Animal Reproduction Science 223 (2020) 106623

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Effects of DDT, DDE, aldrin and dieldrin on prostaglandin,

oxytocin and steroid hormone release from smooth chorion
explants of cattle
J. Mlynarczuk *, M. Górska, M.H. Wrobel
Institute of Animal Reproduction and Food Research Polish Academy of Sciences, Tuwima St 10, 10-747, Olsztyn, Poland

A R T I C L E I N F O A B S T R A C T

Keywords: Chlorooganic xenobiotics (XBs) such as DDT, DDE, aldrin and dieldrin interfere with release of
Cow hormones from chorionic villi that are necessary for sustaining the normal course pregnancy:
Smooth chorion prostaglandins (PGs), oxytocin (OT), progesterone (P4) and estradiol (E2). Approximately 20 %–
Organochlorine insecticides
40 % of these hormones originate from the smooth chorion. The aim of current studies was to
Hormones secretion
Prostaglandins
investigate effects of these XBs on synthesis and release of PGE2, PGF2α, OT, P4 and E2 from
Oxytocin explants of smooth chorion of cattle, obtained during the120–150 and 151–180 day gestational
Progesterone period. Explants were incubated with DDT, DDE, aldrin or dieldrin at concentrations of 1 and
Estradiol 10 ng/mL for 24 h, and concentrations of PGE2, PGF2α, OT, P4 and E2 in post incubation medium
and the relative abundances of COX-2, PTGES, AKR1B1, NP-I/OT, PAM, HSD3B, and CYP19A1
mRNA transcripts in tissue explants were determined. The XBs did not have effects on cell
viability in explants (P > 0.05), however, there were effects on prostaglandins, OT and P4
secretion and relative abundance of mRNA transcript for genes encoding the main enzymes
involved in synthesis of these hormones (P < 0.05). The XBs that were evaluated did not have
effects on E2 synthesis and secretion (P > 0.05). In summary, XBs evaluated in the present study
had effects on the pattern of prostaglandin secretion, and can increase OT and P4 release from
smooth chorion explants. Because XBs inhibit hormonal action throughout the chorion, there is an
increase in risk of abortions or premature births in animals.

1. Introduction

Results from screening studies in animal and human populations indicate there are close correlations between the amount of
pesticides accumulated in tissues and the incidence of abortions or premature births (Korrick et al., 2001; Pollack et al., 2011). One of
the most focused on substances in these studies is pesticides: DDT and aldrin and the environmental derivatives of these compounds,
which are DDE and dieldrin, respectively (Garcia, 1998; Korrick et al., 2001; Pollack et al., 2011). These lipophilic compounds enter
animal and human organisms from the environment in many ways and then accumulate in various tissues of the reproductive tract
(Kamarianos et al., 2003), including the placenta (Hirako et al., 2005), where these compounds can function as “endocrine disruptors”.
These substances affect the secretion of oxytocin (OT) from ovarian steroidogenic cells (Mlynarczuk et al., 2010; Wrobel et al., 2015)
and prostaglandins: PGF2α, PGE2 and prostaglandin I2 (PGI2) from the endometrium and myometrium during the estrous cycle as well

* Corresponding author.
E-mail address: j.mlynarczuk@pan.olsztyn.pl (J. Mlynarczuk).

https://doi.org/10.1016/j.anireprosci.2020.106623
Received 26 March 2020; Received in revised form 6 October 2020; Accepted 6 October 2020
Available online 17 October 2020
0378-4320/© 2020 Elsevier B.V. All rights reserved.
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

as during pregnancy (Wrobel et al., 2012, 2014). In the placenta of cattle, the majority of PGs, 17β-estradiol (E2), progesterone (P4) and
oxytocin (OT), are synthesized and released within the cotyledons; however, the smooth chorion is also an important source of these
hormones (Fuchs et al., 1992; Fields et al., 1983). Approximately 20 %–40 % of these hormones originate from interplacentomal areas
(Slama et al., 1994; Arosh et al., 2004).
Results from studies conducted in which there were evaluations of the effects on cattle cotyledons of DDT and DDE in concen­
trations present in the environment indicated these compounds could have effects on OT, prostaglandin F2α and E2 secretion; ipso facto,
that proportions of these hormones changed. Less evident, but significantly, these xenobiotics affect the secretion of P4 and E2
(Wojciechowska et al., 2017). The results of this research allowed insights regarding the changes in the secretion of these hormones
from the chorion villosus area. The effects of chloroorganic XBs on the secretory activity of smooth chorion, however, has not been
previously studied.
The placenta is an organ connecting the maternal circulatory system to the fetal circulatory system (Walls et al., 2008). Prosta­
glandins F2α (PGF2α) and E2 (PGE2) as well as oxytocin (OT) have a marked function in the regulation of blood flow in the fetal
compartments of the placenta (Migaard et al., 1986a, b; Poston, 1997). The 17β-estradiol and P4 modulate the proper development of
blood vessels in this organ (Albrecht and Pepe, 2010), and these factors are also regulators of uterine contractile activity. At the
beginning of the 5th month of the gestational period, the cattle placenta is remodeled from an epithelial type placenta into a
connective-epithelial type placenta. (Pfarrer et al., 2003). At this time, the synthesis of E2 and P4 by placental tissues markedly in­
creases (Beindorf et al., 2010; Pennington et al., 2010). Both of these hormones regulate the growth and development of the pla­
centomes (Robertson and King, 1979; Janowski et al., 1996). The changes in hormone secretion from the smooth chorion induced by
XBs may adversely affect placental development and function and, therefore, fetal viability.
The aim of this study was to investigate the effect of DDT and aldrin and their respective metabolites, DDE and dieldrin, at con­
centrations typically found in animal and human tissues on the release of PGE2, PGF2α, OT, P4 and E2 from the smooth chorion of cattle
that were obtained before the beginning of placental remodeling (120–150 days of the gestational period) and after the start of the
remodeling process (from 151 to 180 days of the gestational period).

