycle of female pigeons, Columba livia. Anim. Reprod. Sci.
91:133–141.
Gillespie, M. J., V. R. Haring, K. A. McColl, P. Monaghan, J. A.
Donald, K. R. Nicholas, R. J. Moore, and T. M. Crowley. 2011.
Histological and global gene expression analysis of the ’lactating’
pigeon crop. BMC Genomics. 12:452–461.
Gillespie, M. J., T. M. Crowley, V. R. Haring, S. L. Wilson, J. A.
Harper, J. S. Payne, D. Green, P. Monaghan, J. A. Donald, K.
R. Nicholas, and R. J. Moore. 2013. Transcriptome analysis of
pigeon milk production - Role of cornification and triglyceride
synthesis genes. BMC Genomics. 14:169–181.
Goldsmith, A. R., C. Edwards, M. Koprucu, and R. Silver. 1981.
Concentrations of prolactin and luteinizing hormone in plasma
of doves in relation to incubation and development of the crop
gland. J. Endocrinol. 90:437–443.
Gosler, A. G. 1991. On the use of greater covert moult and pectoral
muscle as measures of condition in passerines with data for the
Great Tit Parus major. Bird Study. 38:1–9.
Gosler, A. G. 1996. Environmental and social determinants of win-
ter fat storage in the great tit Parus major. J. Anim. Ecol. 65:
1–17.
Hammond, K. A., J. Szewczak, and E. Król. 2001. Effects of alti-
tude and temperature on organ phenotypic plasticity along an
altitudinal gradient. J. Exp. Biol. 204:1991–2000.
Hnasko, R. M., and J. D. Buntin. 1993. Functional mapping of neu-
ral sites mediating prolactin-induced hyperphagia in doves. Brain
Res. 623:257–266.
Horseman, N. D., and C. L. Will. 1984. Characterization of lipid
storage associated proteins induced in crop tissue by prolactin. J.
Comp. Physiol. B. 154:237–242.
Horseman, N. D. 1987. Models of prolactin action in nonmammalian
vertebrates. Pages 41–67 in Actions of Prolactin on Molecular
Processes, ed. J. A. Rillema, Boca Raton, FL: CRC.
Horseman, N. D., and J. D. Buntin. 1995. Regulation of pigeon crop-
milk secretion and parental behaviors by prolactin. Annu. Rev.
Nutr. 15:213–238.
Hu, X. C., C. Q. Gao, X. H. Wang, H. C. Yan, Z. S. Chen, and X. Q.
Wang. 2016. Crop milk protein is synthesised following activation
of the IRS1/Akt/TOR signalling pathway in the domestic pigeon
(Columba livia). Br. Poult. Sci. 57:855–862.
Hunter, R. W., and I. Hers. 2009. Insulin/IGF-1 hybrid receptor ex-
pression on human platelets: Consequences for the effect of insulin
on platelet function. J. Thromb. Haemost. 7:2123–2130.
Jacobs, S. R., D. B. Edwards, J. Ringrose, K. H. Elliott, J. M. We-
ber, and A. J. Gaston. 2011. Changes in body composition during
breeding: reproductive strategies of three species of seabirds un-
der poor environmental conditions. Comp. Biochem. Physiol. B
Biochem. Mol. Biol. 158:77–82.
Jacquin, L., L. Blottière, C. Haussy, S. Perret, and J. Gasparini.
2012. Prenatal and postnatal parental effects on immunity and
growth in ‘lactating’ pigeons. Funct. Ecol. 26:866–875.
Jones, M. M. 1991. Muscle protein loss in laying House Sparrows
Passer domesticus. Ibis. 133:193–198.
2202 XIE ET AL.
Junghanns, M. K., and B. H. Coles. 2008. Aids to diagnosis. Pages
56–102 in Essentials of Avian Medicine and Surgery. Black well
Publishing Ltd: Oxford, UK.
Kierończyk, B., M. Rawski, J. Dlugosz, S. Światkiewicz,
 and D.
Józefiak. 2016. Avian crop function - A review. Ann. Anim. Sci.
16:653–678.
