REPRODUCTION-DEVELOPMENT

Maternal Ghrelin Deficiency Compromises

Reproduction in Female Progeny through Altered
Uterine Developmental Programming

J. Ryan Martin, Sarah B. Lieber, James McGrath, Marya Shanabrough,

Tamas L. Horvath, and Hugh S. Taylor
Department of Obstetrics, Gynecology, and Reproductive Sciences (J.R.M., S.B.L., H.S.T.) and

Downloaded from https://academic.oup.com/endo/article/152/5/2060/2457138 by guest on 04 April 2023

Department of Comparitive Medicine (J.M., M.S., T.L.H.), Yale University School of Medicine, New
Haven, Connecticut 06520

Ghrelin has a well-known role in the regulation of appetite, satiety, energy metabolism, and
reproduction; however ghrelin has not been implicated in reproductive tract development. We
examined the effect of ghrelin deficiency on the developmental programming of female fer-
tility. We observed that female wild-type mice born of ghrelin heterozygote dams (i.e. exposed
in utero to ghrelin deficiency) had diminished fertility and produced smaller litters. We dem-
onstrate that exposure to in utero ghrelin deficiency led to altered developmental program-
ming of the reproductive tract. The number of ovarian follicles, corpora lutea, and embryos
produced were identical in both exposed and unexposed mice. However wild-type embryos
transferred to uteri of mice exposed to in utero ghrelin deficiency had a 60% reduction in the
rate of embryo implantation compared with those transferred to wild-type unexposed uteri. We iden-
tified significant alterations in the uterine expression of four genes critical for implantation and a
defect in uterine endometrial proliferation. Taken together, these results demonstrate that the mech-
anism of subfertility was abnormal endometrial function. In utero exposure to decreased levels of
ghrelin led to defects in developmental programming of the uterus and subsequent subfertility in
wild-type offspring. (Endocrinology 152: 2060 –2066, 2011)

ormones involved in energy balance and metabo-
H lism, such as ghrelin, have been shown to regulate
reproductive function in animals and humans (1, 2). Ghrelin
functions as an endocrine/paracrine mediator that links en-
ergy homeostasis and physiological regulation of reproduc-
tion; however, ghrelin’s role in development is not well char-
acterized (3–5). Here we investigate the role of ghrelin in
female reproductive tract developmental programming and
subsequent fertility in the offspring.
Ghrelin is produced primarily in the stomach in re-
sponse to hunger and starvation (6, 7). It circulates in
the blood, serving as a peripheral signal to the central
nervous system to stimulate feeding (2, 6 –9). N-oc-
tanoyl-modified ghrelin has bioactivity whereas des-
acyl ghrelin is thought to be inactive (10). Active ghrelin
is an endogenous ligand for the GH secretagogue re-
ISSN Print 0013-7227 ISSN Online 1945-7170
Printed in U.S.A.
Copyright © 2011 by The Endocrine Society
doi: 10.1210/en.2010-1485 Received December 28, 2010. Accepted January 24, 2011.
First Published Online February 15, 2011
ceptor type 1a (10). Production of ghrelin increases dur-
ing fasting or in conditions of negative energy balance,
and hence lean individuals have high serum ghrelin lev-
els. Conversely, levels are typically low in obese indi-
viduals (11, 12). The role of ghrelin in appetite, satiety,
energy metabolism, and reproduction is established;
however, the impact of in utero exposure to ghrelin
deficiency on the reproductive success of future gener-
ations has not previously been investigated (1).
Both ghrelin and its receptor are expressed in a wide
variety of tissues, including reproductive organs such as
the ovary, uterus, testes, and placenta and are thought
to help regulate gonadotropin release and the timing of
puberty (1, 13). Ghrelin is secreted in endometrial fluid,
and levels rise in response to fasting (14). Ghrelin is
expressed in both the uterus and ovaries throughout the
rodent estrous cycle, reaching maximal levels in the lu-
teal phase; ghrelin is thought to have a role in adult
Abbreviations: PCNA, Proliferating cell nuclear antigen.

