Received: 15 February 2019 | Accepted: 8 July 2019

DOI: 10.1002/mrd.23242

RESEARCH ARTICLE

Cloned pig fetuses exhibit fatty acid deficiency from impaired

placental transport

Zheng Ao1,2 | Xiao Wu1,2 | Jun Zhou1,2 | Ting Gu1,2 | Xingwang Wang1,2 |
Junsong Shi 3
| Chengfa Zhao 1,2
| Gengyuan Cai 1,2
| Enqin Zheng 1,2
| Dewu Liu1,2 |
Zhenfang Wu 1,2
| Zicong Li 1,2

1
National Engineering Research Center for
Breeding Swine Industry, College of Animal Abstract
Science, South China Agricultural University, Cloned pig fetuses produced by somatic cell nuclear transfer show a high incidence
Guangzhou, Guangdong, China
2 of erroneous development in the uteri of surrogate mothers. The mechanisms
Guangdong Provincial Key Laboratory of
Agro‐animal Genomics and Molecular underlying the abnormal intrauterine development of cloned pig fetuses are poorly
Breeding, College of Animal Science, South
understood. This study aimed to explore the potential causes of the aberrant
China Agricultural University, Guangzhou,
Guangdong, China development of cloned pig fetuses. The levels of numerous fatty acids in allantoic
3
Guangdong Wens Pig Breeding Technology fluid and muscle tissue were lower in cloned pig fetuses than in artificial
Co. Ltd., Wens Foodstuff Group Co. Ltd.,
Yunfu, Guangdong, China insemination‐generated pig fetuses, thereby suggesting that cloned pig fetuses
underwent fatty acid deficiency. Cloned pig fetuses also displayed trophoblast
Correspondence
Zhenfang Wu and Zicong Li, National hypoplasia and a reduced expression of placental fatty acid transport protein 4
Engineering Research Center for Breeding (FATP4), which is the predominant FATP family member expressed in porcine
Swine Industry, College of Animal Science,
South China Agricultural University, 510642 placentas. This result suggested that the placental fatty acid transport functions
Guangzhou, Guangdong, China. were impaired in cloned pig fetuses, possibly causing fatty acid deficiency in cloned
Email: wzfemail@163.com (Z. W.) and
lizicong@scau.edu.cn (Z. L.) pig fetuses. The present study provides useful information in elucidating the
mechanisms underlying the abnormal development of cloned pig fetuses.
Funding information
Department of Science and Technology of
KEYWORDS
Guangdong Province, China, Grant/Award
Numbers: 2018B030314004, allantoic fluid, cloned, pig fetuses, placenta, SCNT
2016B020233006; National Natural Science
Foundation of China, Grant/Award Number:
31772554

1 | INTRODUCTION available information regarding the causes of erroneous intrauterine

Pig somatic cell nuclear transfer (SCNT) has valuable applications in
agriculture, biomedicine, and life science (Matsunari & Nagashima,
2009; Yang & Wu, 2018). However, SCNT‐derived cloned pig fetuses
frequently exhibit aberrant intrauterine development (Ao et al.,
2017; Ao, Li, et al., 2019; Chae et al., 2009; Kim et al., 2011; Ruan
et al., 2018), leading to high stillbirth occurrence (17–32.8%; Ao,
Zhao, et al., 2019; Estrada et al., 2007; Huan et al., 2015; Kurome
et al., 2013; Liu et al., 2015), congenital malformations (29.5–60.0%;
Kurome et al., 2013; Schmidt, Winther, Secher, & Callesen, 2015),
and neonatal mortality (48.0–74.5%; Ao et al., 2017; Park et al.,
2009; Schmidt et al., 2015) in newborn cloned piglets. Nevertheless,
Mol Reprod Dev. 2019;86:1569–1581. wileyonlinelibrary.com/journal/mrd
development of cloned pig fetuses is extremely limited.
Fetal development is linked to several crucial intrauterine environ-
mental factors, such as amniotic fluid, allantoic fluid, and placenta (Dessi,
Marincola, & Fanos, 2015). Amniotic fluid originates from fetal, maternal,
and placental tissues and is resorbed via fetal swallowing (Beall, van den
Wijngaard, van Gemert, & Ross, 2007). The amniotic fluid can provide an
appropriate aqueous environment and serves as a source of nutrients for
developing fetuses (Kwon, Spencer, Bazer, & Wu, 2003). In clinical
conditions, amniotic fluid metabolomic profiles can reflect fetal health
status (Baraldi et al., 2016; Gil & Duarte, 2018; Palmas et al., 2016). The
allantoic fluid is mainly provided by fetal urine and acts as a nutrient
reservoir for fetuses (Bazer & Johnson, 2014). Changes in allantoic fluid
© 2019 Wiley Periodicals, Inc. | 1569
1570 | AO
F I G U R E 1 Representative total ion current chromatograms (a) and PCA score scatter plot (b) of QC samples. AI, artificial insemination; ESI,
electrospray ionization; PCA, principal component analysis; QC, quality control; SCNT, somatic cell nuclear transfer [Color figure can be viewed
at wileyonlinelibrary.com]
composition affect fetal development and survival (Li, Wells, Peterson, &
Lee, 2005; Razdan et al., 2004). The placenta regulates multiple biological
processes, including the exchange of nutrients, oxygen, and wastes
between mother and fetus and hormone and cytokine production in
maintaining pregnancy and supporting fetal growth (Jansson & Powell,
2006; Seckl & Holmes, 2007). Placental dysfunction is related to multiple
fetal complications, such as miscarriage (Gunnarsdottir, Stephansson,
Cnattingius, Akerud, & Wikstrom, 2014), intrauterine growth retardation
(IUGR; Benton et al., 2016), stillbirth (Smith & Fretts, 2007), and cardiac
defects (Kasapoglu, Kasapoglu, Syngelaki, Akolekar, & Nicolaides, 2018).
We compared amniotic fluid metabolomes and placental tran-
scriptomes between SCNT and artificial insemination (AI) pig fetuses.
The results showed that cloned pig fetuses exhibited abnormal bile
acid and steroid hormone metabolism in amniotic fluid, possibly
caused by the erroneous expression of bile acid transporters and
steroid hormone biosynthesis enzyme and poor fold development in
placentas (Ao, Li, et al., 2019).
Given that allantoic fluid is also an important intrauterine
environmental factor for fetal growth, its metabolic profiles may
provide useful information in elucidating the mechanisms underlying
the abnormal development of cloned pig fetuses. This study aimed to
identify the allantoic fluid metabolomic differences between SCNT
and AI pig fetuses and determine the possible causes of the allantoic
fluid metabolomic differences between the two groups.
2 | RES U LTS
2.1 | Comparison of allantoic fluid metabolomic
profiles between AI and SCNT pig fetuses
Twelve quality control (QC) samples were analyzed with the
allantoic fluid samples of AI and SCNT fetuses by ultra
performance liquid chromatography—tandem mass spectrometer
ET AL.
(UPLC‐MS/MS). The total ion current chromatograms (Figure 1a),
principal component analysis (PCA) score plots (Figure 1b) of the
QC samples indicated that the chromatographic separation
system showed high accuracy, consistency, and reproducibility.
A total of 10,414 ions were identified after low‐quality ions were
removed (relative standard deviation [RSD] > 30%). The PCA
score plot showed that insignificant outliers were detected in the
samples (Figure 2a). A supervised partial least squares‐discrimi-
nation analysis (PLS‐DA) pre‐analysis revealed that the samples
from the two groups exhibited clear separation, but the A8 and
A23 samples from the AI group and the S8 from the SCNT group
showed remarkable deviation in the clustering (Figure 2b). The
fetal body weight of the three outlier samples were close to or at
the extreme ends of the body weight range of their own group
(Figure 2c). To improve the analysis accuracy, we removed A8,
A23, and S8 samples from the final PLS‐DA analysis (Figure 2d).
In accordance with the PLS‐DA model, 517 differential ions
between the SCNT and AI groups were screened out. A total of
73 differential metabolites in the allantoic fluid between the
SCNT and AI groups were identified by matching the exact
molecular mass data (m/z) of samples with the online Human
Metabolome Database (HMDB) and Kyoto Encyclopedia of Genes
and Genomes (KEGG) database (Table 2).
KEGG pathway analysis demonstrated that the differential
metabolites between the SCNT and AI allantoic fluids were
enriched in six pathways, viz., arachidonic acid (fatty acid)
metabolism, linoleic acid (fatty acid) metabolism, biosynthesis of
unsaturated fatty acids, primary bile acid biosynthesis, PPAR
signaling pathway, and Fc epsilon R1 signaling pathway (p < .05,
Figure 3). The first three enriched pathways all belonged to fatty
acid metabolism pathways, which involved a total of 20 differential
metabolites (see No. 1–20 metabolites in Table 2). All of the 20
fatty acid metabolism‐related differential metabolites and five other
AO ET AL. | 1571