Kullberg, C., D. C. Houston, and N. B. Metcalfe. 2002. Impaired
flight ability–A cost of reproduction in female blue tits. Behav.
Ecol. 13:575–579.
Landys-Ciannelli, M. M., T. Piersma, and J. Jukema. 2003. Strategic
size changes of internal organs and muscle tissue in the Bar-tailed
Godwit during fat storage on a spring stopover site. Funct Ecol-
ogy. 17:151–159.
Leboucher, G., M. A. Richard-Yris, J. Williams, and A. Chadwick.
1990. Incubation and maternal behaviour in domestic hens: Influ-
ence of the presence of chicks on circulating luteinising hormone,
prolactin and oestradiol and on behaviour. Br. Poult. Sci. 31:851–
862.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene
expression data using real-time quantitative PCR and the 2(-
Delta Delta C(T)) Method. Methods. 25:402–408.
Mady, E. A. 2000. Association between estradiol, estrogen recep-
tors, total lipids, triglycerides, and cholesterol in patients with
benign and malignant breast tumors. J. Steroid Biochem. Mol.
Biol. 75:323–328.
Mau, M., C. Kalbe, K. Wollenhaupt, G. Nürnberg, and C. Rehfeldt.
2008. IGF-I- and EGF-dependent DNA synthesis of porcine my-
oblasts is influenced by the dietary isoflavones genistein and
daidzein. Domest. Anim. Endocrinol. 35:281–289.
Moe, B., I. Langseth, M. Fyhn, G. W. Gabrielsen, and C. Bech.
2002. Changes in body condition in breeding kittiwakes Rissa
tridactyla. Journal of Avian Biology. 33:225–234.
Mohamed, R. A., M. Shukry, T. M. Mousa-Balabel, and A. A. El-
bassiouny. 2016. Assessment of plasma prolactin and nest defense
behaviour during breeding cycle of pigeon (Columba livia domes-
tica). Journal of Environmental and Agricultural Sciences. 7:19–
22.
Neto, J. M., and A. G. Gosler. 2010. Variation in body condition of
breeding Savi’s Warblers Locustella luscinioides: The reproduc-
tive stress and flight adaptation hypothesis revisited. J. Ornithol.
151:201–210.
Piersma, T., and R. E. Gill, Jr. 1998. Guts don’t fly: Small digestive
organs in obese Bar-Tailed Godwits. The Auk 115:196–203.
Piotrowska, A., K. Burlikowska, and R. Szymeczko. 2011. Changes
in blood chemistry in broiler chickens during the fattening period.
folia biol (krakow). 59:183–187.
Refetoff, S., N. I. Robin, and V. S. Fang. 1970. Parameters of thyroid
function in serum of 16 selected vertebrate species: A study of
PBI, serum T4, free T4, and the pattern of T4 and T3 binding
to serum proteins. Endocrinology. 86:793–805.
Sanz, J. J., and J. Moreno. 1995. Mass loss in brooding female
pied flycatchers Ficedula hypoleuca: No evidence for reproductive
stress. Journal of Avian Biology. 26:313–320.
Scanes, C. G., S. Harvey, J. A. Marsh, and D. B. King. 1984. Hor-
mones and growth in poultry. Poult. Sci. 63:2062–2074.
Schooley, J. P., O. Riddle, and R. W. Bates. 1941. Replacement ther-
apy in hypophysectomized juvenile pigeons. Dev. Dynam. 69:123–
157.
Schultz, J. R., L. N. Petz, and A. M. Nardulli. 2003. Estrogen recep-
tor alpha and Sp1 regulate progesterone receptor gene expression.
Mol. Cell. Endocrinol. 201:165–175.
Shani, J., R. J. Barkey, and T. Amit. 1981. Endogenous prolactin
maintains its own binding sites in the pigeon crop sac mucosa. J.
Recept. Res. 2:407–417.
Sivik, T., and A. Jansson. 2012. Progesterone and levonorgestrel
regulate expression of 17β HSD-enzymes in progesterone receptor
positive breast cancer cell line T47D. Biochem. Biophys. Res.
