Domestic Animal Endocrinology 59 (2017) 11–22

Contents lists available at ScienceDirect

Domestic Animal Endocrinology

journal homepage: www.domesticanimalendo.com

Glucocorticoid metabolism in equine follicles and oocytes

D. Scarlet a, *, N. Ille b, R. Ertl c, B.G. Alves d, G.D.A. Gastal d, S.O. Paiva d,
M.O. Gastal d, E.L. Gastal d, C. Aurich b
a
Division of Obstetrics, Gynecology and Andrology, Department for Small Animals and Horses, University of Veterinary Medicine
Vienna, 1210 Vienna, Austria
b
Center for Artificial Insemination and Embryo Transfer, Department for Small Animals and Horses, University of Veterinary
Medicine Vienna, 1210 Vienna, Austria
c
Vetcore Facility, University of Veterinary Medicine Vienna, 1210 Vienna, Austria
d
Department of Animal Science, Food and Nutrition, Southern Illinois University, Carbondale, IL 62901, USA

a r t i c l e i n f o a b s t r a c t

Article history: The objective of this study was to determine whether (1) systemic and intrafollicular
Received 12 July 2016 cortisol concentrations in horses are directly related and (2) supraphysiological levels of
Received in revised form 30 September 2016 glucocorticoids affect in vitro maturation (IVM) rates of oocytes. Specifically, we studied
Accepted 23 October 2016
the (1) changes in the intrafollicular cortisol and progesterone in context with granulosa
cell gene expression during maturation of equine follicles (from 5–9 mm, 10–14 mm, 15–19
Keywords:
mm, 20–24 mm, and
25 mm in diameter) and (2) effects of cortisol supplementation on
Cortisol
IVM rates and gene expression of equine cumulus–oocyte complexes (COCs). For these
Horse
Ovary purposes, follicular fluid, granulosa cells, and COCs were collected from 12 mares (mean
Follicle age 8.6  0.5 yr) by transvaginal aspiration. Cortisol and progesterone concentrations in
Oocyte follicular fluid from follicles
25 mm were greater (P < 0.05) than in all other follicle
classes and were positively correlated (r ¼ 0.8; P < 0.001). Plasma concentrations of
cortisol and progesterone did not differ before and after follicle aspiration (P > 0.05). In
granulosa cells, gene expression of NR3C1, HSD11B1, HSD11B2, and CYP21A2 did not differ
(P > 0.05) among different follicle classes. Maturation rates were similar (P > 0.05) among
groups, regardless of the cortisol concentration in the IVM medium. In cumulus cells,
messenger RNA expression of genes involved in glucocorticoid mechanism and apoptosis
was either increased (NR3C1 and BCL2) or decreased (HSD11B2) by treatment (P < 0.01). In
oocytes, gene expression of maturation markers (BMP15 and GDF9) was affected (P <
0.001) by cortisol treatment. This study demonstrates the involvement of glucocorticoids
in follicle and oocyte maturation and cortisol modulation by HSD11B2 in equine COCs. Our
data provide further information for understanding the normal ovarian endocrine physi-
ology which might in turn also help improve equine assisted reproduction techniques.
Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction reproductive function in a variety of species [1,2]. How-

Glucocorticoids are mediators of a systemic stress
response. Increased glucocorticoid release and synthesis
in response to acute or chronic stress impairs
* Corresponding author. Tel.: þ43-1-250776426; fax:
250775491.
E-mail address: dragos.scarlet@vetmeduni.ac.at (D. Scarlet).
ever, glucocorticoids are also involved in tissue differ-
entiation and maturation [3]. A well-regulated balance
between beneficial and detrimental effects of glucocor-
ticoid hormones might therefore be of utmost impor-
tance for reproductive tissue development as well as
maintenance of its function.
þ43-1- The ovary is a target tissue for glucocorticoids in many
species, including rats [4], mice [5], pigs [6,7], humans [8],