F I G U R E 2 Multivariate analyses of UPLC‐MS detected metabolic signature in allantoic fluid from SCNT and AI fetuses. (a) PCA
score scatter plot. (b) PLS‐DA scores plot (R2 = 0.988, Q2 = 0.802). (c) Body weight of SCNT and AI pig fetuses. (d) PLS‐DA scores plot after A8,
A23, and S8 samples were removed (R2 = 0.997, Q2 = 0.865). AI, artificial insemination; PCA, principal component analysis; PLS‐DA, partial least
squares‐discrimination analysis; SCNT, somatic cell nuclear transfer; UPLC‐MS, ultra performance liquid chromatography—tandem mass
spectrometer [Color figure can be viewed at wileyonlinelibrary.com]

T A B L E 1 Primers used for qPCR

Genes Primer sequences (5′ to 3′) Product size (bp) Amplification efficiency (%) GenBank accession no.
FATP1 F: GTGCTGGTGATGGACGAACTGG 180 98.76 XM_021076151
R: GCCTGCTTTGCCCTCTACTCCT
FATP2 F: GGACGAGACGCTCACCTATG 185 102.04 NM_001278777
R: TGTAGTTGAGGCACGCCATG
FATP3 F: AGGTCTCAGCCGAAGTGGATGC 127 104.21 XM_021089805
R: TGACTGATCCGAGCAGCCTTGG
FATP4 F: TATGGTGTGGAGGTGCCAGGAA 198 103.49 XM_013993903
R: CCGCAGGTCTGTCTTCTGTAGC
FATP5 F: CGGTTGCCTGGATCAATC 151 – XM_021097372
R: AAGCAGCGGATGTTCTCT
FATP6 F: TCAGGATGTGGACAGGAGGAGT 183 102.87 XM_021084735
R: GAAGCGGAGCGGATGTTGGA
β‐Actin F: CCACGAGACCACCTTCAACTC 131 96.56 DQ845171
R: TGATCTCCTTCTGCATCCTGT
Abbreviations: FATP, fatty acid transport protein; qPCR, quantitative polymerase chain reaction.
T A B L E 2 List of differential metabolites in allantoic fluid between SCNT and AI fetuses
1572
|

Fold change
No. m/z Rt (min) Mode VIP (SCNT/AI) q Value ppm Metabolite name Metabolic pathway
1 281.2469 7.776 Neg 2.02 0.24 0.028 −6.09 Oleic acid Biosynthesis of unsaturated fatty acids; fatty acid biosynthesis
2 301.2155 6.799 Neg 2.58 0.15 0.034 −5.83 Eicosapentaenoic acid Biosynthesis of unsaturated fatty acids
3 327.2327 7.048 Neg 2.10 0.17 0.044 −0.82 Docosahexaenoic acid Biosynthesis of unsaturated fatty acids
4 329.2476 7.412 Neg 2.53 0.16 0.024 −2.98 Docosapentaenoic acid Biosynthesis of unsaturated fatty acids
5 303.2323 7.177 Neg 2.37 0.16 0.028 −2.17 Arachidonic acid Arachidonic acid metabolism, linoleic acid metabolism,
biosynthesis of unsaturated fatty acids
6 317.2109 6.158 Neg 3.27 0.07 0.019 −4.26 Leukotriene A4 Arachidonic acid metabolism
7 335.2210 5.067 Neg 1.66 0.41 0.023 −5.20 Leukotriene B4 Arachidonic acid metabolism, PPAR signaling pathway,
neuroactive ligand–receptor interaction, inflammatory
mediator regulation of TRP channels
8 624.3007 6.421 Neg 1.79 0.35 0.031 7.43 Leukotriene C4 Arachidonic acid metabolism, neuroactive ligand–receptor
interaction, Fc epsilon RI signaling pathway
9 319.2268 6.072 Neg 2.80 0.11 0.018 −3.32 8(R)‐HETE Arachidonic acid metabolism
10 319.2280 6.507 Neg 2.16 0.22 0.022 0.32 16(R)‐HETE Arachidonic acid metabolism
11 337.2370 5.445 Neg 1.22 0.63 0.039 −4.18 14,15‐DHET Arachidonic acid metabolism
12 315.1974 5.188 Neg 1.82 0.34 0.025 2.71 15‐Deoxy‐Δ12,14‐PGJ2 Arachidonic acid metabolism
13 363.1953 7.177 Neg 1.97 0.35 0.045 2.74 2,3‐Dinor‐8‐iso prostaglandin F1α Arachidonic acid metabolism
14 335.2211 5.551 Neg 2.38 0.24 0.042 −5.14 Hepoxilin B3 Arachidonic acid metabolism
15 311.2213 5.110 Neg 1.75 0.40 0.031 −4.70 8(R)‐HPODE Linoleic acid metabolism
16 313.2353 4.760 Neg 2.10 0.19 0.030 −9.87 9,10‐DHOME Linoleic acid metabolism
17 329.2314 4.760 Neg 1.66 0.47 0.011 −5.87 9,10‐Dihydroxy‐12,13‐epoxyoctadecanoate Linoleic acid metabolism
18 329.2328 4.518 Neg 1.53 0.50 0.019 −1.57 9,12,13‐TriHOME Linoleic acid metabolism
19 295.2264 6.464 Neg 1.29 0.55 0.039 −4.83 12,13‐EpOME Linoleic acid metabolism
20 295.2264 6.464 Neg 1.29 0.55 0.039 −4.83 13S‐Hydroxyoctadecadienoic acid Linoleic acid metabolism, PPAR signaling pathway
21 335.2210 5.067 Neg 1.66 0.41 0.023 −5.20 Prostaglandin B1 (fatty acid derivative) Null
22 187.1321 4.838 Neg 1.75 0.42 0.017 −9.99 (R)‐3‐Hydroxydecanoic acid (fatty acid derivative) Null
23 269.2109 6.478 Neg 1.29 0.59 0.030 −5.01 3‐Oxohexadecanoic acid (fatty acid derivative) Null
24 297.2422 6.906 Neg 1.70 0.35 0.035 −4.32 10‐Oxooctadecanoic acid (fatty acid derivative) Null
25 343.2270 6.001 Neg 2.58 0.14 0.020 −2.65 20‐HDoHE (fatty acid derivative) Null
26 480.3093 6.756 Neg 1.65 0.47 0.030 −0.49 LysoPC(15:0) Glycerophospholipid metabolism
27 480.3493 7.513 Pos 1.79 0.34 0.035 9.24 LysoPC(P‐16:0) Glycerophospholipid metabolism
28 508.3799 7.947 Pos 2.29 0.17 0.025 7.38 LysoPC(P‐18:0) Glycerophospholipid metabolism
AO

(Continues)
ET AL.
 AO

TABLE 2 (Continued)
ET AL.

