General and Comparative Endocrinology 210 (2015) 87–95

Contents lists available at ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier.com/locate/ygcen

Expression and localization of ghrelin and its receptor in ovarian follicles

during different stages of development and the modulatory effect
of ghrelin on granulosa cells function in buffalo
M. Gupta, S.S. Dangi, G. Singh, M. Sarkar ⇑
Physiology & Climatology Division, Indian Veterinary Research Institute, Izatnagar 243122, India

a r t i c l e i n f o a b s t r a c t

Article history: Ghrelin, a hormone predominantly found in the stomach, was recently described as a factor that controls
Received 31 May 2014 female reproductive function. The aim of our study was to investigate the expression and localization of
Revised 1 September 2014 ghrelin and its active receptor, growth hormone secretagogue receptor type 1a (GHS-R1a) in buffalo
Accepted 20 September 2014
ovarian follicles of different follicular size and to investigate role of ghrelin on estradiol (E2) secretion,
Available online 30 September 2014
aromatase (CYP19A1), proliferating cell nuclear antigen (PCNA) and apoptosis regulator Bax gene expres-
sion on granulosa cell culture. Using real time PCR and western blot, we measured gene and protein
Keywords:
expression of examined factors. Localization was done with immunofluorescence method. Expression
Ghrelin
GHS-R1a
of ghrelin increased with follicle size with significantly highest in dominant or pre-ovulatory follicle
Follicle (P < 0.05). Expression of GHS-R1a was comparable in medium and large follicle but was higher than small
Buffalo follicles (P < 0.05). Both the factors were localized in granulosa and theca cells. Pattern of intensity of
Granulosa cell immunofluorescence was similar with mRNA and protein expression. In the in vitro study granulosa cells
(GCs) were cultured and treated with ghrelin each at 1, 10 and 100 ng/ml concentrations for two days
after obtaining 75–80 per cent confluence. Ghrelin treatment significantly (P < 0.05) inhibited E2 secre-
tion, CYP19A1 expression, apoptosis and promoted cell proliferation. In conclusion, this study provides
novel evidence for the presence of ghrelin and receptor GHS-R1a in ovarian follilcles and modulatory role
of ghrelin on granulosa cell function in buffalo.
Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction
Water buffalo (Bubalus bubalis) is the principal dairy animal in
the developing countries of Asia, providing milk, meat and draught
power. India produces about 68 per cent of the world’s buffalo milk
production (FAOSTAT, 2012). A large number of buffaloes (30–40%)
remain unproductive as the result of reproductive problems such
as subestrus, anestrus, and infertility, all of which have hormonal
etiologies (Madan and Prakash, 2007). The species has received
considerable research attention in the last few years but informa-
tion on certain basic aspects of buffalo reproduction is still lacking.
The ovarian cycle of domestic species is characterized by repeated
patterns of cellular proliferation, differentiation and transforma-
tion of ovarian steroidogenic cells (granulosa, theca and luteal
cells) that accompany follicular and luteal development (Schams
et al., 2009). Much like cattle, female buffalo have 2 or 3 waves
of ovarian follicular development in each estrous cycle (Baruselli
⇑ Corresponding author. Fax: +91 0581 2301327.
E-mail address: msarkar24@gmail.com (M. Sarkar).
et al., 1997; Mondal et al., 2007). The growth and maturation of
follicle is controlled by a complex interaction of systemic gonado-
tropins and local growth factors. All of the major cell types within
the follicle (granulosa, theca, oocyte) are a source or the target of
locally-released growth factors (Doyle et al., 2010). Through
understandings of the endocrine, autocrine & paracrine growth fac-
tors would be helpful in elucidating the mechanisms of follicular
development, ovulation and luteal functions, thereby facilitating
development of approaches for alleviation of infertility due to
subestrus & anestrus resulting in improvement of reproductive
efficiency of buffalo.
Ghrelin is a recently discovered hormone that has been shown
to be a natural ligand of the growth hormone secretagogue (GHS)
receptor type 1a (GHS-R1a) and is characterized by a novel post
translational acylation that ensures bioactivity (Kojima et al.,
1999; Wren et al., 2000). The active form of bovine ghrelin is a
27 amino acids peptide (Dickin et al., 2004). Majority of circulating
ghrelin is produced by X/A-like cells of the oxyntic mucosa of the
stomach (Date et al., 2000) but has also been identified in a variety
of other organs such as the intestine, kidney, thyroid, lung,

http://dx.doi.org/10.1016/j.ygcen.2014.09.013
0016-6480/Ó 2014 Elsevier Inc. All rights reserved.

Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
88 M. Gupta et al. / General and Comparative Endocrinology 210 (2015) 87–95
lymphatic tissue, hypothalamus, and pituitary, placenta, testis,
ovary (van der Lely et al., 2004). Since its discovery in 1999, the
evidence for potential involvement of this molecule in the
regulation of numerous endocrine and non endocrine functions
like GH releasing, orexigenic effects and role in gastrointestinal,
cardiovascular, immune, and coagulation systems are constantly
growing (Gualillo et al., 2003; van der Lely et al., 2004; Leite-
Moreira and Soares, 2007; Arici and Cetin, 2010). Although the
general view has been that the principal effects of ghrelin are on
the neuroendocrine component of reproduction (Fernandez-
Fernandez et al., 2004, 2005), evidence has emerged to indicate
direct involvement of ghrelin in ovarian function. Ghrelin and its
receptor GHS-R1a have been detected in the ovary of human
(Gaytan et al., 2003), rat (Caminos et al., 2003), sheep (Du et al.,
2009), goat (Chandra et al., 2012), pig (Rak-Mardyla and
Gregoraszczuk, 2012) and cattle (Deaver et al., 2013). In the recent
study, we demonstrated the expression and localization and local
effect of ghrelin on progesterone production in buffalo corpus
luteum (CL) (Gupta et al., 2014). In human and pigs, it is reported
that expression of ghrelin and its active receptor GHSR1a paral-
leled follicular development (Gaytan et al., 2003; Rak-Mardyla
and Gregoraszczuk, 2012) and GHS-R1a localization has also been
observed in the granulosa and theca cell layers of healthy antral
follicles in human (Gaytan et al., 2003). However, no data is avail-
able regarding ghrelin and GHS-R1a expression and role of ghrelin
in ovarian follicles in bubaline species during estrous cycle.
Few studies have reported that ghrelin has modifying role in
ovarian steroidogenesis. Estradiol is important steroid hormone
produced by the ovarian follicles. A rate limiting enzyme in estro-
gen biosynthesis is cytochrome P450 aromatase (P450 AROM),
which convert theca cell derived androgen to estrogen (Luu-The,
2001). The gene responsible for this enzyme is cytochrome P450
19A1 (CYP19A1). Few reports indicated the modulatory effect of
ghrelin on estradiol production by follicular cells. Both stimulatory
and inhibitory effects of ghrelin on E2 secretion have been reported
in different species (Viani et al., 2008; Rak and Gregoraszczuk,
2008). Some studies also demonstrated role of ghrelin in the con-
trol of cell proliferation and apoptosis in ovarian cells (Sirotkin
and Grossmann, 2008; Rak and Gregoraszczuk, 2008). Based their
role in controlling ovarian function in other species, ghrelin and
its receptor are hypothesized to be involved in follicle
development and granulosa cell function during estrous cycle in
an autocrine/paracrine manner in buffalo. To test this hypothesis,
we examined a) the gene and protein expression of ghrelin and
GHS-R1a in different size of ovarian follicles during estrous cycle
and b) effect of ghrelin on E2 secretion and survivability of cells
the cultured granulosa cells of buffalo ovaries.
2. Materials and methods
2.1. Collection of follicles and preparation
Entire reproductive tracts from buffalo cows were collected
from local abattoir and the samples were transported on ice within
10–20 min after slaughter to the laboratory. From the ovary, only
follicles which appeared healthy (well vascularized and having
transparent follicular wall and fluid) and with diameter more than
3 mm were used. Large follicles (>14 mm) were collected only after
CL regression, with signs of mucus production in the uterus and
cervix, and were considered to be pre-ovulatory. For RNA
extraction, follicles were dissected out from ovarian stroma. The
surrounding tissue (theca externa) was carefully removed with for-
ceps under a stereo microscope as previously explained (Babitha
et al., 2013) and the surface diameter was determined. After aspi-
ration of follicular fluid (FF), each follicle was bisected and its
Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
inside wall was gently scraped and flushed with Ringer’s lactate
solution to separate out the granulosa cells (GC) and the remaining
follicle wall after GC separation formed the theca interna (TI). GC
and TI isolated from each follicle were transferred into separate
tubes and labeled. The GC in the flushing solution was centrifuged
at 3000g for 10 min at 4 °C. The TI and GC pellet were separately
snap frozen in liquid nitrogen and stored at 80 °C until RNA
and protein isolation. The FF was stored at 20 °C until determina-
tion of progesterone (P4) and E2. Because healthy follicles have rel-
atively constant P4 concentrations in FF, only follicles with P4
below 100 ng/ml FF were used for the evaluation, to exclude atretic
follicles (Babitha et al., 2013).
2.2. Follicle classification
The follicles were classified according to the E2 content in FF as
follows; (i) <0.5; (ii) 0.5–5; (iii) 5–40; and (iv) >180 ng/ml FF. The
corresponding size of follicles were in the range of (i) 4–6 mm
(F1 or small); (ii) 7–9 mm (F2 or medium); (iii) 10–13 mm (F3 or
large); (iv) >14 mm (F4 or mature/dominant/pre ovulatory follicle)
(Sarkar et al., 2010). Forty ovaries, each with follicles, were used to
extract 10 follicles each per group for RNA extraction, western
blotting studies.
2.3. Hormone estimation
Concentrations of P4 in FF and E2 in the FF and spent culture
media of GC culture were estimated by P4125I RIA kit (Catalog
No. IM1188) and E2125I RIA kit (Catalog No. A21854) supplied by
Immunotech, Czech Republic as per manufacturer’s instruction.
The measurable range was 0.05–50 ng/ml for P4 and 6–5000 pg/
ml for E2. The FF was diluted 1:100 with PBS. The intra- and inter-
assay coefficients of variation were 6.5% and 7.2% for P4 and 12.1
and 11.2 for E2 respectively.
2.4. Primers
Primer of ghrelin, CYP19A1, b-actin was designed using the Fast
PCR (Version:6.2.73) software. Published primers were used for
GHS-R1a, BAX and PCNA. Details of the primers used are given in
Table 1.
2.5. Quantitative RT-PCR analysis
Total RNA was isolated from GC and TI (collected from 10 folli-
cles per group) of all four follicular groups and cultured GC cells by
TRIzol reagent (Invitrogen) according to manufacturer instructions.
RNA was treated with Dnase 1 (Invitrogen) to remove any possible
DNA contamination. Purity and integrity was checked as per stan-
dard methods. Constant amounts of 1 lg of total RNA from CL
(n = 10/group) were reverse transcribed using iScript™ Select
cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA) and
oligo-dT18 primer at 42 °C for 90 min. The resulting complimen-
tary DNAs (cDNAs) were used in quantitative RT-PCR (qRT-PCR)
reactions. The qRT-PCR for each cDNA and the housekeeping gene