0739-7240/$ – see front matter Ó 2016 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.domaniend.2016.10.004
12 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22
cattle [9], sheep [10], and horses (own unpublished results).
Intracellular glucocorticoid activity is regulated by 11b-
hydroxysteroid dehydrogenase (HSD11B) enzyme types 1
and 2. Although HSD11B1 has a bidirectional activity in
activating and deactivating conversion of cortisone to
cortisol, HSD11B2 only inactivates conversion of cortisol to
cortisone [11].
Glucocorticoid effects on oocyte maturation are still
controversial. This may be because of the fact that systemic
concentration and intracellular or intracompartmental ac-
tivity of glucocorticoids are not necessarily correlated [11].
In humans and cattle, high intrafollicular concentrations of
the biological active metabolite cortisol were found around
the time of the LH peak [12,13]. In these species, oocyte
in vitro maturation (IVM) and blastocyst development were
improved by adding cortisol to the culture medium [14–
16]. Conversely, IVM of pig [7] and lamb [10] oocytes was
inhibited by glucocorticoids.
Cortisol is not produced de novo by the ovaries [17] and
reaches ovarian follicles via blood circulation, where it is
largely bound to corticosteroid-binding globulin (CBG) [18].
Only the free, unbound cortisol fraction is considered bio-
logically active [19]. Earlier, the increased expression of
HSD11B1 in the granulosa cells from human pre-ovulatory
follicles in response to the mid-cycle surge of gonadotro-
phins has been associated with metabolization of cortisol
from cortisone [20]. As ovulation has been previously
described as a controlled inflammatory reaction, it was
suggested that the local high levels of free cortisol act as
anti-inflammatory agents and thus limit tissue damage to
the follicle and the developing corpus luteum (CL) [19]. This
suggestion is in line with the finding that HSD11B1 acts
rather as a dehydrogenase during porcine [21] and bovine
[9] follicle maturation, inactivating cortisol to cortisone.
Cortisol is also present in follicular fluid (FF) of mares [22],
but its intrafollicular dynamics during folliculogenesis has
not been investigated so far.
Cortisol is not only involved in the stress response but is
also an important mediator of other events such as
apoptosis [23]. Previous studies indicated that the pro-
apoptotic gene BAX is upregulated in cumulus cells from
aged mares [24]. Also, oocytes originating from older mares
showed a lower expression of GDF9 and BMP15 [25], two
genes co-expressed during follicular development and
associated with developmental competence of oocytes.
However, the effects of cortisol supplementation on the
expression of genes involved in the apoptotic pathway or in
oocyte maturation have not been studied so far.
The objective of this study was to determine whether
(1) the equine ovary possesses mechanisms to modulate
cortisol activity and (2) supraphysiological concentrations
of glucocorticoids affect IVM rates of oocytes. Specifically,
we studied the (1) changes in the intrafollicular concen-
trations of cortisol and progesterone in context with
granulosa cell gene expression during maturation of equine
follicles (from 5–9 mm, 10–14 mm, 15–19 mm, 20–24 mm
and
25 mm in diameter) and (2) effects of cortisol sup-
plementation on IVM rates and gene expression of equine
cumulus–oocyte complexes (COCs). We hypothesized that
systemic and intrafollicular cortisol concentrations in
horses are not directly related and that exposing equine
oocytes to high concentrations of cortisol during IVM im-
pairs maturation and the expression of maturation-
associated genes.
2. Materials and methods
All experimental procedures were performed according
to the United States Government Principles for
the Utilization and Care of Vertebrate Animals Used
in Testing, Research, and Training (https://grants.nih.gov/
grants/olaw/references/phspol.htm#USGovPrinciples). The
research protocol (#14-055) was approved by the Institu-
tional Animal Care and Use Committee of Southern Illinois
University. The study was conducted in the northern
hemisphere during the months of October and November.
Quarter Horse mares (n ¼ 12: BW ¼ 533  7.3 kg) were aged
between 7 and 12 yr (mean age: 8.6  0.5 yr), were repro-
ductively sound, and still undergoing normal estrous cycles.
This was proven by the fact that in all mares, at least 1
ovulation was inferred by the presence of 1 collapsed antral
follicle and subsequent development of a CL after the end of
the study. Animals were kept on pasture under natural light
conditions and were fed additional orchardgrass–alfalfa
mixed hay and had free access to mineral salt and fresh
water in a sheltered area. The ovaries and uteri of all mares
were scanned with a transrectal ultrasound scanner (Aloka
SSD-900; Aloka Co, Ltd, Wallingford, CT, USA) equipped
with a multi-frequency 5- to 10-MHz linear array trans-
ducer (Aloka UST-5821–7.5).
2.1. Animal preparation for transvaginal aspiration
For follicular ablation–aspiration or ovum pickup
(OPU) procedures, mares were restrained in a palpation
chute to restrict movement. The mare’s tail was wrapped
in a plastic palpation sleeve to minimize contamination.
Feces were removed from the rectum, the perineal area
was washed with povidone–iodine solution and alcohol,
and a Foley catheter was placed in the urinary bladder.
Approximately 10 min before the start of each procedure,
rectal relaxation was induced with hyoscine N-butyl bro-
mide (Buscopan; 0.2 mg/kg intravenously (i.v.); Sigma, St.
Louis, MO, USA). Approximately 5 min before the start of
each procedure, sedation and analgesia were induced with
a combination of detomidine (Dormosedan; 0.02–
0.04 mg/kg (i.v.); Zoetis, Florham Park, NJ, USA) and
butorphanol tartrate (Dolorex; 0.05 mg/kg (i.v.); Merck
Animal Health, Summit, NJ, USA). Mares were treated with
antibiotics (Penicillin, Agri-Cillin; 12,000 IU/kg intramus-
cularly; AgriLabs, St. Joseph, MO, USA) for 3 d after each
procedure.
2.2. Experiment 1: hormone concentrations in FF and plasma
and gene expression of the granulosa cells
2.2.1. Aspiration of FF and collection of granulosa cells
A total of six mares were used for the collection of FF and
granulosa cells. Antral follicles were measured and aspi-
rated with 18-G needles using transvaginal ultrasonogra-
phy [26]. A different needle was used for each follicle class
from each animal to avoid contamination. Aspirated
 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22
follicles were grouped according to their diameter into the
following classes: 5 to 9 mm, 10 to 14 mm, 15 to 19 mm, 20
to 24 mm and
25 mm. In total, 4 to 7 FF samples from each
follicle class (mean: 5.4  0.5) were collected. To obtain as
many different follicle samples as possible from each ani-
mal, 1 to 2 follicle aspirations were performed per animal,
allowing at least 2-d interval between procedures. During
aspiration of FF, follicles were flushed 2 to 3 times with
their own FF to retrieve the granulosa cells. Collected FF
was first filtered through a 70-mm cell strainer (Fisher Sci-
entific, Pittsburgh, PA, USA) for isolation of granulosa cells.
After centrifugation (1,200  g, 10 min), the supernatant
(pure FF) was removed and stored in 0.5-mL aliquots at
20 C until analysis. Granulosa cells were eluted from the
cell strainer with PBS, and the fluid was analyzed in a Petri
dish under a stereomicroscope to confirm the absence of
oocytes. After centrifugation (1,200  g, 10 min), the su-
pernatant was discarded, and the granulosa cells were
stored at 80 C. Before RNA extraction, granulosa cell
samples were washed twice with Buffer EL (79,217; Qiagen,
Hilden, Germany) to remove remaining erythrocytes. In
total, 4 to 7 granulosa cell samples (mean: 5.4  0.5) per
follicle class were collected.
Blood samples were collected from the mare’s jugular
vein into heparinized tubes at the beginning and at the end
of the aspiration period. After centrifugation at 1,200  g
for 10 min, plasma was collected and stored at 20 C until
further analysis.
2.2.2. Hormone assays
Total cortisol concentrations in blood and FF were
determined with a commercial enzyme-linked immuno-
sorbent assay (DE1887; Demeditec, Kiel-Wellsee, Germany).
According to the manufacturer, cross-reactivity is 100% with
cortisol and <9% with progesterone. Serial dilutions of
equine plasma and FF showed very good parallelism to the
cortisol standard curve (deviation within 10% of expected
values). The mean recovery of the standard added to equine
plasma and FF before assaying was 83% and 95%, respec-
tively. Plasma and FF were not diluted before analysis. The
intra- and inter-assay coefficients of variation were 6.1% and
10.9%, respectively, whereas the sensitivity of the assay was
0.02 ng/mL.
Progesterone concentrations were determined with a
commercial enzyme-linked immunosorbent assay (ADI-
901–011; Enzo Life Sciences, Farmingdale, NY, USA) as
described for equine plasma [27]. The antiserum cross-
reacts 100% with progesterone and 100% with 5a-preg-
nane-3,20-dione. According to the manufacturer,
cross-reactivity is 3.5% with 17-OH progesterone and <1%
with all other steroids tested. Serial dilutions of equine
plasma and FF showed good parallelism to the progester-
one standard curve (deviation within 20% of expected
values). The mean recovery of the standard added to equine
plasma and FF samples before assaying was 96% and 74%,
respectively. Plasma and FF were diluted 1:100 before
analysis. The intra- and inter-assay coefficients of variation
were 5.3% and 5.5%, respectively, and the minimal detect-
able concentration was 0.081 ng/mL.
CBG concentrations were assessed using an equine-
specific commercial assay (MBS047353; MyBioSource,
13
San Diego, CA, USA). Serial dilutions of equine plasma and
FF showed good parallelism to the CBG standard curve
(deviation within 20% of expected values). The mean re-
covery of standard added to equine plasma and FF sam-
ples before assaying was 90% for both. The intra- and
inter-assay coefficients of variation were 10.2% and 8.1%,
respectively, whereas the minimal detectable concentra-
tion was 3.12 mg/mL.
2.3. Experiment 2: effects of cortisol supplementation on IVM
of equine oocytes
2.3.1. Follicle ablation
At the beginning of the experiment, ablation of all fol-
licles was performed to induce a new follicular wave and to
avoid atretic and/or pre-ovulatory follicles. Afterward, 1
injection of prostaglandin F2a (Lutalyse; 0.01 mg/kg; Zoetis)
was given to regress any CL present. Mares (n ¼ 12) were
then examined by transrectal ultrasound on a daily basis to
establish the best time for OPU, according to the number of
follicles
8 mm and 25 mm present in each mare. Two to
3 OPU procedures per mare were performed at 5- to 10-
d intervals. In 2 cases, luteal tissue was observed during
the first OPU procedure; therefore, these mares received
another injection of prostaglandin F2a (Lutalyse) after the
procedure.
2.3.2. Ovum pickup
All follicles were punctured and vigorously flushed at
least 6 times with 30- to 100-mL Vigro complete embryo
flush with BSA (Bioniche, Pullman, WA, USA) containing 2
IU/mL heparin (H3149; Sigma), pre-warmed at 38 C.
Flushing fluid was collected in 50-mL Falcon tubes, filtered
in 70-mm cell strainers (Fisher Scientific), and the
remainder in the filter was eluted with flushing medium in
Petri dishes to permit searching the COCs.
2.3.3. In vitro maturation of COCs
After collecting the COCs (n ¼ 93), they were washed in
pre-warmed HEPES-buffered (20 mM) synthetic oviduct
fluid medium (Caisson Labs, North Logan, UT, USA) and kept
at 38 C in air atmosphere for 2 to 4 h before maturation. All
COCs with <3 layers of cumulus cells, as well as expanded
COCs and damaged oocytes (in total, n ¼ 11), were excluded
from culture. After arrival at the laboratory, COCs (n ¼ 82)
from different mares were pooled and randomly assigned
either to the control group (standard IVM medium) or 1 of
the treatment groups and cultured for 28 h at 38.5 C. In total,
14 to 19 COC samples (mean: 16.4  0.9) were assigned to
each treatment group. For the treatment groups, cortisol
(H4001; Sigma) was added at the following concentrations:
0.1, 1, 5, and 10 mg/mL. The COCs were grouped (2–3 per
group) and cultured in 500-mL droplets. The standard IVM
medium consisted of advanced DMEM-F12, 15% serum
replacement, 50-ng/mL epidermal growth factor, 100-ng/mL
IGF, and 0.1% penicillin–streptomycin (all from Life Tech-
nologies, Carlsbad, CA, USA), to which 0.1 IU/mL each of FSH
and LH (Sioux Biochemical, Sioux Center, IA, USA) were
added as previously described [28].
After IVM, COCs were denuded by incubating them for 5
to 10 min in 0.5% hyaluronidase (H3884; Sigma)
14 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22