2060 endo.endojournals.org Endocrinology, May 2011, 152(5):2060 –2066

Endocrinology, May 2011, 152(5):2060 –2066
uterine function and endometrial decidualization (12–
16). In humans, it has been established that ghrelin and
its receptor are expressed in the testis, ovary, and pla-
centa and is thought to contribute to the functional
control of the reproductive axis and its integration with
energy balance (1). There have been no reports describ-
ing a role for ghrelin in reproductive tract development.
Developmental programming describes the process
by which a developing fetus undergoes permanent al-
terations or adaptations based on in utero exposures.
These modifications are the mediators of gene-environ-
ment interaction in which genetic traits can be modified
by an epigenetic response to the environment (17). De-
velopmental programming provides plasticity to fetal
gene expression in response to external stimuli, allow-
ing for adaptation of fetal tissue to optimize survival
after birth (18). However, adaptation to short-term ad-
verse stimuli may alter gene expression in a way that
impairs reproductive potential. Diethylstilbestrol is a
well-known example of an agent affecting developmen-
tal programming of the reproductive tract; in utero ex-
posure results in impaired reproductive potential of fe-
male offspring (19, 20).
We observed that wild-type progeny of ghrelin
heterozygous dams had decreased fertility and smaller
litter size when compared with wild-type progeny of
wild-type dams. We hypothesized that exposure to
ghrelin deficiency in utero would lead to altered devel-
opmental programming of the reproductive tract. Spe-
cifically, we determined that female offspring exposed
in utero to ghrelin deficiency displayed subfertility as
adults, and we isolated the defect to impairment of the
uterine function. We identified epigenetic alterations in
FIG. 1. Wild-type (WT) female mice born from ghrelin heterozygote (HET) dams,
exposed to in utero ghrelin deficiency, are termed “exposed.” Female wild-type mice
born from wild-type dams are termed “unexposed.”
endo.endojournals.org 2061
uterine gene expression that caused significant endo-
metrial defects and impaired implantation.
Materials and Methods
Animal care
Ghrelin-deficient B6D2F1 mice and wild-type B6D2F1 were
obtained from Regeneron. Phenotypic evaluation of ghrelin het-
erozygote and wild-type mice revealed no difference in weight,
body mass index, or food intake. Adult wild-type B6D2F1 fe-
males exposed to ghrelin deficiency in utero (pups of ghrelin
heterozygote dams) and wild-type females unexposed to ghrelin
Downloaded from https://academic.oup.com/endo/article/152/5/2060/2457138 by guest on 04 April 2023
deficiency (pups of wild-type dams of the same strain) mice were
obtained by breeding ghrelin heterozygote dams or wild-type
dams, respectively, with wild-type males as demonstrated in Fig.
1 (n ⫽ 30 per group). Mice were housed in standard polypro-
pylene cages in a temperature-controlled room (22 C) with a 14-h
light, 10-h dark cycle. Food (Purina Chow, Purina Mills, Rich-
mond, IN) and water were provided ad libitum. Wild-type fe-
male mice born from ghrelin heterozygotes dams, exposed to in
utero ghrelin deficiency, are termed “exposed” (Fig. 1). They
were mated with B6D2F1 male mice and analyzed for litter size.
Female wild-type mice born from wild-type dams, termed “un-
exposed,” were similarly analyzed. All mice were genotyped af-
ter tail clipping using red extract standard genotyping protocol
(Sigma Chemical Co., St. Louis, MO). All breeding was done on
6-wk-old mice, and only first pregnancy was analyzed in all stud-
ies except long-term breeding studies that were conducted over
16 months. All experiments were conducted in accordance with
the Yale University Institutional Animal Care and Use Commit-
tee Guidelines.
Embryo collection and transfer
To evaluate embryo production, exposed and unexposed
mice were mated with wild-type males; embryos were obtained
via oviduct flushing. Separately, to evaluate term pregnancy sur-
vival rates, exposed and unexposed pseudopregnant females
were mated with vasectomized males. Wild-type embryos were
then transferred to both exposed and unexposed
uteri. After a 17-d gestation, the mice were eu-
thanized and litter sizes were tabulated. The birth
rate per embryo transferred was calculated by
comparing litter size on d 17 of pregnancy to the
number of embryos that were transferred to each
uterus.
Ghrelin assay
Mice were fasted for 24 h and euthanized and
blood was drawn by cardiac puncture. Blood was
collected in EDTA-containing tubes and kept at 4
C during processing. Samples were centrifuged at
3000 rpm for 30 min; hydrochloric acid and phe-
nylmethylsulfonyl fluoride were immediately
added to the plasma. Total and active plasma ghre-
lin levels were measured by RIA using kits pur-
chased from LINCO Research (St. Charles, MO).
This RIA kit uses a polyclonal antibody raised in
rabbit against both octanoylated and des-octanoy-
lated ghrelin and ghrelin as the tracer. The lower
2062 Martin et al. Maternal Ghrelin Deficiency and Reproduction
limit of detection was 80 pg/ml. Known concentrations were used
to generate a standard curve. Acetylated (active) serum ghrelin lev-
els were measured in 10 wild-type mice and 10 ghrelin heterozy-
gotes. Because acetylated ghrelin has been widely shown to be bi-