beta actin was performed in duplicate using SsoFast™ Eva Green
Supermix kit (Bio-Rad) in an Agilent Stratagene MX3005P Real-
Time qPCR System instrument (Stratagene) as per manufacturer’s
instructions. Briefly, PCR templates containing 0.5 ll reverse-tran-
scribed total RNA were added to 0.20 ll forward primer (0.2 mM),
0.20 ll reverse primer (0.2 mM) and 5 ll of SsoFast™ Eva Green
Supermix to a final volume of 10 ll and were subjected to general
real-time PCR protocol for all investigated factors. The following
general qPCR protocol was employed for all investigated factors:
denaturation for 30 s at 95 °C, 40 cycles of a three segmented
amplification and quantification programme [denaturation for
 M. Gupta et al. / General and Comparative Endocrinology 210 (2015) 87–95
Table 1
Target gene, primer sequences, efficiency and amplicon length for qRT-PCR used in the study.
Gene Sequences 50 -30
Ghrelin For: AGCTGTCAGGGGCTCAGTCC
Rev: AGTGTCCCGGAAGCCAGGTGAG
GHSR1a For: CCTGGCTCTGTGGAGATC
Rev: CCCGAGAACTTTCATCCTTTAG
CYP19A1 For: CGTCCTGGTCACCCTTCT
Rev: ACGCACCGACCTTGCAA
PCNA For: ACCTGCAGAGCATGGACTCGTC
Rev: CATGCTGGTGAGGTTCACGCCCA
BAX For: TCTGACGGCAACTTCAACTG
Rev: AAGTAGGAGAGGAGGCCGTC
Beta actin For: AGTTCGCCATGGATGATGA
Rev: TGCCGGAGCCGTTGT
10 s at 95 °C, annealing for 10 s at the primer specific temperature
(56 °C for GHS-R1a and PCNA, 58 °C for b-actin)] and two
segmented amplification and quantification programme [denatur-
ation for 10 s at 95 °C, combined annealing and extension for 13 s
at 60 °C for CYP19A1, and 62 °C for ghrelin and BAX), elongation for
15 s at 72 °C], a melting step by slow heating from 61 to 95 °C with
a rate of 0.58 °C/s and continuous fluorescence measurement, and
a final cooling down to 4 °C. After the run ended, cycle threshold
(Ct) values for all determined factors were acquired using the
‘EVA green (with dissociation curve)’ method of the real-time
machine (MxPro3005P Stratagene, Agilent Technologies,
Germany).
qPCR efficiencies were determined by amplification of a
standardized dilution series, and slopes were obtained. The
specificity of desired products was documented using analysis of
melting temperature and a high resolution gel electrophoresis to
verify that transcripts were of exact molecular size and further
confirmed by sequence analysis. Negative control PCR containing
all components except template was included for each sample to
check out the formation of primer dimer.
2.6. Antibodies and growth factor
Western blotting, immunohistochemistry and immunocyto-
chemistry were performed using monoclonal anti-mouse b-actin
(SC-81178, Santa Cruz Biotechnology, Inc., Dallas, TX, USA), rabbit
polyclonal ghrelin (SC-50297, Lot#H01111), goat polyclonal
GHSR-1a (SC-10359, Lot#D1812), rabbit polyclonal CYP19
antibody (SC-30086, Lot D1712) antibody and mouse anti-goat
IgG-HRP (sc-2354, Lot # G0910), goat anti-rabbit IgG-HRP (sc-
2004, Lot #B1711), goat anti-mouse IgG-HRP (SC-2005, Lot #
C2011), goat anti rabbit IgG-CFL-488 (sc-362262, Lot#B0112) and
bovine anti goat IgG-CFL-488 (sc-362254, Lot#B0812). Human
Ghrelin (Cat No. 4990-100, Lot No. 40190) was procured from Bio-
Vision (USA).
2.7. Western blot
Total proteins from follicular tissues (GC and TI) of different
groups (10 samples pooled from each group) was isolated using
Tissue-PE LBTM (G Biosciences, USA) buffer and Halt™ protease
inhibitor cocktail (Thermo Scientific). Total protein was estimated
using Bradford protein assay. Protein was diluted in sodium dode-
cyl sulfate (SDS) sample buffer (final concentration to 60 mM Tris,
pH 6.8, 2% SDS, 100 mM dithiothreitol and 10% glycerol), followed
by boiling for 5 min. The protein samples (100 lg from GC and TI
from each follicle from each group) were subjected to 10–12%
SDS–polyacrylamide gel electrophoresis, electro transferred onto
Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
89
Efficiency (%) Amplicon length (bp) EMBL accession No. or reference
92.2 170 Nucleotide JQ859818.1
91.6 199 Deaver et al. (2013)
101.3 57 Nucleotide U18447.1
98.6 160 RefSeq (Nucleotide) NM_001034494.1
99.1 250 RefSeq (Nucleotide) NM_173894.1
104.3 54 RefSeq (Nucleotide) NM_173979.3
polyvinylidene difluoride (PVDF) membrane and blocked with 3%
bovine serum albumin (BSA) before incubation with primary anti-
bodies, viz. anti-ghrelin and anti-GHS-R1a respectively at a 1:200
dilution, and anti-b-actin at a 1:500 dilution for overnight at
4 °C. After incubation, membrane was washed thrice with PBS-T
(PBS + 0.01% Tween 20) for 5 min each then respective secondary
antibody conjugated with horse radish peroxidase was added and
incubated at 37 °C for 1 h. After washing 3 to 4 times in PBS-Tween
20 solution, the positive signals were detected by incubating the
membrane using 0.06% 3,30 -diaminobenzidine tetrahydrochloride
(DAB, Genei) in 1 PBS (pH 7.4) containing 0.06% H2O2 for 10–
15 min. The bands were visualized under white light and recorded
on a gel documentation system (DNR-BioImaging system (Minibus
Pro). Densitometry of the immunospecific bands was performed
using ImageJ 1.43U software (National Institute of Health,
Bethesda, Maryland). The experiment was replicated thrice for
each protein.
2.8. Immunohistochemistry
Intact follicles were carefully dissected out from the ovaries by
sectioning the ovary into two halves and removing the connective
tissue around the follicles with the help of a pair of forceps and sur-
gical blade and after fine separation from all surrounding stroma,
the follicles were fixed with 10% neutral buffer formalin (NBF),
dehydrated through a series of graded alcohols, paraffin-embed-
ded, serial sectioned (5 lm), mounted on Mayer’s albumin coated
slides and dried at 37 °C overnight. Deparaffinization was carried
out in xylene followed by rehydration in a series of graded alcohols
at room temperature, epitope retrieval in sodium citrate buffer
(10 mM sodium citrate, pH 6.0, 0.05% Tween-20), rinsing and
blocking with 5% BSA for 2 h at 37 °C. Subsequently, sections were
probed with anti-ghrelin, anti-GHSR-1a, at 1:100 dilutions.
Primary antibodies were detected by fluorescent conjugated
respective secondary antibodies. The slides were rinsed and
0.4 lg/ml of 40 ,6-diamidino-2-phenylindole (DAPI) in PBS was
applied to stain the nuclei of the cells in the follicular sections.
The control slides were processed under similar conditions except
for the addition of isotype IgG and omission of the primary anti-
body. Fluorescently stained sections were mounted with antifade
mounting media (MP Biomedicals) and images were captured
using AxioObserver.Z1 (Carl Zeiss Micro Imaging GmbH, Germany)
microscope.
2.9. Granulosa cell culture and treatments
Ovaries were washed properly with physiological saline
solution and GCs were collected from pre ovulatory follicles
90 M. Gupta et al. / General and Comparative Endocrinology 210 (2015) 87–95