2. Materials and methods

2.1. Chorion explant preparation

Fragments of a pregnant uterus were collected during the 120–150 and 151–180 day gestational periods (four cows in each group)
were obtained from cows in an abattoir 15–20 min after the animal was killed; the tissues were then transported to the laboratory in an
ice bath (4 ◦ C) within 1 h of the time of collection in 0.9 % NaCl. The gestation period was identified using Keller’s formula: x(x+2) =
length of fetus, where “x” is the gestational age and evaluation of fetal morphological features (Jainudeen and Hafez, 1980). From each
uterine fragment, the inter placentomal areas were excised, and then the smooth chorion was separated from the endometrium. The
smooth chorion was subsequently divided into the lamina interna and externa. Isolated fragments of the lamina externa of the smooth
chorion were proportioned into explants (60− 80 mg) and washed in a cold (4 ◦ C) 0.9 % NaCl solution that had penicillin (10 IU/mL),
streptomycin (100 μg/mL), amphotericin B (2 μg/mL; ICN Pharmaceuticals, New York, NY, USA)) and L-glutamine (100 μg/mL)
added. All materials used in these studies were purchased from Sigma-Aldrich (Poznan; Poland), unless stated otherwise.

2.2. Incubation of smooth chorion explants

Prepared explants were placed into glass vials with 2 mL of M-199 incubation medium (without phenyl red) with 2% FCS and 10 %
sterilized amniotic fluid (Wojciechowska et al. 2015), gentamicin (40 mg/mL; KRKA Novo Mesto) and amphotericin (20 μg/mL).
Incubations were conducted in a water bath (37.5 ◦ C) in a controlled atmosphere (95 % O2 + 5% CO2). After 2 h of a pre-incubation
period, xenobiotics (DDT, DDE, aldrin, and dieldrin) dissolved in DMSO (10 μL per sample) at doses 1 and 10 ng/mL were added to the
culture (n = 4 for each dose of treatment and control) and then were further incubated for 24 h. In addition, some explants were
incubated with 10 μL of DMSO (solvent effect control, not added to the statistical analyses, n = 4). After incubation, the culture
medium was collected in tubes and centrifuged (3000 g at 4 ◦ C for 15 min). The supernatant was transferred to tubes containing 10 μL
of a 0.3 M EDTA solution in 1% acetylsalicylic acid and kept frozen at − 70 ◦ C until evaluations occurred. Tissue explants were frozen
in liquid nitrogen and stored at − 70 ◦ C until real-time PCR procedures were performed.

2.3. Tissue explant viability

The cell viability of the smooth chorion explants was assessed using an AlamarBlue™ test (Life Technologies, Waltham, MA, USA).
Briefly, chorion explants (20–40 mg) from four cows of each group were placed in triplicate in 24-well plates in 1 mL of medium with
composition identical to that described previously in this manuscript and incubated for 48 h with DDT, DDE, aldrin and dieldrin at a
dose of 100 ng/mL each. As negative controls, explants treated with 0.004 % paraformaldehyde (PFA) were used. Colorimetric
measurements were collected at two wavelengths (570 and 600 nm) after 4 h of incubation with AlamarBlue™ (Epoch Microplate
Spectrophotometer, BioTek, Winooski, VT, USA). The results are expressed as the percentage of AlamarBlue™ reduction per 1 mg of
tissue.

2
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

2.4. Hormone determination

The PGFM (1314-dihydro-15-keto-PGF2α; a stable metabolite of PGF2α) concentration in culture medium reliably reflects the
quantity of PGF2α that is secreted from explants. The PGFM and PGF2α, therefore were used interchangeably (Skarzynski et al., 1999).
The PGF2α (measured as a stable metabolite PGFM - 1314-dihydro-15-keto-PGF2α), PGE2, OT, P4 and E2 concentrations in culture
media were determined using an enzyme immunoassay (EIA). The standard curve range, intra- and inter-assay coefficients of variation,
and the association between the added and hormone concentrations quantified, which were expressed as coefficients of regression,
were as follows: PGFM: 62.5 to 2000 pg/mL, 10.4 %, 12.9 %, and r = 0.92; PGE2: 78 to 20,000 pg/mL, 10.6 %, 13.1 %, and r = 0.91;
OT: 7.8 to 2000 pg/mL, 8.6 %, 10.7 %, and r = 0.96; P4: 0.1–25 ng/ml, 8.6 %, 10.7 % and r = 0.95; E2: 6.25 to 1600 pg/mL, 10.4 %,
12.5 % and r = 0.88. The working dilutions of primary antibodies used were as follows: anti-PGFM (gift from Prof. W. Silvia): 1:50,
000, anti-PGE2 (gift from Prof. W.W. Thatcher): 1:35,000, anti-OT (gift from Prof G. Kotwica): 1:50,000, anti-P4 (gift from Prof S.
Okrasa): 1:80,000, and anti-E2 (gift from Prof G. I. Williams): 1:65,000. All assays were performed in 96-well plates coated with ovine
anti-rabbit γ-globulin, which was from the Institute of Animal Reproduction and Food Research Polish Academy of Sciences source.
Absorbance was measured at a wavelength of 450 nm using a Multiscan MX plate reader (Thermo Scientific), and the results were
analyzed using Genesis Lite 3.0 (Labsystems, Vantaa, Finland). The final hormone concentrations are expressed per mg of tissue
explant.