resuspended in DMEM-F12 at 38.5 C, followed by repeated
pipetting. After cumulus cell removal, oocytes were stained
in 1- to 2-mg/mL Hoechst 33,342 (Sigma) for 3 min at 37 C
to assess chromatin configuration under UV light (Fig. 1) as
previously described [29]. Oocytes were classified as
metaphase II (MII), metaphase I (MI), germinal vesicle (GV),
or degenerated. Cumulus cells were centrifuged for 5 min
at 1,500  g, followed by removal of the supernatant. Oo-
cytes and cumulus cell samples were then stored at 80 C
until analysis.
2.4. Quantitative real-time PCR
Total RNA was extracted from single oocytes, cumulus
cells, and granulosa cells using the Arcturus PicoPure RNA
Isolation Kit (Life Technologies, Foster City, CA, USA). The
cells were lysed in 20-mL PicoPure extraction buffer and
incubated at 42 C for 30 min. The subsequent RNA isolation
was performed according to the manufacturer’s in-
structions (CapSure HS LCM Caps protocol) with two
modifications: 20 mL of 70% ethanol (instead of 10 mL) was
added to the cell extract for RNA precipitation and 100 mL of
Wash Buffer 1 (instead of 40 mL) was used for washing after
the DNase treatment. The on-column DNase digestion was
performed after step (e) of the RNA isolation protocol, as
recommended by the manufacturer, using the RNase-Free
DNase Set (Qiagen). The precipitated RNA was eluted in
11-mL elution buffer. Total RNA of 10 mL per sample was
used as input for complementary DNA synthesis using the
SuperScript III First-Strand Synthesis System with random
hexamer primers (Invitrogen, Carlsbad, CA, USA). Two
replicates were reverse transcribed for each sample and
then pooled for quantitative real-time PCR (qPCR) analysis.
To monitor for residual DNA, additional control samples
were included, in which no reverse transcriptase (RT)
enzyme was added. These “minus RT” controls were
consistently negative in qPCR, indicating the absence of any
contaminating DNA.
Real-time PCR primers and hydrolysis probes for the
equine target genes glucocorticoid receptor (NR3C1),
HSD11B1, HSD11B2, 21-hydroxylase (CYP21A2)da gene
which is involved in cortisol biosynthesis, the anti-apoptotic
gene B-cell lymphoma 2 (BCL2), the pro-apoptotic gene
BCL2-associated X protein (BAX), and the maturation
markers: bone morphogenetic protein 15 (BMP15) and
growth differentiation factor 9 (GDF9) were designed using
the PrimerExpress 2.0 software (Life Technologies). Hydro-
lysis probes were dual labeled with fluorescent dye FAM on
the 50 end and the non-fluorescent quencher, Black Hole
Quencher 1 on the 30 end (FAM-BHQ1). All assays were

Fig. 1. Horse oocytes labeled with Hoechst 33342 to reveal chromatin configuration. (A) Germinal vesicle (GV). (B) Metaphase I (MI). (C) Metaphase II (MII), with
metaphase and polar body chromatin. (D) Degenerated; the unfocused area of fluorescence is the nucleus of a cumulus cell. 400.
 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22 15

Table 1
Details on quantitative real-time PCR assays.