Fold change
No. m/z Rt (min) Mode VIP (SCNT/AI) q Value ppm Metabolite name Metabolic pathway
29 514.2988 3.555 Neg 1.75 0.33 0.046 9.41 LysoPC(18:4(6Z,9Z,12Z,15Z)) Glycerophospholipid metabolism
30 520.3429 7.409 Pos 1.76 0.31 0.046 6.00 LysoPC(18:2(9Z,12Z)) Glycerophospholipid metabolism
31 504.3072 5.858 Neg 1.68 0.41 0.049 −4.62 LysoPE(0:0/20:2(11Z,14Z)) Null
32 532.3369 6.393 Neg 2.29 0.23 0.037 −7.37 LysoPE(0:0/22:2(13Z,16Z)) Null
33 534.3554 6.856 Neg 2.48 0.18 0.035 −1.99 LysoPE(0:0/22:1(13Z)) Null
34 413.3151 7.006 Pos 1.63 0.41 0.026 3.17 Sphingosine 1‐phosphate (d19:1‐P) Null
35 299.2218 4.703 Neg 1.63 0.46 0.020 −3.14 MG(14:1(9Z)/0:0/0:0) Null
36 315.2527 5.665 Neg 1.49 0.50 0.025 −4.52 MG(15:0/0:0/0:0) Null
37 671.4441 4.603 Neg 1.58 2.05 0.035 −1.01 DG(18:3n3/0:0/20:5n3) Null
38 907.7449 8.234 Pos 1.51 2.00 0.049 −7.61 TG(14:0/22:4(7Z,10Z,13Z,16Z)/o‐18:0) Null
39 1011.9327 3.228 Neg 1.52 1.96 0.035 0.14 TG(22:0/22:0/20:2n6) Null
40 1077.9729 0.648 Neg 1.26 1.59 0.049 −6.13 TG(22:0/22:4(7Z,10Z,13Z,16Z)/24:0) Null
41 415.3202 7.312 Neg 2.04 0.28 0.024 −3.69 7α,24‐Dihydroxy‐4‐cholesten‐3‐one Primary bile acid biosynthesis
42 448.3073 4.953 Neg 1.13 0.61 0.049 0.96 Glycochenodeoxycholic acid Primary bile acid biosynthesis, secondary bile acid
biosynthesis, bile secretion
43 498.2895 5.095 Neg 1.89 2.63 0.035 −0.03 Taurochenodeoxycholic acid Primary bile acid biosynthesis, secondary bile acid
biosynthesis, bile secretion
44 433.3311 6.029 Neg 1.67 0.40 0.042 −2.91 3α,7α,12α‐Trihydroxy‐5β‐cholestan‐26‐al Primary bile acid biosynthesis
45 423.2741 4.297 Neg 1.23 1.58 0.049 −2.59 3α,7α,12α,23R‐Tetrahydroxycholanic acid Secondary bile acid biosynthesis
46 389.2687 5.067 Neg 1.25 0.58 0.046 −2.62 3α,12α‐Dihydroxy‐5β‐chol‐6‐enoate Null
47 385.1772 7.911 Pos 2.48 0.10 0.032 −1.19 21‐Deoxycortisol Steroid hormone biosynthesis
48 385.1772 7.911 Pos 2.48 0.10 0.032 −1.19 Corticosterone Steroid hormone biosynthesis
49 367.1574 4.675 Neg 1.48 0.47 0.041 −2.89 Dehydroepiandrosterone sulfate Steroid hormone biosynthesis, bile secretion
50 239.0583 6.856 Neg 1.20 1.51 0.028 −4.64 L‐Tryptophan Glycine, serine, and threonine metabolism; tryptophan
metabolism; phenylalanine, tyrosine, and tryptophan
biosynthesis
51 306.0752 0.676 Neg 3.38 0.06 0.017 −4.41 Glutathione Cysteine and methionine metabolism, glutathione metabolism
52 239.0149 0.576 Neg 2.45 0.13 0.035 −7.17 L‐Cystine Cysteine and methionine metabolism
53 179.0695 4.618 Neg 1.79 2.39 0.042 −7.35 4‐Guanidinobutanamide Arginine and proline metabolism
54 208.0600 3.727 Neg 1.23 1.57 0.038 −7.41 Hydroxyphenylacetylglycine Tyrosine metabolism
55 174.0544 3.847 Neg 1.34 1.67 0.037 −9.33 Indoleacetic acid Tryptophan metabolism
|

56 190.0497 3.727 Neg 2.46 4.28 0.014 −6.63 5‐Hydroxyindoleacetic acid Tryptophan metabolism
(Continues)
1573
 (Continued)
1574