2.5. Total RNA isolation and qPCR analysis

Total RNA was isolated using a Total RNA kit (A&A Biotechnology, Gdynia, Poland). Frozen explants of tissues were pulverized
(Retsch, Haan, Germany) in liquid nitrogen and covered with phenozol (A&A Biotechnology). The concentration and purity of the
isolated RNA samples were determined using a NanoDrop spectrophotometer and NanoDrop 1000 V.3.7.1 software (Thermo Scien­
tific, Waltham, MA, USA). The mRNA (1 μg) from each sample was reverse transcribed (42 ◦ C for 60 min) in a 20 μL reaction using
reverse transcriptase. The obtained complementary DNA was stored at − 20 ◦ C for further analysis. Primers for cyclooxygenase-2
(EC:1.14.99.1; COX-2), 20 alpha-hydroxysteroid dehydrogenase/prostaglandin F-synthase (EC:1.1.1.149; AKR1B1), prostaglandin E
synthase 2 (EC:5.3.99.3; PTGES), neurophysin-I/oxytocin (NP-I/OT), peptidylglycine alpha-amidating monooxygenase (EC:1.14.17.3;
PAM) and 3β-hydroxysteroid dehydrogenase (EC:1.1.1.145; HSD3B) genes were designed using Primer Express software (Thermo
Scientific), and these were based on gene sequences available in GenBank (NCBI). The primers for aromatase (EC:1.14.14.14;
CYP19A1) was used previously by Luo and Wiltbank (2006). The qPCR procedures were performed using a KAPA SYBR FAST qPCR
Master Mix kit (KapaBiosystems, Wilmington, NC, USA) and a 7900 H T Fast Real-Time PCR System (Applied Biosystems, Carlsbad,
USA) with a 384-well block. The total volume of each reaction was 10 μL (3 μL containing 200 ng of complementary DNA, 6 μL of
qPCR Master Mix, and 0.5 μL of each 0.2 mM primer). The reaction conditions were as follows: initial denaturation (95 ◦ C for 10 min)
followed by 40 cycles of denaturation (95 ◦ C for 15 s), and annealing and extension (60 ◦ C for 60 s). All reactions were performed in
duplicate. After each qPCR reaction, melting curves were obtained by increasing the temperature from 60 to 95 ◦ C in a stepwise
manner to ensure single-product amplification. In addition, the specificity of each qPCR product was confirmed using electrophoresis
on a 2 % agarose gel (EuroGenTec, Köln, Germany). The data were normalized using TATA box binding protein (TBP) mRNA, as
reported earlier (Wojciechowska et al., 2017). Primer sequences are shown in Table 1.

2.6. Statistical analysis

The mean (n = 12; ±SEM) values for the placentome explant viability were compared using one-way ANOVA followed by the

Table 1
Primer sequences used in RealTime-PCR reactions.
Gene Primers sequence (5′ → 3′ ) Amplicon Access number (GeneBank) or source
(forward – F, reverse - R lenght (bp)

COX-2 F: GCCTGATGACTGCCCAACA 140 AF004944.1

R: GCAAAGAATGCAAACATCAGATTT
PTGES F: TGGGCGGACGACTGGTT 151 NM_001166554.1
R: GGTGGTGCCTGCGTTTG
PGFS F: TGTGGTGCACGTATCACGACA 160 S54973
R: AATCACGTTGCCGTCCTCATC
NP-I/OT F: GTCTGCACCATGGCAGGTT 157 NM_17685.1
R: ACGGCAGGTAGTTCTCCTSTTG
PAM F: GCACCCATCGTTTGGAAGAA 158 NM_173948.2
R: TCCACCGAATAAATAAGGCA
HSD3B F:TCATGAACGTCAATGTGAAAGGT 167 X17614.1
R: TCTTCTTCACGGCCGTCTTG
CYP19A1 F: GTGTCCGAAGTTGTGCCTATT 183 Luo and Wiltbank; 2006
R: GGAACCTGCAGTGGGAAATGA
TBP F: CAGAGAGCTCCGGGATCGT 194 NM_001075742.1
R: ACACCATCTTCCCAGAACTGAATAT

3
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

Newman-Keuls posttest. All other mean (n = 16; ±SEM) values were compared by two-way ANOVA followed by the Newman-Keuls
posttest. Prism 6 software (GraphPad Software, San Diego, CA, USA) was used to prepare all statistical analyses and figures. The raw
data results of the real-time PCR analyses were calculated based on the real-time PCR Miner algorithm (Zhao and Fernald, 2005).