Gene symbol NCBI/Ensembl accession number Oligo sequence 50 -30 Amplicon size (bp) PCR efficiency (%) R2 value

NR3C1 NM_001195191.1 F: GGCACCAGCAGAGGCAAT 71 101.8 0.998

XM_005599142.1 R: GAAAACTCCAAATCCGGCAAA
XM_005599145.1 P: TGTATACCACAGACCAAAGAACCTTTGAC
XM_005599143.1
XM_005599144.1
HSD11B1 XM_001490175.2 F: CTGGGATACTTGACACAAATGCA 71 90 0.997
R: CAGAGCTCCCCCTTTGATGA
P: CTCCAAAGGAAGAATGTGCCCTGGC
HSD11B2 NM_001081926.2 F: TCCAAGGGTCGCATTGTGA 61 100.6 0.999
R: CCAAGCATGGATATGGCATGT
P: TGTGGGCAGCCCGGCAGG
CYP21A2 ENSECAT00000017464 F: GGCATTCTTGCTTCACCACC 67 91 0.998
R: GCCCAGCTCACGATCCAA
P: ATTCAGCAGCGACTGCAGGACGAG
BCL2 XM_001490436.2 F: TTGGAAAGCCTACCACTAATTGC 74 92.6 0.998
R: CCGTGTTTATAGGCACAGGAGAT
P: CCCACCTGAGCGGCTCCACC
BAX XM_014729721.1 F: AGGATGCGTCCACCAAGAAG 80 93.2 0.994
XM_014729717.1 R: CCTCTGCAGCTCCATGTTACTG
P: CTCAAGCGCATCGGAGATGAGCTG
BMP15 XM_001496223.2 F: AGCCCTTGACCAATGTAGCAA 79 94.5 0.999
R: CGGTTGGATCTCAGAGGAAAGT
P: CAGAGGCCCCTGGCATATACAGACCC
GDF9 XM_001504427.2 F: AGGCCACCTCTACAACACTGTCC 113 99.5 0.999
R: CCAGGTTAAACAGCAGGTCCAC
P: CCCCCTGTGCCCAGCACAAGC
SNRPD3 XM_001489060.4 F: ACGCACCTATGTTAAAGAGCATG 120 99.4 0.996
XM_008511652.1 R: CACGTCCCATTCCACGTC
PSMB4 XM_001492317.4 F: CTTGGTGTAGCCTATGAAGCCC 82 93.1 0.991
XM_005610132.1 R: CCAGAATTTCTCGCAGCAGAG
XM_008515015.1
XM_005613704.1

Abbreviations: BAX, BCL2-associated X protein; BCL2, B-cell lymphoma 2; BMP15, bone morphogenetic protein 15; CYP21A2, 21-hydroxylase; GDF9, growth
differentiation factor 9; HSD11B1, 11beta-hydroxysteroid dehydrogenase type 1; HSD11B2, 11beta-hydroxysteroid dehydrogenase type 2; NCBI, National
Center for Biotechnology Information; NR3C1, glucocorticoid receptor; PSMB4, proteasome subunit beta type IV; SNRPD3, small nuclear ribonucleoprotein
D3 polypeptide.
R2: correlation coefficient of standard curve; F and R: forward and reverse primers; P: hydrolysis probe.

validated by the generation of standard curves to determine
the PCR reaction efficiencies (E), which were calculated ac-
cording to the formula E ¼ 101/s  1, where s is the slope of
the graph obtained by plotting the Cq value against the log10
of the cDNA input. For Cq values generated at E < 1,
efficiency-corrected Cq values were obtained from the term
Cq  log10 ðE þ 1Þ=log10 ð2Þ [30]. Detailed assay data are lis-
ted in Table 1.
Real-time PCR was performed in 20-mL reaction mixes
including 200 mM of each dNTP, 1 buffer B2 (Solis BioDyne,
Tartu, Estonia), 3-mM MgCl2, 300 nM of each primer, 200-
nM probe, 50-nM ROX reference dye (Invitrogen), 1 unit
HOT FIREPol DNA polymerase (Solis BioDyne), and 2-mL
cDNA template. All samples were analyzed in duplicates on a
Viia7 Real-Time PCR System (Life Technologies) using the
following temperature profile: 95 C for 10 min, 45 cycles of

Fig. 2. (A) Cortisol, (B) progesterone, and (C) corticosteroid-binding globulin (CBG) concentrations in plasma of mares before and after ovum pickup (OPU) and in
follicular fluid (FF) from the following follicle classes: 5 to 9 mm, 10 to 14 mm, 15 to 19 mm, 20 to 24 mm and
25 mm. Values are means  SEM. Significant
differences in FF concentrations are marked with an asterisk. No significant differences were seen in plasma concentrations.
16 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22
 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22 17