TABLE 2
|

Fold change
No. m/z Rt (min) Mode VIP (SCNT/AI) q Value ppm Metabolite name Metabolic pathway
57 253.0591 3.784 Neg 1.78 2.21 0.013 −2.58 5‐L‐Glutamyl‐L‐alanine Glutathione metabolism
58 299.0458 0.562 Neg 3.98 3.23 0.032 −6.20 Aspartyl‐methionine Null
59 300.1340 3.555 Neg 1.59 1.94 0.020 −4.53 Tryptophyl‐proline Null
60 326.0886 3.468 Neg 1.31 1.66 0.048 −9.39 Serinyl‐tryptophan Null
61 252.0865 3.541 Neg 1.75 2.32 0.032 −4.88 N‐acetylvanilalanine Null
62 261.1232 3.526 Neg 2.03 2.69 0.010 −4.93 L‐Prolyl‐L‐phenylalanine Null
63 354.0865 3.271 Neg 2.15 2.68 0.049 0.80 Aspartyl‐tryptophan Null
64 294.0842 3.403 Neg 1.98 2.66 0.035 −7.73 Hydroxyprolyl‐γ‐glutamate Null
65 181.0525 4.154 Neg 2.16 0.28 0.025 −8.73 Dimethylbenzimidazole Riboflavin metabolism
66 134.0451 3.228 Neg 1.71 2.22 0.026 −5.71 4‐Hydroxy‐L‐threonine Vitamin B6 metabolism
67 187.0184 10.413 Neg 1.04 1.40 0.046 0.38 Tetranorbiotin Biotin metabolism
68 243.0796 3.584 Neg 2.33 3.65 0.025 −5.19 Biotin Biotin metabolism
69 443.2795 5.901 Neg 1.72 0.39 0.028 −1.76 1,25‐Dihydroxyvitamin D3–26,23‐lactone Null
70 373.2369 7.048 Neg 2.90 0.09 0.047 −4.07 Calcitroic acid Null
71 286.0709 3.741 Neg 1.87 2.58 0.044 −1.37 Deoxyadenosine Purine metabolism
72 363.1758 7.947 Pos 1.90 0.30 0.024 −4.79 Thyrotropin releasing hormone Neuroactive ligand–receptor interaction
73 370.1996 0.711 Pos 2.49 0.19 0.035 1.86 3‐Hydroxydecanoyl carnitine Null
Abbreviations: AI, artificial insemination; PPAR, peroxisome proliferator‐activated receptor; SCNT, somatic cell nuclear transfer; VIP, variable importance in projection.
AO
ET AL.
AO ET AL.
F I G U R E 3 Overview of the remarkably altered metabolic pathways in SCNT allantoic fluid that was identified through the pathway
enrichment analysis of the differential metabolites between SCNT and AI allantoic fluids. The X‐axis represents the number of differentially
abundant metabolites, while the Y‐axis represents the name of metabolic pathways. AI, artificial insemination; Fc, fold change; PPAR,
peroxisome proliferator‐activated receptor; SCNT, somatic cell nuclear transfer [Color figure can be viewed at wileyonlinelibrary.com]
differential metabolites (see No. 21–25 metabolites in Table 2),
which were fatty acid derivatives, were downregulated in SCNT
allantoic fluid relative to those in the AI allantoic fluid (Table 2).
2.2 | Comparison of skeletal muscle fatty acid
composition between AI and SCNT pig fetuses
The reduced fatty acid levels in allantoic fluid indicate that the
SCNT pig fetuses suffered from fatty acid deficiency. To test this
hypothesis, we compared the skeletal muscle fatty acid concen-
tration between the SCNT and AI pig fetuses. The results showed
that among the 32 detected fatty acids in the muscle, 3 saturated
fatty acids and 15 unsaturated fatty acid levels in the SCNT
fetuses were significantly lower than those in the AI fetuses
(p < .05, Table 3). Among the remaining 14 fatty acids, 12 showed a
downward trend in SCNT fetuses (Table 3). The amount of total
fatty acid in the muscle of SCNT fetuses was significantly lower
than that in the muscle of AI fetuses (p = 0.004, Table 3). These
results strongly indicate that the SCNT pig fetuses suffered from
fatty acid deficiency.
2.3 | Comparison of placental morphology and
fatty acid transport protein (FATP) expression
between the SCNT and AI fetuses
Given that the majority of fatty acids utilized by the fetuses are
provided from the mother via placental transport (Larque et al.,
2011), the decreased deposition of fatty acids suggests the
reduced placental transport efficiency of fatty acids in SCNT
fetuses. To test this hypothesis, we analyzed sections of the
maternal–fetal interface of the AI and SCNT placentas. SCNT
placentas exhibited severe trophoblast hypoplasia compared with
the AI placentas (Figure 4).
The mRNA and protein expression levels of FATP4, which
showed a much higher expression level than other FATP family
members in porcine placentas, were significantly lower in the SCNT
| 1575
placentas than those in AI placentas ( Figures 5 and 6). These data
suggested that SCNT placentas had a lower fatty acid transport
capacity compared with AI placentas.
3 | D I S C U SS I O N
By comparing the allantoic fluid metabolomes between the SCNT and
AI pig fetuses, we found that the levels of numerous fatty acids were
decreased in the allantoic fluid of SCNT pig fetuses. This global
downregulation of fatty acids in the allantoic fluid was associated
with the insufficient depositions of numerous fatty acids in the
muscle tissue of cloned pig fetuses, thereby suggesting that cloned
pig fetuses undergo fatty acid deficiency.
Fatty acids play central roles in fetal growth and development as
an energy source, structural components of cell membranes, and
precursors of important bioactive eicosanoids, such as prostaglan-
dins, prostacyclins, thromboxanes, and leukotrienes (Haggarty,
2010). In mammals, the inadequate intake of fatty acid during
pregnancy causes poor fetal neural (Innis, 2008) and immune system
development (Prescott & Dunstan, 2007), IUGR, and preterm birth
(Bobinski & Mikulska, 2015; Zhou et al., 2008). Most of these
abnormalities are observed in cloned pig fetuses or newborn piglets
(Ao, Li, et al., 2019; Carroll, Carter, Korte, & Prather, 2005; Cho et al.,
2005; Estrada et al., 2007). Substantial epidemiological and experi-
mental evidence demonstrates that fetal fatty acid deficiency has
long‐term implications for the development of metabolic diseases in
postnatal life (Haggarty, 2010; Innis, 2011; Wadhwani, Patil, & Joshi,
2018). Thus, fatty acid deficiency may be a potential cause of high
perinatal morbidity and mortality in cloned pig fetuses and newborn
piglets.
Developing mammalian fetuses show a limited capacity to
synthesize some saturated and monounsaturated fatty acids and
are unable to produce de novo polyunsaturated fatty acids. There-
fore, the considerable bulk of fatty acids must be provided by the
maternal circulation through the placenta to achieve proper fetal
1576 | AO ET AL.

T A B L E 3 Comparison of the fatty acid concentrations in the muscles between AI and SCNT fetuses
No. Detected fatty acids Concentration in AI (μg/g) Concentration in SCNT (μg/g) FC (SCNT/AI) p Value
Saturated fatty acids
1 Hexanoic acid (C6:0) 0.85 ± 0.14 0.75 ± 0.25 0.89 .4805
2 Undecanoic acid (C11:0) 0.14 ± 0.01 0.11 ± 0.05 0.81 .4895
3 Dodecanoic acid (C12:0) 4.33 ± 0.46 3.74 ± 0.22* 0.87 .0285
4 Tridecanoic acid (C13:0) 1.70 ± 0.77 2.16 ± 0.21 1.27 .2279
5 Myristic acid (C14:0) 33.36 ± 3.08 28.24 ± 4.53 0.85 .0637
6 Myristoleatic acid (C14:1) 8.07 ± 1.98 6.59 ± 2.08 0.82 .3092
7 Pentadecanoic acid (C15:0) 30.58 ± 5.97 25.98 ± 4.16 0.85 .1878
8 cis‐10‐Pentadecenoic acid (C15:1) 5.71 ± 1.22 5.96 ± 0.47 1.04 .6772
9 Palmitatic acid (C16:0) 580.06 ± 121.48 367.97 ± 71.56* 0.63 .0072
10 Palmitic acid (C16:1) 39.00 ± 6.45 35.12 ± 7.40 0.90 .3972
11 Heptadecanoic acid (C17:0) 44.85 ± 8.6 41.91 ± 7.23 0.93 .5721
12 cis‐10‐Heptadecenoic acid (C17:1) 41.17 ± 13.86 38.79 ± 14.49 0.94 .7965
13 Stearic acid (C18:0) 506.01 ± 31.47 396.8 ± 75.84* 0.78 .0139
Unsaturated fatty acids
14 Oleic acid (C18:1) 208.88 ± 25.02 151.75 ± 33.87* 0.73 .0126
15 Linoleic acid (C18:2) 57.34 ± 6.28 36.57 ± 9.38* 0.64 .0021
16 γ‐Linolenic acid (C18:3n6) 10.11 ± 0.46 8.91 ± 0.61* 0.88 .0060
17 Linolenic acid (C18:3n3) 8.61 ± 0.21 8.35 ± 0.14 0.97 .0049
18 Arachidic acid (C20:0) 16.15 ± 0.68 13.56 ± 1.54* 0.84 .0063
19 cis‐11‐Eicosenoic acid (C20:1) 9.44 ± 0.67 7.82 ± 0.72* 0.83 .0044
20 cis‐11,14‐Eicosadienoic acid (C20:2) 9.06 ± 0.82 7.83 ± 0.56* 0.86 .0204
21 Heneicosanoic acid (C21:0) 8.28 ± 4.35 3.64 ± 0.12* 0.44 .0385
22 cis‐8,11,14‐Eicosatrienoic acid (C20:3n6) 10.66 ± 0.68 7.66 ± 0.86* 0.72 .0001
23 Arachidonic acid (C20:4n6) 127.09 ± 8.59 103.54 ± 25.29 0.81 .0769
24 cis‐11,14,17‐Eicosatrienoic acid (C20:3n3) 9.26 ± 0.22 8.75 ± 0.17* 0.95 .0025
25 Eicosapentaenoic acid (C20:5n3) 10.51 ± 0.29 10.18 ± 0.23 0.97 .0716
26 Docosahexaenoic acid (C22:6n3) 25.09 ± 2.68 23.21 ± 5.45 0.93 .5051
27 Behenic acid (C22:0) 17.15 ± 8.05 8.45 ± 0.35* 0.49 .0364
28 Erucic acid (C22:1n9) 9.39 ± 1.43 6.69 ± 1.53* 0.71 .0163
29 cis‐13,16‐Docosadienoic acid (C22:2) 9.41 ± 0.32 9.06 ± 0.08* 0.96 .0414
30 Tricosanoic acid (C23:0) 6.75 ± 0.48 6.47 ± 0.38 0.96 .3411
31 Tetracosanoic acid (C24:0) 10.75 ± 0.45 9.89 ± 0.24* 0.92 .0039
32 cis‐15‐Tetracosenic acid (C24:1) 9.27 ± 0.64 9.02 ± 1.12 0.97 .6759
Total 1,867.78 ± 113.48 1,395.62 ± 232.88* 0.75 .0022
Note: Data are presented as mean ± SD.
Abbreviations: AI, artificial insemination; FC, fold change; SCNT, somatic cell nuclear transfer; SD, standard deviation.
Values labelled with asterisk (*) mean they are significantly different from those of the AI group (p < .05).