3. Results

There was no negative (P >0.05) effect of the xenobiotics evaluated in this study on cell viability in smooth chorion explants
collected during the 120–150 days and 151–180 days gestational period (Table 2).In explants of smooth chorion collected between 120
and 150 days of the gestational period, DDT (10 ng/mL) inhibited (P < 0.05) and dieldrin (1 ng/mL) there was a larger (P <0.05)
relative abundance of COX2 mRNA transcript compared to that of the control group (Fig. 1A). In contrast, relative abundance COX2
mRNA transcript was less when all doses of aldrin and dieldrin were included in the media of explants collected between 151 and 180
days of the gestational period (P < 0.05; Fig. 1D) relative to values in the control samples. In addition, relative abundance of PTGES
mRNA was less (P < 0.05) in smooth chorion explants collected between 120 and 150 days of gestational period when DDE was added
to the explant media at a dose of 10 ng/mL, and the relative abundance was greater (P < 0.05) at 10 ng/mL was added to the explant
media (Fig. 1B). There was the same effect (P < 0.05) of DDE and dieldrin on relative abundance of PTGES mRNA transcript in smooth
chorion collected between 151 and 180 days of the gestational period (Fig. 1E). The dose of 10 ng/mL of DDE resulted in there being
less PGE2 concentrations in the media of the smooth chorion explants that were collected between 120 and 150 days (P < 0.05; Fig. 1C)
and 151–180 of days of the gestational period (P < 0.05; Fig. 1F). Only dieldrin addition to the media at the dose 10 ng/mL had an
effect on prostaglandin E2 concentrations of the media of explants collected between 120 and 150 days of the gestational period
(P < 0.05; Fig. 1C).
For smooth chorion explants collected between 120 and 150 days of the gestational period, only inclusion of dieldrin in the media
at a dose of 10 ng/mL resulted in greater abundance of AKR1B1 mRNA transcript (P < 0.05; Fig. 2A), however, in explants collected
between 151 and 180 days of the gestation period, there was a greater abundance of this mRNA transcript when DDT (1 ng/mL), DDE
(1 ng/mL) and dieldrin (10 ng/mL) were added to the media (P < 0.05; Fig. 2C). Only addition of DDT (1 ng/mL) to the media resulted
in a greater concentration of PGF2α in the media of the chorion explants collected between 120 and 150 days of the gestational period
(P < 0.05; Fig. 2B). In contrast, both doses of DDT and DDE resulted in greater concentrations of PFG2α in the media (P < 0.05), and at
both doses of aldrin there was a lesser (P < 0.05) concentration PGF2α in the media of explants collected between 150 and 181 days of
the gestational period (Fig. 2D).
In explants of smooth chorion collected between 120 and 150 days of the gestational period, both doses of aldrin and dieldrin
induced a greater (P < 0.05) relative abundance of the OT precursor (NP-I/OT) mRNA transcript; additionally, when there was ad­
ditions of 10 ng/mL DDT, DDE and aldrin to the media, there was a greater abundance mRNA transcript for the PAM enzyme
(P < 0.05; Fig. 3A and B). Furthermore, there was a greater concentration of OT in the media of the chorionic explants after additions
of both doses (1 and 10 ng/mL) of aldrin and dieldrin and the dose of 10 ng/mL DDE (P < 0.05; Fig. 3C). With smooth chorion explants
collected between 151 and 180 days of the gestational period, none of the treatments affected the relative abundance of NP-I/OT
mRNA transcript (P > 0.05; Fig. 3D). The relative abundance of PAM mRNA transcript was greater after addition of DDE and dieldrin
to the media at a dose of 10 ng/mL (P < 0.05; Fig. 3E). Only when there was DDE added to the media at a dose of 10 ng/mL, was there a
greater concentration of OT (P < 0.05; Fig. 3F).
None of the xenobiotics evaluated had an effect on the relative abundance of HSD3B mRNA transcript in explants collected between
120 and 150 days of the gestational period (P > 0.05; Fig. 4A). There was greater concentration of P4 in the media of explants when
there was addition of DDT (10 ng/mL) to the media (P < 0.05; Fig. 4B). Addition of both doses of DDE resulted in a greater abundance
of HSD3B mRNA transcript (P < 0.05; Fig. 4C) in chorion explants collected between 151 and 180 days of gestational period, however
addition of all doses of DDT and DDE to the media, resulted in grater concentrations of P4 (P <0.05; Fig. 4D). When there was addition
of each of the XBs there was no effect (P > 0.05) CYP19A1 mRNA transcript and concentration of E2 in the media of the explants of
smooth chorion (data not shown).

4. Discussion

The pesticides and metabolites of these compounds evaluated in the present study did not affect the viability of the smooth chorion
explants at the doses evaluated (100 ng/mL). It, therefore, can be assumed that the observed in the relative abundance mRNA tran­
scripts responsible for enzyme and hormone secretion were not a result of cytotoxic effects of treatment with these compounds.
The synthesis of PGs was disrupted by all xenobiotics that were evaluated in the present study, however, the effects of these
compounds on these processes was not consistent. The factors affecting the secreted concentrations of both PGE2 and PGF2α are the
enzymes COX2 and prostaglandin synthases PTGES and AKR1B1. The relative abundance of COX2, PTGES and AKR1B1 mRNA

Table 2
Effects of treatment with XBs (all at the dose 100 ng/mL) on cells viability of smooth chorion explants (n = 6) collected between 120 and 150 days,
and 151 to 180 days of the gestational period, after 48 h incubation. Differences are indicated by the asterisks (n = 12; mean ± SD; P <0.05).
Gestational Stage Control DDT DDE Aldrin Dieldrin PFA

120 – 150 days 100 % ±14.9 % 102.4 % ±18.9 % 98.7 % ±17.8 % 92.9 % ±17.1 % 89.7 % ±15.0 % 40.2 % ±122%*
151 – 180 days 100 % ±11.1 % 106.87 % ±189% 98.2 % ±12.8 % 98.4 % ±5.2 % 94.8 % ±17.8 % 45.0 % ±7.8 %*

4
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

Fig. 1. Effects of DDT, DDE, aldrin, and dieldrin at the doses 1 and 10 ng/mL on the relative abundance of COX2, PTGES mRNA transcripts and
PGE2 concentrations in the media of smooth chorion explants collected between 120 and 150 days (A, B, C), and 151 to 180 days (D, E, F) of the
gestational period after 24 h of incubation; Different superscripts above bars are indicative of differences among these values (n =16; P
<0.05; mean ± SEM).

transcripts is regulated by peroxisome proliferator-activated receptors (PPARs), especially PPARγ (Ackerman et al., 2005), which is
present in the chorion (Degrelle et al., 2011). The selective activation of PPARs changes not only gene expression, as indicated by
abundance of mRNA transcripts, but also enzymatic activity, and all enzymes that are involved in regulation of PGE2 and PGF2α
secretion (Aleshin et al., 2009; Astakhova et al., 2015). The DDT and DDE compounds have actions PPARγ antagonists (Routti et al.,
2016), while aldrin and its derivatives have actions as agonists (Moreno-Aliaga and Matsumura, 1999). The amount and proportions of
individual PPAR isoforms in cells that result in smooth chorion tissues development changes during the gestational period (Degrelle
et al., 2011; Blitek and Szymanska, 2017), especially isoforms PPARβ and PPARγ (Bogacka et al., 2013a;b). The effect of the XBs
evaluated in the present study on PGE2 and PGF2α concentration in the explant media of smooth chorion explants could be explained by
unregulated stimulation of individual PPAR isoforms by the XBs evaluated in the present study. This may be a reason for the different
effects on PGE2 and PGF2α concentrations in the media after the same XB treatment of the smooth chorion explants collected between

5
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

Fig. 2. Effects of DDT, DDE, aldrin and dieldrin at the doses 1 and 10 ng/mL on the relative abundance of AKR1B1 mRNA transcript and PGF2α
(PGFM) concentrations in the media of smooth chorion explants obtained between 120 and 150 days (A, B), and 151 to 180 days (C, D) of the
gestational period after 24 h of incubation; Different superscripts above bars are indicative of differences among these values (n = 16; P < 0.05;
mean ±SEM).