95 C for 15 s, and 60 C for 1 min. For data normalization, the
geometric mean of the gene pair composed of SNRPD3 and
PSMB4 was chosen based on its tested suitability for the adult
equine ovary (own unpublished results). Real-time PCR for
SNRPD3 and PSMB4 was done with the fluorescent DNA dye
SYBR Green. Reaction conditions have been described [31].
Only samples with mean Cq of SNRPD3 and PSMB4 <35 cycles
and Cq <38 cycles for all other genes of interest were
considered for further analysis. The mean Cq values of the
normalization factor were 30.6  0.1 for oocyte, 27.5  0.2 for
cumulus cell, and 27.2  0.7 for granulosa cell samples. Target
gene expression levels were then normalized to the geo-
metric mean of SNRPD3 and PSMB4 and relative expression
changes were calculated using the comparative 2DDCt
method [32]. The qPCR data of this work comply with the
Minimum Information for Publication of Quantitative Real-
Time PCR Experiments guidelines [33].
2.5. Statistical analyses
For statistical analyses, the computer software SPSS
version 24 (IBM-SPSS, Armonk, NY, USA) was used. Data
were tested for normal distribution by Kolmogorov–Smirnov
test. All data were normally distributed, and parametric tests
were used throughout. For the analysis of hormone con-
centrations and gene expression in the granulosa cells,
Pearson’s correlation and one-way ANOVA (general linear
model) with follicle class as between subject factor and
progesterone and cortisol as covariate were used. For the
analysis of gene expression in oocytes and cumulus cells,
Pearson’s correlation and one-way ANOVA (general linear
model) with treatment as between subject factor and
maturation status as covariate were used. Chi-square anal-
ysis was used to analyze the IVM rates of oocytes per group.
Data are shown as mean  SEM. A P value <0.05 was
considered statistically significant.
3. Results
3.1. Experiment 1: hormone concentrations in FF and plasma
and gene expression of the granulosa cells
Cortisol (115.4  13.3 ng/mL) and progesterone (22.1
 3.1 ng/mL) concentrations in FF were greater (P < 0.05) in
follicles
25 mm than in all other groups (Fig. 2A,B). Irre-
spective of follicular size, concentrations of cortisol and
progesterone in FF were positively correlated (r ¼ 0.8;
P < 0.001; Fig. 3A). Concentrations of cortisol (118.6  7.8 vs
120.3  12.2 ng/mL), progesterone (2.4  0.5 vs 2.5
 0.4 ng/mL), and CBG (11.1  5.1 vs 9.9  3.2 mg/mL) in
plasma did not differ (P > 0.05) before and after the follicle
aspiration period (Fig. 2). There was a negative correlation
(r ¼ 0.56; P < 0.01; Fig. 3B) between plasma CBG and
progesterone.
Gene expression of NR3C1, HSD11B1, HSD11B2, and
CYP21A2 in the granulosa cells was not different among fol-
licle classes (Fig. 4). Gene expression of NR3C1 was negatively
correlated with CBG concentration (r ¼ 0.56; P < 0.05;
Fig. 3C) in the respective FF, whereas gene expression of
HSD11B1 and CYP21A2 was highly positively correlated be-
tween each other (r ¼ 0.88; P < 0.01; Fig. 3D). All 4 genes
analyzed were either expressed at a low level (HSD11B1 and
HSD11B2) or not expressed at all (NR3C1 and CYP21A2) in the
granulosa cells originating from follicles
25 mm (Fig. 4).
3.2. Experiment 2: effects of cortisol supplementation on IVM
of equine oocytes
During 27 OPU procedures, 192 follicles between 8 and
26 mm were aspirated and 93 COCs were collected, resulting
in a recovery rate of 48.4%. From the total of 93 COCs, 82 were
considered suitable according to previously mentioned
criteria and were submitted to culture. There were no sig-
nificant differences in the percentage of oocytes classified as
MII, MI, GV, and degenerated among groups (Fig. 5), regard-
less of the concentration of cortisol in the IVM medium.
In oocytes, messenger RNA (mRNA) for HSD11B2, BAX,
BMP15, and GDF9 was present, whereas NR3C1, HSD11B1, and
BCL2 were absent. Neither treatment nor maturation stage
had any significant effect on HSD11B2 (Fig. 6A) or BAX (Fig. 6B)
gene expression. In contrast, gene expression of BMP15 and
GDF9 was significantly affected by maturation stage and
treatment group: it was lower in MII oocytes in comparison
with non-matured oocytes (P < 0.01) and increased (P <
0.001) with rising cortisol concentrations in the IVM medium
(Fig. 6C,D). Nevertheless, BMP15 and GDF9 levels were highly
positively correlated (r ¼ 0.9; P < 0.001; Fig. 3E) and also
correlated (r ¼ 0.4; P < 0.001; Fig. 3F,G) with BAX levels.
In cumulus cells, only NR3C1, HSD11B2, BCL2, and BAX
mRNA could be detected, whereas HSD11B1, BMP15, and
GDF9 transcripts were not expressed in these samples. All
expressed genes with exception of BAX were affected by
treatment (P < 0.01), but not by maturation stage (Fig. 7).
Levels of NR3C1 (P < 0.01) and BCL2 (P < 0.001) were
greater in all treatment groups than in the control
(Fig. 7A,C), whereas HSD11B2 levels were lower (P < 0.05)
in the cumulus cells exposed to cortisol at a concentration
of 5 mg/mL compared with all other treatments, excepting
the 10-mg/mL treatment group (Fig. 7B).
4. Discussion
In the present study, intrafollicular concentrations of
total cortisol increased in dominant follicles compared with

=
Fig. 3. Scatter plot graph showing correlation between (A) progesterone (y-axis, nanogram/milliliter) and cortisol (x-axis, nanogram/milliliter) concentrations in
FF (r ¼ 0.8; P < 0.001), (B) progesterone (y-axis, nanogram/milliliter) and CBG (x-axis, microgram/milliliter) concentrations in plasma of mares (r ¼ 0.56; P <
0.01) before and after ovum pickup, (C) gene expression of glucocorticoid receptor (NR3C1) in granulosa cells (y-axis) and CBG concentrations (x-axis, microgram/
milliliter) in FF (r ¼ 0.56; P < 0.05), (D) gene expression of 21-hydroxylase (CYP21A2, y-axis) and 11ß-hydroxysteroid dehydrogenase type 1 (HSD11B1, x-axis) in
granulosa cells (r ¼ 0.88; P < 0.01), (E) gene expression of bone morphogenetic protein 15 (BMP15, y-axis) and growth differentiation factor 9 (GDF9, x-axis) in
equine oocytes (r ¼ 0.9; P < 0.001), (F) gene expression of BCL2-associated X protein (BAX, y-axis) and GDF9 (x-axis) in equine oocytes (r ¼ 0.4; P < 0.001), and
(G) gene expression of BAX (y-axis) and BMP15 (x-axis) in equine oocytes (r ¼ 0.4; P < 0.001). Follicular fluid and granulosa cells were collected from the
following follicle classes: 5–9 mm, 10–14 mm, 15–19 mm, 20–24 mm, and
25 mm.
18 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22

Fig. 4. Relative gene expression in granulosa cells from the following follicle classes: 5–9 mm, 10–14 mm, 15–19 mm, 20–24 mm, and
25 mm. Graphs show
average log10-fold changes in every gene evaluated by quantitative real-time PCR (qPCR). None of the genes was expressed differently among follicle classes.
Values are means  SEM. NR3C1, glucocorticoid receptor; HSD11B1, 11b-hydroxysteroid dehydrogenase type 1; HSD11B2, 11b-hydroxysteroid dehydrogenase type
2; CYP21A2, 21-hydroxylase. Data were normalized against the geometric mean of SNRPD3 and PSMB4. All 4 genes analyzed were either expressed at a low level
(HSD11B1 and HSD11B2) or not expressed at all (NR3C1 and CYP21A2) in the granulosa cells originating from follicles
25 mm.

smaller follicles, which is in agreement with findings in
humans and cattle [12,13]. Nevertheless, CYP21A2, a key
enzyme for de novo production of cortisol was absent from
granulosa cells of dominant follicles. Together with the fact
Fig. 5. Comparison of maturation status between in vitro matured equine
oocytes in the absence or in the presence of cortisol. Values are means 
SEM. MII, metaphase II; MI, metaphase I; GV, germinal vesicle. No significant
differences were seen among treatments. No degenerated oocytes were seen
in the control group.
that cortisol and progesterone concentrations in FF were
highly positively correlated irrespective of follicular size,
this suggests an intrafollicular displacement of cortisol
from CBG in favor of progesterone, as shown in humans
[19]. This can be explained by a similar affinity of CBG to
both hormones. In contrast, concentrations of cortisol in
plasma of the mares remained constant, excluding the
possibility of an increase in FF cortisol because of increasing
cortisol concentrations in the circulation. The negative
correlation between plasma CBG and progesterone also
supports the free hormone hypothesis. Previously, our
group demonstrated a clear acute stress response of horses
to parturition [27] or transport [34]. Therefore, concern has
been raised regarding stress of the mare induced by prep-
aration for OPU and by the procedure itself, which might
exert detrimental effects on oocyte quality. In this study, we
were able to show that OPU itself does not induce a chronic
stress response in mares as cortisol concentration in
plasma was not increased at the end of the period where
mares were exposed to repeated OPU procedures. We did
not determine the acute stress response of mares to indi-
vidual OPU procedures in the present study. The presence
of the gene encoding 21-hydroxylase (CYP21A2) in gran-
ulosa cells originating from follicles <25 mm in diameter is
 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22 19