ologically active, this study evaluated N-octanoyl-modified ghrelin.
Histological and immunohistochemical analysis
The ovaries from mice euthanized on d 4 of pregnancy were
removed, fixed, sectioned, and stained with hematoxylin/eosin
to evaluate the number of follicles and corpora lutea present. The
complete ovary was serially sectioned from each mouse (n ⫽ 30
exposed and 30 unexposed), and the number of corpora lutea
was counted using 10 random sections from each mouse. Uterine
expression of proliferating cell nuclear antigen (PCNA) was as-
sessed by immunohistochemical staining using antibody to
PCNA (1:500, Chemicon, Inc., Temecula, CA). Uteri excised
from exposed and unexposed mice were fixed in formalin over-
night at room temperature and embedded in paraffin. A series of
5-mm sections were deparaffinized in xylene and ethanol and
rinsed with 3% hydrogen peroxide. After a 1-h incubation with
1.5% normal goat blocking serum, sections were placed in pri-
mary antibody overnight at 4 C Normal goat IgG (Santa Cruz
Biotechnology, Inc., Santa Cruz, CA) was used as a negative
control. Horse ␣-goat biotinylated secondary antibody (Vector
Laboratories, Burlingame, CA) was applied for 1 h at 4 C. Slides
were washed in 1⫻ PBS-Tween 20, incubated in ABC Elite (Vec-
tor Laboratories) for 15 min at room temperature, washed in 1⫻
PBS-Tween 20, and incubated for 5 min in diaminobenzidine
(Vector Laboratories). A 12-sec exposure to hematoxylin was
used as a counterstain. All slides were processed simultaneously
for each primary antibody.
Quantitative real-time RT-PCR
Exposed and unexposed mice were mated with wild-type
males. Detection of a vaginal plug was considered d 0 of preg-
nancy. To evaluate uteri during implantation, animals were eu-
thanized 4 d after vaginal plug detection with carbon dioxide and
cervical dislocation. Uteri were removed, and one horn was fixed
in 4% formalin and embedded in paraffin for histological
and immunohistochemical analysis. DNA and RNA were iso-
lated from the other uterine horn using the DNeasy and RNeasy
Mini Kits, respectively (QIAGEN, Valencia, CA) according to
the manufacturer’s protocol. Quantitative real-time RT-PCR
was performed using the LightCycler SYBR Green RT-PCR kit
from Roche (Stockholm, Sweden). Primers used are shown in
Table 1. Total RNA (1 ␮g) was reverse transcribed in 20 ␮l of
reaction mixture containing l0 mm each of deoxy (d) ATP, dCTP,
dGTP, and dTTP; 20 pmol oligo(dT); 40 U/␮l ribonuclease in-
hibitor, l0 U/␮l avian myeloblastosis virus-reverse transcriptase,
TABLE 1. Primer sequences
Sense 5ⴕ 3 3ⴕ
B-Actin GACCTCTATGCCAACACAGT
HOXA10 GCCCTTCCGAGAGCAGCAAAG
Progesterone B GGTCCCCCTTGCTTGCTTGCA
Progesterone AB CTGTGCCTTACCATGTGGCA
WNT7A CGACAAGGAGAAGCAAGG
EMX2 TCTGGGTCATCGCTTCCAAG
IGFBP1 CCGCCACGAGCACCTTGTTCA
GHSR AAGATGCTTGCTGTGGTG
Endocrinology, May 2011, 152(5):2060 –2066
and 10⫻ avian myeloblastosis virus-reverse transcriptase buffer
for 30 min at 61 C. PCRs for endometrial receptivity genes were
performed for 45 cycles of 95 C for 2 sec; 65 C for 5 sec; and 72
C for 18 sec. The increasing fluorescence of PCR products during
amplification was monitored, from which a quantitative stan-
dard curve was created. Quantitation of samples was determined
with the Roche LightCycler and adjusted to the quantitative ex-
pression of ␤-actin from these same samples. Melting curve anal-
ysis was conducted to determine the specificity of the amplified
products and to ensure the absence of primer-dimer formation.
All products obtained yielded the predicted melting temperature.
Bisulfite modification and methylation-specific PCR
Genomic DNA (1␮g) from the uterus of mice euthanized on
Downloaded from https://academic.oup.com/endo/article/152/5/2060/2457138 by guest on 04 April 2023
d 4 of pregnancy was treated with sodium bisulfite using the
CpGenome DNA Modification Kit (Upstate Biotechnology,
Charlottesville, VA). This process converts unmethylated cyto-
sine residues to uracil, whereas methylated cytosines remain un-
changed. Bisulfite-modified samples were aliquoted and stored
at ⫺80 C. A total of 200 ng sodium bisulfite-treated DNA was
then analyzed using primer sets directed to the 5⬘-promoter and
intron-1 regions of the bisulfite-modified Hoxa10 gene se-
quence. These regions contain multiple CpG islands, and alter-
ations in methylation in this region regulate HOXA10 expres-
sion (19). DNA from CpG methylated mouse genomic DNA
(New England BioLabs, Ipswich, MA) was used as a positive
control for methylation. Unmethylated mouse genomic DNA
(New England BioLabs) was used as a negative control for meth-
ylated genes. PCR amplification of 5 ␮l bisulfite-treated DNA
template was performed in a 50-␮l reaction containing 1.5 ␮l
forward and reverse primers, 1.25 mmol/liter deoxynucleotide
triphosphates, 25 mM Mg2⫹, and 0.5 ␮l HotStarTaq DNA poly-
merase (QIAGEN). All primers were synthesized by the Depart-
ment of Pathology, Yale University School of Medicine. Ampli-
fication conditions were as follows: 15 min starting at 95 C; 35
cycles at 95 C for 30 sec; 59 C (methylated) or 53 C (unmeth-
ylated) for 30 sec; and 72 C for 30 sec, followed by a final ex-
tension at 72 C for 10 min. PCR products were resolved by
electrophoresis on a 2% agarose gel and stained with ethidium
bromide.
Bisulfite-sequencing PCR
Quantification of methylation at the 5⬘-promoter and in-
tron-1 regions in the mouse was investigated via bisulfite-se-