120 and 150 days as well as 151–180 days of the gestational period. Additionally, the lack of a close association between the doses and
effects of XBs can be explained by the different sensitivities of cell types within the chorion explant to XB stimulation.
There have been similar effects of DDT and DDE on PG concentrations in the media of epithelial cells of the oviduct of cattle
(Wrobel et al., 2012). Notably, there was a similar lack of a direct dose-dependent effect in other studies when there were xenobiotic
treatment (El Majidi et al., 2012; Wojciechowska et al., 2017). It should also be noted that in the case of DDT and DDE, the observed
changes in secretion in the present study may occur through different cellular pathways. These substances also increase the synthesis
and secretion of interleukin 1β (Martin and Whalen, 2017), which has marked effects the processes of PGE2 and PGF2α synthesis
(Tanikawa et al., 2008). In summary, the most marked changes in PGE2 concentrations were induced by XBs from chorion explants
collected between 120 and 150 days of the gestational period, while the changes in concentrations of PGF2α in the media when there
was treatment with XBs were most marked with the explants collected between 151 and 180 days of the gestational period.
Furthermore, due to the capacity of the XBs to be a ligand for different types of receptors at the same time, the mechanism of action is
difficult to accurately determine.
The increase in OT concentrations in the media of smooth chorion explants collected between 120 and 150 days of the gestational
period when there was treatment with aldrin and dieldrin is accompanied by an increase in the relative abundance of NP-I/OT mRNA
transcript. For explants collected between 151 and 180 days of the gestational period, there was no effect on the relative abundance of
OT precursor gene mRNA transcript and hormone release; however, treatment with dieldrin resulted in an increase of the relative
abundance of the PAM enzyme mRNA transcript, which is the terminal factor regulating the release process of this hormone (Sheldrick
and Flint, 1989). There was a similar effect in a previous study of these XBs on concentration of OT in the media of granulosa and luteal
cells (Wrobel et al., 2015). It, therefore, can be assumed that the increase in OT secretion from smooth chorion explants after
administration of aldrin or dieldrin is the result of an increase in availability of the OT precursor. In contrast to previous studies
(Wrobel et al., 2009), DDT and DDE had a relatively lesser effect on OT synthesis and secretion. For the only effective dose of DDE
(10 ng/mL) that had effects of a simultaneous increase in the relative abundance of both the NP-I/OT and PAM mRNA transcripts, the
mechanism of action was previously described in cells of the corpus luteum collected during the first third of the gestational period
(Mlynarczuk et al., 2010).

6
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

Fig. 3. Effects of DDT, DDE, aldrin and dieldrin at the doses 1 and 10 ng/mL on relative abundances of NP-I/OT and PAM mRNA transcripts and OT
concentrations in the media of smooth chorion explants obtained between 120 and 150 days (A, B, C), and 151 to 180 days (D, E, F) of the
gestational period after 24 h of incubation; Different superscripts above bars are indicative of differences among values (n = 16; P < 0.05;
mean ±SEM).

The main factor regulating the relative abundance of the NP-I/OT mRNA transcripts in cattle is the "orphan" receptor SF-1 [NR5A1]
(Wehrenberg et al., 1994), while the relative abundance of the PAM enzyme mRNA transcript is dependent on activation of the
estradiol receptor (ER), especially isoform α (Gimpl and Fahrenholz, 2001). The DDT and DDE compounds may be ligands for the SF-1
receptor (Mlynarczuk et al., 2013 and 2014); hence, the observed changes in the relative abundance of NP-I/OT mRNA transcript may
be induced by DDE (at a dose of 10 ng/mL) and may be an effect resulting from activation of this receptor. Furthermore, both DDT and
DDE have estrogen-like properties (Kim et al., 2011), which can explain the increase in relative abundance of PAM mRNA transcript. In
contrast, aldrin and dieldrin do not have estrogen-like properties (Kim et al., 2011) and have not yet been studied as potential ligands
for the SF-1 receptor. Hence, an attempt to explain the mechanism resulting in the effects on the secretion of OT through activation of
SF-1 and/or E2 receptors would be too speculative at the current stage of research in this area of study.

7
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

Fig. 4. Effects of DDT, DDE, aldrin and dieldrin at the doses 1 and 10 ng/mL on relative abundance of HSD3B, and P4 concentrations in the media of
smooth chorion explants obtained between 120 and 150 days (A, B), and 151 to 180 days (C, D) of the gestational period after 24 h of incubation:
Different superscripts above bars are indicative of differences among values (n = 16; P <0.05; mean ± SEM).