(n = 4 follicles) separately by aspiration of FF using a needle (18 (A) B

gauge) and syringe (plastic, 10 ml). Aspirants were transferred to 5 Ghrelin mRNA in GC
a 60-mm dish, under sterile conditions, containing 0.1% solution Ghrelin mRNA in TI

Relative expression
of PBS, and all cumulus oocyte complexes were recovered. The c
4
remaining cells and fluids were centrifuged in 15-ml conical tubes
at 300g for 5 min, and the GC pellet was resuspended in 10 ml of
3 bc
1 PBS prior to a second centrifugation. Finally, GCs were resus-
pended and washed in culture medium with DMEM/F12 media AB bc AB
(supplemented with 10% FBS, antibiotic, antimycotic). The number 2
of viable cells was determined using trypan blue exclusion. Then a A
the cells were centrifuged, resuspended and plated out at 1
1.5  105 viable cells per well in a 24-well plate (total volume:
1 ml containing 10% Fetal Bovine Serum (Sigma) and Antibiotic & 0
Antimycotic solution (Penicillin-G 100U/ml, Streptomycin
F1 F2 F3 F4
100 lg/ml, Amphotericin 0.25 lg/ml (SV30079.01; Hyclone,
Follicle classes
Thermo Scientific) in a humidified CO2 (5%) incubator at 38.5 °C.
The cells were allowed to attach and grow (75–80% confluent)
(B)
for 48 h and there after the media was replaced with fresh media
containing different concentrations (1, 10, and 100 ng/ml) of ghre-
lin and were maintained for 48 h. The doses of the ghrelin were 15
GC B

Relative expression of
selected based on the earlier report (Sirotkin et al., 2009; Sirotkin
TI

and Meszarosova, 2010). Control cells were grown in media with-
out ghrelin. The cells were allowed to attach for 24 h and after a
further 24 h period the medium was changed. After 48 h, the med-
ium and cells were collected for mRNA isolation. Each treatment
was tested in triplicate wells in each experiment.
2.10. Statistical analyses
All experimental data are shown as mean ± SEM. The statistical
significance of differences in relative amount of mRNA and protein
of examined factors across follicle of different stages of growth
during estrous cycle was assessed using SPSS.17 by one-way
ANOVA followed by Turkey HSD as a multiple comparison test. Dif-
ferences were considered significant if P < 0.05.
3. Results
3.1. Expression of mRNA of ghrelin and GHS-R1a mRNA in ovarian
follicles
Small or F1 follicles were used as calibrator for obtaining rela-
tive amount of mRNA. Efficiency-corrected relative quantification
of mRNA was obtained by Pfaffl method (2001). The mRNA expres-
sion in separated follicle tissue for ghrelin and GHS-R1a are pre-
sented in Fig. 1. In both GC and TI tissues(Fig. 1A), the mRNA
level was lowest in small or F1 follicle (P < 0.05) and increased with
follicle size and reached highest in pre-ovulatory or F4 follicles but
the differences were not significant between F2, F3 and F4 class of
follicles.
The relative mRNA expression of ghrelin receptor (GHS-R1a) in
GC and TI (Fig. 1B) was found lowest in F1 follicles and increased
thereafter and remain relatively constant in F2, F3 and F4 follicles
(P < 0.05).
3.2. Relative amounts of proteins
Proteins of ghrelin (pro form) and receptor GHS-R1a were
detected using western blotting. b-actin was used as internal con-
trol. Bands corresponding to ghrelin (13 kDa), GHS-R1a
(44 kDa) and b-actin (41 kDa) were observed as shown
(Fig. 2A for GC and Fig. 2C for TI). No bands were observed in the
controls, processed by omitting primary antibodies. Relative
amount of ghrelin in GC (Fig. 2B) and TI (Fig. 2D) increased with
increase in follicle size and reaches maximum in PF or F4 follicles
GHS-R1a mRNA
10
B B b
b b
5
a A
0
F1 F2 F3 F4
Follicle classes
Fig. 1. Relative amounts of ghrelin and GHS-R1a mRNA in granulosa cells (GC,
n = 10/group) and theca interna (TI, n = 10/group) cells of different follicle sizes in
buffalo (A) ghrelin mRNA in GC and TI (B) GHS-R1a mRNA in GC and TI. Class F1
follicle was taken as calibrator. All the values are shown as means ± SEM. Different
superscripts denote differences in values (P < 0.05). GC: granulosa cell; TI: theca
interna.
(P < 0.05) as observed for mRNA expression. The amount was rela-
tively constant in F2 and F3 follicles. GHS-R1a protein level in GC
(Fig. 2B) was significantly higher in F2, F3 and F4 as compared to
F1 whereas in TI (Fig. 2D) it was higher in F3 and F4 as compared
to F1 and F2 (P < 0.05).
3.3. Immunohistochemical localization of proteins
The immunoreactivities of ghrelin and GHS-R1a were observed
using immunohistochemistry with stage specific difference in
reactivity (Figs. 3 and 4). The immunohistochemistry using differ-
ent groups of follicles revealed that both ligand and receptor pro-
teins were localized in both GC and TI cells. The intensity of
immunostaining varied from phase to phase and the number of
positive cells was influenced by the different stages of estrous
cycle. Most intense immunostaining was observed in F4 follicle.
The negative controls, with isotype IgG and without primary anti-
bodies, showed only a weak background staining.
3.4. Effect of ghrelin on E2 secretion and mRNA expression of CYP19A1,
PCNA and BAX
GCs were collected from pre-ovulatory follicles and were cul-
tured for 48 h after attaining 75–80% confluence, without (control)
or with increasing dose of ghrelin (1, 10 and 100 ng/ml).

Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
 M. Gupta et al. / General and Comparative Endocrinology 210 (2015) 87–95 91

(A) mRNA expression of CYP19A1 declined (P < 0.05) with all doses
of ghrelin as compared to control (Fig. 5B). All the doses of ghrelin
Ghrelin 13 kDa
increased (P < 0.05) expression of PCNA (Fig. 5C) and decreased
expression of BAX (Fig. 5D) in GC culture as compared to control
in dose dependant manner.
GHS-R1a 44 kDa
4. Discussion
<beta>-actin 41 kDa
The present study demonstrated, for the first time, the presence
of ghrelin and its cognate receptor GHS-R1a in buffalo ovarian
(B) 5 follicles at all steps of development and the inhibitory effect of
Ghrelin c
Densitometry analysis
of proteins vs <beta> -

ghrelin on cultured GCs function in bubaline species. Although sev-

4
GHS-R1a eral reports have demonstrated the expression of ghrelin and its
functional receptor GHS-R1a in human and other domestic animal
B species, no published reports described the distribution of ghrelin
3 b B
actin

in the ovarian follicles of important dairy animal, water buffalo. So

B far, we found that mRNA and protein expression levels signifi-
2 b cantly varied depending on follicle sizes and increased with follicle
a A development and maturation. Our observations are identical to the
1 findings of other study carried out by Rak-Mardyla and
Gregoraszczuk (2012) in which expression of ghrelin and GHSR
0 was parallel with follicle development and was highest in large fol-
licles as compared to follicle development. Expression of ghrelin
F1 F2 F3 F4
and GHS-R1a has also been reported in dominant ovarian follicle
Follicle classes in bovine ovary (Deaver et al., 2013) which also supports our find-
ings. In sheep, widespread expression of ghrelin was observed
(C) throughout the ovary, with detectable levels found in the somatic
Ghrelin 13kDa and thecal cells of follicles (at all stages of development), granulosa
cells of antral follicles, and in all developmental stages of the CL
(Du et al., 2009) similar with our observations.
GHS-R1a 44kDa Results on mRNA and protein expression were also supported
by the localization of ghrelin and GHS-R1a protein by immunoflu-
orescence. Ghrelin and GHS-R1a immunoreactivity was observed
<beta>-actin 41kDa in cytoplasm of granulosa and theca cells. The intensity of immu-
nostaining and number of GC and TI cells observed in the present
study containing ghrelin and GHS-R1a protein increased during
(D) c follicle development and maturation with maximum intensity in
3 Ghrelin F4 follicles. The localization of both ligand and receptor in somatic
Densitometry analysis
of proteins vs <beta> -

GHS-R1a B cells (GC and TI) of ovarian follicle indicate autocrine and paracrine
B role of this peptide in buffalo follicle development. Similar obser-
b vations were noted in follicles of bovine ovary (Deaver et al.,
2 b 2013) in which both theca and granulose cells showed localization
actin

of ghrelin and GHS-R1a. Similarly, Zhang et al. (2008) also observed

a A
A
1 follicle in pig. Expression of GHS-R1A has been detected on the fol-
0 somatic cell showed ghrelin immunoreactivity however GHS-R1a
F1 F2 F3 F4
Follicle classes
Fig. 2. Relative protein expression (mean ± SEM, band densitometry) of ghrelin and
GHS-R1a in granulose cells (GC) and theca interna (TI) cells of follicular tissue of
different sizes in buffalo. Western blot bands of ghrelin, GHS-R1a and b-actin in GC
(2A) and TI (2C) of ovarian follicles; beta-actin was used as reference protein.
Relative change in protein expression in GC (2B) and TI (2D) of follicle groups of
ghrelin (pro form) and GHS-R1a. Different superscripts denote statistically different
values (P < 0.05).
Concentration of E2 in control culture medium averaged
24.02 ± 2.01 pg/ml. E2 concentration decreased (P < 0.05) with
ghrelin in a dose dependant manner (Fig. 5A). At 1 ng/ml dose, it
was comparable with control but with 10 and 100 ng/ml dose of
ghrelin there was a significant decrease in E2 concentration
(P < 0.05).
ghrelin immunostaining in granulosa cells of growing ovarian
licular, luteal, and surface epithelia of the ovary in rats (Caminos
et al., 2003). The present findings however does not agree with
observations of Gaytan et al. (2003) in human ovary, in which no
protein was detected in somatic follicular cells, with an expression
profile that was roughly parallel to follicle development similar to
our observation.
Expression and localization of ghrelin and its receptor in buffalo
ovarian follicles observed in the present study provided indirect
evidence for autocrine and paracrine roles of ghrelin in follicle
development and function. However, this evidence was not suffi-
cient to draw a conclusive inference about the role of ghrelin in
the process. Therefore, in the second part of our study, an
in vitro granulosa cell culture model was used to evaluate the
effect of ghrelin on E2 secretion, mRNA expression of CYP19A1
and apoptotic (BAX) and cell proliferation (PCNA) marker. The
results showed that ghrelin inhibit E2 secretion and mRNA expres-
sion of CYP19A1, in dose dependant manner in in vitro cultured
GCs. The present observations provide the first evidence that ghre-
lin is involved in the control of ovarian follicular secretory activity
in bubaline species. In earlier study, we observed inhibitory effect

Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
92 M. Gupta et al. / General and Comparative Endocrinology 210 (2015) 87–95

Fig. 3. Immuno-histochemical localization of ghrelin in buffalo ovarian follicles. Immuno-reactivity of ghrelin in different groups of follicle development was stained with
Alexa-488. Expression of ghrelin is merged with 4,6-diamidino-2-phenylindole counterstain (blue), indicating the nuclei of all cells in the sections. Representative pictures
showing immuno-reactivity against ghrelin [(A) F1 Follicle (4–6 mm diameter), (B) F2 Follicle (7–9 mm diameter), (C) F3 Follicle (10–13 mm diameter), (D) F4 Follicle
(>14 mm diameter) and (E) negative control]. Control sections are represented with isotype IgG and without primary antibody labeling. A clear immuno-reactivity for ghrelin
was consistently found in the GC and TI with the most intense immunofluorescence in the F4 follicles. GC: granulosa cell; TI: theca interna; TE: theca externa; EC: endothelial
cell. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

of ghrelin in luteal cell culture in buffalo (Gupta et al., 2014). The
present study is fully supported by earlier studies in which ghrelin
suppressed E2 secretion from cultured granulosa cell in human
(Viani et al., 2008), chicken (Sirotkin and Grossmann, 2008) and
rabbit (Sirotkin et al., 2009). However, the present findings do
not agree with observations of Rak and Gregoraszczuk (2008) in
porcine species, in which ghrelin increased E2 secretion from co-
cultured granulosa and theca cells. It could possibly be due to dif-
ferent actions of ghrelin in different species. The decreased E2
secretion was probably due to inhibition of expression of CYP19A1
gene, thus inhibiting aromatase activity. As the level of E2
increases with follicle development and maturation in in vivo
and ghrelin has inhibitory effect on in vitro cultured GCs, it is
possible, that under in vivo conditions ghrelin’s effects could be

Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
 M. Gupta et al. / General and Comparative Endocrinology 210 (2015) 87–95 93

Fig. 4. Immuno-histochemical localization of GHS-R1a in buffalo ovarian follicles. Immuno-reactivity of ghrelin in different groups of follicle development was stained with
Alexa-488. Expression of GHS-R1a is merged with 4,6-diamidino-2-phenylindole counterstain (blue), indicating the nuclei of all cells in the sections. Representative pictures
showing immuno-reactivity against ghrelin [(A) F1 Follicle (4–6 mm diameter), (B) F2 Follicle (7–9 mm diameter), (C) F3 Follicle (10–13 mm diameter), (D) F4 Follicle
(>14 mm diameter) and (E) negative control]. Control sections are represented with isotype IgG and without primary antibody labeling. A clear immuno-reactivity for ghrelin
was consistently found in the GC and TI with the most intense immunofluorescence in the F4 follicles. GC: granulosa cell; TI: theca interna; TE: theca externa. (For
interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

masked or neutralized by upstream control mechanisms such as
follicle stimulating hormone, luteinizing hormone and growth hor-
mone. At systemic level, inhibitory effect of ghrelin on hypotha-
lamic pituitary axis has been reported in human, rat and pigs
(Zhang et al., 2008; Muccioli et al., 2011). It has been reported that
ghrelin inhibits gonadotropin-releasing hormone (GnRH) release,
LH responsiveness to GnRH, FSH and LH level in several species
(Garcia et al., 2007; Lorenzi et al., 2009).
The effect of ghrelin on cell proliferation was also determined in
this study. Ghrelin promoted expression of marker of cellular
proliferation, PCNA and inhibited marker of apoptosis, BAX at all
the doses in in vitro cultured GCs in the present study. The verifi-

Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
94 M. Gupta et al. / General and Comparative Endocrinology 210 (2015) 87–95

Fig. 5. Concentration of E2 in culture media and mRNA expression of CYP19A1, PCNA, and BAX from GC cultures treated with ghrelin for 48 h at 3 different dose rates (n = 4
follicle); (A) Concentration of E2; (B) expression of CYP19A1 mRNA; (C) expression of PCNA mRNA; (D) expression BAX mRNA. All values are shown as mean ± standard error
of the mean. Different superscripts denote statistically different values (P < 0.05). Ghrelin decreased E2 secretion, CYP 19A1 (aromatse) and BAX expression while it increased
PCNA expression in GCs as compared to control in a dose dependant manner. BAX: Bcl-2- associated X protein; BAX, Bcl-2- associated X protein; CYP19A1, cytochrome
P45019A1; E2, estradiol; mRNA, messenger RNA; PCNA, proliferating cell nuclear antigen.