quencing PCR. A total of 200 ng bisulfite-treated DNA was used
in a 50-␮l reaction containing 1.5 ␮l forward and reverse prim-
ers, 1.25 mmol/liter deoxynucleotide triphosphates, 25 mM
Mg2⫹, and 0.5 ␮l HotStarTaq DNA polymerase. Amplification
conditions were as follows: 15 min starting at 95 C; 35 cycles at
Antisense 5ⴕ 3 3ⴕ
TTGCTGATCCACATCTGCT
AGGTGGACGCTGCGGCTAATCTCTA
CAGGACCGAGGAAAAAGCAG
TTCACCATGCCCGCCAGGAT
TCCTCCAGGATCTTCCGA
CAAAAGCGTGCTCTAGCCTTAAA
TGTTGGGCTGCAGCTAATCTCT
GAGGACAAAGGACACCAG
Endocrinology, May 2011, 152(5):2060 –2066
FIG. 2. Mean serum N-octanoyl ghrelin levels were significantly lower
in ghrelin heterozygotes than in wild-type mice of the same strain,
796.0 pg/ml and 1159.1 pg/ml, respectively. (n ⫽ 5 per group; *, P ⫽
0.02). Shown is mean ⫾ SEM.
95 C for 30 sec; 53 C for 30 sec; and 72 C for 30 sec, followed
by a final extension at 72 C for 10 min. PCR products were
resolved by electrophoresis on a 2% agarose gel and stained with
ethidium bromide. The appropriate-sized product bands were
then isolated and excised from the gel and purified using the
QIAQuick Gen Extraction Kit (QIAGEN), according to the
manufacturer’s protocol. The resultant products were then se-
quenced using the 3730xl DNA Analyzer (Applied Biosystems,
Foster City, CA). For each CpG site, a C was interpreted as a
methylated site, whereas a T was interpreted as an umethylated
(and, thus, bisulfite-modified) site.
Statistical analysis
Litter size tabulation data are presented as mean ⫾ SD and
were analyzed using a t test. The difference in gene expression
between two groups was compared by Student’s t test. Differ-
ences in implantation rates were compared using ␹2. The expres-
sion of PCNA protein by immunohistochemistry was quantified
by two evaluators blinded to the treatment group. An H-score
was determined separately for the glandular and stromal cells on
each slide. Intensity of Hoxa10 nuclear staining was indicated by
a value of 1, 2, or 3 (weak, moderate, or strong, respectively).
Results
Initial experiments verified that ghrelin heterozygotes had
lower serum ghrelin levels than wild-type B6D2F1 mice.
After 24 h of food deprivation, serum from 10 wild-type
mice and 10 ghrelin heterozygotes was collected via car-
diac puncture. RIA was used to measure acetylated ghrelin
TABLE 2. Food intake, weight, and weight gain in pregnancy for wild-type and ghrelin heterozygote females
Wild type-exposed
Average body weight (grams)
Average food consumption per day (grams)
Average weight gain per pregnancy (until d 4)(grams)
a
NS, Nonsignificant (P ⬎ 0.05)
endo.endojournals.org 2063
levels in the serum. Heterozygotes had significantly lower
serum acetylated ghrelin than the wild-type mice. Mean
circulating levels of acetylated ghrelin in the heterozygotes
was 796 pg/ml compared with 1159.1 pg/ml in the wild-
type animals (P ⫽ 0.03) (Fig. 2). Wild-type progeny of
ghrelin heterozygotes had ghrelin levels similar to unex-
posed wild-type controls. Food intake, weight, and weight
gain in pregnancy for both wild-type and ghrelin hetero-
zygote females are shown in Table 2. No significant dif-
ferences were detected in weight, food intake, or weight
gain in pregnancy (n ⫽ 30 per group).
To assess the influence of maternal ghrelin deficiency
Downloaded from https://academic.oup.com/endo/article/152/5/2060/2457138 by guest on 04 April 2023
on reproductive capacity in female offspring, we com-
pared reproductive capacity of wild-type mice that devel-
oped in a ghrelin-deficient uterine environment to that of
wild-type progeny of ghrelin-replete dams. Here we use
the term “exposed” to refer to mice that are genetically
wild-type, but are progeny of ghrelin heterozygous dams
and therefore exposed to ghrelin deficiency in utero (Fig.
1). Exposed and unexposed females were mated with wild-
type males over a 16-month span. As demonstrated in Fig.
3, exposed females have significantly reduced litter sizes
relative to the wild-type controls. Exposed females bore an
average of 4.78 pups per litter compared with 8.65 pups
per litter in the unexposed group (P ⫽ 0.01). A similar
difference was observed when only the first litter was an-
alyzed. The mean number of litters was similar between
the groups. The litter size of the exposed wild-type females
was similar to that observed in ghrelin heterozygotes.
Ghrelin (⫺/⫺) female mice infrequently conceived and
rarely produced viable offspring.
To determine whether the decreased litter sizes were
related to decreased number of ovulated oocytes, 30 ova-
ries from each group (exposed and unexposed) were sec-
tioned, stained with hematoxylin/eosin, and analyzed mi-
croscopically for preovulatory follicles and corpora lutea
number 4 d after mating. Complete ovaries were cut into
serial sections, and all follicles and corpora lutea were
counted from 10 random sections per animal. Both the
exposed and unexposed group contained similar numbers
of follicles and corpora lutea per low-power field (Fig. 4).
The mean number of corpora lutea was 14.2 in the exposed
group and 13.5 in the unexposed group. Similarly, the num-
ber of embryos was assessed 4 d after detection of a vaginal
plug. The mean number of embryos flushed from the uteri of
Wild type-unexposed P value
16.9 17.1 P ⫽ NSa
3.5 3.6 P ⫽ NS
1.8 1.9 P ⫽ NS
2064 Martin et al. Maternal Ghrelin Deficiency and Reproduction Endocrinology, May 2011, 152(5):2060 –2066