Fig. 6. Relative gene expression in oocytes from matured (hatched columns) and nonmatured (open columns) COCs after IVM in the absence or the presence
of cortisol. Graphs show average log10-fold changes in every gene determined by quantitative real-time PCR (qPCR). Significant differences for treatment and
maturation are indicated for each gene. Significant differences among treatment groups are indicated by different superscripts and refer to matured and
nonmatured COCs combined. Values are means  SEM. Note different scales on y-axis. HSD11B2, 11b-hydroxysteroid dehydrogenase type 2; BAX, BCL2-
associated X protein; BMP15, bone morphogenetic protein 15; GDF9, growth differentiation factor 9. Data were normalized against the geometric mean of
SNRPD3 and PSMB4.

an important finding of this study and is in contrast with
findings in other species [17]. Progesterone and 17a-
hydroxyprogesterone can be converted to 11-
deoxycorticosterone and 11-deoxycortisol, respectively,
only through the action of 21-hydroxylase. Typically,
expression of CYP21A2 is exclusively attributed to adreno-
cortical cells and especially those of the zona fasciculata
reticularis [35]. In horses, it has been previously shown that
the ovarian follicle is an extra-adrenal site of preferential
11-deoxycorticosterone biosynthesis by an enzyme having
steroid 21-hydroxylase activity [36]. Nevertheless, in the
present study, CYP21A2 mRNA was exclusively found in
follicles <25 mm in diameter. This makes de novo pro-
duction of cortisol as a reason for higher concentrations in
equine FF collected from large follicles highly unlikely. On
the other hand, CBG concentration was not decreased in
follicles of this size class. The mechanism contributing to an
increase in total cortisol concentration in large follicles in
the present study therefore remains unclear.
Another mechanism for modulating the local glucocor-
ticoid concentration within maturing ovarian follicles is the
action of the two metabolizing enzymes, HSD11B1 and
HSD11B2. In cattle, expression of HSD11B1 increases as
follicular maturation progresses, whereas mRNA expres-
sion of HSD11B2 and NR3C1 in the granulosa cells is low and
remains largely unchanged [9]. During the physiological
estrous cycle, antral follicles of smaller size can become
atretic near ovulation. In the present study, gene expression
of NR3C1, HSD11B1, and HSD11B2 did not change with
increasing follicular size. However, the high correlation
between HSD11B1 and CYP21A2 in granulosa cells suggests
that cortisol synthesis in equine ovarian follicles is pri-
marily regulated by HSD11B1. As CYP21A2 was only found in
follicles <25 mm and cortisol concentrations remained
largely unchanged up to this follicle class, HSD11B1 seems
to be essential for maintaining constant cortisol concen-
trations because of its oxidative activity [11]. In contrast,
HSD11B1 and HSD11B2 were only determined in very few
samples from follicles >25 mm. Their minimal level or
absence in dominant follicles allows physiologically high
levels of cortisol to be present in FF in vivo, suggesting an
important role in oocyte maturation and probably also for
mediation of the inflammatory-like reaction induced by the
LH surge in the follicular wall that precedes ovulation [37].
Our results indicate that the equine COC exclusively
expresses HSD11B2, which exerts an oxidative activity. The
mRNA expression of HSD11B2 in the oocytes was largely
unchanged, regardless of maturation stage or addition of
cortisol to the IVM medium. The same has been observed
also in bovine oocytes [38], whereas the oxidative activity
of HSD11B enzymes, mainly HSD11B2, was increased dur-
ing IVM of pig oocytes [6]. In the present study, HSD11B2
20 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22

Fig. 7. Relative gene expression in cumulus cells from matured (hatched columns) and nonmatured (open columns) COCs after IVM in the absence or the
presence of cortisol. Graphs show average log10-fold changes in every gene determined by quantitative real-time PCR (qPCR). Significant differences for treatment
and maturation are indicated for each gene. Significant differences among treatment groups are indicated by different superscripts and refer to matured and
nonmatured COCs combined. Values are means  SEM. Note different scales on y-axis. NR3C1, glucocorticoid receptor; HSD11B2, 11b-hydroxysteroid dehydro-
genase type 2; BCL2, B-cell lymphoma 2; BAX, BCL2-associated X protein. Data were normalized against the geometric mean of SNRPD3 and PSMB4.