Increased P4 secretion following the DDT or DDE treatments was observed previously in human placenta explants and granulosa
and luteal cells of cattle (Wójtowicz et al., 2008; Mlynarczuk et al., 2013 and 2014). It is possible that these substances are ligands for
the SF-1 receptor (Mlynarczuk et al., 2014), which when activated positively regulates the transcription of genes that encode for
3βHSD (Leers-Sucheta et al., 1997) and StAR protein (Sugawara et al., 2000). In contrast to studies where the research was focused on
explants of cattle cotyledons (Wojciechowska et al., 2017), none of the XBs evaluated in the present study had effects on E2 secretion.
It is noteworthy that the smooth chorion cells have different sensitivities to the effects of the XBs evaluated in the present study
depending on the stage of the gestational period. This may indicate that during this time (between 120 and 180 days of the gestational
period), there is a significant change in the accessibility of factors (hormones, coreceptors, etc.,) that enable the detection and
transduction of signals resulting from treatment with these XBs.
Because the regulation of blood vessel contractility in the chorion area is dependent on the PGE2:PGF2α ratio and the amount of OT,
the changes in the secretion of these hormones caused by XBs may have detrimental effects on the regulation of blood vessels in this
area (Migaard et al., 1986a), and increased OT release can magnify these detrimental effects (Maigaard et al.1986b). Furthermore, PGs
in fetal circulation have a longer half-life than those in peripheral circulation (Walters and Boura, 1991). Consequently, the transport
of nutrients to the fetus, gas exchange and removal of its metabolism products between maternal and fetal parts of the placenta can be
disrupted, which can induce abortions or premature births (Reynolds, 2013).

5. Conclusion

The results from the present study indicate that the XBs evaluated impair the synthesis and release of PGE2, PGF2α OT and P4 from
smooth chorion. These changes differ in smooth chorion sections before and after the beginning of remodeling of the placenta of cattle,
which are not the same as the changes observed in cotyledon sections. Hence, the regulation processes in the placenta of cattle can be
disrupted by XBs, and the possibility of abortions and premature births can increase. These changes differ in smooth chorion sections
before and after the beginning of remodeling of the cattle placenta, and these are not the same as the changes observed in cotyledon
sections.

8
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

Authorship contributions

Please indicate the specific contributions made by each author (list the authors’ initials followed by their surnames). The name of
each author must appear at least once in each of the three categories below.

Category 1

Conception and design of study: Mlynarczuk Jaroslaw; acquisition of data: Mlynarczuk J, Górska M, Wrobel MH; analysis and/or
interpretation of data: Mlynarczuk J, Wrobel MH.
Category 2
Drafting the manuscript: Mlynarczuk J, Wrobel MH, Górska M; revising the manuscript critically for important intellectual content:
Wrobel MH, Mlynarczuk J.
Category 3
Approval of the version of the manuscript to be published (the names of all authors must be listed): Mlynarczuk Jaroslaw, Wrobel
Michal Hubert, Górska Marlena.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to
influence the work reported in this paper.

Acknowledgements

All persons who have made substantial contributions to the work reported in the manuscript (e.g., technical help, writing and
editing assistance, general support), but who do not meet the criteria for authorship, are named in the Acknowledgements and have
given us their written permission to be named. If we have not included an Acknowledgements, then that indicates that we have not
received substantial contributions from non-authors. We thank Professors: W.J. Silvia (University of Kentucky, Lexington, KY, USA),
W.W. Thatcher (University of Florida, Gainesville, FL, USA), G. Kotwica, S. Okrasa (University of Warmia and Mazury, Olsztyn, PL) and
G.L. Williams (A&M Texas University, Beeville, TX, USA) for the PGFM, PGE2, OT, P4 and E2 antisera.

References

Ackerman 4th, W.E., Zhang, X.L., Rovin, B.H., Kniss, D.A., 2005. Modulation of cytokine-induced cyclooxygenase 2 expression by PPARG ligands through NFkappaB
signal disruption in human WISH and amnion cells. Biol. Reprod. 73, 527–535.
Albrecht, E.D., Pepe, G.J., 2010. Estrogen regulation of placental angiogenesis and fetal ovarian development during primate pregnancy. Int. J. Dev. Biol. 54,
397–408.
Aleshin, S., Grabeklis, S., Hanck, T.M., Sergeeva, M., Reiser, G., 2009. Peroxisome proliferator-activated receptor (PPAR)-gamma positively controls and PPARalpha
negatively controls cyclooxygenase-2 expression in rat brain astrocytes through a convergence on PPARbeta/delta via mutual control of PPAR expression levels.
Mol. Pharmacol. 76, 414–424.
Arosh, J.A., Banu, S.K., Chapdelaine, P., Fortier, M.A., 2004. Tissue-specific expression of prostaglandin receptors EP2, EP3, EP4, FP, and cyclooxygenases 1 and 2 in
uterus and fetal membranes during bovine pregnancy. Endocrinology. 145, 407–417.
Astakhova, A.A., Chistyakov, D.V., Pankevich, E.V., Sergeeva, M.G., 2015. Regulation of cyclooxygenase 2 expression by agonists of PPAR nuclear receptors in the
model of endotoxin tolerance in astrocytes. Biochemistry Mosc. 80, 1262–1270.
Beindorf, N., Nagai, R., Shirasuna, K., Herzog, K., Hoefmann, K., Sasaki, M., Bollwein, H., Miyamoto, A., 2010. Vascular changes in the corpus luteum during early
pregnancy in the cow. J. Reprod. Dev. 56, 263–270.
Blitek, A., Szymanska, M., 2017. Peroxisome proliferator-activated receptor (PPAR) isoforms are differentially expressed in peri-implantation porcine conceptuses.
Theriogenology. 101, 53–61.
Bogacka, I., Bogacki, M., Gaglewska, M., Kurzynska, A., Wasielak, M., 2013a. In vitro effect of peroxisome proliferator activated receptor (PPAR) ligands on
prostaglandin E2 synthesis and secretion by porcine endometrium during the estrous cycle and early pregnancy. J. Physiol. Pharmacol. 64, 47–54.
Bogacka, I., Bogacki, M., Kurzyńska, A., Chojnowska, K., 2013b. The involvement of peroxisome proliferator activated receptors (PPARs) in prostaglandin F2α
production by porcine endometrium. Reprod. Biol. 13, 309–316.
Degrelle, S.A., Murthi, P., Evain-Brion, D., Fournier, T., Hue, I., 2011. Expression and localization of DLX3, PPARG and SP1 in bovine trophoblast during binucleated
cell differentiation. Placenta. 32, 917–920.
El Majidi, N., Bouchard, M., Gosselin, N.H., Carrier, G., 2012. Relationship between prenatal exposure to polychlorinated biphenyls and birth weight: a systematic
analysis of published epidemiological studies through a standardization of biomonitoring data. Regul. Toxicol. Pharmacol. 64, 161–176.
Fields, P.A., Eldridge, R.K., Fuchs, A.R., Roberts, R.F., Fields, M.J., 1983. Human placental and bovine corpora luteal oxytocin. Endocrinology. 112, 1544–1546.
Fuchs, R.A., Helmer, H., Behrens, O., Liu, H., Antonian, L., Fields, M.J., 1992. Oxytocin receptors in bovine endometrium and myometrium during pregnancy and
parturition. Biol. Reprod. 47, 937–944.
Garcia, A.M., 1998. Occupational exposure to pesticides and congenital malformations. A review of mechanisms, methods and results. Am. J. Ind. Med. 33, 232–240.
Gimpl, G., Fahrenholz, F., 2001. The oxytocin receptor system: structure, function, and regulation. Physiol. Rev. 81, 629–683.
Hirako, M., Aoki, M., Kimura, K., Hanafusa, Y., Ishizaki, H., Kariya, Y., 2005. Comparison of the concentrations of polychlorinated dibenzo-p-dioxins, dibenzofurans,
and dioxin-like polychlorinated biphenyls in maternal and fetal blood, amniotic and allantoic fluids in cattle. Reprod. Toxicol. 20, 247–254.
Jainudeen, M.R., Hafez, E.S.E., 1980. Gestation, prenatal physiology and parturition. In: Hafez, E.S.E. (Ed.), Reproduction in Farm Animals. Lea & Febiger,
Philadelphia, pp. 247–283.
Janowski, T., Zdunczyk, S., Podhalicz-Dziegelewska, M., Ras, A., Chmielewski, A., 1996. Effect of estrogen antagonist (tamoxifen) on steroid hormone levels,
maturation process of placentomes and course of late pregnancy in cows. Reprod. Domest. Anim. 31, 379–384.
Kamarianos, A., Karamanlis, X., Goulas, P., Theodosiadou, E., Smokovitis, A., 2003. The presence of environmental pollutants in the follicular fluid of farm animals
(cattle, sheep, goats, and pigs). Reprod. Toxicol. 17, 185–190.