Downloaded from https://academic.oup.com/endo/article/152/5/2060/2457138 by guest on 04 April 2023

FIG. 3. Decreased mean litter size in wild-type offspring exposed to
maternal ghrelin deficiency in utero (4.78) compared with wild-type FIG. 5. Birth rate of wild-type embryos transferred to exposed or
unexposed to ghrelin deficiency (8.65). *, P ⫽ 0.01. unexposed uteri of pseudopregnant mice (*, P ⫽ 0.02). Birth rate per
embryo transferred is the number of embryos transferred divided by
the litter size on d 17.
exposed and unexposed mice after mating were identical
(12.5 and 12.1, respectively). Normal ovarian function and
of a vaginal plug, were analyzed. Consistent with the re-
embryo production suggested that the uterus, rather than
sults of the uterine embryo transfer studies, the mRNA
ovary or embryo, was the anatomic location of the defect
expression of multiple genes required for uterine recep-
responsible for the observed differences in litter size.
tivity was altered in the uterus of the exposed mice (Fig. 6).
To determine whether decreased litter sizes were due to
HOXA10 and progesterone receptor B mRNA expression
a uterine etiology, wild-type unexposed embryos were
were significantly increased in the ghrelin-exposed mice com-
transferred to the uteri of exposed and unexposed wild-
pared with the unexposed group. WNT7A and EMX2 ex-
type females (Fig. 5). To calculate the term birth rate per
pression were significantly decreased in exposed mice com-
embryo transferred, the number of embryos was com-
pared with wild-type controls. Total progesterone receptor
pared after 17 d of gestation. In the unexposed uteri 50%
(Fig. 6, AB) expression was also moderately elevated,
of embryos implanted and produced a live born (14/28),
whereas IGF-binding protein-1 (Fig. 6, IGFBP1) expression
whereas in the exposed group only 20% of embryos suc-
was decreased in exposed mice, although these did not reach
cessfully implanted and reached maturity (6/30) (P ⫽
significance. These genes all function in both the regulation
0.02). Together these observations indicate that dimin-
of endometrial growth and differentiation in the estrous cycle.
ished ghrelin exposure in utero affects developmental pro-
Based on the known role of Hoxa10 and Emx2 in en-
gramming of the uterus in exposed animals.
dometrial proliferation, we investigated the ability of the
We next sought to identify the endometrial defects that
exposed uterine endometrium to proliferate. Here PCNA
accounted for the subfertility in the exposed animals.
Uteri, from exposed and unexposed mice that were eu-
thanized in the implantation window, 4 d after detection