was also expressed in equine cumulus cells, and its
expression was downregulated as cortisol concentrations
in the IVM medium increased. In contrast, bovine and
human cumulus cells express only HSD11B1, and its
expression and activity are upregulated as IVM progressed
[38,39]. This might be necessary to modulate in vivo
cortisol production by the pre-ovulatory follicles [12,19].
However, in equine COCs, HSD11B2 expression remained
unchanged as maturation progressed, probably also
because de novo production of cortisol in the dominant
follicles is absent as has been shown in the present study.
For the equine oocyte, no information is available about the
physiological role of HSD11B2, but it may protect oocytes
from adverse effects of cortisol. In our study, NR3C1 was
either absent from equine oocytes or expression was too
low to be reliably quantified. However, presence of
HSD11B2 in the oocytes suggests that changes in the
follicular environment may be translated from cumulus–
granulosa cells or FF and further affect oocyte development.
In the present study, a concentration of cortisol (0.1 mg/mL)
proven to be beneficial for bovine oocytes [14], as well as
concentrations with detrimental effects (eg, 10 mg/mL) for
pig oocytes [7] were tested. In equine oocytes, presence of
cortisol in the IVM medium in concentrations 100 times
higher than those physiologically present in large follicles
did not affect IVM rates, as has been shown in mice [40] and
lambs [10], indicating differences in glucocorticoid sensi-
tivity among species. In our study, the MII rates were
slightly lower than in the study from Galli et al [28], most
likely as a consequence of culturing COCs in small groups
(2–3 COCs in 500 mL). This was done with the aim to easily
separate oocytes and corresponding cumulus cells, ac-
cording to their maturation stage, for subsequent molecu-
lar analysis. Nevertheless, the number of follicles and COCs
available each day was limited, as OPU was performed
when the largest follicle reached 25 mm to avoid retrieving
oocytes from atretic follicles, not every 14 d as recom-
mended [28].
Cortisol addition affected HSD11B2 expression in the
cumulus cells, but not in the oocytes, suggesting a critical
role of the cumulus cells in regulating local glucocorticoid
metabolism in the equine COC. Interestingly, the anti-
apoptotic gene BCL2 is upregulated in the cumulus cells in
response to high cortisol concentrations, whereas HSD11B2
expression is downregulated. This suggests that, when
nonphysiological conditions occur and the metabolizing
capacity of the COC is inhibited, anti-apoptotic mechanisms
are being activated to protect the oocyte. An involvement of
glucocorticoids in granulosa cell apoptosis is not a new
finding [23]; however, it has received no attention so far in
horses. In this study, the anti-apoptotic gene BCL2 was found
exclusively in cumulus cells. However, as RNA transcripts
move through the transzonal projections of the cumulus
cells to the oocyte, the oocyte is also affected [41]. Although
not necessarily all proteins are translated from the cumulus
cells to the oocyte [42], transfer of relevant transcripts for
 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22
meiosis resumption from apoptotic cumulus cells might be
missing. In contrary to BCL2, the pro-apoptotic gene BAX was
present in cumulus cells and oocytes as well. Recently,
expression of several genes involved in the apoptotic pro-
cess was analyzed in equine oocytes [24]. In that study, BAX
was upregulated in cumulus cells originating from older
mares (aged >18 yr), and the authors suggested that aging is
associated with increasing follicular apoptosis rates. Ac-
cording to the current National Center for Biotechnology
Information database, the DNA sequence used in the pre-
vious study [24] is no longer associated with the BAX gene,
but with the transmembrane BAX inhibitor motif containing
6 (TMBIM6), which is not a pro-apoptotic gene, but an anti-
apoptotic gene. In our study, different reference sequences
for primer design and a homogenous group of mares (aged
7–12 yr) were used. Under these conditions, we observed no
significant differences with regard to BAX expression in
matured vs non-matured COCs. However, an involvement of
BAX in oocyte maturation cannot be completely excluded
because of its positive correlation with GDF9 and BMP15.
Oocyte-secreted paracrine factors GDF9 and BMP15 are
key members of the tumor necrosis factor b superfamily and
can regulate female fertility in mammals [43]. Our study
confirmed a highly positive correlation between GDF9 and
BMP15 in equine oocytes and a predictive value for matura-
tion. Although their expression was strictly localized in the
oocytes, this does not exclude a role in cell signaling to the
cumulus cells. Interestingly, mRNA levels of GDF9 and BMP15
were increased in non-matured compared with MII oocytes,
suggesting an essential role of tumor necrosis factor b su-
perfamily members in cumulus–oocyte communication and
for inducing cumulus expansion and meiosis resumption.
Our data show that cortisol supplementation downregulates
their gene expression and thus may influence maturation if
high nonphysiological concentrations occur.
In conclusion, this study addressed for the first time the
involvement of glucocorticoids in follicular growth and
oocyte maturation in horses. We have demonstrated herein
complex mechanisms of glucocorticoid regulation within
the growing ovarian follicle and in maturing equine COCs.
The results clearly suggest that cortisol seems to be
necessary for oocyte development and maturation and that
glucocorticoid action in equine COCs is modulated by
HSD11B2. Our data elucidated at least in part the involve-
ment of glucocorticoids in equine ovarian function. A better
understanding of these mechanisms might help in further
development of equine-assisted reproduction techniques.
Acknowledgments
The authors thank Mahsa Adib and Ashani Hamilton for
their help in performing quantitative real-time PCR ana-
lyses and handling the animals.
References
[1] Breen KM, Karsch FJ. New insights regarding glucocorticoids, stress
and gonadotropin suppression. Front Neuroendocrinol 2006;27:
233–45.
[2] Kalantaridou SN, Makrigiannakis A, Zoumakis E, Chrousos GP. Stress
and the female reproductive system. J Reprod Immunol 2004;62:61–8.
21
[3] Schmid W, Cole TJ, Blendy JA, Schutz G. Molecular genetic analysis
of glucocorticoid signalling in development. J Steroid Biochem Mol
Biol 1995;53:33–5.
[4] Schreiber JR, Nakamura K, Erickson GF. Rat ovary glucocorticoid
receptor: identification and characterization. Steroids 1982;39:569–
84.
[5] Hirst MA, Northrop JP, Danielsen M, Ringold GM. High level
expression of wild type and variant mouse glucocorticoid re-
ceptors in Chinese hamster ovary cells. Mol Endocrinol 1990;4:
162–70.
[6] Webb RJ, Sunak N, Wren L, Michael AE. Inactivation of glucocorti-
coids by 11beta-hydroxysteroid dehydrogenase enzymes increases
during the meiotic maturation of porcine oocytes. Reproduction
2008;136:725–32.
[7] Yang JG, Chen WY, Li PS. Effects of glucocorticoids on maturation of
pig oocytes and their subsequent fertilizing capacity in vitro. Biol
Reprod 1999;60:929–36.
[8] Rae MT, Niven D, Critchley HO, Harlow CR, Hillier SG. Antiin-
flammatory steroid action in human ovarian surface epithelial cells.