development (Haggarty, 2002; Hanebutt, Demmelmair, Schiessl,
Larque, & Koletzko, 2008). The placenta is extremely important in
modulating maternal–fetal fatty acid transport (Hanebutt et al.,
2008; Larque et al., 2011). Fatty acids can be transferred across
the placenta by simple diffusion or via mediation by FATPs
(Chassen, Ferchaud‐Roucher, Gupta, Jansson, & Powell, 2018).
The impairment of FATP functions is linked to abnormal fetal
development (Assumpcao et al., 2017; Chassen et al., 2018; Ye et al.,
2017). In the present study, the expression of FATP4, which is the
predominant FATP member in pig placenta, was downregulated in
SCNT placentas relative to that in AI placentas. FATP4 expression
level is positively correlated with a polyunsaturated fatty acid level
in human umbilical cords (Larque et al., 2006). Reduced FATP4
expression is related to the decline of bovine fetal total n‐3 fatty
AO ET AL. | 1577

F I G U R E 4 SCNT placental folds exhibit trophoblast hypoplasia compared with AI placental folds. Multilayer trophoblast cells (green frames) were
observed in AI placental folds, while only single‐layer trophoblast cells (black frames) were seen in SCNT placental folds. AI, artificial insemination; LE,
endometrial luminal epithelium; SCNT, somatic cell nuclear transfer; Tr, trophoblasts [Color figure can be viewed at wileyonlinelibrary.com]

acids (Ambrose, 2017). Therefore, decreased FATP4 expression may The deformations of placental architecture and shape may also
cause impaired placental delivery of fatty acids from maternal blood cause insufficient transport of fatty acids from the surrogate mothers
to the developing fetuses. This condition may be an important reason to the cloned pig fetuses. Pigs have diffuse and epitheliochorial
for the deficiency of fatty acids in cloned pig fetuses. placenta characterized by allantochorion membrane forming folds to