FIG. 6. Exposure to ghrelin deficiency in utero alters expression of

FIG. 4. Ovaries were obtained from exposed and unexposed mice,
sectioned, and stained with hematoxylin and eosin. Similar numbers of
follicles and corpora lutea were seen in the ovaries of exposed
offspring (A) compared with unexposed offspring (B). (n ⫽ 30 mice per
group). Representative photomicrographs are shown. Scale bar, 1 mm.
genes that are critical for endometrial receptivity and implantation.
Gene expression was measured 4 d after the detection of the vaginal
plug at the time of implantation. HOXA10 and progesterone B
expression were significantly higher in the ghrelin-exposed group (P ⫽
0.021 and P ⫽ 0.002, respectively). WN7A and Emx2 expression were
significantly lower in the ghrelin- exposed group (P ⫽ 0.004 and P ⫽
0.005, respectively). *, P ⬍ 0.05; **, P ⬍ 0.01.
Endocrinology, May 2011, 152(5):2060 –2066 endo.endojournals.org 2065

ation of a receptive endometrium have

been described, and specifically, altera-
tion of Hoxa10 expression dramatically
affects implantation (21–26). To evalu-
ate the peri-implantation window, we
evaluated gene expression on d 4 of
pregnancy. Here we show that Hoxa10
is significantly elevated after exposure to
ghrelin deficiency in utero. Another
marker of endometrial receptivity,
Emx2, was found to be significantly de-
creased after exposure to ghrelin defi-

Downloaded from https://academic.oup.com/endo/article/152/5/2060/2457138 by guest on 04 April 2023