J Clin Endocrinol Metab 2004;89:4538–44.
[9] Tetsuka M, Nishimoto H, Miyamoto A, Okuda K, Hamano S. Gene
expression of 11beta-HSD and glucocorticoid receptor in the bovine
(Bos taurus) follicle during follicular maturation and atresia: the role
of follicular stimulating hormone. J Reprod Dev 2010;56:616–22.
[10] Gonzalez R, Ruiz-Leon Y, Gomendio M, Roldan ER. The effect of
glucocorticoids on ERK-1/2 phosphorylation during maturation of
lamb oocytes and their subsequent fertilization and cleavage ability
in vitro. Reprod Toxicol 2010;29:198–205.
[11] Michael AE, Thurston LM, Rae MT. Glucocorticoid metabolism and
reproduction: a tale of two enzymes. Reproduction 2003;126:425–41.
[12] Acosta TJ, Tetsuka M, Matsui M, Shimizu T, Berisha B, Schams D,
Miyamoto A. In vivo evidence that local cortisol production in-
creases in the preovulatory follicle of the cow. J Reprod Dev 2005;
51:483–9.
[13] Harlow CR, Jenkins JM, Winston RM. Increased follicular fluid total
and free cortisol levels during the luteinizing hormone surge. Fertil
Steril 1997;68:48–53.
[14] da Costa NN, Brito KN, Santana P, Cordeiro Mda S, Silva TV,
Santos AX, Ramos Pdo C, Santos Sdo S, King WA, Miranda Mdos S,
Ohashi OM. Effect of cortisol on bovine oocyte maturation and
embryo development in vitro. Theriogenology 2016;85:323–9.
[15] Lewicka S, von Hagens C, Hettinger U, Grunwald K, Vecsei P,
Runnebaum B, Rabe T. Cortisol and cortisone in human follicular
fluid and serum and the outcome of IVF treatment. Hum Reprod
2003;18:1613–7.
[16] Thurston LM, Norgate DP, Jonas KC, Gregory L, Wood PJ, Cooke BA,
Michael AE. Ovarian modulators of type 1 11beta-hydroxysteroid
dehydrogenase (11betaHSD) activity and intra-follicular cortisol:
cortisone ratios correlate with the clinical outcome of IVF. Hum
Reprod 2003;18:1603–12.
[17] Omura T, Morohashi K. Gene regulation of steroidogenesis. J Steroid
Biochem Mol Biol 1995;53:19–25.
[18] Gayrard V, Alvinerie M, Toutain PL. Interspecies variations of
corticosteroid-binding globulin parameters. Domest Anim Endo-
crinol 1996;13:35–45.
[19] Andersen CY. Possible new mechanism of cortisol action in female
reproductive organs: physiological implications of the free hormone
hypothesis. J Endocrinol 2002;173:211–7.
[20] Tetsuka M, Thomas FJ, Thomas MJ, Anderson RA, Mason JI,
Hillier SG. Differential expression of messenger ribonucleic acids
encoding 11beta-hydroxysteroid dehydrogenase types 1 and 2 in
human granulosa cells. J Clin Endocrinol Metab 1997;82:2006–9.
[21] Sunak N, Green DF, Abeydeera LR, Thurston LM, Michael AE.
Implication of cortisol and 11beta-hydroxysteroid dehydrogenase
enzymes in the development of porcine (Sus scrofa domestica)
ovarian follicles and cysts. Reproduction 2007;133:1149–58.
[22] Short RV. Steroids present in the follicular fluid of the mare. J
Endocrinol 1960;20:147–56.
[23] Sasson R, Tajima K, Amsterdam A. Glucocorticoids protect against
apoptosis induced by serum deprivation, cyclic adenosine 30 ,50 -
monophosphate and p53 activation in immortalized human
granulosa cells: involvement of Bcl-2. Endocrinology 2001;142:
802–11.
[24] Cox L, Vanderwall DK, Parkinson KC, Sweat A, Isom SC. Expression
profiles of select genes in cumulus-oocyte complexes from young
and aged mares. Reprod Fertil Dev 2015;27:914–24.
[25] Campos-Chillon F, Farmerie TA, Bouma GJ, Clay CM, Carnevale EM.
Effects of aging on gene expression and mitochondrial DNA in the
equine oocyte and follicle cells. Reprod Fertil Dev 2015;27:925–33.
22 D. Scarlet et al. / Domestic Animal Endocrinology 59 (2017) 11–22
[26] Gastal EL, Gastal MO, Wiltbank MC, Ginther OJ. Follicle deviation
and intrafollicular and systemic estradiol concentrations in mares.
Biol Reprod 1999;61:31–9.
[27] Nagel C, Erber R, Bergmaier C, Wulf M, Aurich J, Mostl E, Aurich C.
Cortisol and progestin release, heart rate and heart rate variability
in the pregnant and postpartum mare, fetus and newborn foal.
Theriogenology 2012;78:759–67.
[28] Galli C, Colleoni S, Duchi R, Lagutina I, Lazzari G. Developmental
competence of equine oocytes and embryos obtained by in vitro
procedures ranging from in vitro maturation and ICSI to embryo
culture, cryopreservation and somatic cell nuclear transfer. Anim
Reprod Sci 2007;98:39–55.
[29] Hinrichs K, Choi YH, Love LB, Varner DD, Love CC, Walckenaer BE.
Chromatin configuration within the germinal vesicle of horse oo-
cytes: changes post mortem and relationship to meiotic and
developmental competence. Biol Reprod 2005;72:1142–50.
[30] Kenkel CD, Aglyamova G, Alamaru A, Bhagooli R, Capper R,
Cunning R, deVillers A, Haslun JA, Hedouin L, Keshavmurthy S,
Kuehl KA, Mahmoud H, McGinty ES, Montoya-Maya PH, Palmer CV,
Pantile R, Sanchez JA, Schils T, Silverstein RN, Squiers LB, Tang PC,
Goulet TL, Matz MV. Development of gene expression markers of
acute heat-light stress in reef-building corals of the genus Porites.
PLoS One 2011;6:e26914.
[31] Scarlet D, Ertl R, Aurich C, Steinborn R. The orthology clause in the
next generation sequencing era: novel reference genes identified by
RNA-seq in humans improve normalization of neonatal equine
ovary RT-qPCR data. PLoS One 2015;10:e0142122.
[32] Livak KJ, Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods 2001;25:402–8.
[33] Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M,
Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT.
The MIQE guidelines: minimum information for publication of quan-
titative real-time PCR experiments. Clin Chem 2009;55:611–22.
[34] Deichsel K, Pasing S, Erber R, Ille N, Palme R, Aurich J, Aurich C.
Increased cortisol release and transport stress do not influence
semen quality and testosterone release in pony stallions. Ther-
iogenology 2015;84:70–5.
[35] Ishimura K, Fujita H. Light and electron microscopic immunohisto-
chemistry of the localization of adrenal steroidogenic enzymes.
Microsc Res Tech 1997;36:445–53.
[36] Bijault C, Dehennin L. Steroid 21-hydroxylase activity in equine
ovarian follicles evidenced by isotope dilution-mass spectrometry. J
Steroid Biochem Mol Biol 1991;38:165–72.
[37] Hillier SG, Tetsuka M. An anti-inflammatory role for glucocorticoids
in the ovaries? J Reprod Immunol 1998;39:21–7.
[38] Tetsuka M, Takagi R, Ambo N, Myat TS, Zempo Y, Onuma A.
Glucocorticoid metabolism in the bovine cumulus-oocyte complex
matured in vitro. Reproduction 2016;151:73–82.
[39] Smith MP, Mathur RS, Keay SD, Hall L, Hull MGR, Jenkins JM. Peri-
ovulatory human oocytes, cumulus cells, and ovarian leukocytes
express type 1 but not type 2 11b-hydroxysteroid dehydrogenase
RNA. Fertil Steril 2000;73:825–30.
[40] Andersen CY. Effect of glucocorticoids on spontaneous and
follicle-stimulating hormone induced oocyte maturation in
mouse oocytes during culture. J Steroid Biochem Mol Biol 2003;
85:423–7.
[41] Macaulay AD, Gilbert I, Scantland S, Fournier E, Ashkar F,
Bastien A, Saadi HA, Gagne D, Sirard MA, Khandjian EW,
Richard FJ, Hyttel P, Robert C. Cumulus cell transcripts transit to
the bovine oocyte in preparation for maturation. Biol Reprod
2016;94:16.
[42] Macaulay AD, Gilbert I, Caballero J, Barreto R, Fournier E, Tossou P,
Sirard MA, Clarke HJ, Khandjian EW, Richard FJ, Hyttel P, Robert C.
The gametic synapse: RNA transfer to the bovine oocyte. Biol
Reprod 2014;91:90.
[43] Otsuka F, McTavish KJ, Shimasaki S. Integral role of GDF-9 and BMP-
15 in ovarian function. Mol Reprod Dev 2011;78:9–21.