F I G U R E 5 Comparison of FATP1–6 mRNA expression levels between SCNT and AI placentas by mRNA sequencing (a, see sequencing data in
Ao, Li, et al., 2019) and qPCR (b). Values are presented as mean ± SEM. AI, artificial insemination; FATP, fatty acid transport protein; mRNA,
messenger RNA; ND, nondetectable; qPCR, quantitative polymerase chain reaction; SCNT, somatic cell nuclear transfer; SEM, standard error of the
mean. Values labelled with an asterisk (*) mean they are significantly different (p < .05) [Color figure can be viewed at wileyonlinelibrary.com]
1578 | AO
maximize the surface area contact with the endometrium (Furukawa,
Kuroda, & Sugiyama, 2014). Our previous study showed that cloned
pig fetuses exhibit defects in placental fold formation (Ao, Li, et al.,
2019). The results of the present study further demonstrated that
trophoblasts in the placentas of cloned pig fetuses underwent severe
hypoplasia. Therefore, the hypoplasia of placental folds and
trophoblasts may also contribute to the inadequate supply of fatty
acids from the recipient sows to the cloned pig fetuses.
In summary, cloned pig fetuses show not only reduced levels
of fatty acids in the allantoic fluid and muscle tissue but also
decreased placental FATP4 expression and defects in the placental
fold and trophoblast development. These results suggested that
cloned pig fetuses underwent fatty acid deficiency that is
possibly caused by the impaired placental transport of fatty acids
from the surrogate mothers. Future studies can be conducted to test
whether the maternal dietary supplementation of fatty acids can
increase the transport of fatty acids from the mothers to the cloned
pig fetuses to ameliorate their intrauterine dysplasia.
4 | MATERIALS AND METHODS
4.1 | Ethics statement
The animal experiment protocol (Protocol no. 2017‐P008) employed
in this study was approved by the Institutional Animal Care and Use
Committee of South China Agricultural University, Guangzhou,
China. All efforts were made to minimize suffering.
4.2 | Sample collection
Allantoic fluid was collected during gestation day 65 from SCNT
and AI pig fetuses that were reported in one of our published studies
ET AL.
F I G U R E 6 Comparison of protein
expression levels of FATP2–4 between
AI and SCNT placentas. (a) Western blot
analyses of protein expression levels of
FATP2–4 and endogenous control β‐actin.
(b) Relative quantification of protein
expression levels of FATP2–4 in AI and
SCNT placentas. Values are presented as
mean ± SEM. AI, artificial insemination;
FATP, fatty acid transport protein; SCNT,
somatic cell nuclear transfer. Values
labelled with asterisk (*) mean they are
significantly different (p < .05) [Color figure
can be viewed at wileyonlinelibrary.com]
(Ao, Li, et al., 2019). An ear fibroblast cell line was isolated from an
adult Duroc boar and used as donor cells to produce 916 SCNT
embryos, which were transferred into four Duroc recipient sows. The
semen collected from the same nuclear donor Duroc boar for SCNT
was used to artificially inseminate four Duroc sows. Eight male SCNT
fetuses were collected from two pregnant recipients, and 13 male AI
fetuses were collected from four pregnant sows at gestation day 65.
The SCNT pig fetuses exhibited IUGR because their average body
weight was significantly lower than that of the control AI pig fetuses
(p < .05; Ao, Li, et al., 2019). Allantoic fluid (5 ml) was obtained
through the amniochorion membrane of each fetus. Allantoic fluid
samples were centrifuged after collection (177.4 g, 22°C, 10 min), and
their supernatants were collected. The longissimus dorsi muscle and
placental tissue samples of all pig fetuses were collected. All samples
were immediately snap frozen in liquid nitrogen and stored at −80°C
until use.
4.3 | LC‐MS/MS analysis
A UPLC system (2777C; Waters) was used to perform all analyses.
Chromatographic separation was achieved using an ACQUITY UPLC
BEH C18 column (100 mm × 2.1 mm, 1.7 μm; Waters) at a column
temperature of 50°C and flow rate of 0.4 ml/min. The mobile phase
consisted of solvents A (0.1% formic acid in water) and B (0.1%
formic acid in acetonitrile). The following gradient elution conditions
were set as 100% phase A for 0–2 min, 0–100% phase B for ~11 min,
100% phase B for 11–13 min, and 100% for phase A for 13–15 min.
The injection volume for each sample was 10 μl. The metabolites
eluted from the column were detected using a high‐resolution
tandem mass spectrometer (SYNAPT G2 XS QTOF; Waters) in
positive and negative electrospray ionization modes. For positive
ionization mode, the capillary and sampling cone voltages were set at
AO ET AL.
2 kV and 40 V for positive ionization mode and 1 kV and 40 V for
negative ionization mode, respectively. Centroid mean square error
(MSE) mode was used to obtain mass spectra. The TOF mass range
was 50–1,200 Da, and the scan time was 0.2 s. For MS/MS detection,
all precursors were fragmented at 20–40 eV, and the scan time was
0.2 s. During data acquisition, leucine enkephalin (LE) signal was
achieved every 3 s for real‐time quality correction. To evaluate the
stability of the LC‐MS during the entire acquisition, we tested a QC
sample acquired after every 10 samples.
4.4 | Metabolome data processing
All raw data files were processed using Progenesis QI (version 2.2;
Waters). Data were processed for possible adducts, peak alignment,
peak detection, deconvolution, data set filtering, noise reduction,
compound identification, and normalization via the sum method. To
obtain consistent variables and ensure that the data were of
comparable high quality within an analytical run, we removed the
features detected in <50% of QC samples or 80% of biological
samples and imputed the remaining peaks with missing values with
the k‐nearest neighbor algorithm to further improve data quality.
Each retained peak was normalized to the QC sample by using robust
Loess signal correction. A threshold of 30%, which is accepted as the
standard in the assessment of repeatability in metabolomics data
sets, was set for the RSD values of metabolites in the QC samples.
Logarithmic transformation and Pareto scaling were applied to the
data sets before statistical analysis.
Multivariate statistical analyses via PCA and PLS‐DA were
performed using SIMCA P 13.0 (Umetrics AB, Umea, Sweden) after
weight normalization and Pareto scaling. PCA was performed for
outlier detection and batch effect evaluation by using the prepro-
cessed data set. Supervised PLS‐DA was applied for the modeling
prediction of the sample between the examined groups and to
explore the prominent features responsible for this clustering. The
reliability of the models was assessed with the relevant R2 and Q2.
The PLS‐DA model performances were evaluated using permutation
testing (200 permutations). Differential metabolites were identified
based on q < 0.05 (adjusted p values), fold change ≥ 1.2 or fold
change ≤ 0.833, and variable importance in projection score > 1 from
the PLS‐DA model.
4.5 | Metabolite identification
The compounds with accurate mass charge ratio (m/z) were annotated
using two databases, namely, HMDB (http://www.hmdb.ca/) and
KEGG (www.genome.jp/kegg/). The metabolites searched from data-
bases were fragmented to obtain theoretical fragment spectrum.
Similarity scores were determined by comparing ion secondary
spectrum obtained from the deconvolution of observed and theore-
tical spectra. Isotopic similarity score was obtained by matching the
theoretical isotope distribution in the database. A mass error range of
10 ppm was set to match the compound. These assessments were
combined into total scores, which were used to screen the metabolites.
| 1579
Heat maps and analysis of variance (ANOVA) results were constructed
by R (version 3.5.1). The metabolic pathway of the differential
metabolites was analyzed by MBRole (http://csbg.cnb.csic.es/
mbrole2/) to recognize the affected metabolic pathways (Chagoyen
& Pazos, 2011). MBRole allows the categorization of metabolite