ciency in utero. This is consistent with
previous studies demonstrating that
Hoxa10 directly represses Emx2 expres-
FIG. 7. Immunohistochemical analysis reveals enhanced expression of PCNA in uterine cells
sion (27). In addition, expression of
from exposed mice. Top panel, Uterine section from exposed female (E) displayed greater
stromal cell expression of PCNA at estrus than unexposed females (U). Bottom panel, H-Score WNT7A and PR-B, markers of endome-
was used to quantify PCNA expression in both endometrial glands and stroma (*, P ⬍ 0.03, trial differentiation (28 –32), were al-
exposed compared with unexposed). tered in exposed animals compared with
controls. Coordination of endometrial
was used as a marker of endometrial proliferation (20). In differentiation with embryo maturation is critical for im-
Fig. 7, we demonstrate elevated PCNA expression in ex- plantation. This aberrant gene regulation likely results in
posed females relative to controls at d 4 of pregnancy. dyssynchrony between the endometrium and embryo, pre-
Differential intensity of PCNA staining was especially ap- venting implantation.
parent in uterine stromal cells. Precise regulation of endometrial proliferation is sim-
We sought to determine the mechanism responsible for ilarly critical for establishment of endometrial receptivity.
programming the expression of uterine genes after exposure Both Emx2 and Hoxa10 have been shown to regulate
to in utero ghrelin deficiency. We investigated whether the endometrial proliferation. Hoxa10-deficient mice have
observed changes in gene expression were correlated with impaired endometrial proliferation leading to loss of im-
alterations in DNA methylation using bisulfite conversion. plantation (25). Conversely, decreasing Emx2 expression
Twenty regions of the Hoxa10 promoter rich in CpG islands results in increased cell proliferation and lower implanta-
are known to epigenetically regulate this gene and were pre-
tion rates (33). Here exposed mice showed elevated
viously identified as sites responsible for in utero epigenetic
Hoxa10 and decreased EMX2 gene expression correlating
regulation (19). DNA from five exposed mice and five un-
with the observed increase in endometrial proliferation.
exposed mice were examined. The quantitative difference in
The increased proliferation rate likely results in further
methylation levels of Hoxa10 expressed as the mean per-
uncoupling of endometrial and embryo development.
centage of methylation at each CpG island was also exam-
In addition to evaluating uterine receptivity in the peri-
ined, demonstrating the extent of methylation on average for
implantation window, we analyzed overall reproductive suc-
both the promoter and intronic regions. In all 20 sites, there
cess by calculating the birth rate per embryo transferred. The
was less than a 1% difference in methylation between ex-
mice exposed to ghrelin deficiency in utero had a decreased
posed and unexposed mice (data not shown). Differences
birth rate due to a uterine defect. We demonstrated defects in
were not statistically significant, indicating that methylation
uterine gene expression in the window of implantation and
at these sites was not responsible for alterations in gene
suggest that these alterations lead to decreased implantation
expression.
and subsequently are responsible for the observed decrease in
birth rate. Additional or continued defects in uterine gene
expression in the postimplantation window may further af-
Discussion
fect birth rate. The mechanism of the persistent altered gene
Successful implantation requires the synchronous devel- expression is not due to DNA methylation and is a topic of
opment of both the embryo and the endometrium. Uterine current investigation.
receptivity is established by precise modulation of endo- Taken together, we have demonstrated impaired female
metrial differentiation regulated by ovarian hormones and fertility as a result of ghrelin deficiency in utero. We identified
timed to ovulation. Multiple genes crucial for differenti- epigenetic alterations in uterine gene expression, leading to
2066 Martin et al. Maternal Ghrelin Deficiency and Reproduction
differentiation and proliferation defects and impaired em-
bryo implantation. Exposure to ghrelin deficiency in utero
impairs developmental programming and causes uterine ab-
normalities that result in subfertility. Ghrelin is decreased in
obese individuals; these findings may have significant repro-
ductive implications for daughters of obese women.
Acknowledgments
Address all correspondence and requests for reprints to: Hugh S.
Taylor, Yale University School of Medicine, 333 Cedar Street,
P.O. Box 208063, New Haven, Connecticut 06520. E-mail:
hugh.taylor@yale.edu.
This work was supported by National Institutes of Health
Grants HD052668, HD036887, and ES010610.
Disclosure Summary: The authors have no conflict of interest.
References
1. Garcı́a MC, López M, Alvarez CV, Casanueva F, Tena-Sempere M,
Diéguez C 2007 Role of ghrelin in reproduction. Reproduction 133:
531–540
2. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa
K 1999 Ghrelin is a growth-hormone-releasing acylated peptide
from stomach. Nature 402:656 – 660
3. Tschöp M, Smiley DL, Heiman ML 2000 Ghrelin induces adiposity
in rodents. Nature 407:908 –913
4. Cummings DE, Weigle DS, Frayo RS, Breen PA, Ma MK, Dellinger
EP, Purnell JQ 2002 Plasma ghrelin levels after diet-induced weight
loss or gastric bypass surgery. N Engl J Med 346:1623–1630
5. Pasquali R, Pelusi C, Genghini S, Cacciari M, Gambineri A 2003