9
J. Mlynarczuk et al. Animal Reproduction Science 223 (2020) 106623

Kim, T.S., Kim, C.Y., Lee, H.K., Kang, I.H., Kim, M.G., Jung, K.K., Kwon, Y.K., Nam, H.S., Hong, S., Kim, H.S., Yoon, H.J., Rhee, G.S., 2011. Estrogenic activity of
persistent organic pollutants and parabens based on the stably transfected human estrogen receptor-α transcriptional activation assay (OECD TG 455). Toxicol.
Res. 27, 181–184.
Korrick, S.A., Chen, C., Damokosh, A., Ni, J., Liu, X., Cho, S., Altshul, L., Ryan, L., Xu, X., 2001. Association of DDT with spontaneous abortion: a case-control study.
Ann. Epidemiol. 11, 491–496.
Leers-Sucheta, S., Morohashi, K., Mason, J.I., Melner, M.H., 1997. Synergistic activation of the human type II 3beta-hydroxysteroid dehydrogenase/delta5-delta4
isomerase promoter by the transcription factor steroidogenic factor-1/adrenal 4-binding protein and phorbol ester. J. Biol. Chem. 272, 7960–7967.
Luo, W., Wiltbank, M.C., 2006. Distinct regulation by steroids of messenger RNAs for FSHR and CYP19A1 in bovine granulosa cells. Biol. Reprod. 75, 217–225.
Martin, T.J., Whalen, M.M., 2017. Exposures to the environmental toxicants pentachlorophenol (PCP) and dichlorodiphenyltrichloroethane (DDT) modify secretion of
interleukin 1-beta (IL-1β) from human immune cells. Arch. Toxicol. 91, 1795–1808.
Migaard, S., Forman, A., Andersson, K.E., 1986a. Relaxant and contractile effects of some amines and oxytocin in myometrial and vascular smooth muscle within the
human uteroplacental unit. Acta Physiol. Scand. 128, 33–40.
Migaard, S., Forman, A., Andersson, K.E., 1986b. Different effects of angiotensin, vasopressin and oxytocin on various smooth muscle tissues within the human
uteroplacental unit. Acta Physiol. Scand. 128, 23–31.
Mlynarczuk, J., Wrobel, M.H., Kotwica, J., 2010. Effect of environmental pollutants on oxytocin synthesis and secretion from corpus luteum and on contractions of
uterus from pregnant cow. Toxicol. Appl. Pharmacol. 247, 243–249.
Mlynarczuk, J., Wrobel, M.H., Ziolkowska, A., Kotwica, J., 2013. Involvement of the orphan nuclear receptor SF-1 in the effect of PCBs, DDT and DDE on the secretion
of steroid hormones and oxytocin from bovine granulosa cells. Anim. Reprod. Sci. 143, 30–37.
Mlynarczuk, J., Wrobel, M.H., Kotwica, J., 2014. The orphan nuclear receptor SF-1 is involved in the effect of PCBs, DDT, and DDE on the secretion of steroid
hormones and oxytocin from bovine luteal cells during the estrous cycle in vitro. Theriogenology. 81, 877–886.
Moreno-Aliaga, M.J., Matsumura, F., 1999. Endrin inhibits adipocyte differentiation by selectively altering expression pattern of CCAAT/enhancer binding protein-
alpha in 3T3-L1 cells. Mol. Pharmacol. 56, 91–101.
Pennington, K.A., Oliveira, L.J., Yang, Q.E., Elay, A.D., 2010. The enrichment of trophoblast giant cells from mid-gestation bovine placentae using fluorescence-
activated cell sorting. Placenta. 31, 738–740.
Pfarrer, C., Hirsch, P., Guillomot, M., Leiser, R., 2003. Interaction of integrin receptors with extracellular matrix is involved in trophoblast giant cell migration in
bovine placentomes. Placenta. 24, 588–597.
Pollack, A.Z., Buck Louis, G.M., Lynch, C.D., Kostyniak, P.J., 2011. Persistent organochlorine exposure and pregnancy loss: a prospective cohort study. J. Environ.
Prot. (Irvine, Calif). 2, 683–691.
Poston, L., 1997. The control of blood flow to the placenta. Exp. Physiol. 82, 377–387.
Reynolds, R.M., 2013. Programming effects of glucocorticoids. Clin. Obstet. Gynecol. 56, 602–609.
Robertson, H.A., King, G.J., 1979. Conjugated and unconjugated oestrogens in fetal and maternal fluids of the cow throughout pregnancy. J. Reprod. Fertil. 55,
463–470.
Routti, H., Lille-Langøy, R., Berg, M.K., Fink, T., Harj, M., Kristiansen, K., Rostkowski, P., Rusten, M., Sylte, I., Øygarden, L., Goksøyr, A., 2016. Environmental