compounds according to their biological annotation (enrichment
analysis) in metabolomics database.
4.6 | Fatty acid analysis
The fatty acids of muscle tissue samples were extracted with
chloroform–methanol (1:2 v/v) mixture according to the protocol of
a previous study (Vetter, 2005). The extracted fatty acids were
transesterified with 2 ml of 1% methanol–sulfuric acid mixture for
30 min at 80°C. Approximately 1 ml of hexane and 5 ml of H2O were
then added and vortex mixed. Methyl ester derivatives in the organic
layer added with 25 µl of the internal standard (i.e., methyl salicylate,
TCI, Tokyo, Japan) was injected using a GC‐mass spectrometer
(Agilent 6890N/5975B, CA). The GC was equipped with an HP‐
INNOWAX (Agilent; 30 m × 0.25 mm ID × 0.25 μm) capillary column.
The samples were injected by splitless mode and carried by He gas at
a flow rate of 1 ml/min. The GC oven was initially set at 50°C and
held for 3 min. The column temperature was gradually increased to
220°C at a rate of 10°C/min, maintained for 3 min, gradually
increased to 250°C at a rate of 15°C/min, and maintained for
10 min. MS detection was conducted first in electron ionization mode
with an electron energy of 70 eV and then in the selected ion
monitoring scan mode. Supelco 37 component FA methyl ester
(FAME) mix (Nu‐Chek Prep, Inc.) was used as the reference standard
to identify fatty acids. The quantity of each FAME was calculated
from the calibration curves of the standards.
4.7 | Histopathological examination
The combination of placenta and endometrium derived from six
SCNT fetuses and six AI fetuses were dissected and fixed
immediately with 4% paraformaldehyde. The paraffin‐embedded
tissues were stained with hematoxylin and eosin, as previously
described (Ao et al., 2017). A photomicrograph of each stained
section was obtained using a Nikon 80i light microscope (×400 mag-
nification) fitted with a Nikon (DS‐Fi1) digital camera (Nikon, Japan).
4.8 | Quantitative polymerase chain reaction
(qPCR)
Total RNA was extracted from six AI placental samples and six SCNT
placental samples by using a Total RNA Kit (Omega) in accordance
with the manufacturer’s instructions. RNA quality and amounts
were determined by nondenaturing agarose gel electrophoresis
and spectrophotometry. Only the RNA samples without signs of
degradation were used and stored at −80°C. Total RNA (1 μg) was
reverse‐transcribed to complementary DNA (cDNA) by using a
PrimeScript RT Reagent Kit (Takara, Japan). SYBR Select Master Mix
1580 | AO
(Thermo Fisher Scientific, MA) was used to detect cDNA products.
The primer information for target genes is presented in Table 1.
qPCR was performed on QuantStudio™ 7 Flex Real‐Time PCR System
(Thermo Fisher Scientific) by following the parameters recommended
by the manufacturer. The reactions were run via initial denaturation
at 95°C for 5 min; 40 cycles of denaturation at 95°C for 5 s, annealing
at 60°C for 15 s, and extension at 72°C for 20 s; and a final melting
cycle consisting of 95°C for 15 s, 55°C for 15 s, and 60°C for 15 s. β‐
Actin was used as the house‐keeping gene, and the relative mRNA
expression levels were calculated using the 2−ΔΔCt method. The
amplification efficiency of each pair of primers at different cDNA
template concentrations was validated to be >96% (Figure S1 and
Table S1), following a previously reported method (Dhanasekaran,
Doherty, Kenneth, & Group, 2010).
4.9 | Western blot analysis
Western blot analyses were performed as described previously (Ao
et al., 2017). The total protein of placenta samples was isolated using
a Tissue Protein Extraction Kit (CWBio, China). The concentration of
the extracted total protein was determined by bicinchoninic acid
assay (CWBio). Sodium dodecyl sulphate‐polyacrylamide gel electro-
phoresis and transmembrane were carried out with the Mini‐
PROTEAN Tube Cell Instrument (Bio‐Rad, Hercules, CA). The
membranes were incubated with primary antibodies, including anti‐
FATP2 (#PA5‐42429; Thermo Fisher Scientific), anti‐FATP3
(#12943‐1‐AP; ProteinTech, IL), anti‐FATP4 (#11013‐1‐AP; Protein-
Tech), and anti‐β‐actin (#4970; Cell Signaling Technology, Danvers).
Afterward, the membranes were incubated with HRP‐conjugated
goat anti‐rabbit secondary antibody (#sc‐2004; Santa Cruz Company,
CA), and immunoreactive bands were visualized using the electro-
chemiluminescence (ECL) kit (Beyotime, China). The membranes
were documented with a chemiluminescence imaging system (UVP,
Upland, CA). The densitometric analytes of the band were quantified
by the ImageJ 1.45 software (NIH image). All blots were normalized
to β‐actin to measure the relative expression of the target proteins.
4.10 | Statistical analysis
Differences in muscle fatty acid concentrations, placental FATP gene
mRNA, and protein expression levels between the SCNT and AI
groups were analyzed via one‐way ANOVA by using the SPSS 19.0
software (IBM Corp., Armonk, NY). Significant difference in the
means between two different groups was determined at p < .05.
A C K N O W L E D GM E N T S
This study was supported by a grant from the National Natural Science
Foundation of China (grant no. 31772554) and two grants from the
Department of Science and Technology of Guangdong Province, China
(grant nos. 2016B020233006 and 2018B030314004).
ET AL.
CON F LI CT OF IN TE RES T S
The authors declare that there are no conflict of interests.
ORCI D
Zheng Ao http://orcid.org/0000-0002-7999-8752
R E F E R E N CE S
Ambrose, D. J. (2017). Prepartum maternal diets supplemented with
oilseeds alter the fatty acid profile in bovine neonatal plasma possibly
through reduced placental expression of fatty acid transporter
protein 4 and fatty acid translocase. Reproduction, Fertility, and
Development, 29(9), 1846–1855.
Ao, Z., Li, Z., Wang, X., Zhao, C., Gan, Y., Wu, X., … Cai, G. (2019).
Identification of amniotic fluid metabolomic and placental transcrip-
tomic changes associated with abnormal development of cloned pig
fetuses. Molecular Reproduction and Development, 86(3), 278–291.
Ao, Z., Liu, D., Zhao, C., Yue, Z., Shi, J., Zhou, R., … Wu, Z. (2017). Birth
weight, umbilical and placental traits in relation to neonatal loss in
cloned pigs. Placenta, 57, 94–101.
Ao, Z., Zhao, C., Gan, Y., Wu, X., Shi, J., Zheng, E., … Li, Z. (2019).
Comparison of birth weight and umbilical and placental character-
istics of cloned and artificial insemination‐derived piglets. Frontiers
of Agricultural Science and Engineering, 6(1), 54–60.
Assumpcao, R. P., Mucci, D. B., Fonseca, F. C. P., Marcondes, H., Sardinha,
F. L. C., Citelli, M., … do Carmo, M. G. (2017). Fatty acid profile of
maternal and fetal erythrocytes and placental expression of fatty
acid transport proteins in normal and intrauterine growth restriction
pregnancies. Prostaglandins, Leukotrienes & Essential Fatty Acids, 125,
24–31.
Baraldi, E., Giordano, G., Stocchero, M., Moschino, L., Zaramella, P.,
Tran, M. R., … Gervasi, M. T. (2016). Untargeted metabolomic
analysis of amniotic fluid in the prediction of preterm delivery and
bronchopulmonary dysplasia. PLOS One, 11(10), e0164211.
Bazer, F. W., & Johnson, G. A. (2014). Pig blastocyst–uterine interactions.
Differentiation, 87(1‐2), 52–65.
Beall, M. H., van den Wijngaard, J. P., van Gemert, M. J., & Ross, M. G.
(2007). Amniotic fluid water dynamics. Placenta, 28(8‐9), 816–823.
Benton, S. J., McCowan, L. M., Heazell, A. E. P., Grynspan, D.,
Hutcheon, J. A., Senger, C., … von Dadelszen, P. (2016). Placental
growth factor as a marker of fetal growth restriction caused by
placental dysfunction. Placenta, 42, 1–8.
Bobinski, R., & Mikulska, M. (2015). The ins and outs of maternal–fetal
fatty acid metabolism. Acta Biochimica Polonica, 62(3), 499–507.
Carroll, J. A., Carter, D. B., Korte, S. W., & Prather, R. S. (2005). Evaluation
of the acute phase response in cloned pigs following a lipopolysac-
charide challenge. Domestic Animal Endocrinology, 29(3), 564–572.
Chae, J. I., Lee, K. S., Kim, D. J., Han, Y. M., Lee, D. S., Lee, K. K., & Koo, D. B.
(2009). Abnormal gene expression in extraembryonic tissue from