Obesity and reproductive disorders in women. Hum Reprod Update
9:359 –372
6. Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kan-
gawa K, Matsukura S 2001 A role for ghrelin in the central regula-
tion of feeding. Nature 409:194 –198
7. Cummings DE, Overduin J 2007 Gastrointestinal regulation of food
intake. J Clin Invest 117:13–23
8. Ariyasu H, Takaya K, Tagami T, Ogawa Y, Hosoda K, Akamizu T,
Suda M, Koh T, Natsui K, Toyooka S, Shirakami G, Usui T, Shi-
matsu A, Doi K, Hosoda H, Kojima M, Kangawa K, Nakao K 2001
Stomach is a major source of circulating ghrelin, and feeding state
determines plasma ghrelin-like immunoreactivity levels in humans.
J Clin Endocrinol Metab 86:4753– 4758
9. Broglio F, Gottero C, Benso A, Prodam F, Volante M, Destefanis S,
Gauna C, Muccioli G, Papotti M, van der Lely AJ, Ghigo E 2003
Ghrelin and the endocrine pancreas. Endocrine 22:19 –24
10. Kojima M, Kangawa K 2005 Ghrelin: structure and function.
Physiol Rev 85:495–522
11. Hansen TK, Dall R, Hosoda H, Kojima M, Kangawa K, Christian-
sen JS, Jørgensen JO 2002 Weight loss increases circulating levels of
ghrelin in human obesity. Clin Endocrinol (Oxf) 56:203–206
12. Shiiya T, Nakazato M, Mizuta M, Date Y, Mondal MS, Tanaka M,
Nozoe S, Hosoda H, Kangawa K, Matsukura S 2002 Plasma ghrelin
levels in lean and obese humans and the effect of glucose on ghrelin
secretion. J Clin Endocrinol Metab 87:240 –244
13. Tawadros N, Salamonsen LA, Dimitriadis E, Chen C 2007 Facili-
tation of decidualization by locally produced ghrelin in the human
endometrium. Mol Hum Reprod 13:483– 489
14. Kawamura K, Sato N, Fukuda J, Kodama H, Kumagai J, Tanikawa
Endocrinology, May 2011, 152(5):2060 –2066
H, Nakamura A, Honda Y, Sato T, Tanaka T 2003 Ghrelin inhibits
the development of mouse preimplantation embryos in vitro. En-
docrinology 144:2623–2633
15. Caminos JE, Tena-Sempere M, Gaytán F, Sanchez-Criado JE, Bar-
reiro ML, Nogueiras R, Casanueva FF, Aguilar E, Diéguez C 2003
Expression of ghrelin in the cyclic and pregnant rat ovary. Endo-
crinology 144:1594 –1602
16. Tanaka K, Minoura H, Isobe T, Yonaha H, Kawato H, Wang DF,
Yoshida T, Kojima M, Kangawa K, Toyoda N 2003 Ghrelin is
involved in the decidualization of human endometrial stromal cells.
J Clin Endocrinol Metab 88:2335–2340
17. Bjornsson HT, Fallin MD, Feinberg AP 2004 An integrated epige-
netic and genetic approach to common human disease. Trends Genet
20:350 –358
18. Greathouse KL, Cook JD, Lin K, Davis BJ, Berry TD, Bredfeldt TG,
Downloaded from https://academic.oup.com/endo/article/152/5/2060/2457138 by guest on 04 April 2023
Walker CL 2008 Identification of uterine leiomyoma genes devel-
opmentally reprogrammed by neonatal exposure to diethylstilbes-
trol. Reprod Sci 15:765–778
19. Bromer JG, Wu J, Zhou Y, Taylor HS 2009 Hypermethylation of
homeobox A10 by in utero diethylstilbestrol exposure: an epigenetic
mechanism for altered developmental programming. Endocrinol-
ogy 150:3376 –3382
20. Lai MD, Lee LR, Cheng KS, Wing LY 2000 Expression of prolif-
erating cell nuclear antigen in luminal epithelium during the growth
and regression of rat uterus. J Endocrinol 166:87–93
21. Taylor HS, Vanden Heuvel GB, Igarashi P 1997 A conserved Hox
axis in the mouse and human female reproductive system: late es-
tablishment and persistent adult expression of the Hoxa cluster
genes. Biol Reprod 57:1338 –1345
22. Bagot CN, Troy PJ, Taylor HS 2000 Alteration of maternal Hoxa10
expression by in vivo gene transfection affects implantation. Gene
Ther 7:1378 –1384
23. Taylor HS, Arici A, Olive D, Igarashi P 1998 HOXA10 is expressed
in response to sex steroids at the time of implantation in the human
endometrium. J Clin Invest 101:1379 –1384
24. Satokata I, Benson G, Maas R 1995 Sexually dimorphic sterility
phenotypes in Hoxa10-deficient mice. Nature 374:460 – 463
25. Yao MW, Lim H, Schust DJ, Choe SE, Farago A, Ding Y, Michaud S,
Church GM, Maas RL 2003 Gene expression profiling reveals proges-
terone-mediated cell cycle and immunoregulatory roles of Hoxa-10 in
the preimplantation uterus. Mol Endocrinol 17:610 – 627
26. Vitiello D, Pinard R, Taylor HS 2008 Gene expression profiling
reveals putative HOXA10 downstream targets in the periimplanta-
tion mouse uterus. Reprod Sci 15:529 –535
27. Troy PJ, Daftary GS, Bagot CN, Taylor HS 2003 Transcriptional
repression of peri-implantation EMX2 expression in mammalian
reproduction by HOXA10. Mol Cell Biol 23:1–13
28. Gaetje R, Holtrich U, Karn T, Cikrit E, Engels K, Rody A, Kaufmann
M 2007 Characterization of WNT7A expression in human endo-
metrium and endometriotic lesions. Fertil Steril 88:1534 –1540
29. Parr BA, McMahon AP 1998 Sexually dimorphic development of the
mammalian reproductive tract requires Wnt-7a. Nature 395:707–710
30. Rutanen EM, Pekonen F, Mäkinen T 1988 Soluble 34K binding
protein inhibits the binding of insulin-like growth factor I to its cell
receptors in human secretory phase endometrium: evidence for au-
tocrine/paracrine regulation of growth factor action. J Clin Endo-
crinol Metab 66:173–180
31. Fazleabas AT, Kim JJ, Strakova Z 2004 Implantation: embryonic
signals and the modulation of the uterine environment–a review.
Placenta 25(Suppl A):S26 –S31
32. Giudice LC, Dsupin BA, Jin IH, Vu TH, Hoffman AR 1993 Differ-
ential expression of messenger ribonucleic acids encoding insulin-
like growth factors and their receptors in human uterine endome-
trium and decidua. J Clin Endocrinol Metab 76:1115–1122
33. Taylor HS, Fei X 2005 Emx2 regulates mammalian reproduction by
altering endometrial cell proliferation. Mol Endocrinol 19:2839 –
2846