chemicals modulate polar bear (Ursus maritimus) Peroxisome Proliferator-Activated Receptor Gamma (PPARG) and adipogenesis in vitro. Environ. Sci. Technol.
50, 10708–10720.
Sheldrick, E.L., Flint, A.P., 1989. Post-translational processing of oxytocin/neurophysin prohormone in the ovine corpus luteum: activity of peptidylglycine alpha-
amidating mono-oxygenase and concentrations of its cofactor, ascorbic acid. J. Endocrinol. 122, 313–322.
Skarzynski, D.J., Bogacki, M., Kotwica, J., 1999. Involvement of ovarian steroids in basal and oxytocin-stimulated prostaglandin (PG) F2 alpha secretion by the bovine
endometrium in vitro. Theriogenology 52, 385–397.
Slama, H., Vaillancourt, D., Goff, A.K., 1994. Control of in vitro prostaglandin F2 alpha and E2 synthesis by caruncular and allantochorionic tissues from cows that
calved normally and those with retained fetal membranes. Domest. Anim. Endocrinol. 11, 175–185.
Sugawara, T., Saito, M., Fujimoto, S., 2000. Sp1 and SF-1 interact and cooperate in the regulation steroidogenic acute regulatory protein gene expression.
Endocrinology. 141, 2895–2903.
Tanikawa, M., Lee, H.Y., Watanabe, K., Majewska, M., Skarzynski, D.J., Park, S.B., Lee, D.S., Park, C.K., Acosta, T.J., Okuda, K., 2008. Regulation of prostaglandin
biosynthesis by interleukin-1 in cultured bovine endometrial cells. J. Endocrinol. 199, 425–434.
Walls, J.R., Coultas, L., Rossant, J., Henkelman, R.M., 2008. Three-dimensional analysis of vascular development in the mouse embryo. PLoS One 3 (8), e2853 doi:
10.1371.
Walters, W.A., Boura, A.L., 1991. Regulation of fetal vascular tone in the human placenta. Reprod. Fertil. Dev. 3, 475–481.
Wehrenberg, U., Ivell, R., Jansen, M., von Goedecke, S., Walther, N., 1994. Two orphan receptors binding to a common site are involved in the regulation of the
oxytocin gene in the bovine ovary. P. Natl. Acad. Sci. USA. 91, 1440–1444.
Wojciechowska, A., Mlynarczuk, J., Kotwica, J., 2015. Short-term incubation of bovine placentome explants as a tool to study xenobiotic mechanism of action.
Reprod. Biol. 15, 238–246.
Wojciechowska, A., Mlynarczuk, J., Kotwica, J., 2017. Changes in the mRNA expression of structural proteins, hormone synthesis and secretion from bovine
placentome explants after DDT and DDE treatment. Toxicology 375, 1–9.
Wójtowicz, A.K., Milewicz, T., Gregoraszczuk, E.Ł., 2008. Time-dependent action of DDT (1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane) and its metabolite DDE (1,1-
dichloro-2,2-bis(p-chlorophenyl)ethylene) on human chorionic gonadotropin and progesterone secretion. Gynecol. Endocrinol. 24, 54–58.
Wrobel, M., Mlynarczuk, J., Kotwica, J., 2009. The adverse effect of dichlorodiphenyltrichloroethane (DDT) and its metabolite (DDE) on the secretion of
prostaglandins and oxytocin in bovine cultured ovarian and endometrial cells. Reprod. Toxicol. 27, 72–78.
Wrobel, M.H., Mlynarczuk, J., Kotwica, J., 2012. The effect of DDT and its metabolite (DDE) on prostaglandin secretion from epithelial cells and on contractions of the
smooth muscle of the bovine oviduct in vitro. Toxicol. Appl. Pharmacol. 259, 152–159.
Wrobel, M.H., Bedziechowski, P., Mlynarczuk, J., Kotwica, J., 2014. Impairment of uterine smooth muscle contractions and prostaglandin secretion from cattle
myometrium and corpus luteum in vitro is influenced by DDT, DDE, and HCH. Environ. Res. 32, 54–61.
Wrobel, M.H., Grzeszczyk, M., Mlynarczuk, J., Kotwica, J., 2015. The adverse effects of aldrin and dieldrin on both myometrial contractions and the secretory
functions of bovine ovaries and uterus in vitro. Toxicol. Appl. Pharmacol. 285, 23–31.
Zhao, S., Fernald, R., 2005. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J. Comput. Biol. 12, 1045–1062.

10