cloned porcine embryos. Theriogenology, 71(2), 323–333.
Chagoyen, M., & Pazos, F. (2011). MBRole: Enrichment analysis of
metabolomic data. Bioinformatics, 27(5), 730–731.
Chassen, S. S., Ferchaud‐Roucher, V., Gupta, M. B., Jansson, T., &
Powell, T. L. (2018). Alterations in placental long chain polyunsatu-
rated fatty acid metabolism in human intrauterine growth restriction.
Clinical Science, 132(5), 595–607.
Cho, S. K., Lee, S. Y., Choi, Y. J., Park, J. Y., Kwon, D. N., Son, W. J., … Kim, J. H.
(2005). A rare and often unrecognized cerebromeningitis and hemody-
namic disorder: A major cause of sudden death in somatic
cell cloned piglets. Proteomics, 5(7), 1928–1939.
AO ET AL.
Dessi, A., Marincola, F. C., & Fanos, V. (2015). Metabolomics and the
great obstetrical syndromes‐‐GDM, PET, and IUGR. Best Practice &
Research: Clinical Obstetrics & Gynaecology, 29(2), 156–164.
Dhanasekaran, S., Doherty, T. M., Kenneth, J., & Group, T. B. T. S. (2010).
Comparison of different standards for real‐time PCR‐based absolute
quantification. Journal of Immunological Methods, 354(1‐2), 34–39.
Estrada, J., Sommer, J., Collins, B., Mir, B., Martin, A., York, A., …
Piedrahita, J. A. (2007). Swine generated by somatic cell nuclear
transfer have increased incidence of intrauterine growth restriction
(IUGR). Cloning Stem Cells, 9(2), 229–236.
Furukawa, S., Kuroda, Y., & Sugiyama, A. (2014). A comparison of the
histological structure of the placenta in experimental animals. Journal
of Toxicologic Pathology, 27(1), 11–18.
Gil, A. M., & Duarte, D. (2018). Biofluid metabolomics in preterm birth
research. Reproductive Sciences, 25(7), 967–977.
Gunnarsdottir, J., Stephansson, O., Cnattingius, S., Akerud, H., &
Wikstrom, A. K. (2014). Risk of placental dysfunction disorders after
prior miscarriages: A population‐based study. American Journal of
Obstetrics and Gynecology, 211(1), 34.e1–34.e8.
Haggarty, P. (2002). Placental regulation of fatty acid delivery and its
effect on fetal growth—A review. Placenta, 23(Suppl. A), S28–S38.
Haggarty, P. (2010). Fatty acid supply to the human fetus. Annual Review
of Nutrition, 30, 237–255.
Hanebutt, F. L., Demmelmair, H., Schiessl, B., Larque, E., & Koletzko, B.
(2008). Long‐chain polyunsaturated fatty acid (LC‐PUFA) transfer
across the placenta. Clinical Nutrition, 27(5), 685–693.
Huan, Y., Hu, K., Xie, B., Shi, Y., Wang, F., Zhou, Y., … Liu, Z. (2015).
Ovulation statuses of surrogate gilts are associated with the
efficiency of excellent pig cloning. PLOS One, 10(11), e0142549.
Innis, S. M. (2008). Dietary omega 3 fatty acids and the developing brain.
Brain Research, 1237, 35–43.
Innis, S. M. (2011). Metabolic programming of long‐term outcomes due to
fatty acid nutrition in early life. Maternal & Child Nutrition, 7, 112–123.
Jansson, T., & Powell, T. L. (2006). Human placental transport in altered
fetal growth: Does the placenta function as a nutrient sensor?—
Review. Placenta, 27(Suppl. A), 91–97.
Kasapoglu, D., Kasapoglu, T., Syngelaki, A., Akolekar, R., & Nicolaides, K. H.
(2018). Fetal major cardiac defects and placental dysfunction at
11‐13 weeks’ gestation. Ultrasound in Obstetrics & Gynecology, 51(2),
194–198.
Kim, J. H., Park, J. Y., Park, M. R., Hwang, K. C., Park, K. K., Park, C., …
Kim, J. H. (2011). Developmental Arrest of scNT‐Derived Fetuses by
Disruption of the Developing Endometrial Gland as a Result of
Impaired Trophoblast Migration and Invasiveness. Developmental
Dynamics, 240(3), 627–639.
Kurome, M., Geistlinger, L., Kessler, B., Zakhartchenko, V., Klymiuk, N.,
Wuensch, A., … Wolf, E. (2013). Factors influencing the efficiency of
generating genetically engineered pigs by nuclear transfer: Multi‐
factorial analysis of a large data set. BMC Biotechnology, 13, 43.
Kwon, H., Spencer, T. E., Bazer, F. W., & Wu, G. (2003). Developmental
changes of amino acids in ovine fetal fluids. Biology of Reproduction,
68(5), 1813–1820.
Larque, E., Demmelmair, H., Gil‐Sanchez, A., Prieto‐Sanchez, M. T.,
Blanco, J. E., Pagan, A., … Koletzko, B. (2011). Placental transfer
of fatty acids and fetal implications. Journal of Clinical Nutrition,
94(Suppl.), 1908S–1913S.
Larque, E., Krauss‐Etschmann, S., Campoy, C., Hartl, D., Linde, J., Klingler, M.,
… Koletzko, B. (2006). Docosahexaenoic acid supply in pregnancy affects
placental expression of fatty acid transport proteins. Journal of Clinical
Nutrition, 84(4), 853–861.
Li, N., Wells, D. N., Peterson, A. J., & Lee, R. S. (2005). Perturbations in the
biochemical composition of fetal fluids are apparent in surviving
bovine somatic cell nuclear transfer pregnancies in the first half of
gestation. Biology of Reproduction, 73(1), 139–148.
| 1581
Liu, T., Dou, H., Xiang, X., Li, L., Li, Y., Lin, L., … Du, Y. (2015).
Factors determining the efficiency of porcine somatic cell nuclear
transfer: Data analysis with over 200,000 reconstructed embryos.
Cell Reprogram, 17(6), 463–471.
Matsunari, H., & Nagashima, H. (2009). Application of genetically modified
and cloned pigs in translational research. Journal of Reproduction and
Development, 55(3), 225–230.
Palmas, F., Fattuoni, C., Noto, A., Barberini, L., Dessi, A., & Fanos, V.
(2016). The choice of amniotic fluid in metabolomics for the
monitoring of fetus health. Expert Review of Molecular Diagnostics,
16(4), 473–486.
Park, J. Y., Kim, J. H., Choi, Y. J., Hwang, K. C., Cho, S. K., Park, H. H., …
Kim, J. H. (2009). Comparative proteomic analysis of malformed
umbilical cords from somatic cell nuclear transfer‐derived piglets:
Implications for early postnatal death. BMC Genomics, 10, 511.
Prescott, S. L., & Dunstan, J. A. (2007). Prenatal fatty acid status and
immune development: The pathways and the evidence. Lipids, 42(9),
801–810.
Razdan, P., Tummaruk, P., Kindahl, H., Rodriguez‐Martinez, H., Hulten, F.,
& Einarsson, S. (2004). The impact of induced stress during
days 13 and 14 of pregnancy on the composition of allantoic fluid
and conceptus development in sows. Theriogenology, 61(4), 757–767.
Ruan, D., Peng, J., Wang, X., Ouyang, Z., Zou, Q., Yang, Y., … Lai, L. (2018).
XIST derepression in active X chromosome hinders pig somatic cell
nuclear transfer. Stem Cell Reports, 10(2), 494–508.
Schmidt, M., Winther, K. D., Secher, J. O., & Callesen, H. (2015).
Postmortem findings in cloned and transgenic piglets dead before
weaning. Theriogenology, 84(6), 1014–1023.
Seckl, J. R., & Holmes, M. C. (2007). Mechanisms of disease: Glucocorti-
coids, their placental metabolism and fetal ‘programming’ of adult
pathophysiology. Nature Clinical Practice Endocrinology, 3(6), 479–488.
Smith, G. C., & Fretts, R. C. (2007). Stillbirth. Lancet, 370(9600), 1715–1725.
Vetter, W. (2005). A gas chromatography/electron ionization‐mass
spectrometry‐selected ion monitoring method for determining the
fatty acid pattern in food after formation of fatty acid methyl esters.
Journal of Agricultural and Food Chemistry, 53(23), 8896–8903.
Wadhwani, N., Patil, V., & Joshi, S. (2018). Maternal long chain
polyunsaturated fatty acid status and pregnancy complications.
Prostaglandins, Leukotrienes & Essential Fatty Acids, 136, 143–152.
Yang, H., & Wu, Z. (2018). Genome editing of pigs for agriculture and
biomedicine. Frontiers in Genetics, 9, 360.
Ye, K., Li, L., Zhang, D., Li, Y., Wang, H. Q., Lai, H. L., & Hu, C. L. (2017).
Effect of maternal obesity on fetal growth and expression of placental
fatty acid transporters. Journal of Clinical Research in Pediatric
Endocrinology, 9(4), 300–307.
Zhou, Y., Nijland, M., Miller, M., Ford, S., Nathanielsz, P. W., & Brenna, J. T.
(2008). The influence of maternal early to mid‐gestation nutrient
restriction on long chain polyunsaturated fatty acids in fetal sheep.
Lipids, 43(6), 525–531.
SU PP ORT IN G IN FOR M ATI O N
Additional supporting information may be found online in the
Supporting Information section.
How to cite this article: Ao Z, Wu X, Zhou J, et al. Cloned pig
fetuses exhibit fatty acid deficiency from impaired placental
transport. Mol Reprod Dev. 2019;86:1569–1581.
https://doi.org/10.1002/mrd.23242