cation of ghrelin effects on the expression of selected markers of Acknowledgments

proliferation and apoptosis fully supported the data obtained
previously on porcine ovarian GCs and whole follicles [Rak and
Gregoraszczuk, 2008; Rak et al., 2009]. Similarly, in ghrelin treated
GCs of rabbit ovary, cellular proliferation was promoted and
apoptosis was inhibited (Sirotkin et al., 2009), however, ghrelin
promoted both proliferation and apoptosis in chicken ovarian cells
(Sirotkin et al., 2006). The possible mechanism of granulosa cell
proliferation by ghrelin through activation of ERK1/2, PI-3 kinase
pathway and accumulation of PCNA in cells. (Sirotkin et al.,
2009; Rak-Mardyla and Gregoraszczuk, 2010). Estradiol also
promote ovarian cell proliferation by directly increasing PCNA
expression (Wang et al., 2008). In the present study we observed
that ghrelin inhibits estradiol secretion and directly promote PCNA
expression and thereby causes cell proliferation alone devoid of
estradiol. Increased expression of marker of proliferation and
inhibition of apoptosis marker as observed in the present study,
suggest that in buffalo, ghrelin potentially stimulates growth and
development of ovarian cells in vitro.
Although the reproductive actions of ghrelin and their mecha-
nisms require further study, the present data provides evidence
that ghrelin has a role in the regulation of female reproductive
functions in buffalo. In summary, the present study demonstrated:
(1) expression and localization of the ghrelin and receptor GHSR-
1a in ovarian follicles and their expression and localization
increases with ovarian follicle development and maturation, and
(2) ghrelin have inhibitory effect on estradiol secretion, aromatase
expression and apoptosis and stimulatory effect on cell prolifera-
tion on GCs in bubaline species.
Conflict of interest
The authors declare that there is no conflict of interest on
publishing the article.
Funding support received from Department of Biotechnology,
Department of Science and Technology, Government of India and
Director IVRI is gratefully acknowledged.
References
Arici, O.F., Cetin, N., 2010. Protective role of ghrelin against carbon tetrachloride
(CCl)-induced coagulation disturbances in rats. Regul. Pept. 166, 139–142.
Babitha, V., Panda, R.P., Yadav, V.P., Chouhan, V.S., Dangi, S.S., Khan, F.A., Singh, G.,
Bag, S., Taru, Sharma G., Silvia, W.J., Sarkar, M., 2013. Amount of mRNA and
localization of vascular endothelial growth factor and its receptors in the
ovarian follicle during estrous cycle of water buffalo (Bubalus bubalis). Anim.
Reprod. Sci. 137, 163–176.
Baruselli, P.S., Mucciolo, R.G., Visintin, J.A., Aruda, W.G.R.P., 1997. Ovarian follicular
dynamics during the estrous cycle in buffalo (Bubalis bubalis). Theriogenology
47, 1531–1547.
Caminos, J.E., Tena-Sempere, M., Gaytan, F., Sanchez-Criado, J.E., Barreiro, M.L.,
Nogueiras, R., Casanueva, F.F., Aguilar, E., Dieguez, C., 2003. Expression of
ghrelin in the cyclic and pregnant rat ovary. Endocrinology 144, 1594–1602.
Chandra, V., Ram, H., Sharma, A.K., 2012. Expression profile of ghrelin and ghrelin
receptor in cyclic goat ovary. Indian J. Anim. Sci. 82 (9), 984–987.
Date, Y., Kojima, M., Hosoda, H., Sawaguchi, A., Mondal, M.S., Suganuma, T.,
Matsukura, S., Kangawa, K., Nakazato, M., 2000. Ghrelin, a novel growth
hormone-releasing acylated peptide, is synthesized in a distinct endocrine cell
type in the gastrointestinal tracts of rats and humans. Endocrinology 141 (11),
4255–4261.
Deaver, S.E., Hoyer, P.B., Dial, S.M., Field, M.E., Collier, R.J., Rhoads, M.L., 2013.
Localization of ghrelin and its receptor in the reproductive tract of Holstein
heifers. J. Dairy Sci. 96 (1), 150–157.
Dickin, J.C., Thue, T.D., Buchanan, F.C., 2004. An alternative splice site in ghrelin is
missing in ruminants. Anim. Genet. 35, 411–412.
Doyle, L.K., Walker, C.A., Donadeu, F.X., 2010. VEGF modulates the effects of
gonadotropins in granulosa cells. Domest. Anim. Endocrinol. 38, 127–137.
Du, C., Xilingaowa, Cao, G., Wang, C., Li, H., Zhao, Y., Siqingaowa, Cao, J., 2009.
Expression of orexigenic peptide ghrelin in sheep ovary. Domest. Anim.
Endocrinol. 36, 89–98.
Fernandez-Fernandez, R., Tena-Sempere, M., Aguilar, E., Pinilla, L., 2004. Ghrelin
effects on gonadotropin secretion in male and female rats. Neurosci. Lett. 362,
103–107.
Fernandez-Fernandez, R., Tena-Sempere, M., Navarro, V.M., Barreiro, M.L.,
Castellano, J.M., Aguilar, E., Pinilla, L., 2005. Effects of ghrelin upon

Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
 M. Gupta et al. / General and Comparative Endocrinology 210 (2015) 87–95
gonadotropin-releasing hormone and gonadotropin secretion in adult female
rats: in vivo and in vitro studies. Neuroendocrinology 82 (5–6), 245–255.
FAOSTAT, 2012. <http://faostat.fao.org/site/573/
DesktopDefault.aspx?PageID=573#ancor>, 2012. accessed on 12.04.2014.
Garcia, M.C., Lopez, M., Alvarez, C.V., Casanueva, F., Tena-Sempere, M., Dieguez, C.,
2007. Role of ghrelin in reproduction. Reproduction 133, 531–540.
Gaytan, F., Barreiro, M.L., Chopin, L.K., Herington, A.C., Morales, C., Pinilla, L.,
Casanueva, F.F., Aguilar, E., Dieguez, C., Tena-Sempere, M., 2003.
Immunolocalization of ghrelin and its functional receptor, the type 1a growth
hormone secretagogue receptor, in the cyclic human ovary. J. Clin. Endocrinol.
Metab. 88, 879–887.
Gualillo, O., Lago, F., Omez-Reino, J.G., Casanueva, F.F., Dieguez, C., 2003. Ghrelin, a
widespread hormone: insights into molecular and cellular regulation of its
expression and mechanism of action. FEBS Lett. 552 (2–3), 105–109.
Gupta, M., Dangi, S.S., Chouhan, V.S., Hyder, I., Babitha, V., Yadav, V.P., Khan, F.A.,
Sonwane, A., Singh, G., Das, G.K., Mitra, A., Bag, S., Sarkar, M., 2014. Expression
and localization of ghrelin and its functional receptor in corpus luteum during
different stages of estrous cycle and the modulatory role of ghrelin on
progesterone production in cultured luteal cells in buffalo. Domest. Anim.
Endocrinol. 48, 21–32.
Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., Kangawa, K., 1999.
Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature
402, 656–660.
Leite-Moreira, A.F., Soares, J.B., 2007. Physiological, pathological and potential
therapeutic roles of ghrelin. Drug Discov. Today 12, 276–288.
Lorenzi, T.R., Meli, D., Marzioni, M., Morroni, A., Baragli, M., Castellucci, M., 2009.
Ghrelin: a metabolic signal affecting the reproductive system. Cytokine Growth
Factor Rev. 20 (2), 137–152.
Luu-The, V., 2001. Analysis and characteristics of multiple types of human 17beta-
hydroxysteroid dehydrogenase. J. Steroid Biochem. Mol. Biol. 76, 143–151.
Madan, M.L., Prakash, B.S., 2007. Reproductive endocrinology and biotechnology
applications among buffaloes. Soc. Reprod. Fertil. Suppl. 64, 261–281.
Mondal, S., Prakash, B.S., Palta, P., 2007. Endocrine aspects of oestrous cycle in
buffalo (Bubalus bubalis): an overview. Asian-Aust. J. Anim. Sci. 20, 124–131.
Muccioli, G., Lorenzi, T., Lorenzi, M., Ghe, C., Arnoletti, E., Raso, G.M., Castellucci, M.,
Gualillo, O., Meli, R., 2011. Beyond the metabolic role of ghrelin: a new player in
the regulation of reproductive function. Peptides 32, 2514–2521.
Pfaffl, M., 2001. A new mathematical model for relative quantification in real-time
RT-PCR. Nucleic Acids Res. 29, 2002–2007.
Rak, A., Gregoraszczuk, E.L., 2008. Modulatory effect of ghrelin in prepubertal
porcine ovarian follicles. J. Physiol. Pharmacol. 59, 781–793.
Downloaded for Anonymous User (n/a) at Grigore T Popa University of Medicine and Pharmacy Iasi from ClinicalKey.com by Elsevier
on April 04, 2023. For personal use only. No other uses without permission. Copyright ©2023. Elsevier Inc. All rights reserved.
95
Rak, A., Szczepankiewicz, D., Gregoraszczuk, E.L., 2009. Expression of ghrelin
receptor, GHSR-1a, and its functional role in the porcine ovarian follicles.
Growth Horm. IGF Res. 19, 68–76.
Rak-Mardyla, A., Gregoraszczuk, E.L., 2010. ERK 1/2 and PI-3 kinase pathways as a
potential mechanism of ghrelin action on cell proliferation and apoptosis in the
porcine ovarian follicular cells. J. Physiol. Pharmacol. 61 (4), 451–458.
Rak-Mardyla, A., Gregoraszczuk, E.L., 2012. Expression of ghrelin and its receptor in
porcine ovarian follicles collected from prepubertal and estrous cycle animals. J.
Physiol. Pharmacol. 63 (2), 195–199.
Sarkar, M., Schilffarth, S., Schams, D., Meyer, H.H.D., Berisha, B., 2010. The
expression of leptin and its receptor during different physiological stages in
the bovine ovary. Mol. Reprod. Dev. 77, 174–181.
Schams, D., Steinberg, V., Steff, M., Meyer, H.H.D., Berisha, B., 2009. Expression and
possible role of fibroblast growth factor family members in porcine antral
follicles during final maturation. Reproduction 138, 141–149.
Sirotkin, A.V., Grossmann, R., Maria-Peon, M.T., Roa, J., Tena-Sempere, M., Klein, S.,
2006. Novel expression and functional role of ghrelin in chicken ovary. Mol.
Cell. Endocrinol. 257–258, 15–25.
Sirotkin, A.V., Rafay, J., Kotwica, J., Darlak, K., Valenzuela, F., 2009. Role of ghrelin in
regulating rabbit ovarian function and the response to LH and IGF-I. Domest.
Anim. Endocrinol. 36, 162–172.
Sirotkin, A.V., Meszarosova, M., 2010. Comparison of effects of leptin and ghrelin on
porcine ovarian granulosa cells. Domest. Anim. Endocrinol. 39, 1–9.
Sirotkin, A.V., Grossmann, R., 2008. Effects of ghrelin and its analogues on chicken
ovarian granulosa cells. Domest. Anim. Endocrinol. 34, 125–134.
Van der Lely, A.J., Tschop, M., Heiman, M.L., Ghigo, E., 2004. Biological, physiological,
pathophysiological, and pharmacological aspects of ghrelin. Endocr. Rev. 25,
426–457.
Viani, I., Vottero, A., Tassi, F., Cremonini, G., Sartori, C., Bernasconi, S., Ferrari, B.,
Ghizzoni, L., 2008. Ghrelin inhibits steroid biosynthesis by cultured granulosa-
lutein cells. J. Clin. Endocrinol. Metab. 93, 1476–1481.
Wang, C., Jie, Yu., Kallen, C.B., 2008. Two estrogen response element sequences near
the PCNA gene are not responsible for its estrogen-enhanced expression in
MCF7 cells. PLoS One. http://dx.doi.org/10.1371/journal.pone.0003523.
Wren, A., Small, C., Ward, H., Murphy, K., Dakin, C., Taheri, S., Kennedy, A.R., Roberts,
G.H., Morgan, D.G., Ghatei, M.A., Bloom, S.R., 2000. The novel hypothalamic
peptide ghrelin stimulates food intake and growth hormone secretion.
Endocrinology 141 (1), 4325–4328.
Zhang, W., Lei, Z., Su, J., Chen, S., 2008. Expression of ghrelin in the porcine
hypothalamo–pituitary–ovary axis during the estrous cycle. Anim. Reprod. Sci.
109, 356–367.