Commun. 422:109–113.
Stearns, S. C. 1992. The evolution of life histories. Q. Rev. Biol.
123:835–839.
Stingl, J. 2011. Estrogen and progesterone in normal mammary
gland development and in cancer. HORM CANC 2:85–90.
Taniguchi, C. M., B. Emanuelli, and C. R. Kahn. 2006. Critical nodes
in signalling pathways: Insights into insulin action. Nat. Rev. Mol.
Cell Biol. 7:85–96.
Thomas, G., J. Martin-Perez, M. Siegmann, and A. M. Otto. 1982.
The effect of serum, EGF, PGF2 alpha and insulin on S6 phos-
phorylation and the initiation of protein and DNA synthesis. Cell.
30:235–242.
Tome, M. W. 1984. Changes in nutrient reserves and organ size of
female ruddy ducks breeding in manitoba. The Auk 101:830–837.
Vandeputte-poma, J. 1980. Feeding, growth and metabolism of the
pigeon, Columba livia domestica: Duration and role of crop milk
feeding. J. Comp. Physiol. B. 135:97–99.
Vézina, F., and T. D. Williams. 2003. Plasticity in body composi-
tion in breeding birds: What drives the metabolic costs of egg
production? Physiol. Biochem. Zool. 76:716–730.
Vleck, C. M., L. L. Ross, D. Vleck, and T. L. Bucher. 2000. Prolactin
and parental behavior in Adélie penguins: Effects of absence from
nest, incubation length, and nest failure. Horm. Behav. 38:149–
158.
Wang, J. P., J. S. Yoo, H. J. Kim, J. H. Lee, and I. H. Kim. 2009.
Nutrient digestibility, blood profiles and fecal microbiota are in-
fluenced by chitooligosaccharide supplementation of growing pigs.
Livestock Sci. 125:298–303.
Wang, X., F. Magkos, and B. Mittendorfer. 2011. Sex differences in
lipid and lipoprotein metabolism: It’s not just about sex hor-
mones. The Journal of Clinical Endocrinology & Metabolism
96:885–893.
Welte, T., K. Garimorth, S. Philipp, and W. Doppler. 1994.
Prolactin-dependent acti vation of a tyrosine phosphorylated
DNA binding factor in mouse mammary epithelial cells. Mol. En-
docrinol. 8:1091–1102.
Williams, T. D., A. S. Kitaysky, and F. Vézina. 2004. Individual
variation in plasma estradiol-17β and androgen levels during egg
formation in the European starling Sturnus vulgaris: Implications
for regulation of yolk steroids. Gen. Comp. Endocrinol. 136:346–
352.
Wistedt, A., Y. Ridderstråle, H. Wall, and L. Holm. 2014. Exogenous
estradiol improves shell strength in laying hens at the end of the
laying period. Acta Vet Scand. 56:34–44.
Woodburn, R. J. W., and C. M. Perrins. 1997. Weight change and
the body reserves of female blue tits, Parus caeruleus, during the
breeding season. J. Zool. Lond. 243:789–802.
Xie, P., S. Y. Fu, Z. Bu, H. B. Tong, and J. M. Zou. 2013. Effects of
age and parental sex on digestive enzymes, growth factors, and
immunoglobulin of pigeon squab. J. Anim. Vet. Adv. 12:932–936.
Xie, P., X. Y. Jiang, Z. Bu, S. Y. Fu, S. Y. Zhang, and Q. P. Tang.
2016. Free choice feeding of whole grains in meat-type pigeons:
1. Effect on performance, carcass traits, and organ development.
Brit. Poult. Sci. 57:699–706.
Xie, P., X. P. Wang, Z. Bu, and X. T. Zou. 2017. Differential expres-
sion of fatty acid transporters and fatty acid synthesis-related
genes in crop tissues of male and female pigeons (Columba livia
domestica) during incubation and chick rearing. Br. Poult. Sci.
58:594–602.
Xu, R. J. 1996. Development of the newborn GI tract and its relation
to colostrum/milk intake: A review. Reprod. Fertil. Dev. 8:35–48.